HIV Gene Therapy Using Nucleases
by
Sanjeev Singwi
A thesis submitted in conformity with the requirements for the degrw of Master of Science Graduate Department of Mokcular and Meâical Genetics University ot Toronto
O Sanjwv Sin@ (1999) National Library Bibliotheque nationale 1+1 ,,an, du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellingîon Street 395. fue Wellington O#awaON KlAW OrrawaON K1AW canada CaMda
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or selI reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cetie thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Table of Contents
Pa- Table of Content...... i ... Aknowledgements ...... VIII Abstract ...... ix
List of Abbreviations...... x
List of figures...... xi ... List of tables...... XII[
Chapter 1. Introduction...... 14
Human lmmunoôeficiency Virus ...... 15
HIV life cycle ...... 15
HIV pathogenesis...... 25 Drug therapy...... 27
Gene therapy...... 27
AntEHlV Nucleases ...... 29
Targeted nucleases...... 30
Colocalized nucleases...... ,...... 37
Cytotoxic nucleases...... 43
Target Celle for Intracellular and Systemic Delivery...... 49 lntracellular delivery via PBLs and HSCs...... 49
Systemic delivery via producer cells ...... 50 i D. Gene ûelivery and Expmuion...... 51 Expression of genes encoding targeted nucleases ...... 54 Expression of genes encoding mlocalized nucleases...... 55 Expression of genes encoding cytotoxic nucleases...... 57
E. Reconstitution of a tkaîthy Immune Syatem...... 57 Reconstitution using targeted nucleases...... 59 Reconstitution using colocalized nucleases...... 59 Reconstitution using cytotoxic nucleases...... 60
F. Thesis Objective...... 61
Chapter 2. Materials and Methoda...... 68
A Retroviral Vector Construction...... 68
Primer purification...... *...... 68 PCR ...... 68
Electroelution...... 71
Overlap PCR ...... -72 Site directed mutagenisis by PCR ...... 72
Restriction enzyme digestion ...... 72
Ligation...... 73
Prepatation of competent cells and transformation ...... 73 Screening by PCR ...... 74 Minipreparation procedure for extracting plasmid DNA ...... 75 Maxipreparation procedure for extracthg piasmid DNA ...... 76
CSCI-ethidiumbromide gradient procedure for extrading
circular DNA ...... , ...... ïï Construction of the GT retroviral vector ...... 78 Construction of the GTRC. GTR. and GTC retroviral vectors ...... 80
Construction of the rntGTRC, rntGT, mtGTR and mtGTC
retroviral vectors ...... û3
B. Transformation of E .coli and Analyris of Gag-RNase Tl by ELISA ...... û4 ELISA ...... 85 Growth rate of E. coli transfomed with GT and detection of Gag-RNase Tl by ELISA ...... 85
Detection of Gag-RNase Tl by ELISA in E. wli
transformed with GTRC...... 86
C. Analyds of RNase Tl Anti-rum by Western Blot and Immunoprecipitation...... 87
Production of RNase Tl antiserum...... 87 Western Biot analysis...... ûû Western Blot analysis using RNase Tl antiserum ...... 89
lmmunoprecipitation using RNase Tl antisenim ...... 89
D. Transknt Transfection of 2-T Celk and Anulysis of Gag- RlUaseT1 &y ELISA ...... 9û Transient transfection using the Capo, precipitation method...... 90 Lysis of cultured mamrnalian cells...... 91
Detection of Gag-RNase Tl by ELISA in the absence of
Rev in transiently transfected 293-1 cells...... 91
Detection of Gag-RNase Tl by ELISA in the presence of
Rev in transientiy transfected 293-T cells...... 92
D. Stabie Transduction of MT4 Celis and Analysis of Gag-RNase Tl and Mutant Gag-Rhm 71 by ELISA...... 93 Cell lines...... -93 Stable transfection of the Psi-2 packaging cell line...... 93 Stable transduction of the PA317 packaging cell line...... 94 Stable transduction of the MT4 cell line ...... 95
Detection of Gag-RNase Tl and mutant Gag-RNase Tl
by ELISA in stable MT4 transductants...... 96
F. Analysis of DNA and RNA Extracted from a Stable MT4 Transductant Using PCR and RTIPCR ...... 96
Total DNA extraction from mammalian cells ...... 96
Total RNA extraction from mammalian cells...... 97 RT-PCR ...... -98
PCR analysis of total DNA extracted from MT4 cells transduced with GTR ...... 98
RT-PCR analysis of total RNA extracted from MT4 cells
transduced with GTR ...... 98
G . Construction of the HVP-Pacbging Cell Line and Analysis of Cocuttureâ MTI Celk by PCR and RT-PCR ...... 99 Stable transfection of the p6 cefl line with HVP...... 99 Transduction of MT4 cells with replication incompetent HIV...... 10
Analysis of transduced MT4 cells by PCR and RT-PCR ...... 100
Chapter 3. Results...... -103
A Retroviral Vector Construction...... 103 Retroviral vector design...... 103 Construction of the GT retroviral vector ...... 112 Construction of the GTRC, GTR and GTC retroviral vectors ...... Il3 Construction of the mtGTRC, mtGT, mtGTR and mtGTC retroviral vectors ...... 120
B. TeMing Gag-RNaw Tl Production in Transforrned E. col/ ...... 128 Growth rate of E. coli transformed with GT and detection Gag-RNase Tl by ELISA ...... -128 Oetection of Gag-RNase Tl by ELISA in E. coli transformed with GTRC...... 128
C. Characterization of RNanTl Antiwrum for Use in Oetection of Gag-RNase Tl or Mutant Gag-RNase Tl...... 129
Antigenic reactivity and specif icity of RNase Tl antisenim...... 129 Precipitating ability of RNase Tl antiserum...... 130
O. Testing Gag-RMw T1 Production in Tmnsîentiy Transfected BTcells ...... 130
Detection of Gag-RNase Tl by ELISA in the absence of Rev in transiently transfected 293-T cells...... -138
Detection of Gag-RNase Tl by ELlSA in the presence of Rev in transiect!y transfected 293-1cells ...... 139
E. Tesüng GagRNatm Tl and Mutcint Gag-RlUaae TI Production
in Stable MT4 Tmnaductants...... 146
Stable transduction of aie MT4 cell line...... 46
Detection of Gag-RNase Tl and mutant Gag-RNase Tl by
ELISA in stable MT4 transductants...... 147
E. Analysk of DNA and RNA Extracted From a Stable !UT4 Cell Tranductant ...... 147
PCR analysis of total DNA extracted from MT4 cells transduced
with GTR ...... 148
RT-PCR analysis of total RNA extracted from MT4 cells
transduced with GTR ...... 14û
F. Generation of Cell Line for Studying the Mode of Inhibition of Gag-RNaee Tl or mutant Gag-RNase Tl...... 154 Design...... 54 Construction of the HVP-packaging cell Iine...... 155 Transduction of MT4 œlls with replication incompetent HIV...... 155 Chapter 4. Diacuuion...... -166
Discussion of msub...... 166 Future studks...... 186
Appendix A . Targetd RNaaes: a feaaibility atudy for
HIV gene thenpy...... -209 Acknowledgemenfs
I would like to dedicate this thesis to my farnity whose sacrifice and love are limitless.
I am grateful to my supervisor, Dr. Sadhna Joshi, for helping me grow intellectually. I would also like to thank my supervisory cornmittee members, Dr. Rick Collins and Dr.
Alan Codrane, for their support and valuable advice.
I would also like to express gratitude to my lab mates, Ali Ramerani and Dr. Shi-Fa
Ding, for their assistance throughout graduate school.
viii HIV Gene Therapy Using Nucleases A the& wbmitteâ in confmity wtth the requimments for the -me of Master of Science Graduate Department of Mobcuhr and Medical Gemice University of Toronto 8 Sanjœv Singwi (1 999)
We are interested in designing RNases for use in HIV gene therapy. In order to develop a "colocalized RNasen, Gag-RNase Tl was designed to cleave HIV genomic
RNA within viral progeny. Retroviral vectors have been constructed to allow expression of the gtl gene and mutant gtl gene. Gag-RNase Tl was detected by
ELISA in transformed E. colicells with no apparent cytotoxicity; however, it could not be detected in transiently transfected 293-T cells or stable MT4 transductants.
Preliminary PCR and RT-PCR analysis of an MT4 cell transductant suggested that a deletion within the proviral DNA was associateci with the lack of Gag-RNase Tl production. RNase Tl antibodies were raised in rabbits for specific detection of Gag-
RNase Tl or mutant Gag-RNase Tl. Also, a cell line producing replication incompetent HIV was constructed for analyzing the mode of inhibition of Gag-RNase
Tl or mutant Gag-RNase Tl. List of Abbmviations
AlDS acquired irnmunodeficiency virus bp base pair CA capsid Env envelope Gag group antigen HIV human immunodeficiency virus HSV-tk herpes simplex thymidine kinase IN integrase INS instability sequence kb kilobase kDa kiloDaltons LTR long terminal repeat MA matrix MLV murine leukemia virus NC nucleocapsid Nef negative factor neo neophophtransferase nt nucleotide PBS primer binding site Pol polyme rase PPT poly-purine tract Pro protease 'Y packaging signal R repeat RRE Rev-response element Rev regulator of expression of viral proteins RT reverse transcription RTase reverse transcnp tase SU surface Tat trans-activator of transcription TAR trans-activation respone element TM transmembrane Vif virion infectivity factor VP~ virion protein R VPU virion protein U List of Figures
Pa- Figure 1. HIV-1 life cycle and virion ...... 16 Figure 2. Gag-RNase Tl and mutant Gag-RNase Tl fusion proteins...... 64 Figure 3. Gene delivery using retroviral vectors ...... 66 Figure 4 . HIV-1 protease cleavage products of Gag-RNase Tl and mutant Gag-RNase Tl ...... 105 Figure 5 . The GT, GTR, GTC, AGT and GTRC retroviral vectors ...... 107 Figure 6. The mtGT, mtGTR, mGTC and mtGTRC retroviral vectors ...... 109 Figure 7. Construction of the GT retroviral vector...... 114 Figure 8. Schematic construction of the GTRC retroviral vector ...... 116 Figure 9. Construction of the GTRC retroviral vector ...... 1 18 Figure 10. Restriction sites designed in the GTRC and mtGTRC
retroviral vectors...... 121 Figure i1 . Construction of the GTR and GTC retroviral vectors...... 123 Figure 12. Construction of the mtGTRC, mtGT, mtGTR and mtGTC retroviral vectors...... 126 Figure 13. Growth rate of E. coliproducing Gag-RNase Tl...... 131 Figure 14. Detection of Gag-RNase Tl by ELISA in E. coii transfomed with GTRC...... 134
Figure 15. Antigenic reacivity and specificty of RNase Tl antiserum...... 136 Figure 16. Detection of Gag-RNase Tl by ELISA in the absence of Rev in transienlty transfected 293-T cells...... 140 Figure 17. Detection of Gag-RNase Tl by ELISA under varying conditions in transiently transfected 293-T ce Os ...... -142 Figure 18. Detection of Gag-RNase Tl by ELISA in the presence of Rev in transiently transfected 293-T cells...... 144 Figure 19. Detection of Gag-RNase Tl and mutant Gag-RNase Tl
by ELISA in stable MT4 transductants...... ,...... 150 Figure 20 . PCR and RT-PCR analysis of total DNA and RNA extracted
fmm MT4 cells transduœd with GTR ...... 1 52 Figure 21 . Schematic construction of the HVP-packaging cell line...... 155
Figure 22. Detection of HIV-1 Gag by ELISA from culture supernatants of induced p6 cells...... 160 Figure 23. Detection of HIV-1 Gag by ELISA from culture supematants of induced HVP-packaging cells...... 162 Figure 24. Transduction of MT4 cells using replication incampetent HIV...... 164 List of Tables
Table I Overview of primers...... 69
Table II Overview of plasmids and cell lines...... 70
Table III Coculture of k-4cells with HVP packaging cell line ...... 1 02
Table IV Production of stable MT4 cell transducbnts...... 149 Chapter 1. lntroductlon
HIV' (hurnan irnmunodeficiency virus) infection leads to the slow and progressive destruction of the immune system. As a result, the infected individual becomes susceptible to opportunistic infections leading to the diseased state known as acquired immunodeficiency syndrome (AIDS). Dnig therapies have improved the quality of life of many infected individuals; however, current drug cocktails cannot completely eradicate the virus from the body (Ho, 1998). In contrast, gene therapy for HIV-infected individuals offers a promising approach in the fight against AIDS
(Baltimore, 1988). It involves the introduction of a therapeutic gene into the infected individual for the purposes of reducing viral load and ultimately reconstituting a healthy immune system. HIV gene therapy, however, has not been able to provide therapeutic benefit to date. In addition to improving the efficiency of gene delivery and the maintenance of gene expression, better therapeutic genes must be designed before this therapy becomes available to patients. A new class of therapeutic genes may be designed to enwde nucleases that inhibit HIV replication.
These nucleases may be classified into three categories based on their mode of action: (i) Yargeted nucleases' for specifically cleaving HIV RNA within the cell, (ii)
'colocalized nucleases' for cleaving HIV proviral DNA or genomic RNA present within the cell or the progeny virus and (iii) 'cytotoxic nucleases' for confemng selective toxicity to HIV-infected cells. This introduction will focus on the design of anti-HIV nucleases and their application in HIV gene therapy. A brief review of HtV-1 molecular biology is presented first.
HIV will refer to HlV-1 and HIV-2 unless stated explicitly A. Human Immunodeficiency Virus i) HlV-1 lits cyck
HIV is a member of the lentivinis genus in the Retrovin'dae family (Gallo et al., 1983).
In addition to gag, pol and env, six other genes are encoded by the virus. Upon fusion with the host cell, the RNA genome is reverse transcnbed and integrated into the host chromosome. Viral gene expression leads to the assembly, release and maturation of progeny virions, yielding infectious virus (Fig. 1).
Viral entry: Viral entry is determined by specific protein-protein interactions between the HIV envelope (Env) protein complex on the surface of the virion and cellular receptors (Wyatt and Sodroski, 1998). HIV Env protein is initially produced in the host cell as the precursor gp160 and subsequently cleaved by a cellular convertase
(within the endoplasmic reticulum) into the gp120 surface subunit and the gp41 transmembrane subunit (Decroly et al., 1996). 60th subunits remain noncovalently attached and are targeted to the host plasma membrane by vessicular transport
(Earl et al., 1991).
The gp120 surface subunit binds to cellular CD4 and a coreceptor belonging to the chemokine receptor family (Wu et al., 1996; Lapham et al., 1996). The CD4 receptor is found primarily on the surface of T-hetper lymphocytes, monocyteç/macrophages, dendritic cells and brain microglial cells (Bour et ai., 1995). The primary coreceptors utilized by the virus are either CCRS or CXCR4 (Alkhatib et ai., 1996; Deng et al.,
1996). HIV variants that use the CCRS coreceptor are termed macrophage-tropic Figure 1. HIV-1 Iïfe cyck
HIV is a rnember of the lentkirus genus in the Retrovindae family. Upon fusion with the host cell, the RNA genome is reverse transcribed and integrated into the host chromosome. Viral gene expression leads to the assembly, release and maturation of progeny vinons, yielding infectious virus. This figure is wmpiled from Joshi and Joshi, 1996. HIV-1 Life Cvcle
Figure 1 while variants that use the CXCR4 coreceptor are temed T-cell fine-tropic (Doranz et ai., 1996). Upon initial binding of gp120 to the cellular receptors, conformational changes allow the N-terminus of the gp41 transmembrane subunit to mediate fusion between the viral membrane and the host cell membrane (Salzwedel et al., 1999).
The Env protein can also mediate fusion between infected cells and uninfected cells in a process calfed syncytium formation (Rausch et a/., 1992).
Reverse transcription: Initiation of reverse transcription of the viral RNA genome requires the formation of a temary complex between HIV Reverse Transcriptase
(RTase), a cellular ~RNA~~~which serves as a primer and the viral RNA genome (Isel et al., 1999). Rfase has an RNase H domain and a polyrnerase domain (Mizrahi et al., 1989). Initiation primarily occurs post-fusion within the cytoplasm of the newly infected cell where there is an abundance of dNTPs; although, proviral DNA has been detected in some rare vinons (Arts et al., 1994; Rarnezani et al., 1997). The
~RNA~~~anneals to complementary sequences within the 5' region of the viral genome, called the primer binding site (PBS) (Yu and Morrow, 1999). RTase then polymerizes negative strand strong-stop DNA to the 5' end of the genome (Li et al.,
1996). Dunng polymerization, the RNase H domain cleaves the RNA in the
RNAIDNA hybrid (Artzi et al., 1996; Gotte et al., 1999). Sequence complementanty of negative strand DNA to repeat sequences favours an interrnolecular jump to the 3' end of the other genomic copy of HIV RNA (Kim et al., 1997); although, an intrarnolecular strand transfer has also been shown to occur suggesting that two genomic RNA copies are not necessary for proviral DNA synthesis (van Wamel et al., 1998). Negative strand DNA synthesis then proceeds to the PBS, while the RNase H domain cfeaves RNA within the RNAiDNA hybrid
(DeStefano et al., 1994). RNase H also nicks the genomic RNA 3' to two PPTs
(polypurine tracts) upstrearn of the 3' LTR, the RNA then serving as primer for positive strand DMsynthesis (Fuentes et a/., 1995). Sequence wmplernentarity to the PBS favours circularization of the template and allows for RTase to complete synthesis of double stranded proviral DNA (Pop, 1996). Recombination may occur during reverse transcription by intenolecular jumping of RTase between both genomic RNA copies (Yu et al., 1998). The diploid nature of HIV sugjgests that recombination serves a central function in virus evolution.
Nuclear localkation: Since HIV can infect nondividing cells (Freed, 1994). the pre- integration complex must translocate through the nuclear pore complex (NPC). It is this process that allows infection of monocytes/macrophages (Mann et al., IWO).
Little is known of the intermediates involved during import of the preintegration complex. However, nuclear import is mediated by independent pathways that use the Vpr (virion protein R), MA (matrix) or IN (integrase) protein. The Vpr protein uses two different import pathways (Jenkins et al., 1998) that are distinct from the classical NLS (nuclear localization sequence)- and M9-mediated pathways. The Vpr protein does not seem to use cellular receptors involved in import, but rather appears to interact directly with the NPC (Jenkins et al., 1998; Fouchier et al., 1998). Unlike the Vpr protein (Kami et al., 1998), the MA protein contains a classical NLS sequence (Bukrinsky et a 1993) and binds to a member of the karyopherin-alpha family (Gallay et al., 1996). In addition, tyrosine phosphorylation at the C-terminus of the MA protein is needed for import (Gallay et al., 1995). The integrase protein has an atypical bipartite NLS that utilizes the importinfkaryopherin pathway (Gallay et al., 1997).
Integmtion: The IN protein of HIV cataiyzes the insertion of provirai DNA into the genome of the host. The integration event is not site specific but certain topological features of the chromosome may be more amenable to integration (Katz et al.,
1998). The IN protein recognizes short inverted repeats at both ends of the proviral
DNA and cleaves a dinucleotide at the 3' end, leaving an AT overhang at the 5' end
(Drake et al., 1998). The IN protein also catalyzes the cleavage of the host genome and subsequently ligates the 5' overhang to the cellular genorne creating a 5 bp
repeat on either side (Bushman et al., 1990).
Early and late -ne expression: Transcriptional regulation of HIV-1 gene expression is controlled by CO-operativeinteractions between host-cell transcription factors and viral gene products. The 5' LTR contains binding sites for transcription factors such as AP-1, NF-kappa B, NF-AT, IRF, and Spl (Al-Harthi and Roebuck,
1998). The transcription initiation site is in the U3 region and transcription occurs under control of RNA polymerase II (Al-Harthi and Roebuck, 1998). The prirnary transcript either remains unspliced, singly spliced or multiply spliced, thereby permitting translation of nine open reading frames (Joshi and Joshi, 1996). Multiply spliced mRNAs code for the eariy gene products, trans-activator of transcription
(Tat), regulator of viral proteins (Rev) and the negative factor (Nef). The viral gene product Tat positively regulates the production of al1 three types of HIV mRNAs, (Tat), regulator of viral proteins (Rev) and the negative factor (Nef). The viral gene product Tat positively regulates the production of al1 three types of HIV mRNAs, while Rev positively regulates the production late gene products from the unspliced and singly spiced HIV mRNAs. Unspliced HIV mRNA senres as the viral genome and mRNA coding for the group antigen (Gag) and Gag-polymerase (Pol) precursors, while singly spliced HIV mRNAs code for the virion infectivity factor (Vif), viral protein R (Vpr), viral protein U (Vpu), and Env (Joshi and Joshi, 1996).
An essential transcriptional activator required for HIV gene expression is the viral Tat protein. Tat contains an NLS and nuclear export signal (NES) allowing it to cycle in and out of the nucleus (Truant R, Cullen, 1999; Stauber and Pavlakis 1998). Tat prornotes transcriptional elongation by binding to the viral tranç-activation response
FAR) element located immediately 3' to the transcriptional start site (Keen et al.,
1997). The TAR element is a 59 nucleotide-long RNA stem loop structure having two important sequence elements - a three nucleotide bulge and a six nucleotide loop (Aboul-da et al., 1996). Tat recruits cellular cofactors to the TAR element in a process that involves Tat binding to the bulge and cofactor binding to the loop
(Yankulov and Bentley, 1998). Tat acts to prornote the processivity of RNA pol II by recruiting a CTD (C-terminal domain) kinase which allows the phosphorylation of the
CTD of the RNA pol II enzyme (Cujec et al., 1997). This results in the production of high levels of the primary transcript which is available to the spicing pathway. HIV has evolved the required mechanism for exporüng newly synthesized unspliced and singly spliced HIV rnRNAs, by using the Rev protein.
The HIV Rev protein regulates the production of viral gene products encoded by singly spliced and unspliced HIV mRNAs. The Rev protein contains an NLS and NES and thus shuttles back and forth between the nucleus and cytoplasm (Tniant and Cullen, 1999). Rev binds to a 234 nucleotide-long viral RNA multi-stem-loop structure, called the Rev-responsive element (RRE) (Heaphy et al., 1990). Rev initially binds to stem loop 118 within RRE (Heaphy et al., 1991). This event serves to remit other Rev molecules in a multimerization process (Mann et al., 1994).
Nuclear export of the RevfRNA complex is mediated by exportin Cm3 and Ran-
GTP, (Askjaer et al., 1998), while nuclear import of Rev is mediated by importin P
(Henderson and Percipalle, 1997). Rev has also been shown to promote polysomal loading during translation of viral mRNAs (O'Agostino et al., 1992).
The third early gene product encoded by HIV is the Nef protein. The Nef protein downregulates cell surface CD4 and MHC I proteins (Mangasarian et al., 1999)- The amino terminus of the Nef protein is post-translationally modified by mynstoylation
(Harris and Neil, 1994). Myristoylation promotes targeting to the inner surface of the plasma membrane where Nef promotes binding of a clathrin adaptor complex with the cytoplasmic tails of CD4 or MHC I protein (Lock et al., 1999). This interaction promotes their intemalization and transport to Iysozomes for degradation via independent pathways (Piguet et al., 1999; Greenberg et al., 1998). Downregulation of cell surface CD4 protein may prevent complex formation between CD4 and Env proteins at the plasma membrane and facititate release of HIV virions (Ross et al.,
1999). Downregulation of MHC I inhibits CTL-mediated lysis of HIV-1 infected cells
(Collins et al., 1998). The Nef protein is also packaged into vinons during viral budding and seems to enhance virion infectivity since HIV-1 virions produced in the absence of Nef inefficiently reverse transcrîbe the RNA genome (Aiken and Trono,
1995). Rev-dependent accumulation of singly spliced and unspliced HIV mRNAs allow for the production of late gene products. The main function of the Vif protein is to enhance the infectnrity of HIV virions (Simon et a/., 1999); however, Vif may not be incorporated into virions during viral assembly and may therefore function in the cytoplasm to somehow modify HIV vinons through a cellular factor (Dettenhofer and
Yu, 1999). The Vpr protein is packaged into vinons and aHows eventual nuclear import of the preintegration complex (Mahalingam et al., 1997). The Vpr protein is also involved in arresting HIV-infected cells in the G2 phase of the cell cycle (Poon et al., 1998a). The HIV-1 LTR was shown to be more active in G2-arrested cells, maximizing virus production (Gummuluru and Emerman, 1999). The Vpu protein is unique to HIV-1 and is absent in HIV-2. Vpu selectively targets CD4 to a degradation pathway in the endoplasrnic reticulum (ER) (Schubert et al., 1998). This permits the release of Env from the ER, which may be complexed with CD4 (Lama et al., 1999). The Vpu protein also selectively enhances virion release (Paul et al.,
1998). Vpu has been proposed to make an ion channel in the plasma membrane to facilitate the release of virions; however the mechanisrn by which Vpu promotes virion budding is unknown (Moore et al., 1998).
Viral assernbly and maturation: The virus is assembled at the plasma membrane.
Two copies of unspliced genomic RNA and cellular ~RNA~~~are packaged into the budding viral particle along with virion structural and enzymatic proteins (Haseltine,
1991). Host cellular proteins are also packaged into virions (Emerman and Malim,
1998). The pathway through which hundreds of subunits self-assemble into an infectious virus has been difficult to determine. However, al1 the information needed to form virus-like particles resides within the HlV Gag protein (Freed, 1998). Initially, the gag gene product is translated as a precurçor from cytosolic ribosomes.
Ribosomal frarneshifting dunng translation of unspliced mRNA also allows for the
production of the Gag-Pol polyprotein precuisors (Hung et al., 1998). The Gag and
Gag-Pot precursois are then post-translationally modified by removal of the N- terminal methionine and attachment of myristic acid to the second amino acid glycine
(Jacobs et al., 1989). The hydrophobic interactions between the lipid bilayer and the mynstate moiety along with the electrostatic contacts between flanking residues and the acidic phospholipids allow for efficient membrane targeting (Ehrlich et ai., 1996).
Ordered Gag-Gag and Gag-Gag/Pol aggregation is achieved through multiple protein-protein interactions between Gag molecules at the plasma membrane
(Freed , 1998).
Proteolytic cleavage by the Protease (Pro) domain of the Gag-Pol precursors allows for large conformational changes which may promote induction of cuwature and virion release from the infected cell (Gitti et al., 1996). HIV Gag precursors are processed at the membrane and in the virus into (from N to C terminus ends) the
MA, capsid (CA), nucleocapsid (NC) and core-envelope-link (CEL) proteins (Kaplan et al., 1994). Upon protease cleavage, the MA protein foms a matrix under the viral envelope and the CA protein condenses to fom a conical core surrounding the NC- coated HIV RNA genome. The CEL protein is thought to become associated with the Env protein. The Gag-Pol precursors are afso processed into the above products, plus the HIV enzymatic proteins Pro, RTase and IN. The association of
Gag and Gag-Pol precursors with the Env protein is mediated by protein/protein interactions between the MA domain and gp41 protein (Dorfman et al. 1994). All of the information needed for packaging two copies of genomic RNA is contained within the unspliced HIV RNA. The packaging signal (Y), adjacent to the 5' splice donor, is necessary for recognition by the NC domain of the Gag precursor during viral assembly (De Guzman et al., 1998). In addition, sequences within the env coding region of HIV RNA have been shown to promote packaging (Kaye et al.,
1995). Dimerization of two copies of genornic RNA is mediated by palindromic sequences within the dimer linkage structure (DLS) (Skripkin et al., 1994). The DLS overfaps the Y! element (Skripkin et al., 1994). Dimerization may not necessarily be a prerequisite for packaging genomic RNA; however, dimerkation is catalysed by the
NC domain in vitro (Muriaux et al., 1996). Thus, the NC domain not only allows for recognition but also seems to allow for packaging two copies of genomic RNA.
Cellular ~RN&'~is also packaged into virus by binding to the RTase domain of the
Gag-Pol precursor (Mak et al., 1994).
Correct folding and trafficking of proteins may be mediated by cellular factors. For example, virions lacking cyclophillin A are non-infectious (Yin et al., 1998). The central region of the CA domain binds to cyclophillin A; however, the function of cyclophillin A during virus assembly is largely unknown (Wiegers et al., 1999).
Furthemore, this association with cyclophillin A has not been shown with other closely related retroviruses and seems to be unique to HIV (Franke et al., 1994). ii) HIV pathogenisis
HIV infection ultimately leads to the destruction of the cells within the immune system. lnfected cetls can infiltrate the lymph nodes and infection can occur within the thymus, brain and gut (Gaulton et al., 1997; Kofson et al., 1998; Chui and Owen, 1994). The onset of AIDS occurs as the progressively deteriorating immune system
becomes susceptible to opportunistic infections (Lloyd, 1996). The pathogenic mechanisrns leading to AIDS are not well understood but involve bath viral and host factors.
Viral replication causes disease and host-mediated immunity atternpts to reduce viral
load. These two opposing forces on viral population may eventualiy fall out of equilibrium as the continuous and rapid turnover of virus leads to the emergence of variants that evade the immune response (Nowak and Bangham, 1996). As a result,
infection leads to a massive depletion of cells within the immune system, particularly of the C04+ T-lymphocytes.
Host factors rnay regulate the life cycle of HIV resulting in acute, chronic or latent infection. Acutely infected cells are short-lived, whereas chronically infected cells and resting cells harbouring latent HIV proviral DNA are relatively long-lived (Ho,
1998). Resting cells likely evade dnig treatrnent and control by the immune response (Kawano et al., 1997; lkuta et al., 1997).
The infected cells rnay die as a result of cytopathic effects such as syncytium formation or viral budding (Whitaker, 1997). Thus far, only in vitro results show that cell death results from direct infection of the cell (Talbott et al., 1993; Gandhi et al.,
1998); however, this rnay not be the case in vivo (Finkel et al., 1995; Mosier et al.,
1993). Instead, cell death may also be caused by host factors.
Mechanisrns other than syncytium formation and virally induced cytopathicity rnay contribute to the massive deptetion of cells in the immune system. For example, studies have shown that a pathogenic CTL response rnay be induced in which uninfected CD4+ cells are destroyed (Grant et al., 1994). Additionally, other bystander effects such as T-cell anergy in vivo (Weissman et al., 1997;
Hesselgesser et a!., 1998) or apoptosis (Herbein et al., 1998) may be mediated by free HIV gpt 20. In addition, host genetic factors also play a role in pathogenesis. It is known that both non-MHC (Samson et al., 1996; Dean et al., 1996) and MHC
(Gaudieri et al., 1997; Achord et al.. 1997) genes influence the spread of HIV infection and progression to AIDS. iii) Drug therapy
The Worid Health Organization has estimated that 33 million people will be infected by the end of the century (WHO, 1998). Currently, the complete eradication of the virus in the infected individual has not been fully realized by drug therapy (Ho, 1998).
Anti-viral drugs have extended the Bves of many individuals infected with HIV in the
United States; however, they have not proven effective in completely reducing viral loads and have exhibited toxic side effects (Struble et al., 1997). Drug therapy has not been able to deai with the latent reservoir (Chun et al., 1997) and undetected viral compartments or sanctuary sites (Perelson et al., 1997). Unfortunately, viral resistance to al1 classes of anti-HIV drugs has been described (Mayers, 1997). In addition, the high cost of anti-viral drugs make it impossible for developing countries, where 95% of al1 HIV-infected people live, to have access to the treatment.
Therefore, a treatment rnust be sought that can also be cost-effective. iv) Gene therapy
HIV infection leads to the aquisition of viral genes by the host. Thus, AIDS can be considered as an acquired genetic disorder. Gene therapy would decrease viral load and protect susceptible cells, resulting in the eventual reconstitution of a healthy,
HIV-resistant immune system. In addition, a single gene therapy treatment could
manage the infection for the life of the patient. Thus, gene therapy has the potential
to be less costly without the complication of cornpliance associated with drug
therapy.
The therapeutic genes can be designed to inhibit viral replication such that infected cells do not produce any infectious progeny. The therapeutic genes are designed to
encode RNAs (Le. antisense RNAs, sense RNAs, and ribozymes) ancilor proteins
(i.e. HIV receptors, trans-dominant mutants, single-chah antibodies, suicide proteins,
nucleases, and coreceptors and their ligands). The therapeutic gene products may
inhibit one or multiple sites within the viral Iife cycle or cellular processes essential for viral replication by blocking initial infection, inhibiting viral replication, or rendering progeny virus non-infectious. The inhibitory strategy that will be most successful is the one that is able to completely block any given step in the viral life cycle.
Altematively, the therapeutic gene products may disable the infected cells, thereby eliminating the infected cells, so that viral spread would not occur. A significant decrease in the viral load will prevent new infections and also protect gene-modified and unmodified cells from bystander effects. Cunent clinical trials have focused on the use of several anti-HIV genes, even though they do not confer complete resistance to HIV replication in vitro. Since the emergence of viable escape mutants has been the primary obstacle with the efficacy of curent anti-HIV drugs, the isolation of therapeutic genes conferring 100% protection with zero probability of developing viable escape mutants is crucial for long terni resistance. Thus, there is a clear need to explore better therapeutic genes that completely inhibit HIV replication while disallowing the ernergence of a viable escape mutant.
B. Anti-HlV Nucleases
Nucleases are enzymes capable of hydrolyzing the phosphodiester bonds present in nucleic acids. Nudeases which cleave DNA are called deoxyribonucleases
(DNases), while nucleases which cleave RNA are called ribonucleases (RNases).
DNases may cleave single stranded DNA or double stranded DNA. Also, DNases known as restriction endonucleases can recognize and cleave DNA at specific sequences. RNases may cleave single stranded RNA, double stranded RNA or
RNA present in a DNNRNA hybrid. Until now no RNase has been found that exhibits restriction endonuclease-like specificity. However, the specific nature of
RNA processing in mammalian cells suggests that RNases do recognize specific sequence motifs. Furthemore, nature has used nucleases as a defence mechanism against viral infections. For example, RNase(s) with anti-HIV-1 activity in-vitro, are associated with hurnan chorionic gonadotropin (hcg) preparations from pregnant women (Lee-Huang et al., 1999). High levels of hcg correlate with reduced transmission of HIV from infected mothers to fetus (Lee-Huang et al., 1999).
Nucleases have a unique advantage as therapeutic agents because of their reaction specificity and catalytic efficiency. Therapeutic genes expressing nucleases have been designed for use in HIV gene therapy (Wu et al., 1995a; Melekhovets and
Joshi, 1996; Singwi et al., 1999). HIV gene therapy strategies that require stoichiornetric binding of interfering molecules to HIV RNNprotein molecules require an excess of the intedering molecules to shift the equilibrium towards the bound form. Since, the HIV RNNprotein is not consurned in the reaction, a slight shift in
the equilibrium may be sufficient to permit HIV replication to proceed beyond the
inhibitory step, allowing virus ta propagate. In wntrast, anti-HIV nuclease-based
strategies rnay be preferred since they would result in a permanent loss of HIV
DNAIRNA function. Furthemore, since nucleases act in a catalytic manner, low
concentrations would be required for thern to be effective. By designing anti-HIV
nucleases whose function depends on several essential viral functions, the overall
probability of the ernergence of escape mutants would be reduced to the multiple of
their individual probabilities. Thus, HIV will have little latitude for the emergence of
escape mutants since any such mutation will be deleterious and confer a replicative
disadvantage to the virus. In addition, since conserved viral processes may be
targeted, nucleases may be designed to be effective against various subtypes of
both HIV-1 and/or HIV-2.
Genetic engineering allows for the construction of three types of anti-HIV nucleases:
(i)'targeted nucleases' can be designed to specifically cleave HIV RNA within the
cell, (ii) 'colocalized nucleases' can be designed to cleave HIV proviral DNA or
genomic RNA present within the cell or viral progeny and (iii) 'cytotoxic nucleases'
can be designed to confer selective toxicity to HIV-infected cells.
i) Targeted nucieases
Definition: A targeted nuclease is defined as a nuclease which would specifically bind to and cleave its target RNA. Inhibition of HIV replication would involve the
intracellular production of a targeted nuclease in infected cells so that specific cleavage of HtV RNA would prevent subsequent steps within the viral Iife cycle. The nuclease should inhibit HIV replication without causing any cytotoxicity. Design: Most existing nucleases that cleave RNA, cleave al1 single stranded RNAs at a specific ribonucleotide or al1 double stranded RNAs at any ribonucleotide
(Deutscher., 1990). but lack target RNA specificity. The ribonucleotide specificity of a nuclease resides within the ribonucleotide binding motif. Target RNA specificity may be provided by modifying a nuclease to contain an HIV RNA binding motif to redirect the active site to the HIV target RNA. This rnay be accomplished by fusing a gene encoding an HIV RNA binding domain to a gene encoding a nuclease. HIV
RNA binding motifs that have been well characteriad include the RRE binding domain of the HIV Rev protein (Daly et al., 1989; Heaphy et al., 1990), the TAR RNA binding domain of the HIV Tat protein (Dingwall et al., 1989), and the Y binding domain of the HIV NC protein (Stauber and Pavlakis, 1998). In addition, the HIV-1
Tev protein (produced from a gene containing the first coding exon of tat, a portion of env, and the second coding exon of rev) has both TAR and RRE RNA binding domains (Benko et al., 1990). The emergence of HIV mutants preventing HIV RNA recognition by the targeted nuclease would also prevent recognition by wild type
Rev, Tat, Tev or NC protein. Viable escape mutants would be rare since simultaneous mutations in both the HIV protein and HIV target RNA would be required for recognition and retention of function by wild type proteins and not the targeted RNase.
Tat-nucleam: Tat binds the TAR RNA element within HIV RNA. Since TAR is present at the 5' and 3' ends of al1 HIV RNAs, a fat-nuclease will recognize and cleave al1 HIV RNA transcripts and inhibit subsequent steps leading to viral production. The cleavage of HIV RNA will take place either in the nucleus or in the cytoplasrn since HIV Tat cycles in and out of the nucleus (Stauber and Pavlakis,
1998).
Tat-RNase H was engineered in Our laboratoty by fusing the HIV-1 TAR RNA binding domain of HIV-1 Tat with the RNase H domain of HIV-1 RTase (Melekhovets and
Joshi, 1996). RNase H cleaves RNA in RNNDNA hybrids and can cleave RNA in
RNAfRNA hybrids at a lower efficiency (Gotte et al., 1995). Unlike most RNases, the
RNA binding activity and catalytic activity of HIV RNase H are separable (Le. the
RNA binding motif is within the polymerase domain). Thus, specificity of Tat-RNase
H can be mediated by the TAR RNA binding domain of Tat. fat-RNase H was shown to specifically recognize and cleave HIV-1 TAR RNA in vitro (Melekhovets &
Joshi, 1996). However, Tat-RNase H did not inhibit HIV-1 replication in MT4 cells (a human T-lymphoid cell Iine) (our unpublished results). It seems that Tat-RNase H failed to cleave HIV-1 RNA in vivo- Lack of inhibition of HIV-1 replication suggests that HIV-1 RNNDNA hybrids may not have been available for cleavage by Tat-
RNase H during transcription. It is also possible that the fusion protein has specific ion requirements for cleavage of RNAIRNA hybrids that may be missing in vivo.
Rev-nuclease: Rev binds to the RRE element within HIV RNA. A Rev-nuclease will contain the RRE binding domain and thus specifically cleave RRE-containing HIV
RNAs. Since Rev cycles in and out of the nucleus (Truant and Cullen, 1999), a Rev- nuclease is expected to cleave HIV RNA within the nucleus as well as in the cytoplasm. RRE-mntaining RNAs that would be cleaved include the unspliced and singly spliced HIV mRNAs (Fukomori et al., 1999). Cleavage of primary HIV transcripts, before they enter the splicing pathway, will inhibit the production of al1 early and late gene products. Cleavage of unspliced and singly spliced viral transcripts, after they leave the splicing pathway, will inhibit the production of al1 late viral gene products.
Tev-nucleasa: Tev contains the RNA binding domains of both Tat and Rev and can thus target both TAR and RRE within HIV RNA. Tev contains a nuclear localization signal and is predicted to act primarily within the nucleus. Therefore, a Tev-nuclease is expected to target al1 HIV transcripts and inhibit the production of both earfy and late viral gene products. Furthemore, HIV-1 Tat and Rev proteins also bind HIV-2
TAR and RRE (Garcia-Martinez et l., 1995; Paulous et al., 1992). A Tev-nuclease is therefore expected to confer protection against both HIV-1 and HIV-2.
We designed the fusion protein Tev-RNase Tl which contains the HIV-1 Tev domain and the Aspergillus orylae RNase Tl domain (Singwi et al., 1999). RNase Tl specifically recognizes and cleaves guanylate residues within single stranded RNAs.
The catalytic activity and RNA binding activity of RNase Tl cannot be uncoupled
(Martinez-Oyanedel et al., 1991) and were both present within the fusion protein.
Since the RNase Tl domain still retains its own RNA binding activity, Tev-RNase Tl specificity in vivo is expected to be dependent on the initial binding event of HlV-1
Tev to TAR or RRE which occurs with up to a 104foldhigher affinity than the binding of RNase Tl to RNA (Roy et al., 1990; Heaphy et ai., 1990; Hakoshima et al., 1991).
Therefore, Tev-RNase Tl is predicted to cleave HIV-1 RNA at available guanylate residues within and outside the TAR and RRE regions.
Tev-RNase Tl was shown to be enzymatically functional and intracellular production of Tev-RNase Tl in MT4 cells and human PBLs (peripheral blood lymphocytes) resulted in a significant delay in replication of a laboratory strain and a clinical isolate of HIV-1, respectively (Singwi et al., 1999). Also, cells producing Tev-RNase T 1 were viable and showed no signs of toxicity suggesting that Tev-RNase TI did not cleave host cellular RNA. The absence of cytotoxicity suggests that nuclear host
RNAs are not available for cleavage by Tev-RNase Tl. The compartmentalization of nuclear bodies within the nucleus dunng RNA metabolism (Laemmli and Tjian, 1996) may prevent any association of nuclear host RWprotein complexes with Tev-
RNase Tl. Host nuckar RNA exclusion in combination with the specific affinity and compartmentalization of Tev-RNase Tl with HIV RNA may thus be important factors contrîbuting to the lack of toxicity and specificity of Tev-RNase Tl.
Tev-RNase Tl was shown to interfere with the HIV-1 life cycle post-integration
(Singwi et a1.,1999). Our results suggest that Tev-RNase Tl may not cleave incoming HIV genomic RNA. Rather, Tev-RNase Tl seerns to act by specifically decreasing HIV-1 transcript levels, resulting in the inhibition of the subsequent steps within the viral life cycle. In addition to acting as a targeted RNase, our results cannot exclude the possibility that Tev-RNase Tt also acts as a trans-dominant negative mutant since this would also result in a reduction of HIV RNA levels.
NGnuclease: The HIV NC protein binds specifically to the Y element, which is retained in unspliced HIV RNA (Damgaard et al., 1998). It is also important in the dimerization of the HIV genomic RNA and allows specific annealing of ~RNA~"to the primer binding site durîng HIV RNA reverse transcription (Darlix et al., 1995).
The NC domain within the HIV Gag precursor is essential for packaging HIV genornic
RNA into virus (Poon et al., 1998b). The functional properties of the NC domain are dependent on the maintenance of two highly conserved Cys-His boxes separated by a basic linker, RAPRKKG (Schwartz et al., 1997). Thus, an NC-nuclease should allow for specific cleavage of unspliced HIV RNAs containing the Y element. The
cleavage will take place in the cytoplasrn where the NC-nuclease is expected to bind
to and cleave unspliced HIV RNAs. This in turn should inhibit the production of HIV
Gag and Gag-Pol precursors and the availability of HIV genomic RNA for packaging.
The HIV-1 NC protein also binds to the Y element of HIV-2 RNA (Damgaard et al.,
1998). An NC-nuctease fusion protein should therefore inhibit replication of both
HIV-1 and HIV-2.
lmproved targeted nuckases: Complete inhibition of H1V-1 replication was not
obsewed in vitro using Tev-RNase Tl (Singwi et al., 1999). Protein design and
selection strategies can be used to build improved targeted nudeases. An effective
targeted nuclease strategy is expected ta depend on both cleavage efficiency and
specificity. The nuclease domain may be evolved with a higher catalytic activity
under varied reaction conditions. One study described a general method to evolve
protein catalysts in vitro by using staphylococcal nuclease (SN) as a model enzyme
in a phage display library (Pedersen et al., 1998). SN was displayed as a plll fusion
protein on phage and substrate DNA was covalently attached to the phage to allow
intramolecular cleavage. The modified phage was attached to a solid support by the
substrate. Reaction conditions favourable for cleavage allowed for the release and
enrichment of phage having enzymatically functional SN variants. Similar strategies
can be used to develop targeted nucleases and selection can be done under shorter
reaction times, varying temperatures, solvent conditions and pH for optimal activity in
vivo.
lmproved HIV RNA binding domains may be developed by selecting or evolving variants of known RNA binding structural motifs. Various families of RNA binding domains like the RNP motif, the arginine-rich motif, the ds-RNA binding motif and the zinc finger motif have al1 been well charactenzed (Varani and Nagai, 1998).
Combinatonal libraries of peptides based on sequences from known RNA binding motifs can be used to isolate specific HIV RNA binding peptides that bind as tightly or better than HIV Tat, Rev, Tev or NC protein. In vivo selection of HIV RNA binding peptides based on the arginine-rich RNA binding motif has been dernonstrated
(Harada et al., 1996; Harada et al., 1997). Peptides were isolated with high aff inity for RRE (Harada et al., 1996; Harada et al., 1997). To this end, the 19 amino acid
N-terminal RNA binding domain of the bactenophage iL antitermination protein N was replaced with a library of arginine-rich peptides, while the box B hairpin was replaced by HIV RRE. Anti-termination was obsewed with only specific peptide-RRE interactions in vivo (Harada et al., 1996; Harada et al., 1997). ln another study, a zinc finger library was displayed on bacteriophage and peptides that had a high affinity for stem loop ilB within HIV RRE were selected (Friesen and Darby, 1998).
The novel zinc fingers selected in the assay were shown to bind to RRE with affinities that were comparable or better than that of monomeric Rev- The selected zinc finger peptides were also shown to bind to RRE stem loop llB in vivo in an HIV-1
LTR-CAT reporter gene expression system in which the RNA binding domain of Tat was replaced with the zinc finger peptide and the TAR element by the RRE-IIB element.
The use of targeted nucleases in HIV gene therapy also raises the issue of potential immunogenicity. Protein engineering can be used to select for targeted nucleases with minimal functional requirements while leaving out immunodominant epitopes.
Also targeted nudeases may be 'humanized8 to contain TAR and RRE binding domains as well as nuclease domains of human origin. For example, the human
TAR RNA binding protein (TRBP) interacts with the TAR RNA during HIV infection.
Mutational analysis has identified a 15 amino acid stretch of TRBP protein that is necessary and sufficient for binding to TAR RNA (Erard et al., 1998). Two human proteins, with molecular masses of 120 kDa and 62 kDa, were shown to bind HIV-1
RRE RNA (Shukla et al., 1994). Nucleases of human origin that may be used to develop humanized nucleases include pancreatic RNase, angiogenin, EDN
(eonisophil derived nuerotoxin) and ECP (eonisophil cationic protein). ii) Colocalized nucieaws
Definition: A colocalized nuclease is defined as a nuclease which will cleave HIV genomic RNA or proviral DNA by compartmentalizing with them during the early or late stages of the viral Iife cycle. A colocalized nuclease rnay act by compartmentalizing with the preintegration complex early in the viral life cycle and cleaving proviral DNA or by copackaging with progeny virus late in the viral life cycle and cleaving virion genomic RNA. Compartmentalization of a colocalized nuclease with the preintegration complex will prevent the acquisition of proviral DNA, while copackaging of the colocalized nuclease will degrade virion genomic RNA making the viral progeny non-infectious.
Design: A colocalized nucfease for HIV-1 gene therapy can be designed by genetically fusing a gene encoding a protein that colocalizes with the preintegration complex or virion to a gene encoding a nuclease.
Single chain antibodies (scFvs) can be used to colocalize nucleases with the preintegration complex to inactivate proviral DNA. Such nucleases will be referred to as scFv-nucleases. An scFv-nuclease can be designed by fusing a gene encoding an scFv to a gene encoding a nuclease.
HIV proteins can be used to incorporate nucleases into viral particles. Such nucleases will be referred to as packageable nucleases. Well characterized HIV proteins that can package nucleases into viral progeny include Gag, Vpr, Vpx, and
Nef. Although the Vif protein was originally believed to be packaged into virions, a recent study suggests otherwise (Dettenhofer and Yu, 1999). A packageable nuclease can be designed by genetically fusing a gene encoding a virion protein to a gene encoding a nuclease. This strategy was first demonstrated in the inhibition of transposition of the yeast Tyl element, whose replication resembles that of a retrovirus (Natsoulis and Boeke, 1991 ). Tyf capsid-nuclease fusion proteins were shown to be targeted to Tyl-virus-like particles and to degrade nucleic acid in vitro.
ScW-nuclease: The colocalized scFv-nuclease may be designed to become cornpartmentalized with a nucleoprotein complex by specific proteinlprotein interactions and subsequent inactivation of HIV proviral DNA. Such a strategy may allow inactivation of the incoming viral genome pnor to integration. Colocalization may be achieved by designing nuclease fusions with scFvs specific for HIV DNA binding proteins, like HIV IN proteins. The scFv of an antibody is the smallest structural domain which retains the complete specificity and binding site capability of the parent antibody (Cao and Suresh, 1998). One can denve scFvs from monoclonal antibodies produced by hybridomas (Denton et al., 1997). ScFVs may be isolated that bind to different domains of the IN protein. The application of scFvs would involve a bifunctional task in which binding of an ScW t~ a target antigen would allow colocalization of the nuclease to the site of cleavage. Since reverse transcription can already start in the virus, the preintegration complex may be partly made up of DNA dunng viral entry (Arts et al.,1994). Therefore, an scN fusion with a nuclease having both DNase and RNase activities, such as SN, may be ideal.
One study found that the intracellular production of anti-IN scFvs in PBLs specifically neutralizes IN activity (Levy-Mintz et al., 1996). This study dernonstrated that f undional, non-cytotoxic scFvs can be produced, Furthemore, scFvs localized to the nucleus (via fusion to an NLS) also inhibited HIV replication, indicating scFv- nucleases can be designed to cleave HIV RNNDNA within the cytoplasm and the nucleus (Levy-Mintz et al.,1 996). An scFv specific for the IN protein can be used to target a nuclease to a preintegrated HIV nucleoprotein complex and allow subsequent cleavage, preventing the host cell from acquiring the proviral DNA. This strategy should thus be effective in newly infected cells as well as in resting cells which may harbour extrachromosomal proviral DNA (Pischinger et al., 1998) that is normally invisible to the immune system and anti-HIV drugs.
Gag-nuclease: The HIV-1 Gag protein precursors are self-associating molecules specifically targeted to the site of virion assembly (Freed, 1998). The HIV-1 Gag protein is able to fom virus-like particles in the absence of other viral gene products.
In one study, the gag gene from the Murine Leukemia Virus (MLV) was genetically fused to the gene encoding SN. The Gag-SN fusion protein was shown to become incorporated into MLV virions and reduce their infectivity by degrading virion RNA
(Schumann et al., 1996). A minor steric effect also resulted in a loss in virion infectivity, suggesting that an aberrant structural phenotype of the heterochimeric viral progeny can prevent the next round of infection. This strategy was further extended by designing a Gag-RNase Hl fusion protein with a protease cleavage site between the MLV Gag and E. coli RNase Hl domains (VanBrocklin et al., 1997).
Cleavage at this site was shown in MLV particles, demonstrating the feasibility of designing a packageable nuclease in which the activation of the RNase is controlled by protease cleavage so that enzyme activity would be limited to within the virus and not within cells (VanBrocklin et al., 1997).
The Gag-GFP fusion protein containing the HIV-1 Gag domain and the 238 amino acid GFP (green fluorescent protein) domain was shown to associate with HIV-1 Gag suggesting that cellular routing of HIV-1 Gag was not affected by fusion to GFP
(Perrin-Tricaud et al., 1999). The HIV-1 Gag-B-galactosidase fusion protein was shown to assemble with native HIV-1 Gag precursors into viral particles (Wang et al.,
1994), demonstrating that foreign proteins could also be packaged by HIV. Thus, an
HIV Gag-nuclease fusion protein should be co-packaged with HIV and inhibit subsequent rounds of infection. To take advantage of the HIV RNA binding properties of NC, HIV Gag-nucleases should be designed by genetically fusing sequences encoding the nuclease dornain downstream of sequences encoding the
NC domain of the Gag precursor. This should allow for efficient cleavage of virion genomic RNA.
Since the HIV Gag protein has multiple essential functions (Freed, 1998), it is unlikely that HIV will came up with a viable escape mutant against Gag-nucleases.
The HIV-1 Gag also coassembles with HIV-2 Gag (Shimano et al., 1998). Thus, a
Gag-nuclease is expected to confer protection against a broad range of HIV-1 and
HIV-2 subtypes. The existence of infectious proviral DNA within the virion has been established (Arts et al., 1994; Ramezani et al., 1997). Therefore, the use of a nuclease such as SN with both RNase and DNase activities should be more effective.
VprNpx-nuckase: HIV-1 Vpr and HIV-2 Vpx proteins are incorporated in vinons
(Matsuda et al., 1993). Thus, Vpr and Vpx proteins can also be used to package nucleases into HiV particles. To evaluate this possibility, Vpr-SN and Vpx-SN fusion proteins were genetically engineered and tested for their abiiity to copackage with
HIV-1 and HIV-2 virions, respectively. When produced intracellulariy, Vpr-SN and
Vpx-SN fusion proteins were shown to be incorporated into HIV-1 and HIV-2 particles, respectively (Wu et al., 1995a). However, nuclease activity was not retained since HIV Pro inactivated the SN moiety. Thus, packageable nucleases must be designed using nucleases resistant to cleavage by HIV Pro. Susceptibility of the fusion nucleases to cleavage rnay be dependent on the colocalization of Vpr and Vpx with HIV Pro dunng and after viral assembly. Vpx can be packaged by HIV-
1 (Matsuda et a., 1993). Vpx-nucleases may, therefore, be used to inhibit both HIV-
1 and HIV-2 replication. Since Vpr has been shown to be packaged into HIV-1 and not HIV-2 (Wu et al., 1995a), this strategy may only be used for inhibiting HIV-1 replication. Also, Vpr and Vpx proteins only enhance infectivity and are not essential for HIV replication. Thus, escape mutants of HIV may emerge that prevent packaging of Vpr or Vpx protein, and thus copackaging of a Vpr- or Vpx-nuclease.
Nef-nuclease: The Nef protein is incorporated into viral particles and could thus be used to package a nuclease. Virion associated Nef was shown to be cleaved by the viral Pro between amino acids 57 and 58 (Chen et al., 1998). Mutational analyses of
Nef revealed that both myristoylation and an N-terminal cluster of basic amino acids were required for plasma membrane targeting and virion incorporation of Nef (Welker et a!., 1998). The virion association of Nef is strongly enhanced by
myristoylation and does not seem to require other HIV proteins as Nef could be efficiently incorporated into and cleaved inside MW particles (Chen et al., 1998).
Proteolytic deavage of the Nef protein results in the liberation of the C-terminal core domain from the membrane-associated N-terminal dornain (Chen et al., 1998).
Therefore, Nef-nucleases rnay be designed by genetically fusing sequences encoding the nuclease domain at the 3'4enninus of the nef coding region. The intravirion focalization of the C-terminal domain of the Nef protein is not known. This information is critical in predicting the usefulness of this strategy since the nuclease will need access to the genornic RNA in the virion core. Since the Nef protein only enhances infectivity in vitro (Bukovsky et al., 1997), HIV escape mutants may emerge that prevent packaging of Nef and thus copackaging of a Nef-nuclease. lmproved colocalized nucleases: Since scFvs derived from hybridomas are murine in origin, they may be immunogenic in humans. Combinatorial phage libraries may be used to select for high affinity human scFvs. A human scFv gene library may be constructed by heavy and light chah shuffling followed by selection of phage that bind to antigens immobilized on a solid support (Schier et al., 1996; Radar et al.,
1998). Protein design can also be used to build better packageable nucleases. A phage-based method could be used ta select for proteins with improved stability in a virion environment. For example, stabilized variants of RNase Tl were selected as follows: variants of RNase Tl were inserted into the gene-3-protein (g3p) of the phage head. Since a tight association between domains of g3p are required for infectivity, several cycles of in vitro proteolysis, infection and phage propagation were performed to enrich for phage resistant to proteolysis and thus hosting the most stable variants of RNase Tl. Three of ten RNase Tl variants were found to be significantly more stable than the wild type, This strategy can be used to select for packageable nucleases that are resistant to HIV Pro. The temperature, pH, solvent conditions and duration of proteolysis may be varied for selection of nucleases that would be active in the cytosol and virion.
HIV Gag- or Nef-based packageable nucleases may be designed with the minimum sequences required for myristoylation and plasma membrane targeting to minimize immunodominant epitopes. Altematively, humanized packageable nucleases may be developed by designing therapeutic genes encoding fusion proteins with both the packaging and the nuclease domains of human origin. Cyclophillin A (Endrich et al.,
1999) and MAPK (mitogen activated protein kinase) (Jacque et al., 1998) are two cellular proteins that are incorporated into virions. Also the human RNases, EDN and ECP, were shown to have antiviral activity against enveloped single stranded
RNA virions in vitro (Domachowski et al., 1998a; Domachowski et al., 1998b) and could thus be used to construct packageable nucleases. iii) Cytotoxic nucleans
Definition: A cytotoxic nuclease is defined as a nuclease which will kill an HIV- infected cell so that viral spread will not occur. Cytotoxic nucleases can be designed to be produced intracellulady in infected cells, Alternatively, they could be designed to be secreted and taken up by infected cells via specific cell targeting.
Design: Cytotoxic nucleases are designed to cleave essential host RNAs in HIV- infected cells. Thus, intracellular cytotoxic nucleases must be produced inside infected cells, while secreted cytotoxic nucleases must be secreted from a producer cell and targeted to HlV-infected cells. The gene encoding the intracellular cytotoxic nuclease rnust be designed to be switched on if the genetically modified cell becornes infected. On the otherhand, the secreted cytotoxic nuclease must be genetically engineered to contain a protein domain which allows specific targeting and internakation into HIV-infected celfs. In both cases, the cytotoxic nuclease may inhibit translation by cleaving host RNA in infected cells, thereby confemng specific cell death. lntracellular cytotoxic nuclease: Nucleases have been shown to exhibit cytotoxic effects in the cell (Rybak et al., 1991; Wu et al., 1995b) and cm, therefore, be used to confer cytotoxicity to HIV-infected cells. An intracellular cytotoxic nuclease should be produced and be cytotoxic in cells that become infected, thus destroying potential reservoirs of viral production. The feasibility of this approach has previously been demonstrated in a 'suicide' gene therapy strategy in which intracellular production of diptheria toxin selectively killed HIV-1 infected cells (Harrison et al., 1991).
Production of this gene product was regulated by HIV-1 Tat and Rev proteins and thus restncted to infected cells only (Harrison et al., 1991).
Various RNases have been also shown to be toxic to human cells and rnay be used to develop intracellular cytotoxic nucleases. Onconase from Rana pipens oocytes, which is homologous to RNase A, conferred cytotoxicity to glioma cells via degradation of 28s and 18s rRNA (Wu et al.. 1993). RNase activity appears to be essential for cytotoxicity since a non-active fom was 100 fold less cytotoxic (Wu et a/., 1993). RNase A is less cytotoxic than Onconase. This may be due to the binding of PR1 (placental RNase inhibitor), a 50 kDa RNase inhibitor (Lee et al.,
1988). On the otherhand, Onconase is resistant to PR1 and another RNase inhibitor, Inhibit-Ace. Angiogenin, BS-RNase and eosinophilderived neurotoxin have low Ki values for PR1 (Shapiro and Vallee, 1991 ; Kim et al., 1995). These nucleases may therefore prove to be better than those which can be inactivated in the cell.
Secreted cytotoxic nuchan: The object of using a secreted cytotoxic nuclease is to eliminate HIV-infected cells. Unlike intracellular cytotoxic nucleases that employ a self-destructive mechanisrn, secreted cytotoxic nucleases are designed to destroy the HIV-infected target cell and not the cell they are produced in. A cytotoxic nuclease, secreted from a producer cell, would function by binding specifically to the infected cefl, becoming internalized and causing ceH death. Thus, the fusion protein would contain a cell targeting domain and a nuclease domain. CelI targeting rnay be achieved by genetically engineering a secreted cytotoxic nuclease to contain an scFv domain specific for surface antigens present on HIV-infected cells.
The feasibility of secreted cytotoxic nucleases has been demonstrated in cancer therapy using recombinant RNase fusion proteins exhibiting cell-type specific cytotoxicity. For example, the gene for an scFv that recognizes the human transferrin receptor was fused in frame to the gene encoding angiogenin, a hurnan homologue of pancreatic RNase. The chirneric protein produced was shown to bind to the transfemn receptor, to retain RNase activity and to selectively kill human tumor cells containing high levels of the transfemn receptor (Rybak et al., 1992; Newton et al., 1996)-
Secreted cytotoxic nucleases and immunotoxins rnay fall under a larger class of cytotoxic molecules designed to specifically kill HIV-infected cells. The design of irnmunotoxins is based on a principle similar to the one used to develop secreted cytotoxic nucleases. The toxic rnoieties of immunotoxins are toxins denved frorn bacteria and plants. Toxins used to date inciude ricin, pseudornonas exotoxin A and diptheria toxin (Lacy and Stevens, 1998). The immunotoxin CD4-PE40, containing the CD4 domain and the toxic domain of pseudomonas exotoxin A, selectively killed
HIV-infected cells in vitro; however, it failed to exhibit the same specificity when injected in patients, It also caused toxic side effects even at very low doses (Davey et al., 1994). Furthermore, the duration of treatment was limited by an immune response (Davey et al., 1994). Since nucleases can be of mammalian ongin, a secreted cytotoxic nuclease should be less immunogenic. Furthermore, systemic delivery via gene therapy should altow for stable, continuous and sufficient production of the therapeutic gene product in viva, obviating the need for patient compliance.
Amongst HIV antigens, only the HIV Env protein is a specific cell surface marker of infected cells. As the viral core enters the cell, gp41 rernains intact on the cellular membrane, thereby marking the infected cell during viral entry, while gp120 is readily shed (Thali et al., 1992). Thus, gp41 alone is a marker of infected cells at both eariy and late stages of viral replication.
Interestingly, when certain RNases of the RNase A superfamiiy are added to in vitro cultures of HIV-infected cells, some viral inhibition is obsewed (Youle et al., 1994).
BS-RNase and Onconase were shown to modestly inhibit HIV replication in infected cells while rernaining non-toxic to uninfected cells (Saxena et al., 1996). In the absence of a targeting domain, it appears that HIV particles may have carried the
RNase into the target cell where it can efficiently degrade viral andor cellular RNA.
For a secreted cytotoxic nuclease to cause cell death, it must be intemalized and delivered to the cytosol of the infected cell. This was demonstrated by targeting pokeweed antiviral protein (PAP) to CD4+ cells by conjugating it to monoclonal antibodies reactive with C05, CD7 or CD4 protein on the cell surface. The anti-HIV potency of the conjugated PAP protein was increased by up to 1,000-fold in HIV- infected CD4+ cells (Zading et al., 1990).
The ability for an immunotoxin such as CD4-PE to kill a cell suggests that the gp120fgp41 complex allows intemalization and access to the cytosol. However, the gp41 transmembrane protein may be a better target for a secreted cytotoxic nuclease since soluble gp120 shedded from the virus and the infected cells may inhibit the binding of nucleases targeted to gp120. Studies have found that the cytoplasmic domain of HIV-1 gp41 has an intemalization motif (RQGYSPL) (Rowell et al., 1995). This motif is similar to those found in the cytoplasmic domains of certain cell surface proteins, such as the transfemn receptor that undergoes rapid constitutive endocytosis in clathrin-coated pits (Ohno et al., 1997). A highly consewed intemalization motif is also found within the cytoplasmic domain of HIV-2 gp41 (Egan et al., 1996). Mutagenesis of specific tyrosine residues results in significantly reduced rates of endocytosis of the HIV-1 Env protein (Egan et al.,
1996). Since the cytoplasmic domain of gp41 alone can confer the ability to undergo intemalization in the absence of other HIV proteins, a secreted cytotoxic nuclease targeting gp41 should be sequestered into the infected cells eariy during the viral life cycle. This strategy should also be effective against latently infected cells harbouring the proviral DNA. Thus, reservoirs of infected cells may be killed before subsequent rounds of infection are initiated. lmproved cytotoxic nuckases: Protein design and selection strategies can be used to build better cytotoxic nucleases. For intracellular cytotoxic nucleases, residues can be mutated to diminish an interaction with a putative cellular protein such as PR1 (Kim et al., 1995). hkmmalian cytotoxic nucleases should be sought to lower the immunogenic potential. Libraries of phage displaying peptides cm also be screened for secreted cytotoxic nucleases having better binding affinities to a receptor. As already discussed, combinatonal phage libraries can be used to select for high affinity human scFvs (Schier et al., 1996; Radar et al., 1998). In one study, an scFv was obtained with a five to six fold higher affinity cornpared to antibodies produced from mouse hybridoma cell lines generated with the same antigen (Schier et al., 1996). Such high affinity scFvs will have lower dissociation constants and thus be present on the cell surface for longer periods of time. With regards to secreted cytotoxic nucleases, the use of human scFvs with lower dissociation constants should allow for higher intemalkation efficiencies. The best scFv will be the one directed against a well conserved, neutralizing, immunorecessive epitope.
This would allow protection against a broad variety of subtypes of HIV-1 and HIV-2, and minimize any cornpetition for the receptor binding site with antibodies produced by the host immune response. Humanization of a cytotoxic nuclease can be achieved by humanizing the antibody, as stated above, and also using a cytotoxic nuclease of human origin (Rybak et al., 1992).
C. Target Cella foi Intmcellular and Systemic Delivery
The therapeutic gene should not only allow inhibition of HIV replication but also the eventual reconstitution of a healthy immune system. Thus, al1 cell types susceptible to infection should be protected by the therapeutic gene product. These cell types are pnmarily derived from the hematopoietic stem cells (HSCs) and circulate within the peripheral blood and lymphatic system. The population of cells that need to be genetically modified will depend on the type of nuclease-based strategy employed. i) Intracellular ddivery via PBb and HSCs: When the therapeutic gene is designed to protect the cell it is expressed in, al1 ceff types susceptible to infection must be transduced to campletely inhibit the spread of the virus. Ex-vivo transduction of human PBLs will mainly allow protection of a subpopulation of T- lymphocytes and macrophages/monocytes. However, HIV infection also results in the destruction of other cell types, like the dendritic cells and brain microglial cells
(Patterson et al., 1998; Warren et al., 1996; Strizki et al., 1997). In contrast, human
HSCs do give rise to al1 cell types susceptible to HIV infection. Their pluripotential, differentiative capacity and ability for self-renewal make them an ideal target for therapeutic gene transfer (Gervaix et al., 1997). Delivery of the therapeutic gene into this single population of cells should, upon differentiation and proliferation, give rise to a population of mature progeny cells that have acquired the therapeutic gene.
The primary source of HSCs include bon8 marrow, peripheral biood and umbilical cord blood Nang et al-, 1997; Gardner et al., 1998; Huang et al., 1998).
Autologous cells may be obtained in the early stages of infection when the percentage of infected cells is low. Allogeneic cells may also be used from healthy, uninfected donors; however, strategies must be developed to minimize the host immune response to a foreign cell source. Altematively, ceil lines of HSCs may be used. Human embryonic stem cell lines could be proliferated in vitro for up to five months and still give rise to gut epithelium, cartilage, bone, smooth muscle, striated muscle, neural epithelium, embryonic ganglia, and stratified squamous epithelium
(Thomson et al., 1998). Pluripotent stem cell fines will offer a significant advance in
HSC gene therapy. ii) Systemic delivery vla producer celb: Gene therapy for HIV may also be implemented by allowing in vivo spread of the therapeutic gene product to the infected cells. This may be achieved by systemic delivery of the therapeutic gene product to al1 sites of infection from a small population of irnplanted, autologous producer cells. Producer cells rnay be derived frorn myoblasts and f ibroblasts, since they are not susceptible to infection and stimulate little or no immune response.
Genetically rnodified myoblasts implanted in the forelimb of a mouse were shown to alfow the systemic delivery of ScWs for several months (Noel et al., 1997). The same study demonstrated that other cell types that are amenable to autologous transplantation, like skin fibroblasts and hepatocytes, are also capable of secreting
ScFVs in vitro (Noel et al., 1997). The secreted ScWs were able to bind efficiently to their antigen, suggesting that the proper folding mechanism is availabfe in cells other than plasmocytes. This study suggests that it may also be possible for scFv fusion proteins to be secreted by non-6 cells. Exocrine organs such as the pancreas and liver can also be used to produce and secrete the therapeutic gene product into the blood. The therapeutic gene product, if small enough, will diffuse into the lymphatic system and home into the lymph nodes (Reichel et al., 1976). Also, since the Langerhan cells can migrate from the skin through the lymph vessels and to the lymph node, genetic modification of Langerhan cells in the skin cm allow for locxtlization of the therapeutic gene product to the lymph nodes (Becker, 1996). D. Gene Delivery and Expression
Since blood tissue is amenable to manipulations ex vivo, gene therapy for HIV can be camed out ex vivo. This involves isolation of autologous or allogeneic cells followed by their genetic modification. Genetically modified cefls are then transplanted into the patient. Retroviral vectors can allow for stable gene delivery, cell targeting, and long terni gene expression. These vectors are, therefore, widely used to deliver anti-HIV genes. Several retroviral vectors, including MLV-based vectors, can allow for therapeutic gene delivery into PBLs (Lodge et al., 1998; Sun et al., 1995); however human HSCs seem to be difficult to transduce because they are difficult to isolate and are quiescent (Karlsson, 1997). fi vivo delivery of the therapeutic gene into pluripotent HSCs via a retroviral vector requires that the stem cell be active, dividing, and not differentiating (Karlsson, 1997). The right environment and factors needed to foster these events ex vivo must be further elucidated for efficient gene delivery into pluripotent HSCs and not intermediate progenitor cells. Gene marking protocols in human HSCs result in less than 1% differentiated, gene-rnarked progeny cells in the peripheral blood (Dunbar et al.,
1995; Plavec et. al., 1996).
Stem cells have a low level of amphotropic receptors, which is part of the reason why they are poorly transduced by MLV-based vectors (Sabatino et al., 1997;
Thomsen et al., 1998; Von Laer et al., 1998). Specific targeting with high efficiency has been achieved using pseudotyped vectors. The vesicular stomatitis virus-G protein (Akkina et al., 1996; Sinclair et al., 1997) and gibbon ape leukemia virus Env protein (Movassagh et al., 1998) have been shown to improve transduction efficiencies of HSCs. However, since the receptors for these Env proteins are widespread, gene deiivery was not cell type-specific. Targeted gene delivery may be achieved by changing the extracellular SU domain of Env with a ligand or an ScFV that recognizes a specific cell surface receptor (Yajima et al., 1998). Fuïther advances in cell targeting should be signifiant since specific cell targeting will be a requirement for in vivo gene delivery into HSCs.
Altemativeiy, lentiviral vectors have been shown to transduce nondividing cells, obviating the need to find the right conditions for cell division. HIV-based vectors were shown to transduce activated CD34+ cells in GdGi phase, while MLV-based vectors failed to do so (Uchida et al., 1998). Most fascinating, was the ability of HIV- based vectors to mediate stable in vivo gene transfer into terrninally differentiated neurons (Naldini et al., 1996). In vivo gene therapy should provide a less invasive and cost effective treatment for HIV. Specific in vivo delivery of the therapeutic gene to al1 cell types susceptible to HIV infection rnay be achieved by using HIV-based replication-incompetent retroviral vector particles, since they would have the same tropism as HIV. HIV-based replication-competent, non-cytopathic vectors can be designed to achieve higher transduction efficiencies in vivo. However, since HIV does not infect al1 target cells, transduction efficiency will not be very high.
Furthemore, HIV-based vectois wiIl be subject to inactivation by preexisting neutralizing antibodies in infected individuals.
Once the gene has been delivered, gene expression must be maintained throughout the treatment at adequate levels in appropriate cell types. The proviral DNA canying the therapeutic gene may be genetically or epigenetically inactivated, once inserted into the host cell chromosome. Genetic phenomena include proviral DNA rearrangements or deletions, while epigenetic phenornena include suppression of therapeutic gene expression resulting from differential utilization of identical DNA sequences. Oierential utilization will be dependent on the chromosomal environment of the therapeutic gene. Euchromatin contains transcriptionally active genes, while heterochromatin is more condensed and therefore is transcriptionally inactive (Clark, 1993)- Maintenance of stable gene expression may require the design of retroviral vectors capable of targeting the therapeutic gene to specific regions of the chromosome that remain transcriptionally active during cell differentiation and proliferation. Further advances in the area of developing site specific integrases will be needed (Schubeler et al., 1998; Tanaka et al., 1998; Katz et al., 1996). Also, the discovery of locus control regions (LCRs) which insulate promoters from position effects can allow for position-independent gene expression
(Raftopoulos et al., 1997; Fraser, 1998).
The retroviral vector can be designed to be HIV Tat- andlor Rev-inducible so that the therapeutic gene product is only manufactured if the cell becomes infected. This can be accomplished by designing, within the retroviral vector, elements that allow
HIV Tat- andior Rev-inducible production of the therapeutic gene product. Tat- inducible gene expression can be achieved by using the HIV LTR promoter or heterochimeric promoters containing the HIV TAR element (Weerasinghe et al.,
1991; Robinson et al., 1995). Rev-inducible production of the therapeutic gene product may be achieved by designing, within the coding region of the therapeutic gene, instabifity elements (INS) and the RFIE (Mikaelian et al., 1996). INS sequences decrease mRNA stability, whereas the binding of HIV-1 Rev to the RRE overrides this negative effect and increases the half-life of the transcripts produced, making the gene product Rev-inducible (Mikaelian et ai., 1996). MLV-based retroviral vectors allowing Tat- and Rev-inducible gene expression have been constructed (Harrison et al., 1992; Liem et al., 1993). HIV-based retroviral vectors were also designed to allow Tat- and Rev-inducible production of the therapeutic gene product (Cam et al., 1998). Tat- and Rev-inducible gene expression drarnatically reduces basal expression and limits the therapeutic gene expression to
HIV-infected cells. Tightly controlled production also prevented cytotoxic effects by the protective proteins (Cara et al., 1998). Thus, inducible production of intracellular cytotoxic nucleases should allow the cell to evade cytotoxic effects, if any, prior to
HIV infection. Altematively, the therapeutic genes may be expressed constikitively depending on the nuclease-based strategy used. i) Expression of gencrs encoding targeted nuckases
Genes encoding targeted nucleases, which are designed to downregulate the HIV gene product post-integration, will have to be expressed once the cell is infected.
100% downregulation is an overwhelming task. Hypothetically, an infinite loop of cornpetition may occur between the therapeutic gene product's ability to downregulate the HIV gene product and the HIV gene product's ability to overcome the downregulation since vital transcription will still continue.
Targeted nucleases designed to cleave HIV TAR, RRE or the Y signal must be maintained at sufficient inhibitory levels to prevent gene expression andior production of infectious virai progeny. Targeted nucleases designed to cleave the
TAR element may be more effective, since TAR RNA interaction with HIV Tat protein is required for trans-activation of HIV gene expression (Li et al., 1998). A reduction in HIV Tat mRNA level should also decrease the amount of Tat protein available for transactivation. ln contrast, targeted nucleases designed to cleave RRE and Y signal may have to be produced at higher levels since viral transcription will continue.
Since a fat-nuclease is designed to cleave TAR RNA and prevent the production of early gene products like Rev, it cannot be produced in a Rev-inducible manner. A
Tat-inducible gene encoding a Tat-nuclease would also be ineffective since it would be self-inhibitory. A gene encoding a Rev-nuclease cannot be Tat-inducible since it should be able to cleave the primary HIV transcripts before they enter the splicing pathway, thus inhibiting the production of eariy gene products like fat- Rev- inducible of a gene encoding a Rev-nuclease would also be ineffective since it would be self-inhibitory. Thus, genes encoding a Tat-nuclease or Rev- nuclease cannot be designed to manufacture the therapeutic gene product in a Tat- and/or Rev-inducible manner and must, therefore, be expressed in a consitutive manner. On the otherhand, the production of an NC-nudease can be either Tat- andor Rev-inducible since it is designed to cleave HIV genomic RNA while allowing the production of eariy gene products, like HIV Tat and Rev. ii) Expression of -ne$ encoding colocalûed nucleases
The mechanisrn of inhibition of coblized nudeases is not very demanding in contrast to targeted nudeases which must act perpetually to downregulate HIV gene products at a post-transcriptional level. An scFv-nuclease designed to cleave HIV proviral DNA within the pre-integration complex should, therefore, be effective at cornpletely inhibiting virus production. The number of integration events are likely to be finite, since oniy a limited number of viral particles can enter a cell and get reverse transcribed. Thus, the scf\/-nucleases need only inactivate a finite number of preintegration complexes for 100% inhibition of viral replication, until the cell encounters another virus. Colocalized nucleases designed to cleave incoming proviral DNA should, therefore, be produced constitutively so that the therapeutic gene product would be present at the time of viral entry.
Packageable nucleases are designed to produce non-infectious viral progeny. The number of viral progeny produced per infected cell should also be a finite, since the amount of cellular plasma membrane available for viral budding may be limited.
Thus, packageable nudeases need only b8 incorporâted and be active in al1 budding viral particles for 100% inhibition of subsequent rounds of infection. This strategy can potentially disarm al1 viral prageny produced fmm the infected cells and, therefore, contribute significantly to decreasing viral loads. The packageable nucleases should not be produced in uninfected cells. Thus, the therapeutic gene product should be manufactured in a Tat- andor Rev-inducible manner. This can be achieved with
Gag-nuclease fusion proteins since the Rev-response is nonnally required for stability of the HIV Gag transcript (Smythe et al., 1994; Schwartz et al., 1992). Thus, production of the Gag-nuclease fusion gene can be induced in the presence of HIV
Rev and synchronized with wild type production of HIV-1 Gag for efficient heterochimeric assembly and virion inactivation. Therapeutic genes designed to produce packagable nucleases based on Vpu, Vpr or Nef should also be produced in a Tat- and/or Rev-inducible manner. iii) Expression of genes encoding cytotoxic nucletases
An intracellular cytotoxic nuclease is designed to kill the cell once it is infected and therefore must be produced in a Tat- and Rev-inducible manner. The production of the intracellular cytotoxic nuclease can be achieved such that cell death would occur before viral production ensues, thus inhibiting subsequent rounds of replication.
There will have to be stringent requirements on the regulation of gene expression since any basal level expression may kill the cell prior to infection. During vector particle production, strategies must also be designed to avoid any cytotoxicity ta the packaging cell lines.
A secreted cytotoxic nuclease can be constitutively secreted, while the infection persists. Secreted cytotoxic nucleases must contain a signal sequence for targeting into the endoplasmic reticulum so that these nucleases can be routed to the cell surface via the Golgi cornplex (Komada, 1997). Secreted cytotoxic nucleases must be delivered at appropriate physiological concentrations to achieve an inhibitory effect. This can be modulated by the number of transduced producer cells that are transplanted.
E. Reconstitution of a Healthy Immune Systern
In the case of PBL gene therapy, the therapeutic gene is delivered into a subpopulation of mature progeny cells. Since these cells are not self-renewing and will have a finite life span, PBL gene therapy will require repeated cycles of transduction and transfusion until viral loads are sufficiently diminished and the immune system is sufficiently reconstituted with healthy cells. In contrast, since
HSCs can self-renew, the delivery of the therapeutic genes into these cells should not require repeated cycles of transduction and transfusion, although feasible.
Unless al1 cells susceptible to infection can be transduced, the eventual reconstitution of a healthy immune system will require that genetically modified cells have a selective suivival advantage over untransduced cells. Given that HIV will kiII the untransduced cells, natural selection of transduced celfs containing genes confemng resistance will happen in vivo. Once the viral load begins to decrease, repopulation of uninfected transduced and untransduced cells would result in eventual reconstitution of a healthy immune system. In contrast, for genes confemng negative selection, the immune system would have to be populated with a higher proportion of transduced cells. These cells could sewe to reduce viral load over time, resulting in the eventual reconstitution of a healthy immune system.
Since gene therapy may likely be applied to patients already on anti-HIV dnig therapy, a low viral load (maintained by anti-HIV drugs) may not constitute enough of a selection pressure on transduced cells. Thus, for gene therapy strategies conferring positive and especially negative selection, the proportion of transduced cells will have to be increased by additional selection in vivo (Sorrentino et al., 1992).
A recent study demonstrated that upon transduction of murine stem cells with the antifolate resistant DHFR gene and in vivo diug selection, transplanted mice were repopulated with a significantly increased percentage of vector expressing peripheral blood erythrocytes, platelets, granulocytes, and T and B lymphocytes (Allay et al.,
1998). Furthemore, transduced cells were detected in the bone marrow, spleen, lymph nodes and thymus (Allay et al., 1998).
Systemic delivery of the therapeutic gene product is achieved frorn producer cells such as myoblasts or fibroblasts that are not susceptible to infection. Thus, selection criteria are not required for such strategies which do not require in vivo spread of the genetically modified cells, but rather in vivo spread of the therapeutic gene product. i) Reconstitution udng targeteâ nuckases
A targeted nudease-based strategy shouid confer protection to the genetically modified cells Mile alMng maintenance of normal cellular function. Thus, positive selecoion of protected, functional cells will take place until viral loads are suffiienüy diminished.
Maintenance of nom1 cellular functions will depend on the step(s) in the viral life cycle the therapeutic gene is designed to inhibit. The level of cytotoxicity will be directly proportional to the passaging of the viral life cycle that is allowed in the transduced cell, and most pronounced if viral gene products appear and viral progeny begin to assemble. A targeted nudease-based strategy may be used in PBL or HSC gene therapy. Tat and Rev-nudeases will allow selective destruction of viral
RNA early in the virai life cyde. An NCiiuclease, on the other hand, will still allow production of eariy and some late gene products which may be toxic to the cell. Thus, a therapeutic gene designed to inhibit eady stages of the viral life cycle may be preferred over those designed to inhibit the later stages of the viral Iife cycle. ii) Reconstitution udng colocalized nuclsamr
An scFv-nuclease, designed to inhibit HIV replication before integration, is ideal since it will prevent the acquisition of proviral DNA by the host ceIl and allow the maintenance of normal cellular functions. Thus, an scFv-nuclease can be used in
PBL and HSC gene therapy. Consequently, the immune system will be reconstituted with a population of transduced cells facking proviral DNA until viral loads are sufficiently diminished for reconstitution by healthy cells. A packageable nudease cm be used in PBL and HSC gene therapy. This stmtegy
involves interference at the late phase of the viral life cyde, rendeflng the pmgeny virus
produced from the geneücaily modifieci celis non-infectious. Packageable nudeases can
potentially inhibit viral replication very effectively, especialiy in chronicaliy infected cells.
However, the geneticaliy modified cells that do bewrne infected may not function
nomally because production of viral proteins is stilf aflowed. This strategy may, thus, confer negative seledion to the infected celis by inhibing normal cellular functions.
Thus, PBL gene therapy will require repeated cycles of transduction and transfusion to decrease the viral load incrementalfy. Reconstitution of the immune system with healthy cells will take place once viral loads are sufficiently diminished. HSC gene therapy will
require a significant proportion of total HSCs to be transduced. Only then, will the
immune system be continuously repopulated with a sufficient amount of genetically modified cells to reduce viral load. iii) Reconstitution using cytotoxic nuclsases
Since intracellular cytotoxic nucleases are designed to catalyze the self-destruction of infected cells, this strategy clearly results in negative selection of the genetically rnodified cells. PBL gene therapy may be considered for this strategy but will require repeated cycles of transduction and transfusion to decrease the viral load incrementally. Like in the case of a packageable nuclease strategy, HSC gene therapy using intracellular cytotoxic nucleases will also require a signif icant proportion of the total HSCs to be transduced to allow reconstitution of the immune system with mainly genetically modified cells to decrease viral load. For secreted cytotoxic nucleases, transduced producer cells will secrete the therapeutic gene product. Only a limited number of transduced producer cells should be required to provide the continuous and regulated in vivo production of the therapeutic gene product. This strategy relies on in vivo spread of the fusion protein to infected cells rather than in vivo spread of the genetically modified cells. Thus, reconstitution of the immune system will take place once the viral load is sufficientfy diminished.
G. Thesis Objective
The objective of this study is to develop retroviral vectors expressing genes encoding a targeted and packageable nuclease for HIV gene therapy. The packageable nuclease of interest is an HIV Gag-nuclease, called Gag-RNase Tl (Fig. 2). The fusion protein mutant Gag-RNase Tl has an inactive RNase Tl dornain and will also be tested to evaluate the inhibition of HIV replication achieved by RNase activity
(Fig. 2). It is proposed that the Gag-RNase Tl fusion protein will CO-packagewith
HIV virus particles and inhibit virus replication via cleavage of virion RNA. Mutant
Gag-RNase Tl is also predicted to inhibit HIV replication by sterically inhibiting the formation of infectious progeny. The targeted nuclease of interest is a Tev-nuclease called Tev-RNase Tl (Singwi et al., 1999; see Appendix A).
RNase Tl is a 104 amino acid extracellular enzyme from A. oryizae which catalyzes the hydrolysis of single stranded RNA via a 2-3' cyclic guanosine phosphate intemediate forming 3' guanosine phosphate nucleotides and oligonucleotides
(Osterman and Walz, 1978). Glu58, the general base, His92, the general acid, and
His40 the cationic residue involved in the stabilization of the anionic intermediate, participate in the two step mechanism of fmns-esterïfication followed by hydrolysis by Hz0 (Heinemann and Saenger, 1983).
Retroviral vectors: Retroviral vectors based on MLV can be used to test the feasibility of Gag-RNase Tl for inhibiting HIV replication. The retroviral vector used in this study is the Moloney murine leukemia virus-based retroviral vector, MofiN
(Joshi et al., 1991 ), which expresses the selectable marker neophosphotransferase under control of the HSV WTAR heterologous promoter. Viral genes gag, pu/ and env have been removed and the therapeutic gene can be doned downstream of the selectable marker under control of a second intemal promoter. The retroviral vector contains al1 the cis-acting sequences necessary for the production, packaging, reverse transcription and integration of vector RNA. The 5' LTR contains the necessary sequences for RNA Polymerase II mediated transcription. Imrnediately downstream of the 5' LTR is the PBS which along with the PPT, located upstream of the 3' LTR, are utilized in reverse transcription. Further downstream of the PBS is the Y signal which allows encapsidation of the viral RNA into virions. The 5' LTR and 3' LTR contain the necessary recognition sequences for integration. The vector construct can be transfected into a packaging cell line, which produces al1 of the viral proteins in tram Since only the vector RNA would contain the Y signal, it would be packaged by the viral proteins to generate the retroviral vector particies. These vector particles could then be used to infect the target cells allowing stable transduction of the therapeutic gene of interest (Fig. 3).
Expression of the gagRNam Tl (gtl) gene: AU-rich inhibitory sequences within the ~17~~and ~24~~coding regions decrease Gag mRNA stability (Schneider et al., 1997). The binding of Rev to RRE has been shown to override this negative regulation and increase the half-life of Gag transcripts (Schwartz et al., 1992). In addition, the Rev response will also allow for efficient export of Gag transcfipts to the cytoplasm and to promote polysome formation during translation. Thus, the Gag-
RNase Tl fusion protein should be produced efficiently in a Rev-inducible manner.
Studies have also shown that human cells contain the necessary mechanisms to replace Rev function (Bray et al., 1994). A 240 nucleotide-long cieacting constitutive transport element (CTE) from the Mason-Pfizer Monkey Virus (MPMV) has been shown to allow efficient export and translation of the Gag transcript in the absence of Rev and RRE in MT4 cells (Bray et al., 1994). The CTE may substitute
Rev function by tapping into a normal cellular pathway (Pasquinelli et al., 1997).
Thus, the Gag-RNaçe Tl fusion protein should be produced efficiently in a constitutive manner. Figure 2. GagilRNam Tl and mutant Gag-RMse Tl fusion proteins
The Gag-RNase Tl and mutant Gag-RNase Tl fusion proteins were genetically engineered by fusing the RI gene or mutant rtl gene, respectively, downstream of the HIV-1 gag gene. Two of three amino acids within the active site of the RNase Tl domain were mutated to alanine for construction of the mutant Gag-RNase Tl fusion protein. The HIV-1 Gag domain is subdivided into the MA, CA, P2, and NC domains which are defined by HIV-1 protease cleavage sites. The HIV-1 pmtease cleavage site at the NC/RNase Tl and NC/mutant RNase Tl junction were deleted. e Tl fusion9 ~rotetns
RNase Tq domain
- Gag domain
Inactive RNase Ti domain
Figure 2 Figure 3. Gene cklivery uaing retroviral vectom
The retroviral vector has al1 sequences necessary for packaging, reverse transcription and integeration. On the other hand, the packaging cell provides al1 viral structural and enzymatic proteins needed to produce transducible vector particles. To increase the viral titres, two packaging cell lines are used in succession to make amphotropic vector particles. The first packaging cell Iine is the ecotropic Psi-2 packaging cell line and the second packaging cell line is the amphotropic PA317 packaging cell line. Re troviral ' veetor DNA
Ecotropic pac kaging ceii line
Ecotropic a ,~ransduction vector particles
Amphotropic packaging ceil Line , -;O0 .rr,-- Vector RNA
Amphotropic Transduction vector particles
Target celis
Figure 3 Chapter 2. Materî..sand Methods
A) Retroviral Vector Construction
Primer synthe8i8 and purifkatien: Primers were synthesized by HSC Biotech
(University of Toronto) (Table 1). Plasrnids and cell lines used are also listed (Table
II). Primers were purified from an 8% polyacrylamide 8M urea gel containing a 29:1 accylamide:bis ratio, 1X TBE buffer (diluted from 5X stock: 54 g Tris base, 27.5 g boric acid and 0.01 M EDTA [pH 8 -01 and distilled water to 1000 ml), 1% v/v APS
(amoniurn persutfate) and 0.1 % v/v TEMED (N,N,N',NY-tetramethylenediamine). The gel was stained with bromophenol blue and the band was excised and crushed, resuspended in 100 pl of 10 % V/V SDS (soduim dodecyl sulfate), 300 pl H20 and vortexed overnight. Upon addition of 400 pl of phenol, the tube was vortexed for 15 min and centrifuged at 10000 x g for 5 min. The supematant was transferred to a fresh tube, 400 pl of chlorofom:isoamyl alcohol (24:l) added and sample vortexed for 30 sec. The tube was then centrifuged at 10000 x g for 5 min and the supematant precipitated with two volumes of ethanol and one-tenth volume of 7.5 M ammonium acetate.
PCR: For the purposes of punfying the PCR product for fuither subcloning, the PCR was done in a 50 pi reaction volume. Vent polymerase (New England Biolabs) or Pfu polymerase (Stratagene), which have 3-5' exonuclease activity, were used to minimize the number of mutations in the region amplified. The 50 pl reaction mixture using Vent polymerase contained 1X Vent buffer, 4 mM MgSOd, 0.2 mM Table I
Overview of ri mers
Not I 5TCTCTCTCCTGCGGCCGCGGGTCTCCCTATAGTGAGTCGTAT3'
Not I gag ORF + 5TCACTATAGGGAGACCCGCGGCCGCAGGAGAGAGATGGGTGC3'
BamH I wt CAC SAAACTGTTGGATCCMTTCTTACCCAGCCAAATACC3'
Xho I wt AAG SCATCACCGCTCGAGAGGATAGGCCACGCGTAGTAGGGAGAGCTCACAGAGAAATCAAAACCTr3' Overview of alasmids and cell lines
Plasmid or Cdl Type
Plasmid containing the rfl gene from A oryizae PSVCAT Plasmid containing the gag gene from NL4-3 strain of HIV-1 Pfasmid containing the transcription enhancer and promoter elements from the immediate-eariy gene of the human CMV Plasmid containing the HIV-1 ne and MPMV
cte--- seauences- - MoTiN MMLV-based retrwiral vector GTRC MMLV retrovirai vector containing the gtl gene, HIV-1 rns and MPMV cte sequences - GTR MMLV retrwiral vector containing the gtl aene and HIV-1 ne seauence GTC MMW retrwiral vector containina- the stl- prie and MPMV cte sequence MMLV retroviral vector containing the gtl qene pp MtGTRC MMLV retroviral vector contai5ngthepmt gtl gene, HIV-1 ne and MPMV cte sequences MMLV retroviral vector containing the mt gtl gene and HIV-1 ne sequence MMLV retrwiral vector containing the mt gtl gene and MPMV cte sequence MtGT MMLV retroviral vector containing the mt gtl gene Plasmid containing HIV-1 gag, pol, rev, and tat genes 1 HVP Plasmid containing HIV-1 5' and 3' LTRs, al1 HIV-1 cis-acting sequences and gag, rev and tat genes Psi-2 cell line Adherent ecotropic mouse f ibroblast packaging cell Iine PA317 cell line Adherent amphotropic mouse fibroblast packaging cell line MT4 cell line Suspension human CD4+ T-lyrnphoid cell line Adherent human kidney fibroblaC8ilIine Adherent He-La based cell Iine expressing HIV-1 gag, pol, tat, rev, vif and env qenes- in a tetra6ydine inducible manner dNTPs,approximately 11.5 prnols of the 5' and 3' primers respecüvely, approximately
0.05 pmols of tempiate DNA, 4 units of Vent polymerase and sterile water. The 50 pl
reaction mixture using Pfu polymerase contained 1X Pfu Buffer, 0.2 mM dNTPs, 100
ng of the 5' and 3' pnmers respectively, approximately 300 ng of template DNA, 5
units of Pfu polymerase and sterile water. The reaction mixture was overlaid with
40 pl of mineral oil and arnplified with a Perkin-Elmer Cetus Instruments DNA
Thermal Cycler. The steps for the PCR wen generally 95 OC for 1 min, 55 OC for 1
min, 72 OC for 1 min for 30 cycles. The annealing temperature was optimized between 50 OC and 61 OC in a IOpl small scale PCR while the extension time was
calculated as 1 min per 1000 base pairs (bp) of DNA using Vent polymerase and 2
min per 1000 bp of DNA using Pfu polymerase. The PCR product was then resolved on a 1% w/v agarose gel (0.25 pg/ml ethidiurn bromide) in 0.5X TBE running buffer for purification by electroelution.
Electroelution: The DNA sample to be purified was resolved on a 1Oh w/v agarose gel for 45 min at 80 V alongside an appropriate molecular weight marker. The gel was viewed under long wave UV Iight (365 nrn) and the band was excised from the gel with a blade. The PCR product was then electroeluted from the agarose band using electroelution. The agarose band was chopped into fine pieces and placed in a well of the electroelution apparatus. The apparatus was placed in a minitank containing elution buffer (0.02 M Tris-HCI [pH 8.01, 5.0 pM NaCl and 0.12 FM EDTA
[pH 8.01 and distilled water). Upon addition of 120 pi of 7.5 M ammonium sulfate into the tunnel of the electroelution apparatus, 70 V was applied for 30 min. The buffer in the well was then collected and added to two volumes of 95% ethanol and precipitated ovemight in an eppendorf tube. The eppendorf tube was centrifuged for
20 min at 11 000 x g and the pellet was resuspended in 10 pi of sterile water. Overlap PCR: A 1:1 ratio of agarose gel purified PCR products (having 20 bp of sequence complementarity) were combined in a second PCR using extreme 5' and extreme 3' primers. The PCR conditions were as above. However, annealing temperatures were optimized in a 10 pi small scale reaction mixture. The annealing temperature varied between 50 OC and 61 OC.
Site directed mutageneris: PCR was used to create site-directed mutations within the coding region of the desired gene (Ho et al., 1989). All sequence alterations were introduced within the synthetic primers. The primers were designed to contain restriction sites to permit subcloning. The primers were also designed with 20 base pairs of sequence complementarity for overiap extension by PCR. The overiap PCR was done in a 50 pi reaction mixture using 1X Vent buffer, 4 mM MgS04, 0.2 mM dNTPs, 500 ng of the 5' and 3' primers respectively, 4 units of Vent polyrnerase and sterile water. The reaction mixture was ovedaid with 40 pl of mineral oil and subject to the following cycles: 95 OC for 1min, 56 OC for 1min and 72 OC for 1min for 30 cycles. The PCR product was resolved on a 1% w/v agarose gel, electroeluted, ethanol precipitated and resuspended in sterite water for further manipulation.
Restriction enzyme digestion: Generally about 0.1 pmols of purified PCR DNA for cloning was digested in a 100 pl reaction mixture with the appropriate restriction enzyme at the optimal temperature (usually 37 OC for 3-4 hr). The reaction mixture contained no more than 10% v/v of restriction enzymes (10 unitdul), 1X restriction enzyme buffer and sterile water. In the case of double restriction enzyme digests the enzymes were first tested for their ability to digest in the same restriction enzyme buffer on a test plasmid by agarose gel analysis. If a single buffer, allowed for complete digestion the reaction was camed out in one step. If the restriction enzyme buffers were not compatible, the enzyme requinng the lower ionic strength buffer was added first. The reaction was allowed to proceed for 2-3 hr and the reaction product was ethanol precipitated and resuspended in sterile water. The digestion was continued with the second enzyme in the presence of the higher ionic strength buffer in a 100 pl reaction mixture. Since the ends of the PCR product are being cleaved, completion of digestion cannot be determined by agarose gel analysis. Thus, the completion of digestion was indirectly determined by transformation efficiency and agarose gel analysis of a test plasmid, which was digested in parallel. The reaction mixture was then heat inactivated at 85 OC, ethanol precipitated ovemight and resuspended in 10 CLJ of sterile water. About 0.7 pmols of plasmid DNA prepared from a maxipreparation was digested in a 50 pl or 100 pl reaction mixture, as above.
10 units of RNase Tl (Sigma) were added in the reaction mixture to remove RNA.
The digested products were resolved on a 1% wlv agarose gel. The bands of interest were then excised, electroeluted and ethanol precipitated.
Ligation: The ligation reaction was done with an excess of insert over vector DNA.
Generally the ratio of insert to vector DNA was 2:1. The reaction was carried out in
10 pl using 1 pl of T4 DNA ligase (Gibco BRL), and 2 pl of 5X ligation buffer, approximately 0.08 pmols of vector DNA and approximately 0.3 pmols of insert DNA and sterile water to 10 jd. A control ligation was done with the digested vector fragment alone to test for colonies resulting from vector religation or incomplete digestion. The ligation reaction was camed out at 12 OC ovemight.
Preparation of comptent cells and transformation: To prepare competent cells the glycerol stock was quickly thawed and streaked ont0 an LB agar plate (90mm) and incubated ovemight at 37 OC. The LB agar was prepared by adding 10 g of bacto-tryptone, 5 g of bacto-yeast extract, 10 g of NaCl and 15 g of agar to 950 ml of distilled water and autoclaving. One colony was inoculated overnight in 5 ml of LB medium, with shaking at 37 OC for 16 hr. The LB medium was prepared as the LB agar except no agar was added. The next moming 200 ml of LB containing 15 mM
MgCI2 was inoculated with the 5 ml ovemight culture, and incubation continued at
37 OC until the optical density at W)O nm (0.0.604 measured using the Biochrorn
Ultrospec II was 0.4 to 0.6. The 200 ml culture was centrifugeci at 850 x g at 4 OC for
20 min and the pellet was resuspended in 50 ml of Solution A (10 mM 2-N-
Morpholinoethanesutfonic acid [pH 6.31, 10 mM MnC124H20, 50 mM CaC12) and put on ice for 20 min. The cells were recovered by centrifugation at 850 x g at 4 OC for
15 min and resuspended in 8.5 ml of Solution A and 1.5 ml of glycerol and aliquoted in 1.5 ml eppendotf tubes on dry ice and stored at -70'~.
To transforrn the DNA of interest, the competent cells were thawed on ice and DNA was added to 100 jd of competent cells. The amount of DNA was usually 1-10 ng and the volume of the DNA would not exceed 5% of the volume of competent cells.
The mixture was then stored on ice for 30 min and heat shocked in a 42 OC water bath for 90 sec. The tube was then rapidly transferred to ice for 1-2 min. 500 pl of
LB was added to the tube and incubated at 37 OC for 1 hr with gentle agitation. Up to
200 pl of transfomed competent cells were transferred ont0 an LB agar plate and spread using a stenle bent glas rod. The plates were left at rwm temperature until the liquid was absorbed. then inverted and incubated ovemight at 37 OC for 16 hr.
Screening by PCR: To screen colonies for the correct clone by PCR, a subset of colonies were streaked and inoculated in 200 pi of LB containing the appropriate drugs in a 96 well plate for 12-16 hr ovemight. The next day the culture was
transferred to an eppendod tube, boiled at 100 OC to lyse the cells and centrifuged for
30 sec at 11000 x g. 1 pl of the supernatant was used in a 1O pi PCR containing 1
unit of Taq polymerase, 1X Taq buffer, 0.1 mM dNTPs and about 2.5 pmols of the 5'
and 3' oligonucleotides respectively. The reacüon mixture was overiaid with 20 pl of
mineral oil and amplified using the following cycles: 95 OC for Imin. 56 OC for Imin
and 72 OC for 1min for 40 cycles. The PCR product was then analyzed on a 1% w/v agarose gel.
Minipreparation procedure for extracthg pla8mM DNk Transformed colonies were inoculated in 5 ml of LB with 50 pg/ml of the appropriate antibiotic ovemight at
37 OC. Three ml of the culture was œntrifuged at 11000 x g for 2 min to recover the cells and the supernatant was aspirated completely. The pellet was resuspended in
100 pl of ice-cold Solution 1 (25 mM Tls-CI [pH 8.0). 10 mM EDTA [pH 8-01 and
50 mM glucose) by vortexing. Then 200 pi of freshly prepared Solution II (0.2N
NaOH, 1% w/v SDS) was added to the tube, inverted 5 times and stored on ice for 2 min. 150 pl of ice-cold Solution 111 (3 M potassium acetate, 11.5 % v/v of glacial acetic acid and sterile water) was added and the tube was vortexed gently in an inverted position and stored on ice for 3-5 min. The bacterial lysate was then centrifuged for 5 min at 11000 x g and the supernatant was transferred to a fresh tube. A phenol:chlorofom extraction was perforrned as follows. An equal volume of phenol and chloroform:isoamyl alcohol (24:l) was added to the supernatant, mixed by vortexing and centrifuged at 11 00 x g for 2 min in the microfuge. An equal volume of chloform:isoamyl alcohol (24:l)was then added to the supernatant in a fresh tube, mixed by vortexing and centrifuged at 11000 x g for 2 min. The supernatant was transferred to a fresh tube and two volumes of ethanol were added to precipitate the DNA. The tubes were stored at -20 OC for 1 hr and subsequently centrifuged for 20 min at 11000 x g. The supematant was removed by aspiration and the pellet was allowed to air dry for 10 min or vacuum dried for 2 min. The pellet was dissolved in 30 pl of sterile water and stored at -20 OC.
Maxipreparation procedure for extracthg plasmid DNA: Essentially a scaled up version of the above minipreparation procedure was used to extract plasmid DNA in sufficient amounts for further manipulation. 30 ml of LB medium containing about
50 pg/ml of the appropriate antibiotic was inoculated and incubated, with shaking at
37 OC ovemight The next day the cells were cdlected by centrifugation at 15000 x g for 3 min in a 30 ml screw cap tube. The supematant was aspirated and 2 ml of cold
Solution I was added to the dry pellet and mixed by vortexing. Then 4 ml of freshly prepared Solution II was added and the tube was inverted several times and stored on ice for 2 min. While on ice, 3 ml of Solution III was added and the tube was vortexed gently in an inverted position. The tube was then incubated on ice for 5 min and centifuged for 10 min at 15000 x g. The supernatant was then phenol:chloroform extracted as follows. Upon addition of 4.5 ml of phenol and 4.5 ml of chloroform:isoamyl alcohol (24:l)to the supematant, the tube was centrifuged for 3 min at 15000 x g. Then 9 ml of chloroform:isoamyl alcohol (24:l) was added to the supematant in a new tube and centrifuged for 3 min at 15 000 x g. Two volumes of ethanol were added to the supematant and the DNA was precipitated ovemight at -
20 OC. The next day the tube was centrifuged for 20 min at 11000 x g and the supematant was aspirated. The tubes were air dried for 15 min or vacuum dried for
5 min and aie pellet was resuspended in 1 ml of sterile water. CsClathidium bromick gradient prdumfor extracthg circular DNA: Closed circular DNA was isolatecl by CsCI-ethidium bromide gradients for use in mammalian cell transfections. A bacterial colony was inoculated in 10 ml of LB with 50 pglml of antibiotic and incubated ovemight, with shaking at 37 OC. The next day the 10 ml suspension was poured into 1 L of LB medium containing antibiotic and incubated ovemight (16 hr) at 37 OC. The cuiture was Vien poured into 500 ml centrifuge tubes and centrifuged at 1900 x g for 15 min. After centrifugation was complete the supematant was poured off and any residual supematant was aspirated. The pellet was then resuspended completely in 14 mi of TE containing 15 % w/v sucrose and transferred into a 250 ml erîenmeyer flask. 4 ml of 0.5 M EDTA (pH 8.0) and 2.25 ml of egg white lysozyme (freshly prepared in TNE buffer) were then added to the flask and incubated et 37 OC, with gentle shaking. After 30 min of incubation. 2.25 ml of
10% w/v SDS was added and incubation was continued for another 6 min. Then 6 ml of 5 M NaCl was added to the flask and placed in ice for 3 hr with gentle swirling every 30 min. The viscous pellet was then added to a 30 ml plastic centrifuge tube and centrifuged for 1 hr at 10000 x g at 4 OC. The supematant was transferred to a
50 ml conical tube and filled up with isopropanol and stored at -20 OC ovemight. The next day, the tube was centrifuged for 15 min at 1900 x g. The supematant was discarded and the pellet was allowed to dry by tuming the tube in an inverted position. The pellet was then resuspended in 9.4 ml TE (10 rnM Tris-CI [pH 81, 1 rnM
EDTA pH [8.0]), 11 .O g of CsCl and 100 pl of EtBr (10 mghl). The tube was centrifuged for 5 min at 1300 x g and the liquid phase was transferred to a 15 ml conical tube then centrifuged again for 5 min at 1300 x g. The liqiud phase was transferred to a quick seal tube, sealed, capped, placed into an ultracentrifuge and centrifuged at 55000 rpm ovemight. The next day, the tube was removed, punctured with a needle at the top and with a needle just below the second band from the top containing closed circuiar plasmid. With a 5 ml syringe the band was slowly removed
and poured into a 15 ml conical tube with the needle removed to prevent shearing of
the DNA. TE (pH 8.0) was added to the tube until the volume reached 5 ml. To
extract ethidiurn bromide, an equal volume of N-butanol saturated with 5 M NaCl
(dissolved in TE) was added and the tube was vortexed and centrifuged for 3 min at
850 x g. The top layer was removed and Yie extraction was repeated 4 more times.
Then two volumes of 95% ethanol were added, and the tube was stored at -20 OC
overnight. The next day the tubes were centrifuged for 15 min at 1900 x g. 7he
supematant was discarded and the pellet was washed with 10 ml of 70% ethanol and
centrifuged at 1900 x g for 10 min. The supematant was discarded, and the pellet was resuspended in 1 ml of sterile water. An aliquot of the DNA was then characterized by restriction enzyme digestion. The concentration of the DNA was determined by measunng the O.D.~?
Construction of the GT retroviral vector: The retroviral vector, GT, was constnicted by cloning the CMV-Gag-RNase Tl (cmv-gtl) cassette into the MoTiN retroviral vector downstream of the neo gene which codes for the selectable market neophosphotransferase. The cmv-gtl cassette was constructed using an overlap
PCR strategy as follows: The RNase Tl (dl)gene (A. oryizae) was amplified from the pA2Tl (Quass et al., 1988) template using the TlSKI 3' primer pair in a 50 pl reaction mixture using Pfu polymerase and the following cycles: 30 cycles, 95 OC 45 sec, 56 OC 45 sec, 72 OC 1 min 45 sec. The 365 bp PCR product was resolved on a
1% W/V agarose gel. The band was excised, electroeluted, precipitated with ethanol and resuspended in 20 pi of sterile water. The gag gene (NL4-3 strain) was amplified from the pSVCATGagAEnv (Ding et al., 1998) template using the Gag57Gag3' primer pair in a 50 pi reaction mixture using Pfu polyrnerase and aie following cycles: 30 cycles, 95 OC lrnin, 56 OC Irnin, 72 OC 2min 45 sec. The 1341 PCR product was resolved on a 1% wlv agarose gel. The band was excised, electoeluted, and precipitated with ethanol and resuspended in 20 pl of sterile water. The prornoter and enhancer elements form the immediate-early gene of the human CMV (CMV promoter) was amplified from the pCDM8 template (Invitrogen) in a 50 pl reaction using Vent polymerase and the following cycles: 30 cycles, 95 OC 1min, 56 OC 1min,
72 OC 1 min. The 703 bp PCR produd was resolved on a 1% wfv agarose gel. The band was excised, electroeluted and precipitated with ethanol and resuspended in
20 pl. The gag PCR product and Hl PCR product were combined in an overlap PCR using the CMVGagWT13' primer pair to arnplifiy the gtl gene in a 50 pl reaction mixture using Pfu polymerase and the following cycles: 30 cycles, 95 OC 1 min, 56 OC
1 min, 72 OC 3 min 30 sec. The 1706 bp PCR product was resolved on a 1% w/v agarose gel. The band was excised, electroeluted, ethanol precipitated and resuspended in 20 pl of sterile water. The PCR amplified CMV prornoter and gtl gene were combined in an overlap PCR using the CMV5'K13' primer pair in a 50 pl reaction mime using Vent polyrnerase and the following cycles: 30 cycles, 95 OC 1 min, 61 OC 1 min, 72 OC 4 min 40 sec. The 2409 bp PCR product was excised from a
1% W/Vagarose gel, electroeluted, ethanol precipitated and resuspended in 20 pl of sterile water.
The cmv-gag-rtl PCR insert was cut with Bgl II and Csp 451 simultaneously in a
25 pl double digest reaction mixture. The reaction mixture was heat inactivated, ethanol precipitated and resuspended in 10 pi of sterile water. A maxipreparation of the retroviral vector DNA, MoTiN, was prepared and digested with Cla I and BamH I in a 100 pl reaction mixture and resoived on a 1% whagarose gel. The 8527 base pair band was excised, electroleluted, ethanol precipitated and resuspended in 20 pl of sterile water.
The digested MoTiN fragment and cmv-gag-rtl insert were combined in a 10 pl ligation reaction. 5 pl of the reaction mixture was used in a transformation- The colonies were screened by PCR using the T1StK13' primer pair. Minipreparations of
DNA were further characterized by a 10 pl Sst I restriction enzyme digestion and
10 pl PCRs using the CMVSK13' and TlS/oligo 6 primer pairs. Three recombinants were identified and designated GT1, GT2, and GT3. The cfosed circular DNA conformation of the GT1 clone was isolated by CsCI-ethidiurn bromide centrifugation and characterized by Sst I restriction enzyme digestion.
Construction of the GTRC, GTR and GTC retroviral vectors: The GTRC retroviral vector was constructed using a tetrapartite ligation strategy using the EcoR VCla I fragment from MoTiN, the EcoR Who I fragment from GT1 and the Xho IIHind III digested rtl-ne and Hind IiVCsp 451 ne-cte PCR products.
The RI-rre PCR product was constructed by overlap PCR as follows: The rtl gene was amplified by PCR from the MoTiN-GT plasmid using the Tl S'/Tl 3'Notl primer pair to introduce a Not I site downstream of the RI gene in a 50 pl reaction mixture using Vent polymerase and the following cydes: 30 cycles. 95 OC 1 min, 56 OC 1 min,
72 OC 1 min. This site allows for easy excision and replacement of the gene. The
365 bp PCR product was resolved on a 1% wlv agarose gel. An extended HIV-1 rre sequence (Mann et al., 1994) was amplified by PCR using the pSV-gag-pol-rre- mpmv (Bray et al., 1994) ternplate and the RRESYRRE3' primer pair in a 50 pl reaction mixture using Vent polymerase and the following cycles: 30 cycles. 95 OC 1 min, 56 OC 1 min, 72 OC 1 min. The 504 bp PCR product was resolved on a 1% w/v agarose gel. Both bands were excised, electroeluted, ethanol precipitated and resuspended in 20 pi of sterile water. Boai PCR products were combined in a 50 pl overlap PCR using the 115'/RRE3' primer pair in a 50 pl reaction mixture using Vent polymerase and the following cycles: 30 cycles, 95 OC 1min. 56 OC 1min, 72 OC 1min.
The 869 bp RI-ne PCR product was resolved on a 1% w/v agarose gel, excised, electroeluted, ethanol precipitated and resuspended in 20 pl.
The PCR product me-cte was constnicted by overlap PCR as follows: The MPMV cte sequence was amplified by PCR from aie pSV-gag-pol-rre-mpmv template using the
MPMVS'/MPMV3' primer pair in a 50 pl reaction mixture using Vent polymerase and the following cycles: 30 cycles, 95 OC 1 min, 56 OC 1 min, 72 OC 1 min. The 283 bp
PCR product was resolved on a 1% w/v agarose gel. The band was excised, electroeluted, ethanol precipitated and resuspended in 20 pl. The cte PCR product and ne PCR product were combined in an overlap PCR to amplify the rre-cte sequence using the RREWMPMV3' primer pair in a 50 pl reaction mixture using Vent polymerase and the following cycles: 30 cycles, 95 OC 1 min, 56 OC 1 min, 72 OC 1 min. The 787 bp PCR product was excised from a 1% w/v agarose gel, electroeluted, ethanol precipitated and resuspended in 20 pi.
The Hl-ne PCR proâuct was double digested with Xho I and HInd III simultaneously in a 20 jd reaction mixture, heat inactivated, ethanol precipitated and resuspended in
10 pl of sterile water. The me-cte PCR product was double digested with Hind III and
Csp 451 in a 20 pi reaction, heat inactivated then ethanol precipitated and resuspended in 10 pl of sterile water. A maxipreparation of MoTiN DNA was double digested with EwR I and Ch I in a 100 pl reacüon mixture and resolved on a 1% wlv agarose gel. The 6967 base pair band was excised, electroeluted, ethanol precipitated and resuspended in 20 pl of sterile water. The GT retroviral vector was digested with EwR I and Xho I in a 100 pl reaction mixture and resolved on a 1% wlv agarose gel. The 3734 base pair band was excised, electroeluted, ethanol precipitated and resuspended in 20 pJ of sterile water.
All four fragments were combined in a 15 pl ligation reaction using about 0.1 prnols of each fragment. The ligation was Ehen transfomed and plated on LB agar wntaining
50 pg/ml of kanamycin and ampicillin. 45 colonies were inoculated in a 96 well microtitre plate in 200 pl LB mntaining 50 pgml kanamycin and ampicilin and incubated ovemight at 37 OC. The cultures were subsequently screened by PCR using the GagS'lGag3' primer pair and further characterized by PCR using the
CMVS11MPMV3', CMV5'/T13'Notl, Tl5'/RRE3', Tl5'/MPMV3', oligoC/CMV3' primer pairs. Two recombinants were identified and designated GTRCl and GTRC2.
The GTRC1 clone was digested and religated to make the GTR and GTC retroviral vectors using Sfi I and Bcl I restriction enzymes, respectively. A maxipreparation of the GTRC1 clone was made using SCSlOl (Adam) competent cells (Stratagene) since Bel I is sensitive to dam methylation. Approximately 1 pg of the maxipreparation was digested in 50 pl reaction mixtures. The products were excised from a 1Oh w/v agarose gel, electroeluted, ethanol precipitated and resuspended in
20 pl of stenle water. Two microlitres of the digested DNA was used in a 10 pl ligation reaction to religate the cohesive ends. Transformations were done and colonies were screened by PCR using the TISvloligoBand TlWMPMV3' primer pairs for GTR and GTC, respectively. DNA was isofated by the minipreparation procudure and further characterized by Sst I restriction enzyme digestion. Closed circular DNA confomatons of GTRC1, GTR and GTC recombinants were then isolated by CsCI- ethidium bromide centrifugation and characterized by Sst I restriction enzyme digestion. The GTRC1 cione was also digested with Stu I and religated to construct the GTA retroviral vector which is similar to the GT retroviral vector, except that the former was derived from GTRC.
Construction of the mtGTRC, rntGT, mtGTR and mtGTC retroviral vectors: Site directed mutagenisis of the gtl gene was accomplished by PCR. Primers were designed to make point mutations in the His 40 codon and Glu 58 codon of the rtl gene so that alanine was introduced at each site. The mtT15' primer contained point mutations to the His 40 codon and the mtT1 3' primer contained point mutations to the Glu 58 codon (Table 1). The primers were also designed with a 20 base pair sequence complementarity for overlap PCR. In addition, the point mutations in the mtT13' primer were chosen such that an Mlu l restriction site was created simultaneously for eventual screening of the correct clone. Also a BamH I site was designed in the 5' primer and an Xho I site in the 3' primer.
The mtT1S1/mtT13' primer pair (500 ng each) was combined in a 50 pl Vent PCR (30 cycles, 95 OC 1min. 56 OC 1min, 72 OC 1min). The 106 bp PCR product was excised. electroeluted, ethanol precipitated and resuspended in 20 pi of sterile water. This
PCR product was digested with BamH I and Xho I in two steps. The BamH I reaction was done first in a 200 pl reaction mixture for 2 hr, ethanol precipitated and resuspended in sterile water and then digested with Xho I for 2 hr. The reaction mixture was heat-inactivateci and the reaction poduct was ethanol precipitated and resuspended in 10 pl sterile water. GTRC1 was digested with BamH I and Xho I in two steps, as above. This digest was resolved on a 1% wh agarose gel. Both 7348 bp and 4150 bp DNA bands were each excised, electroeluted, ethanol precipitated and resuspended in 10 pi of sterile water.
One microlitre of each of the digested products frorn GTRCl and 2 pl of the rnutagenized ?CR insert were combined in a 10 jd tripartite ligation reaction. The ligation reaction was then transfomed and phted on LB agar containing 50 pg/ml of kanarnycin and ampicilin. DNA from the colonies were prepared by the minip reparation procedure and chracterized by Mlu I digestion. The clone identified was designated mtGTRC.
The mtGTRC clone was transformeci using SCS101 competent cells and prepared in large scale by rnaxipreparation. For the construction of mtGT, mtGTR and mtGTC the mtGTRC retroviral vector was digested in 50 pl Stu 1, Sfi I and Bcl I reaction mixtures, respectively. The respective bands were resolved on a 1% wlv agarose gel, excised, electroeluted, ethanol precipitated and resuspended in 10 pl of sterile water. One microlitre of each of the Stu 1, Sfi t and Bcl I digested products were each religated in a 10 pl reaction mixture, transfomed and plated on LB agar containing
50 pg/ml of kanamycin and ampicilin. Two colonies from each plate were screened by PCR for mtGT, mtGTC and rntGTR using the TlS'/oligo 6, T1SY/MPMV3'and
RRES'/oligoB primer pairs, respectively.
8) Transformation of E. coli and Analysis of Gag-RNase Tl by ELISA ELISA. The presence of HIV-1 p24 antigen was determined using a p24 antigen
ELISA Kit (Coulter) according to the manufacture's instructions. Fifty micolitres of
Specimen Diluent was added to each well. Two hundred microlitres of the specimen was then added to each well including 3 negative controls (minus HIV-1 Gag antigen) and 2 positive controls @lus HIV-1 Gag antigen). One bead was subsequently added to each well. The tray was covered with a seal and incubated, with shaking at
42 OC for 1 hr. After washing each bead with sterile water, 200 pl of Antibody
Solution was added to each well. The tray was covered again and incubated with shaking at 42 OC for 1 hr. Aft8r washing each bead once, 200 pl of Conjugate was added to each well. The tray was covered and incubated while shaking at 42 OC for 1 hr. During the incubation, fresh OPD (O-Phenytenediamine) Substrate Solution was prepared by transfemng the appropriate number of OPD Tablets into a rneasured amount of Diluent. After incubation the beads were transferred to assay tubes.
Three hundred microlitres of OP0 Substrate Solution was then added to each tube including two empty tubes (substrate blanks). The tubes were covered and incubated at room temperature for 30 min. One mililitre of 1 N sulfuric acid was then added to each tube to stop the reaction. The absorbance of controls and specimens were then determined. A standard aiive (o.D.'" as a function of p24 antigen concentration in pglml) was obtained using p24 antigen provided by the supplier.
The O.D? values obtained for various samples were converted to pg of p24 antigen per 1 ml of sample.
Growth rate of E. coli -Ils tranaformed with GT and deteetion of Gag-RNase
11 by ELISA: MoTiN, GT1, GT2, and GT3 were transformed in E. coli competent cells (BEI strain) and plated on LB agar containing 50 pgml of ampicillin and kanamycin. One colony from each was inoculated in 5 ml of LB containing 50 pglrnl of ampicillin and kanamycin in Me evening and incubated with shaking at 37 OC. The next day equal concentrations (0.0.~of 1.2) of the 5 ml broths were subcultured into 50 ml of LB with 50 pgml of kanamycin and ampicilin in 250 ml Erienmyer flasks.
The broths were incubated with shaking at 37 OC. One mililitre of each culture was checked every hour for the o.D.~.When the o.D.~was approximately 0.6, IPTG was added to a final concentration of 0.4 mM. At 5 hr post-IPTG induction, the cells were harvested by centrifugation at 1500 x g for 3 min. The supernatant was discarded. The cell pellets were resuspended in 2 ml of 50 mM Tris-CI (pHB.O), 2 mM
EDTA (pH 8.0) and left ovemight at -20 OC. The next &y the cells were thawed and incubated in freshly prepared lysozyme to a concentration of 100 &ml and 1% v/v
Triton X-100. The samples were incubated at 30 OC for 15 min. The tubes were placed on ice and sonicated with a microtip until the viscosity was reduced (usually after three 10 sec pulses). The tubes were then centrifuged at 11000 x g for 15 min.
The supernatant containing the soluble proteins was separated from the pellet containing the insoluble proteins. The soluble fractions were resuspended in 1 ml of buffer (10 mM Tris-CI, pH 8.0). Four microlitre aliquots were used for testing for fusion protein production by ELISA using HIV-1 Gag antibodies. The o.D.~values were also plotted at each tirne point to establish a growth curve.
Mection of Gag-RNam Tl by EUSA in E. coli transfarmed with GTRC: MoTiN,
GT1, GTRC1, and GTRC2 were transformeci in Bi21 E. colj competent cells and plated on LB agar containing 50 Wml of kanamycin and amplicilin. One colony from each plate was inoculated in 5 ml of LB containing 50 pg/ml of ampicillin and kanamycin and incubated with shaking ovemight at 37 OC. The next day 500 pl of the 5 ml broths was subcultured into 50 ml of LB containing 50 pghl of kanamycin and ampicilin in 250 ml Erlenmyer flasks. The broths were incubated with shaking at 37 OC. At an o.D.~of approximately 0.6, IPTG was added to a final 0.4 mM. Pnor
to IPTG addition, 1 ml aliquots were centrifuged down in an eppendorf tube and
resuspended in 50 mM Tris-CI (pH 8.0), 2 mM EDTA (pH 8.0). The cultures were
incubated with shaking for 5 hr post-IPTG induction. Soluble fractions (prepared as
indicated previously) for each sample were collected. Four microlitres aliquots were
used for testing for fusion protein production by ELISA using HIV-1 Gag antibodies.
C. Analysis of RNa- Tl Antiwnirn by Western Blot and
Immunoprecipitation
Production of RNanTl antiaerum: Antibodies to RNase Tl were raised in rabbits
at the Division of Comparitive Medicine (Medical Sciences Bldg, University of
Toronto). Two disease free rabbits (SPF) were used. Hair was clipped off the ear of
the rabbit and nibbed with methyl siacylate to dilate the blood vessel. 10 ml of pre-
immune blood was collected from the marginal ear vein from each rabbit using a 21 G
needle and stored at -20 OC. 1 ml of RNase Tl (500 pgiml) was disdved with 1 ml
of Freund's complete adjuvant between two synnges until the mixture was very thick
and creamy in appearance. Then a 2 X 2" area of the back of the rabbit was
shaved with a clipper and disinfected with 70 % ethanol. 0.2 ml of the antigen
emulsion was injected intramuscularly into five sites. The remaining 1 ml was
injected intramuscularly into the hind leg. The second bwst was done 3 weeks later as above with 500 pg of RNase Tl. Two weeks later, the third boost was administered using 100 pg of RNase TI and 10 ml of blood was sampled using the
21 G needle 10 days later. Ten ml of blood was collected again 31 days and 53 days after the third boost- Western Blot analysk: SDS-PAGE (sodium dodecyl sutfate-polyacrylamide gel electrophoresis) for Western Blot analysis was prepared using a minigel electrophoresis apparatus (American Bionetics), 12% resoiving gel and 5% stacking gel. Protein samples were denatured by heating at 1'00 OC in a 1X SOS gel-loading buffer (New England Biolabs) containing 37 mM DTT and loaded into the wells. The gel was nin at 68 V untir the dye had moved into the resohnng gel. nie voltage was then increased to 1O0 V and run until the prestained molecular weight markers were sufficiently resolved, For electrotransfer (BioRad) to the nitrocellulose filter a small amount of transfer buffer (39 mM glycine, 48 mM Tris base, 0.037% w/v SDS, 20%
V/V methanol) was used and SV was applied for 2 hr. The nitocellulose filter was then placed in a heat sealable bag to which 5 mf of blocking solution (5 % w/v skim milk,
0.02 % v/v Tween-20 in PBS (pH 7.40)) was added. The bag was sealed and rotated on a platforrn shaker for 1 hr at room temperature. The bag was then cut open and the blocking solution was discarded. Five ml of fresh blocking solution was prepared containing 50 pi of antisera (first bled collected from rabbit after boost) and added to the bag and incubated overnight at room temperature on a rotating platform. The next day, the filter was removed fmm the bag and washed in 250 ml of PBS (pH 7.4) with gentle rocking for 20 min. The PBS wash was repeated twice. After the final wash, the filter was washed in phosphatefree buffer (50 mM Tris-CI [pH 7.5],150 mM
NaCI) as above. The filter was alen sealed into a bag to which 5 ml of blocking solution containing 2.5 FI (1:2000 dilution) of anti-rabbit IgG FlTC conjugate (Sigma) was added. This was incubated for 1 hr at room temperature on a rotating platform.
The fiiter was then washed four times with 250 ml of phosphate free buffer, as above.
After the final wash, the fiiter was immediately overiaid with a non-isotopic immunological reagent (Amersham) for 1 min and read by the Storm machine (Blue- shift laser). This results in a luminol-based cherniluminescent reaction for the light detection of horseradish peroxidase iabelled antibodies.
Western Biot analysk using Riüaw Tl anüawurn: One hundred nanograms of purified RNase Tl (Sigma) and 20 pi of MT4 cell extracts were resolved by 12%
SDS-PAGE and probed with either 1:IO0 or 1:400 dilutions of rabbit antiserum or a
1:IO0 dilution of preirnmune serum using the Western Blot procedure. The MT4 cell extracts were prepared by collecting 1 X 10' cells by centrifugation at 300 x g for 5 min. The cells were washed twice with PBS, the supematant was discarded and the cell pellet was resuspended in 1 ml of ice-cold RlPA buffer (50 mM Tris-CI (pH 7.5),
150 mM NaCI, 1% v/v NP-40, 0.5% w/v sodium deoxycholate, 0.1 % w/v SDS) and incubated on ice for 30 min. The lysate was then transferred to an eppendorf tube and centrifuged at 11000 x g for 2 min. The supematant was transferred to a new tube and stored at -20°C.
Immunoprecipitcition using RNan Tl antiserurn: To check the specificty and ability to fom a precipitate, purified RNase Tl was irnmunoprecipitatedfrom MT4 cell extracts using the rabbit antiserum. 10 million MT4 cells were washed htvice with
PBS, resuspended in 1 ml of RlPA buffer and left on ice for 30 min. The lysate was centrifuged, the supematant was collected and diluted with 5 ml of NET-gel buffer (50 mM Tris-CI (pH 7.5), 150 mM NaCI, 0.1% v/v NP40, 1 mM EDTA (pH 8.0). 0.25%
V/V gelatin, 0.02% w/v sodium azide). One haIf mililitre of cell lysate was aliquoted into six separate eppendorf tubes and resuspended in 100 ng of RNase Tl. One tube was precleared with preimmune serum as follows: 25 pl of preimmune senirn was added to a tube of cell lysate containing 200 ng of RNase Tl and incubated for 1 hr at O OC. Ten microlitres of protein A-sepharose was then added to the cell lysatdantibody mÏxture and incubated for 30 min at O OC. The mixture was centrifuged at 11000 x g for 5 min and the supernatant transferred to a fresh eppendorf tube with 8 pi of antiserum. Varying volumes (1 pl, 2 pl, 5 pl and 8 N) of antiserum were added to the ottier tubes and 8 pi of preimmune serum added to the last tube. The six tubes were gently rocked at 4'~for 1 hr. Ten microlitres of protein
A-Sepharose was subsequently added to the antibody/antigen mixture. This was then gently rocked for another 1 hr at 4 OC. The protein A-antigen-antibody complex was centrifuged at 11000 x g for 1 min and the supernatant was removed by aspiration- The temary cornplex was washed with 1 mi of NET-gel buffer by gentle rocking at 4OC for 20 min two times. The wash was repeated once using 1 ml of 10 mM Tris-CI (pH 7.5) and 0.1% vhr NP-40. The temary complex was collected by centrifugation at 11000 x g for 1 min and resuspended in 15 pl of 1X SDS gel-loading buffer. The proteins in the sample were denatured by heating to 100 OC for 3 min and the protein A-Sepharose removed by centrifugation at 11000 x g for 1 min. The supernatant was transferred to a fresh tube for further analysis.
D. Transient Transfection of 293-T cells and Analysis of Gag-RNase Tl
by ELISA
Transient transfection uiing the CaPO. pmcipitation method: Two or five million cells of the desired adherent cell line was split the &y before transfection into 60 mm or 90 mm plates, respectively, containing the appropriate medium and incubated ovemight at 37 OC in a 5% COzenvironment. The number of cells seeded may Vary for different cell types and was calculated such that individual celis and not a monolayer was obtained the next &y. The next day, DNA was prepared for transfection as follows: DNA prepared by the CsCI-ethidium bromide procedure was added to 50 pl of 2.5 M Ca& (filter sterilized) and brought upto 500 @ with distilled water (filter sterilized). The amount of DNA was optimized in pilot experiments using
5 ~g to 35 pg of DNA. The mixture was allowed to sit for 10 min at room temperature and then added dropwise to a 5 ml tube containing 500 pi of 2X HEPES-buffered saline (0.283 M NaCI, 0.023 M HEPES acid, t .5 mM Na2HP04,filtet sterilized water) while bubbling with a plastic pipette and vortexed briefiy. The tube was allowed to sit for 20 min, then added evenly and gentfy over the cells and incubated for 6-16 hr (the incubation %mewas optimized in pilot experiments) at 37'~. After the incubation, the medium was rernoved and the cells were washed twice with PBS and fresh medium added. Altematively, a glycerol shock was applied to the cells after incubation by removing aie medium and adding 1 ml of filter sterilized 10 % v/v glycerol (made in
PBS, pH 7.4). After 1 min, 3 ml of PBS was added to the dish, gently rocked and removed. The cells were then washed twice with PBS and fresh medium added.
Lysis of cuttured mdmrnalian cells: Sixty to seventy-two hours post transfection the medium was removed and the cells washed with PBS. Freshly prepared lysis buffer (50 mM Tris-CI [pH 8.01, 150 mM NaCI, 0.02% w/v sodium azide, 100 pglml phenylmethylwtfonylfluoride, 1Oh v/v NP-a), cooled to O OC, was added to the dish
(1 ml was added to 90 mm plates and 0.5 ml to 60 mm plates) and nicubated at 4 OC for 20 min. The cells were then scraped to one side of the dish and transferred to a chilled eppendorf tube. The tube was then centrifuged at 12000 x g for 2 min, the supernatant transfened to a fresh eppendorf tube and stored at -20 OC.
Detection of Gag-RNase Tl by ELISA in the abnce of Rev in transierilty transfected 293-T cells: The retroviral vectors MoTiN, GT, GTR, GTC, GTRC1 were transiently transfeded into 5 X 106 293-T cells (obtained from NIH) in 90 mm plates to show production of Gag-RNase Tl in mammalian cells. 293-T cells were maintained in HG-DMEM medium supplemented with 10% v/v fetal bovine serum
(Hyclone), 1% v/v antibiotbantimycotic solution (100 U/ml penicillin G sodium,
100 pglml streptomycin suMate, 0.25 pglml amphotericin B as Fungizone; Gibco) and
2 mM glutamine (Gibco). The pCMVAR8.91 plasmid (Zufferey et al., 1.997) was transfected in parallel as a positive control for the transfection and detection procedures. This plasmid expresses the HIV-1 gag, pol, rev and env genes. In each case, 10 pg of DNA were used in the Capo4 precipitation method. The time of exposure to the DNA precipitate was 6 hr and no glycerol shock was done. At 72 hr post-transfection 7 X 1o6 cells were collected and lysed in 1 ml of lysis buffer. Two hundred microlitres were analyzed for p24 antigen by ELlSA using HIV-1 Gag antibodies.
To optimize the conditions for transfection, the GTC retroviral vector construct was transfected into 2 X 10' cells in a 60 mm dish using the Cap01 precipitation rnethod.
The amount of GTC DNA was varied in each experiment from 5 pg, 15 pg, and
25 gg. The time of exposure to the DNA precipitate was also varied from 6 hr and 16 hr and transfections were done with or without a 1 min glycerol shock. The pCMVAR8.91 plasmid was transfected in parallel as a positive control. At 72 hr post- transfection, al1 the cells were collected and lysed in 1 ml of lysis buffer. Then 200 pl of the cell lysate were analyzed for p24 antigen by ELISA using HIV-1 Gag antibodies.
ûetection of Gag-RNase Tl by ELISA in the presence of Rev in transiently transfected 293-T ~011s: The retroviral vectors GT, GTR, GTC, GTRC and GTRC2 were cotransfected with the pSV-Rev plasmid (obtained from Dr. A. Cochrane, University of Toronto) to 2 X 106 293-T cells on 60 mm dishes. The amount of
retroviral vector DNA was varied between 5 pg, 15 pg and 25 pg while the amount of
pSV-Rev plasmid was kept constant at 5 pg. The pCMVAR8.91 plasmid was also
transfected in parallel. The DNA precipitate was exposed to the cells for 16 hr with
no glycerol shock. At 72 hr post-transfection, the cells were mllected and lysed in 1
ml of lysis buffer. Then 200pi of the cell lysate were analyzed for p24 antigen by
ELISA using HIV-1 Gag antibodies.
E. Stable Transduction of MT4 CeII8 and Analysis of Gag-RNase Tl and
Mutant Gag-RNese Tl by ELISA
Cell lines: The ecotropic mouse fibroblast cell line, Psi-2 (Mann et al., 1983), and
amphotropic mouse fibroblast cell line, PA317, (Miller and Buttirnore, 1986) were
obtained from A. Bernstein (Mount Sinai Hospital, Toronto) and maintained in aMEM
medium supplemented with 10% vlv fetal bovine serum, 1% vlv antibiotic-
antimycotic solution and 2 mM glutamine. The human C04+ T lymphocyte-derived
MT4 cell line (obtained from O. Richman through NIAID) was maintained in RPMl
1640 medium supplemented with 10% v/v fetal bovine serum, antibiotic-antimycotic
solution and 2 mM glutamine. All cells were grown in a 5% carbon dioxide
environment at 37 OC.
Stable transfection of the Psi-2 packaging wll line and vector particle collection: The Psi2 packaging cell lin8 was transfected with 15 pg of retroviral vector DNA using the CapoI precipitation method in a 60 mm dish. A mock transfection was done in parallel. The transfected cells were aîlowed to incubate ovemight at 37 OC before changing the medium. The next day. the cells were supplemented with selective medium containing 400 pghl of G418. The medium was changed as required every 2-3 days. After Noweeks of seledion, the number of colonies were counted, trypsinized and reseeded. Stable transfectants were frozen in 1 ml aliquots (900 pl of fresh aMEM medium and 100 pi DMSO) in liquid nitrogen for future use.
For vector particle collection, stable transfectants were grown in 5 ml of selective medium in 100 mm plates until 50% confluent. The medium was replaced with 5 ml of fresh medium without adding dnig. The cells were incubated overnight under normal conditions. The next day 5 ml of medium, now containing vector particles were drawn up into a 5 ml synnge with an 18G needle, filter sterilized using a Millex-
GS 0.22 prn filter unit (MiIlipore) and stored at -70 OC in 1 ml aliquots.
Stable transduction of the PA317 packaging cell line and vector particle collection: 3 X 10' amphotropic PA317 packaging cells were seeded in 60 mm plates such that they were 50% confluent prîor to infection. Ecotropic vector particles were removed from -70 OC and thawed quickiy with shaking at 37%. For each sample, 0.5 ml of vector particles were mixed with 0.5 ml of medium containing
16 pglml polybrene (Sigma). One contra1 sample containing no vector particles was also prepared. The medium was removed from the cells and the 1 ml mixture was added. The cells were incubated under normal conditions for 4 hr, then 3 ml of nonseiective medium added. The cells were grown overnight under normal conditions. The next day, infected cells were washed with PBS, trypsinized, transferred to 100 mm plates and grown in selective medium containing 400 pghl of
(3418. The medium was changed as required every 2-3 days. Two weeks after selection, the number of colonies were counted, trypsinized and reseeded. The stable transfectants were frozen in 1 ml aliquots (900 @ of fresh MEM medium and
100 pl DMSO) in liquid nitrogen.
Stable transfectants were grown in selective medium in 100 mm plates until 50% confluent. The medium was rernoved and 5 ml of fresh medium without drug was added. The cells were incubated ovemight under normal conditions. The next day,
5 ml of medium, now containing vector particles were drawn up into a 5 ml synnge with an 18G needle, filter sterilized using a Millex-GS 0.22 pn filter unit (Millipore) and stored at -70 OC in 1 ml aliquots.
Stable transduction of the MT4 cell line: The amphotropic vector particles were removed from -70 OC and thawed quickly with shaking at 37%. MT4 cells were centrifuged at 300 x g for 5 min in 5 ml tubes. The medium was removed and the pellet was resuspended in 0.5 ml of RPMl medium without dwg. One haif mililitre of vector particles containing 16 pg/ml of polybrene were added to the wells of a 12 well plate. Two hundred thousand MT4 cells were added to each well and gently mixed.
The 12 well plate was then spun for 2 hr at 850 x g. 1 ml of the supernabnt was removed from each well and 1 ml of fresh vector particles was added and incubation continued overnight. A mock infection was done in parallei. After 24 hr, 1.5 ml of the supernatant in each well was removed and replaced with 1.5 ml of fresh medium with
400 pg/ml of G418. After 2 days, the cells were transferred to a 10 ml flask and maintained until the mock infected cells were dead. The cells were maintained in
RPMl medium containing 200 pg/ml of G418. The medium was changed every 2-3 days as required for three weeks. About lo7 transduced 6418 resistant cells were then frozen in 1 ml aliquots (900 pl of fresh RPMl without drug and 100 pl of DMSO) in liquid nitrogen. mtection of Gag-RN#, Tl and mutant GagdNIse Tl by ELISA in stable MT4 transâuctarW Fie million cells MT4 cells transduced with either MoTiN, GT, GTR,
GTC, GTRC2, mtGT or mtGTRC were centrifuged at 300 x g. The supematant was discarded and the cells lysed with 500 pl of lysis buffer. Then 200 pl of the cell iysateç were analyzed by ELISA using HIV-1 Gag antibodies. Cell lysates of nontransduced MT4 cells were analyzed by ELISA in paralel. MT4 cells infected with H1V-1 (HXB-2) were analyzed in parallel as a positive control.
F. Analysis of DNA and RNA Extractd From a Stable MT4
Transductant using PCR and RT-PCR
Total DNA extraction from rnammalian cells: Five million cells were centrifuged at
300 x g for 5 min and washed twice with PBS. The supematant was discarded and 4 ml of DNA extraction buffer (10 mM Tris-CI (pH 8.0), 0.1 M EDTA, 0.5% w/v SDS) was used to resuspend the cell pellet. The suspension was incubated at 37 OC for 1-
2 hr. Then 2 ml of phenol and 2 ml of chlorofomi/isoamylalcohol (24:l)were added to the tube, the mixture vortexed vigorously and centrifuged at 5000 x g for 15 min.
The aqueous layer was removed to a fresh tube containing 4 ml of chloroform/isoamyl alcohol (24:l). The tube was vottexed and centrifuged at 5000 x g for 10 min. The chloroform/isoamyl alcohol extraction was repeated once more.
The aqueous layer was transferred to a fresh tube and two volumes of ethanol, 1/10 volume of 7.5 M ammonium acetate added. The tube was stored at -20 OC ovemight. The next day, aie DNA was pelleted at 3500 x g for 5 min. The supematant was discarded, the pellet resuspended washed in 1.5 ml of 70% ethanol and transferred to an eppendorf tube. The tube was centrifuged at 10000 x g for 5 min and the supernatant removed. The pellet was air dned and resuspended in
100 pi of sterile water.
Total RNA extraction tiam mammallan cella: About 5 X 106 suspension cells were washed with PBS Nice. The œlls were transfened to an eppendorf tube containing 350 pi of Solution D (4 M Guanidinium isothiocynate, 25 mM sodium citrate 0.5% sarwsyl) and 5 pl of 6-rnercaptoethanol. Three hundred and fifty microlitres of phenol, 350 pl of chlorofomi:isoamyf alcohol (24:l) and 35 pl 2 M sodium acetate (pH 4.0) were added, the tubes vortexed vigorously for 1 min and centrifuged for 10 min at 10000 x g. The aqueous phase was transferred to a fresh eppendorf tube containing 350 pl of ice COUisopropanol. The tube was left ovemight at -20 OC. The next day, the tube was centrifuged at 11000 x g for 30 min. The pellet was washed in 500 pl of 75% ethanol. The tube was centrifuged for 1 min at
10000 x g and the supernatant was removed by aspiration. The pellet was air dried for 10 min and resuspended in 50 pi of sterile water. The suspension was treated with DNase by adding 10 pl of 100 mM MgCI2/10 mM DiTe4 pl of DNase RQ1
(1 univul), and 36 pl of sterile water and inwbated at 37 OC for 30 min. After incubation, 50 pl of phenol and 50 jd of chlorofom:isoamyl alcohol (24:l) was added to the tube, the sarnpk vortexed and centrifuged for 5 min at 10000 x g. The supernatant was transfened to a fresh tube containing 200 pl of 95% ethanol and
10 pl of 7.5 M ammonium acetate were added. The RNA was precipitated overnight at -20 OC. The next &y, the tube was centrifuged for 20 min at 11000 x g and the supernatant was rernoved by aspiration. The pellet was resuspended in 10 pl of sterile water. RT-PCR: Total RNA extracted from rnarnmalian cells was reverse transcribed as follows: 0.5 pmols of RNA, 100 ng of the 3' oligonucleotide, and sterile water to 5 pl was added to a 0.5 ml PCR tube and heated at 65 OC in a Perkin-Elmer Cetus
Instruments DNA Thermal Cycler for 5 min then plaoed on ice for 1 min. The reaction mixture was then brought up to 10 pl with 1X RT buffer (Gibco), 5 mM Dm,
0.25 mM dNTPs, 200 units of MLV RTase (Gibco) and heated at 37 OC for 1 hr, then
65 C for 5 min. The reactïon mixture was cooled to room temperature and 1-2 pl of the cDNA was amplified by PCR in a 10 pl reaction mixture using Taq polymerase as described previously. The PCR product was analyzed on a 1% w/v agarose gel.
PCR analysis of total gdnomic DNA extractad from MT4 cells transduced with
GTR: Total DNA was extracted from MT4 cells transduced with the GTR retroviral vector and analyzed by PCRs using Taq polyrnerase (as described previously) the
CMVS'/CMV3' and NeoS'INeo3' primer pairs. Total DNA extracted from nontransduced MT4 cells and a maxipreparation of the GTR retroviral vector were also amplified in parallel using the same primer pairs. The PCR products were resolved on a 1% w/v agarose gel.
RT-PCR analysis of total genomic RNA extracted from MT4 cells transduced with GTR: Total RNA was extracted from MT4 cells transduced with the GTR retroviral vector and analyzed by RT-PCR. RT-PCR with the NeoS'/Neo3' primer pair was used to detect transcripts containing neo sequences. RT-PCR was also perfonned with the T15'/r13' primer pair to detect the transcripts containing rtl sequences. RT-PCR analysis was also camed out in the absence RTase as a control for contaminating DNA. RT-PCR analysis of total RNA extracted from plain
MT4 cells was performed w*th the NeoS'/Neo3' primer pair. A 10 pl Taq PCR using the T15'K13' primer pair was also done in parallel to amplify rtl sequences from a maxipreparation of GTR retrovital vector DNA.
O. Construction of the HVP-Packaging CeII Line and Analysis of
Cocultured MT4 Cells by PCR and RT-PCR
Stable transfection of the p6 cell line with HVP: The p6 cell line (obtained from
NIH) was made previously by transfecting Heladerived HtTa-1 cells with
HXBAPAEnv and Tl RevEnv (Fig. 21) (Yu et al., 1996). The cell line was maintained in HG-DMEM medium supplemented with 10% v/v fetal bovine serum, 1% vlv antibiotic-antimycotic solution, 2 mM glutamine, 0.2 mg/ml G418, 0.1 mgml hygromycin, and 0.2 @ml tetracycline. The cell Iine can be induced to express HIV-
1 rev and env genes by removing tetracycline from the culture medium. The production of Rev induces the subsequent production of Gag, GagPol, and Vif, mile
Tat is produced constitutively. Prior to transfecting, the peak production of viral proteins from the cell line was determined as follows: 2 X 1o6 p6 cells were seeded ont0 a 60 mm plate in medium without tetracycline. One mililitre of supernatant was withdrawn from the cells and stored at -70 OC 3, 5, 7, 8 and 9 days post-tetracycline withdrawal. The cells were split every 2 days by seeding 2 X 106 cells. Levels of
Gag antigen in 200 pl of each sample day were then deterrnined by ELISA using
HIV-1 Gag antibodies.
To establish a cell line, unable to express replication competent HIV-1, the p6 cell line was transfected with the HVP retroviral vectot (Lever et al., 1995; Yu et ai., 1996)
(Fig. 21 ). On day 5 post-tetracycline withdrawal, 1-7 X 1o6 p6 cells were split into a
60 mm dish. The next &y, 15 pg of the HVP retroviral vector DNA was used for transfection. The cells were incubated for 8 hr with Capo4 precipitate and then glycerol shocked. The next day (Le. &y 8 post-tetracycline withdrawal), medium supplemented with puromycin (0.6 pg/ml) and tetracycline (0.2ug.ml) were applied.
After 2-3 weeks of selection, the pool of stable transfectants was combined and maintained. The genetically modified p6 cell line was designated as the HVP- packaging cell line.
Transduction of MT4 cells with replication incompetent HIV: The HVP- packaging ceIl line was cocultured with MT4 cells as follows (Table 111): 1.5 X 10'
HVP-packaging cells were seeded onto three 60 mm dishes each without tetracycline. One mililitre of supernatant was withdrawn each day for the duration of the experiment from one of the dishes. On day 5 post-tetracycline withdrawal, the
HVP packaging cells were seeded ont0 90 mm dishes. The next day, 2 X 106 MT4 cells were added to a sieve (in duplicate). The two sieves containing MT4 cells were placed into each dish and cocultured with the HVP packaging cell Iine. After 3 days of coculturing, 95 of the MT4 cells were callected from each dish for RNA and DNA extraction. Also '/r of the MT4 cells from each dish were selected for puromycin resistance in RPMl medium supplemented with 0.6 pg/ml of puromycin. Plain MT4 cells, which were not cocultured with the HVP-packaging cell Iine, were also selected in medium containing puromycin.
Analysb of transduced MT4 cells by PCR and RT-PCR: PCR with the T7-
Gag5'/77-Gag3' primer pair was used to det8ct HVP proviral DNA by amplifcation of sequences within the HIV-1 gag gene from total genomic DNA extracted from the cocultured MT4 cells. The same primer pair was used to amplify sequences within the HIV-1 gag gene from a maxipreparation of HVP plasmid DNA. PCR amplification using the primer pair alone without template was also done in parallel. RT-PCR with the l7-GagSA7-Gag3' primer pair was used to detect HVP mRNA by amplifica5on of sequences within gag cDNA produced from reverse transcription of total RNA extracted from cocultured MT4 cells. RNA extracted from HIV-1 (HXB2)œinfected
MT4 cells was also analyzed in parallel by RT-PCR using the same primer pair. RT-
PCR analysis of total RNA extracteci from cocultured MT4 cells was alço perfonned without the Rienzyme as a control for contaminating DNA. Table III
Coculture of MT4 Cells with HVP mckaaina cell line
Day Comment8 O 1.5 x 1o6 p6 cells were split into three dishes in the presence of
I - 1 tetracycline - -- I 1 - Tetracycline was withdrawn 2 1 .O x 1o6 p6 cells were split into three dishes 4 -3 Allowed growth of p6 cells 4 Allowed growth of p6 cells L 5 All cells from each dish were split into three 10 cm dishes 6 2.0 X 1ob MT4 cells were cocultured in two dishes each (duplicate) 7 5 x 10' p6 cells were split into three dishes while continuing coculture 8 Cocultured MT4 cells were collected for puromycin selection and RNA and DNA extraction Cham3. RESUL TS
A. Retroviral Vector Construction
Retroviral vector design: The gene encoding RNase Tl, rti, was genetically fused immediately downstream of sequences coding for the NC domain within the HIV-1 gag gene. The wild type HIV-1 Gag precursor is norrnaily produced with the 54 amino acid-long p6 region, downstream of the NC domain. The p6 domain is believed to bind to the envelope within the virion and is not necessary for packaging
HIV-1 Gag into virus particles (Freed, 1998). The gtl gene was also designed to exclude the HIV-1 protease cleavage site between the NC and RNase Tl domains.
Thus, the functionally active therapeutic product within the virion is expected to be the NC-RNase Tl fusion protein (Fig. 4). The specific HIV RNA binding properties of the NC domain should promote cleavage of HIV genomic RNA and tI3mLY' molecules within the virion, rendering the viral progeny non-infectious. It is also conceivable that during encapsidation, the unprocessed Gag-RNase Tl fusion protein could cleave viral genomic RNA within the cytosol. In addition, a mutant gtl gene was similarly designed to produce Gag-RNase Tl with an inactive RNase Tl domain. The mutant gtl gene can serve as a negative control for RNase-mediated inhibition of HIV replication; however, mutant Gag-RNase Tl is also expected to inhibit HIV replication. The functionally active therapeutic product within the virion is expected to be the mutant NC-RNase Tl fusion protein (Fig. 4) which could also render progeny virus non-infectious by strerically hindering the formation of infectious virus. Any differential inhibition of HIV-1 replication observed in vitro between the mutant Gag-RNase Tl and wild type Gag-RNase Tl fusion proteins will allow for quantitation of the level of inhibition provided by the RNase activity. Retroviral vectors can be used for the introduction of genes into target cells (Wei et al., 1981). This approach allows for a high efficiency of gene transfer and the ability to study the effects of introduced genes in total cell populations and not only in relatively rare transfectants. Generally the retroviral vector is designed to express a gene enwding a selectable marker and a second gene which encodes the gene product under study. The retroviral vedor used in this study was the MMLV-based vector, MoTiN (Joshi el al., 1991). MoTiN encodes the selectable marker neophosphotransferase.
Retroviral vectors were constnicted to genetically modrfy cells with the gtl gene or mutant gtl gene. The genetically modified cells can subsequently be used to assess the ability and mechanism of the therapeutic gene product to inhibit HIV replication in transient and stable in vitro cell culture systems. It is advantageous to have expression of the therapeutic gene under control of an intemal promoter. As a result, the therapeutic gene can be designed to be regulated in an inducible manner since it is independently transcribed. The therapeutic gene product should be produced once the cell is infected by HIV. A tightly controlled mechanism for gene regulation may be essential for the genetically modified cell to effectively inhibit HIV replication or avoid cytotoxicity.
The gtl or mt gtl gene was designed to be under control of the CMV promoter and subcloned downstream the neo gene under control of the HSV tWAR promoter (Fig.
5 and 6). The 3' region of the CMV promoter also contains the prokaryotic T7 promoter to allow expression of the therapeutic gene in bacteria. The retroviral Figure 4. Postuîateâ HlWl probase ckavage products of Gag-RNase Tl and mutant Gag-RNase T1
The major anticipated products of HIV-1 protease mediated cleavage of Gag-RNase Tl or mutant Gag-RNase Tl within the viral partide is the MA, CA, and NC-RNase Tl or mutant NC-RNase Tl domains, respectively. HM1protease
Mutant Gag-RNase Tl
HIV-1 protease
Figure 4 Figure 5. Schematic of the GT, GTR, GTC and GTRC retroviral vectors
Retroviral vectors based on MMLV were constructed to express the gtl gene under control of the human CMV promoter. A second intemal HSV MARpromoter regulates the expression of the dnig resistant neo gene. The GT retroviral vector does not contain any post-transcriptional control elements. The GTR retroviral vector wntains HIV-1 ne sequences for Rev-inducible production of Gag-RNase Tl. The GTC retroviral vector contains MPMV cte sequences for constitutive production of Gag- RNase Tl. The GTRC retroviral vector contains both HIV-1 ne and MPMV cte sequences for constitutive production of Gag-RNase Tl. c of the GT. GTR. GTC and GTRC rewvectors
GTR
GTC 1 LTR
GTRC 1 LTR H me cte ~LTR
Figure 5 Figure 6. Schematk of the mtGT, WTR, mtGTC and rntGTRC retroviral vectors
Retroviral vectors based on MMLV were wnstructed to express the mutant gtl gene under control of the human CMV promoter. A second interna1 HSV tkKAR prornoter regulates the expression of the dnig resistant neo gene. The mtGT retroviral vector does not contain any post-transcriptional control elements. The mtGTR retroviral vector contains HIV-1 rre sequences for Rev-inducible production of mutant Gag-RNase Tl. The mtGTC retroviral vector wntains MPMV de sequences for constitutive production of mutant Gag-RNase Tl. The rntGTRC retroviral vector mntains both HIV-1 ne and MPMV cte sequences for constitutive production of mutant Gag-RNase Tl. mtGTRC ~LTR cte 3LTR
Figure 6 vectors were also designed to produce Gag-RNase Tl or mutant Gag-RNase Tl in an HIV-1 Rev-inducible or constitutive manner.
Rev-inducible production is accomplished by including the HIV-1 RRE (Bray et al.,
1994) within the transcript encoding Gag-RNase Tl or mutant Gag-RNase Tl.
Constitutive production is accomplished by including the MPMV CTE (Bray et al.,
1994) within the transcript encoding Gag-RNase Tl or mutant Gag-RNase Tl.
Studies have demonstrated that the inclusion of both RRE and CTE within th8 3'
UTR allows for high levels of HIV-1 Gag production in a constitutive manner (Bray et al., 1994). Thus, both ne and cte sequences were subcloned within the 3' UTR of the GT retroviral vector to wnstruct the GTRC retrovital vector. The cte sequence was subcloned near the polyadenylation signal, since unlike the RRE (Campbell et al., 1996)' it functions in a positiondependent manner (Rizvi et al., 1997). The GTR and GTC retroviral vectors were derived from the GTRC retroviral vector for Rev- inducible and constitutive production of Gag-RNase Tl, respectively (Fig. 5).
The mtGTRC retroviral vector (Fig. 6) encoding mutant Gag-RNase Tl, was constructed by replacement with mutagenized r.1 sequences into the GTRCI retroviral vector. Similarly, the mtGTR and mtGTC retroviral vectors were derived from the mtGTRC retroviral vector for Rev-inducible production of mutant Gag-
RNase Tl and constitutive production of mutant Gag-RNase Tl, respectively (Fig. 6).
The mtGT retroviral vector was derived from mtGTRC (Fig. 6) and is predicted not to produce th8 therapeutic gene product in mammalian cells since no post- transcriptional elements are provided, as is the case with ale GT retroviral vector. Construction of the GT retroviral vector: The cmv-gtl insert was constructed using a three step overiap PCR strategy. The gag gene and the rtl gene were amplified by PCR and combined in an overlap PCR using the GagS'IT13' primer pair to construct the gtl fusion gene (results not shown). The second overiap PCR step using the gtl and cmv PCR products and the CMVS1K13' primer pair produced a
DNA band migrating within the range of 2409 bp corresponding to the cmv-gtf insert
(Fig. 7a, lane 3.) The insert was then subcloned into the BamH VCla I site of the
MoTiN retroviral vector. fwenty-two colonies were screened by PCR using the the
T15lK13' primer pair. The PCR product amplified from three of the colonies migrated within the range of 365 bp wrresponding to the fil gene (results not shown). DNA isolated from these colonies was further characterized by PCR and restriction enzyme digestion. PCR using the CMV5'K13' primer pair produced a
DNA band within the range of 2409 bp corresponding to the cmv-gtl insert (Fig. Ib, lane 4,5,6) for each of the three recombinants. PCR analysis of the MoTiN template
(Fig. 7b, lane 3) and no template (Fig. 7b1lane 2) using the same primer pair did not detect a band confirming the specificity of the reaction. The construction of the recombinant should result in the addition of one extra Sst I restriction enzyme site compared to MoTiN. Restriction enzyme digestion of the recombinants with Sst I resulted in four cleavage products (Fig. 7c, lane 1,2,3) compared to three cleavage products resulting from Sst I digestion of MoTiN (results not shown). The orientaion of the insert was confirmed by PCR using the T15'/oligo
B primer pair which produced a DNA band migrating within the range of the expected
435 bp (Fig. 7d, lane 4,5,6). A band slightly smaller than 435 bp was also detected in the same reaction and may be due to nonspecific annealing of primers to the template DM. PCR analysis of the MoTiN ternplate (Fig. 7d, lane 3) and no template (Fig. 7b, lane 2) using the same pnmers did not detect a band confirming the specificity of the reaction. The three recombinants were designated as GT1, GT2 and GT3.
Construction of the GTRC, GTR and GTC mtroviral vectors: The GT1 clone was used to construct the GTRC retroviral vector using a tetrapartite ligation strategy (Fig.
8). PCR amplification of the RIgene, ne and de sequences were done using the
TlS'Notl /Tl 3'Notl, RRES'/RRE3' and MPMV5'/MPMV3' primer pairs, respectively.
The rtl, ne and cte PCR products migrated within the expected range of 365 bp,
504 bp, and 283 bp, repectively (Fig. 9a, lane 3.2.1). An overiap PCR using the ne and cte PCR products and the RRES'MPMV3' primer pair produced a DNA band migrating within the range of 787 bp conesponding to the ne-cte insert (Fig. 9b, lane
2). An overlap PCR using the TlWRRE3' primer pair produced a DNA band migrating within the range of 869 bp conesponding to the rtl-ne insert (Fig. 9c, lane
2). The tetrapartite ligation was transforrned and 45 cotonies were screened by PCR using the Gag5'/Gag3' primer pair. The PCR product from three of the colonies migrated within the range of 1300 bp corresponding to the gag gene (results not shown). Plasmid DNA extracted from two of these colonies were further characterized by PCR using the CMVS'MPMV3'. CMVS'K13'Notl, T15'/RRE3',
Tl5'/MPMV3' and oligoC/CMV3' primer pairs which amplified DNA bands migrating within the expected ranges of 3077 bp (Fig. 9d, lane 7,12), 2344 bp (Fig. 9d, lane
8,l3), 84û bp (Fig. 9d. lane 9, 14), 1099 bp (Fig. 9d, lane 10, 15), 71 1 bp (Fig. 9d, lane 11, 16). respectively. The 71 1 bp product amplified using the oligo C/CMV3' primer pair mnfinned the correct orientation of the insert. PCR amplification of
MoTiN retroviral vector DNA using the same primer pairs yielded no PCR products Figure 7. Conatructiori of the GT retroviral -or. a. The cmv-gt1 insert was constructed by overiap PCR. The gtl gene, constructed by overlap PCR, and the cmv PCR product was amplified from the pCDM8 plasmid. The gtl and cmv PCR products were cornbined in a 50 pi Pfu PCR using the CMVS'K13' primer pair and both templates was done to amplify the cmv-gtl insert. Five microlitres of the PCR product was resolved on a 1% agarose gel (lane 3) and migrated within the range of 2409 bp corresponding to the cmv-gtl insert. 1 pg of a Hinf 1 digest of PBR322 DNA (lane 1) and 1 pg of a Hind III digest of lambda DNA (lane 2) were also resolved on the agarose gel in parallel. The 1631 bp product of the ninf I digest and 2322 bp product of the Hhd III digest are indicated. b. The cmv-gtl insert was subdoned into the BamH VCIa 1 site of the retrovirai vector MoTiN. Minipreparations of DNA from three transformed colonies were analysed by 10 pl PCR reactions using the CMVSK13'. Each reaction was resolved on a 1Oh agarose gel (Iane 4,5,6) and the PCR product migrated within the range of 2409 bp corresponding to the cmv-gt1 cassette. A PCR reaction was also done with MoTiN template DNA (lane 3) and without any template DNA (lane 2). 1 pg of a Hind III digest of lambda DNA was resolved in parallel (lane 1) with the 2322 bp product indicated. c. Minipreparations of DNA from the three transfonned colonies were digested by the Sst I restriction enzyme in 10 pl reactions for further characterization. Each reaction product was resolved on a 1% agarose gel (lane 1, 2 and 3) with the expected digested products indicated in each case. d. ïhe minipreparations of DNA from the three transformed colonies were analysed by PCR using the Tl S/oligo B primer pair in 10 jd reactions to confimi the orientation of the cmv-gtl insert. The PCR product from each reaction was resolved on a 1% agarose gel (lane 4, 5, and 6) and migrated within the expected range of 435 bp. A PCR reaction was also done with MoTiN template DNA (lane 2) and without any template DNA (lane 3). The three clones were designated GT1 (lane 4), GT2 (lane 5) and GT3 (lane 6). 500 ng of a Hinf I digest of PBR DNA was resolved in parallel (lane 1) with the 1631 bp and 506 bp products indicated. tion of the GT retovital vector
Fig. 7a Fig. 7b
Fig. 7c Fig. 7d
Figure 7 Figure 8. Schemaic of the GTRC retroviral vector
A tertrapartite ligation strategy was used to wnstruct the GTRC retroviral vector. The rtl-me and ne-cte fragments were derived by overlap PCR and double digested with Xho VHind III and Hind IIVcsp 451 , respectively. The GT and MoTiN retroviral vectors were double digested with EcoR UXho I and EwR UCla 1. respectively. All four fragments were combined in a tetrapartite ligation to construct the GTRC retroviral vector. c of the GTRC retrovira[ vector
LTR
GTRC
Figure 8 Figure 9. Con.tnictbn of thu GTRC retroviral -or a. The rtl, rre and cte sequences were amplified by PCR for subcloning. The MPMVSr/MPMV3' primer pair was used to amplify the cte sequence from the pSV-gag- pol-rre-mpmv plasmid in a 50 pi PCR. Five microlitres of the PCR product was resolved on a 1% w/v agarose gel (lane 1) and migrated within aie expected range of 283 bp. The RRE5'/RRE?If primer pair was used to amplify the ne sequence from the pSV-gag- pot-rre-mpmv plasmid in a 50 pi Vent PCR. Five microlitres of the PCR product was resolved on a 1% agarose gel (lane 2) and migrated within the expected range of 504 bp. The TlS'Notl/T13'Notl' primer pair was used to amplify the rtl gene from the pA2T1 plasmid in a 50 pl Vent PCR. 5 CL( of the PCR product was resolved on a 1% agame gel (lane 3) and migrated within the expected range of 365 bp. A Hinf I digest of PBR DNA was resolved in parallel (lane 4) with the 1631 bp and 506 bp products indicated. b. The me-cte sequence was constructed by overlap PCR for subcloning. The me and cte PCR products were combined in a 50 pi Vent PCR using the RRES'MPMVB' primer pair. Five microlitres of the PCR product was resolved on a 1% agarose gel (lane 2) and migrated within the range of 787 bp corresponding to the ne-cte sequence. A Hinf I digest of PBR DNA was resolved in paralel (lane 1) with the 1631 bp and 506 bp products indicated. c. The RI-rre sequence was constnicted by overlap PCR for subcloning. The rtl and rre PCR products were combined in a 50 pl Vent PCR using the T15'Notl/RRE3' primer pair. Five microlitres of the PCR product was resolved on a 1% agarose gel (lane 2) and migrated within the range of 869 bp corresponding to the RI-me sequence. A Hinf I digest of PBR DNA was resolved in parallel with the 1631 bp and 506 bp products indicated. d. The EcoR VCla I fragment from MoTiN, EwR VXho I fagrnent from GT1, Xho VHind III digested rtl -ne insert and Hind IfVcsp451 digested ne-cte insert were combined in a tetrapartite ligation. Miniprepartions of DNA from two transformed colonies were characterized by 10 pi Taq PCRs and resohred on a 1% agarose gel. The CMV5'1MPMV3' primer pair was used to amptify a PCR product which migrated within the expected range of 3077 bp (lane 7 and 12). The CMV5T13'Notl primer pair was used to amplify a PCR product which migrated within the expected range of 2344 bp (lane 8 and 13). The TlS'/RRE3' primer pair was used to amplify a PCR product which migrated within the expected range of 840 bp (lane 9 and 14). The TI S'/MPMV3' primer pair was used to amplify a PCR product which migrated within the expected range of 1099 bp (lane 10 and 15). The oligo C/CMV8 primer pair was used to amplify a PCR product which migrated within the expected range of 71 1 bp (lane 11 and 16). The two clones were designated GTRC1 (lane 7 to Il) and GTRCP (lane 12 to 16). Minipreparations of MNDNA were also arnplified with CMVS'/MPMVSr (lane 2), CMVSr/T13'Notl (lane 3), Tl5'/RRE3' (lane 4). TlSIMPMV3' (lane 5) and oligoC/CMV3' (lane 6) primer pairs yielding no PCR product in each case. A Hinf l digest of PBR DNA was resolved in parallel with the 1631 bp and 506 bp products indicated. Fig. 9a Fig. 9b
Fig. 9c Fig. 9d
Figure 9 confirming the specificty of the reaction. Further characterization was done by restriction enzyme digestion on bth recombinants using the Sst I restriction enzyme since the construction of the recombinant would result in the addition of one more Sst
I site compared to the GT retroviral vector. Sst l analysis of the recombinants resulted in f ive cleavage products compared to four cleavage products resulting f rom
Sst I analysis of the GT retroviral vector (results not shown). The two recombinants were designated GTRC1 and GTRCP.
The GTR and GTC constructs were derived from the GTRCl parent retroviral vector by deleting the cte and rre sequences, respectively. The GTR clone was constructed by digesting GTRC1 with the Bcl I restriction enzyme and religation (Fig. 10). The
GTC clone was constnicted by digesting GTRC1 with the Sfi I restriction enzyme and religation (Fig. 10). GTR and GTC were characterized by PCR for detection of the deleted sequences using the TIS1/oligo B and T1S1/MPMV3'primer pair, respectively.
The expected product sizes migrated within the range of 974 bp (Fig. 1la, lane 2) and 648 bp (Fig. Ilb, lane 1) for GTR and GTC, respectively. PCR analysis of the
GTRC1 template with the TlS'/oligoB and T1S1/MPMV3' primer pairs yielded DNA bands migrating within the expected range of 1179 bp (Fig. Ila, lane 1) and 1152 bp
(Fig. Ilb, lane 2), respectively, confirming the deletions. The GTRCl parent retroviral vector was also used to constnict the GTA retroviral vector via Stu I digestion and religation (Fig. 10) (results not shown). The GTA retroviral vector is exactly the same as the GT retroviral vector except the former was derived from
GTRC1.
Construction of the mtGTRC, mtGT, mtGTR and mtGTC retroviral vectors: The retrovirai vector rntGTRC was constnicted to allow expression of the mutant gtl gene Figure 10. Restriction sites designeâ in the GTRC and mtGTRC retroviral vectors
The GTRC and mtGTRC retroviral vectors were designed with unique restriction sites to allow for the deletion of the therapeutic gene (flanked by Not 1) andor me (flanked by Sfi 1) and/or the cte (flan ked by Bcl i) sequences. ed in the GTRC and mtGTRC retroviral vectm
GTRC ILTR .II H rre LTR
rre cte ~LTR
Figure f O Figure 11. Construction of the GTR and GTC retroviral wctors a. The GTR clone was confirmed for the deleted CTE sequence by PCR. The GTR retroviral vector was derived from the GTRC1 parent retroviral by deleting the CTE sequence via digestion with Bcl I and religation. Minipreparation of DNA from a transfonned colony was analysed by a 10 pi Taq PCR using the TlS'loligo 6 primer pair. The PCR product was resolved on a 1% agarose gel (lane 2) and migrated within the expected range of 974 bp. A PCR reaction with the same primer pair using GTRCl template DNA was resoived in parallel (lane 1) and yielded a PCR pduct migrating within the expected range of 1179 bp. b. The GTC clone was confirmed for the deleted RRE sequence by PCR. The GTC retroviral vector was derived from the GfRCf parent retroviral by deleting the RRE sequence via digestion with Sfi I and religation. Minipreparation of DNA from a transfonned colony was analysed by a 10 pl Taq PCR using the Tl WMPMV 3' primer pair. The PCR product was resolved on a 1% agarose gel (lane 1) and migrated within the expected range of 648 bp. A PCR reaction with the same primer pair using GTRCl template DNA was resolved in parallel (lane 2) and yielded a PCR product rnigrating within the expected range of 1152 bp. Fig. llb
Figure 11 coding for a Gag-RNase Tl fusion protein with an inactive RNase Tl domain. Glu 58 and His 40, two of three amino acids essential for RNase Tl activity, were substituted for alanine by site directed mutagenisis via PCR. An overiap PCR using the rntTlS'/rntT13' primer pair, containing aie site directed mutations, were used to cansttuct a 108 bp mutagenized fragment of the rtl gene (Fig.12a, lane 3). The mtT15' and mtT13' primers were each resolved in parallel (Fig. 12a. lane 4 and 5).
The rtl gene was also amplified by PCR using the T1SS/T13'primer pair and resolved in parallel (Fig. 12a, lane 2). The 108 bp mutagenized PCR product was used to consttuct the retroviral vector mtGTRC by replacement of the wild type sequences within the GTRCl retroviral vector. An Mlu I restriction site was introduced into the mtT13' primer, overiaping the site directed mutations, to allow for screening of the mutant clone. Of 10 colonies screened by restriction enzyme digestion using Mlu 1, plasmid DNA frorn one colony gave digested cleavage products within the expected range of 7929, 1514, 2141 bp (Fig. 12b, lane 2). The mtGTRC retroviraf vector was subsequently used to construct mtGT, mtGTR and mtGTC retroviral vectors by deleting out the appropriate sequences using Stu 1, Bcl I and Sfi I restriction enzyme digestions, respectively. The digested products were then religated and transfomed.
Plasmid DNA extracted from 2 colonies each were analysed by PCR for detection of the deleted sequences using the T15'/oligo B, RRES'/oligoB and T15'/MPMV3' primer pair for aie rntGT, mtGTR and mtGTC retroviral vectors, respectively. The expected product sizes, migrating within the range of 443 bp (Fig. 12c, lane 5 and 6),
648 bp (Fig. 12c, lane 8 and 9) and 582 bp (Fig. 12c, lane 2 and 3) were detected for mtGT, mtGTR and mtGTC, respectively. PCR analysis of the mtGTRC DNA with the sarne Tl5'/oligo B, RRE5'/oligoB and T1 WMPMV3' primer pairs yielded DNA products which migrated within the expected range of 1179 bp (Fig. 12c, lane 7), Figure 12. Con.tructkn of the mtGTRC, mtGT, mtOTR and MCretroviral vectors a. The mutant RI gene fragment was ampiified by overlap PCR. The mtT15'/mtT13' primer pair was combined in a 50 pi Vent PCR. Frve microlitres of the PCR product was resolved on a 1% agarose gel (lane 3) and migrated within the expected range of 108 bp. 500 ng of the mtT15' primer (lane 4) and 500 ng of the mtT13' primer (lane 5) was resolved in parallel and migrated within the expected range of 63 bp. A 10 pl Taq PCR using the Tl SNotliT18Notl primer pair and GTRC1 template DNA was resoived in parallel (fane 2) and yielded a PCR product migrating within the range of 365 bp corresponding to the rtl gene. A Hinf I digest of PBR DNA was resoived in parallel (lane 1) with the 506 bp product indicated. b. The mtGTFtC retroviral vector was characterized by Mu I digestion. The ûamH VXho I digested mutant rtl gene fragment was combined in a tripartite Iigation reaction with the BamH VXho I digested products of GTRC1. DNA from a transformed colony was digested with Mlu I in a 10 pl reaction and resolved on a 1% agarose gel (lane 2) yielding products migrating within the expected range of 7927 bp, 2143 bp and 1514 bp. The GTRC parent retroviral vector, digested with Mlu I in a 10 pl reaction was also resolved in parallel (lane 1) and yielded products within the expected range of 10070 bp and 1514 bp. c. The mtGT, mtGTR and mtGTC retroviral vectors were confimied by PCR for the deleted rre-cte, cte and rre sequences, respectively. MtGT, mtGTR and mtGTC were denved from mtGTRC by restriction enzyme digestion with Stu 1, Bcl I and Sli 1, respectively, and subsequent religation. DNA from two transformed colonies for each construct were amplified in 10 pi Taq polymerase reactions and resolved on a 1% agarose gel. PCR amplification using the TlS'/MPMV3' primer pair yielded PCR products which migrated within the range of 582 bp (lane 2 and 3) corresponding to the mtGTC construct. A PCR reaction with the same primer pair using mtGTRC template DNA was resolved in parallel (lane 1) and yielded a product migrating within the expected range of 1152 bp. PCR amplification using the Tl 5'/oligo 6 primer pair yielded PCR products which migrated wiütin the range of 443 bp (lane 5 and 6) corresponding to the mtGT construct. A PCR reaction with the same primer pair using mtGTRC template DNA was resolved in parallel (lane 4) and yielded a product migrating within the expected range of 1179 bp. PCR amplification using the RRE5'/oligoB primer pair yielded PCR products which migrated within the range of 648 bp (lane 8 and 9) corresponding to the mtGTR construct. A PCR reaction with the same primer pair using mtGTRC template DNA was resolved in parallel (lane 7) and yielded a product migrating within the expected range of 848 bp. Fig. 12a Fig. l2b
Fig. 12c 1152 bp (fig. 12c, lane 1) and 848 bp (Fig. 12c, iane 7), respectively, confirming the deletions.
B. Testing GagRNase Tl Production in Tratwformed E. coli
Growth rate of E. coli cells transformed with GT and ôetoction of Gag-RNase
Ti by ELISA: The CMV prornoter was designed with a T7 promoter for studying expression in E. w/i (Studier et al., 1990). Once the GT retroviral vector was constructed, the growth rate of BL21 Ewli cells transformed with GTI, GT2 or GT3 retroviral vectors was rnonitored over time. The parent retroviral vector, MoTiN, was used as a control. Crude preparations of soluble fractions of the bacterial cultures were prepared 5 hr post-IPTG induction and tested for the production of the fusion protein by ELISA using HV-1 Gag antibodies (All analyses of the fusion protein by
ELISA, in this study, were done with HIV-1 Gag antibodies). All three samples showed similar amounts of Gag-RNase Tl demonstrating expression of the gtl gene from al1 three recombinants: GT1, GT2 and GT3 (Fig. 13b). The control sample did not contain any significantly detectable amount of HIV-1 Gag antigens. The growth rate of the three sets of bacterial cells producing Gag-RNase Tl were also sirnilar to cells not producing Gag-RNase (Fig. 13a), suggesting that Gag-RNase Tl was not toxic to bactenal cell growth. The GT1 retroviral vector was subsequently used for construction of the GTRC retroviral vector.
Detection of Gag-RNase Tl by ELISA in E. coli tmnsformeû with GTRC: After construction of the GTRC retroviral vector, the production of Gag-RNase Tl was also show in E. wli transformed with GTRC1 and GTRC2. The MoTiN and GT retroviral vectors were transformed in parallel as wntrols. Cnide preparations of soluble fractions, 5 hr pst-IPTG induction, were analyzed by ELISA. Similar amounts of
Gag-RNase Tl were detected in all three samples compared to the fraction isolated from E. colicells transformed with MoTiN (Fig. 14). demonstrating expression of the gtl gene from the GTRC1 and GTRC2 retroviral vectors.
C. Characteriration of RNase Tl Antiserum for Use in Detection of
Gag-RNase Tl or Mutant GagaNase Tl
Antigenic reactivity and rpecificity of RNase Tl antiserum: RNase Tl antibodies were raised in rabbits for specific detection of Gag-RNase Tl or mutant
Gag-RNase Tl in HlV-infected cells and viral progeny. RNase Tl antiserum can be used to detect the HIV Pro cleavage products of Gag-RNase Tl or mutant Gag-
RNase Tl in viral progeny to confimi copackaging of the fusion proteins. The antiserum was used to determine the reactivity with RNase Tl antigens by Westem
Blot analysis. A 1:100 (Fig. 15a, lane 3) and 1:400 (Fig. 15a, lane 5) dilution of the antiserum allowed for efficient detection of a protein in the 13 kDa range, corresponding to RNase Tl. A 1:IO0 dilution of preirnmune serum was also used to probe for the antigen. Westem Blot analysis did not reveal any antigenic reactivity in the preimmune serum (Fig. 15a, lane 1). The lack of a band using preimmune serum and the presence of one band using the antiserum confirmed the specificty of the
RNase Tl antiserum. In addition, an MT4 cell extract was probed with the antiserum at 1:IO0 and 1:400 dilutions (Fig. 15a lane 4 and 6) and preimmune serum at a 1:IO0 dilution (Fig. 15a, lane 2). Western Bot analysis of the MT4 cell extract did not reveal any antigenic reactivity using both RNase Tl antiserum and preimmune serum, confirming the absence of any cross reactivity with mammalian proteins. Precipitatiiig ability of RNam Tl antimrum: lmmunoprecipitation can allow the specific detection of minute quantities of the fusion protein from the HIV-infected cells and their viral progeny. To test the RNase Tl antiserum's capability for precipitating the antigen, different amounts of antiserum were used to immunoprecipitate 100 ng of purifieci RNase Tl previously mixed with an MT4 cell extract. The irnmunoprecipitate was then analyzed by Western Biot to determine the çpeclicity of antibody binding. Fwe microlitres (Fig. 1Sb, fane 2) and 8 pi (Fig. 15b, lane 1) of antiserum were able to precipitate a 13 kDa protein wrresponding to RNase Tl.
Precleanng the cell lysate with protein A-sepharose prior to immunoprecipitation with
8 y.i of antiserum albdfor more efficient precipitation since the intensity of the 13 kDa protein band was slightly higher (Fig. 1Sb, lane 5). One microlitre (Fig. 15b. lane
4) and 2 pl (Fig. 15b, lane 3) of antiserum were not able to precipitate RNase Tl.
Preirnmune serum (8 pl) was also used as a control for the specificity of the antiserum for RNase Tl antigens during immunoprecipitation. As expected, RNase
Tl could not be precipitated by the preimmune serum (Fig. 15b, lane 6). Only high molecular weight protein bands were detected (Fig. 1Sb, lane 6). These bands were obsenred in al1 lanes and must correspond to rabbit immunoglobulins. The gel indicates that the rabbit antiserum can precipitate RNase Tl specifically from rnammalian cell extracts since no contaminating bands were detected; however, the presence of higher rnolecular weight protein(s) comigrating with rabbit IgG cannot be excluded.
D. Testing Gag-RNase Tl Production in Transbntly Transfected 293J
Cells Figure 13. Growth rate of E. col/ prduclng Gag-RNam Tl a. Equal optical densities (600 nm) of growing cultures of E. coli transformed with MoTiN, GT1, GT2 and GT3 retroviral vectors were innoculated in 50 ml of LB medium and induced with IPTG at an optical density of 0.6. The optical density (600 nm) of growing cultures were measured every hour for 8 hr post- innoculation. b. At 5 hr post-IPTG induction crude soluble fractions of the bacterial cultures were prepared and analysed by ELISA for production of Gag-RNase Tl, No signifiant amount of fusion protein was detected in control cells transfomed MoTiN as compared to cells transfomed with GT1, GT2 and GT3 which had similar amounts of Gag-RNase Tl. Growth rate of E. coli nroducina Gaa-RNase Tl
Fig. 13a
Figure 13 Detection of Gag-RNase Tl bv ELISA in E. coli transformed with GT
Fig. 13b
GT1 GT2
Retroviral vector
Figure 13 Figure 14. Detecüon of Gag-RItbse Tl by EUSA in E. colitninsforrned with GTRC
Growing cultures of E. coli transformed with GTRC1 and GTRC2 retroviral vectors were innoculated in 50 ml of LB medium and induced with IPTG at an optical density (600nm) of 0.6. Growing cultures of E. dittansformed with MoTiN and GT were induced in parallel, as controls. At 5 hr post-IPTG induction crude soluble fractions of the bacterial cultures were prepared and analysed by ELISA for production of Gag- RNase Tl. No significant amount of fusion protein was detected in control cells transformed with MoTiN as compared to cells transformed with GT, GTRCI and GTRC2 which had similar amounts of Gag-RNase Tl. Detection of Gaa-RNase Tl bv ELISA in E. col transformed with -GTRC
Figure 14 Figure 15. Antigenic reacthrity and apeeificity of Rb= Tl antkerurn a. Western Blot analysis using RNase Tl antiserum. 100 ng of RNase Tl was resolved on SDS PAGE and probed with a 1:IO0 (lane 3) and 1:400 (lane 5) dilution of antisenrm and 1:100 dilution of preimmune serum (lane 1). A 13 kDa protein band corresponding to RNase Tl was detected using both dilutions of antise~mwhile no antigenic reactivity could be detected wiü~the preimmune serum. MT4 cell extract was resolved in parallel and probed with a 1:lOû (lane 4) and 1:40 (lane 6) dilution of antiserum and a 1:IO0 dilution of preimmune antiserum (lane 2). No antigenic reacüvity was observed in each case using MT4 cell extracts. b. lmmunoprecipitation using RNase Tl antiseum. 100 ng of RNase Tl was combined with Mr4 cell extracts and immunoprecipitated with 1ul (lane 4). 2 pi (lane 3), 5 pi (lane 2) and 8 pl (iane 1) of antiserum and 8 pi of preimrnune serum (lane 6). The cell lysate was also precleared with Protein A-Sepharose beads prior to imrnunoprecipitating with 8 pi of antiserum (lane 5). A protein band migratïng at 13 kDa wmsponding to RNase Tl was detected using 5 pl (lane 2) and 8ul (lane 1) of antiserum and the preclearing step (lane 5). A protein molecular weight maiker was resoived in parallel (lane 7) with the sites indicated. Fig. 15a
Fig. 15b
Figure 15 Detection of GaeRNase Tl by EUSA in the absence of Rev in transienity
transfecteû 293-T cella: Retroviral vectors were transfected into 293-T cells to
show whether production of Gag-RNase Tl could be detected in mamrnalian cells.
Detection of the fusion protein was expected from cells transfected with the GTC and
GTRC1 retroviral vectors designed to express the gtl gene constitutively, since HIV-
1 Rev was not provided in trans. The GT and GTR retroviral vectors were not
expected to produce Gag-RNase Tt in the absence of Rev. However, according to
results obtained by ELISA no significant arnount of fusion protein could be detected
in lysates of œlls transfected with GTC and GTRC1 (Fig. 16). As expected, no
significant amount of Gag-RNase Tl was detected in lysates of cells transfected with
GT and GTR (Fig. 16). The pCMVAR8.91 plasrnid, isolated by the same extraction
protocol, was transfected in parallel. The pCMVAR8.91 plasmid allows for gag gene
and rev gene expression under control of the CMV promoter. Analysis by ELISA
revealed the presence of significant amounts of HIV-1 Gag antigen in pCMVAR8.91
transfected cell lysates (Fig. 16), confirming the reliability of the transfection assay
and detection protocol. Cell lysates collected fmm MoTiN transfected cells contained
no Gag-RNase Tl, as expected (Fig. 16).
Pilot experiments were subsequently done with the constitutive retroviral vector,
GTC, to determine if lack of production of Gag-RNase Tl could be corrected by optirniring the transfection conditions in 293-T cells (Fig. 17). The parameters that were varied were amount of retroviral vector DNA (5 pg, 20 pg or 35 pg) time of exposure to DNA precipitate (6 hr or 16 hr) and the presence or absence of a glycerol shock. Cells were transfected with 10 pg of pCMVAR8.91 plasmid in each case. According to analysis of cell lysates by ELISA, no significant production of the fusion protein could be detected with a 6 hr (Fig. 17, condition 1) or 16 hr (Fig. 17, condition 2) exposure to DNA precipitate in the absence of a glycerol shock. In each
case, however, a significant amount of HIV-1 Gag antigen was detected in cells
transfected with pCMVAR8.91 (Fig. 17, condition 1 and 2). A rnock transfection was
also done in parallel in which no DNA was added. Analysis of mock transfected cell
lysates by ELISA detected no significant amount of HIV-1 Gag antigens, as
expected. Lysates of cells transfected with only 35 pg of GTC with 6 hr (Fig. 17,
condition 3) or 16 hr (Fig. 17, condition 4) of exposure to DNA precipitate and a
glycerol shock were analyzed by ELISA. Again, no significant production of Gag-
RNase Tl was detected; although, analysis of pCMVAR8.91 transfected cell lysates
revealed the presence of a significant amount of Gag antigen (Fig. 17, condition 3
and 4). These results demonstrate that the conditions of the transfection assay and
detection protocol cannot be an explanation for the Jack of detection of Gag-RNase
Tl in 293-T cells transiently transfected with retroviral vector DNA.
Detection of Gag-RNase Tl by EUSA in the prennce of Rev in transiently transfected 293-T œlls: To detemiine if the copraduction of the HIV-1 Rev protein
could allow for the production of the Gag-RNase Tl fusion protein, the GT, GTR,
GTC, GTRCl and GTRCZ retroviral vectors were cotransfected with the pSV-Rev
plasmid which encodes for HIV-1 Rev under control of the SV40 promoter. The amount of retroviral vector used was either 5 pg, 15 pg or 25 pg while the amount of
pSV-Rev plasrnid was kept constant at 5 pg. Analysis of each of the cotransfected ce11 lysates by ELISA revealed no significant production of the Gag-RNase Tl fusion protein (Fig. 18). A significant amount of Gag antigen was detected by ELISA in lysates of cells transfected with pCMVAR8.91, confiming the reliability of the transfection assay and detection protocol (Fig. 18). Analysis of mock transfected cell Figure 16. lkkctkn of Gag-Rlib~Tl by EUSA in the absence of Rev in transiently transfectd 293-T cells
Ten micrograms of MoTiN, GT, GTR, GTC, and GTRC retroviral vectors were transiently transfected into 5 X Io6 293-T cells. Cell lysates were analysed by ELISA 72 hr post transfection. No significant amount of Gag-RNase Tl could be detected. However, a significant amount of HIV-1 Gag protein was detected in cell lysates of 293- T cells transfected with 10 pg of pCMVAR8.91. Detection of Gaa-RNase Tl bv ELISA in the absence of Rev in translentlv transfected 293-T cells
Retroviral vector
Figure 16 Figure 17. ûetection of Gag-RNaw Tl by EUSA unôer varying condiüons In transiently tran- 293-1 cell.
The amount of DNA, time of exposure to DNA precipitate and application of glycerol shock were varied to optimize transfecüon conditions. The GTC retroviral vector was transiently transfected into 2 X 10' 293-T cells using 5 pg, 20 pg or 35 pg of DNA as indicated. The time of exposure to the precipitate was 6 hr (condition 1 and 3) or 16 hr (condition 2 and 4) and a glycerol shock was applied (condition 2 and 4) or not applied (condition 1 and 3). Cell lysates were analysed by ELISA; however, Gag-RNase Tl was not detected, whereas a significant amount of HIV-1 Gag protein was detected in cell lysates of 293-T cells transfected with 1 O pg of pCMVAR8.91. Cell lysates of mock (no DNA) transfected cells were also analysed by ELfSA in parallel (condition 1 and 2). No HIV-1 Gag antigen was detected from these cells. Detection of Gan-RNase Tl bv ELISA under varvina conditions in transbntlv tninsfected 293-T cells
HIV-1 p24 antigen (pgîml)
Retrovira vector @9) Condition #
Figure 17 Figure 18. Dotecüon of Gag4N.w Tl by EUSA in thu prosence of Rev in translentiy trandected 293-T celli
MoTiN, GT, GTR, GTC, GTRC1, and GTRC2 retroviral vectors were cotransfected into 2 X Io6293-T cells with the HIV-1 rev expressing plasmid, pSV-Rev, in varying ratios. In each cotransfection, 5 pg of pSV-Rev was transfected with either 5 pg, 15 pg or 25 pg of the retroviral vector. Cell lysates were analysed by ELISA 72 hi post- transfection. No significant amount of Gag-RNase Tl could be detected in each case. However, a significant amount of HIV-1 Gag protein was detected in cell lysates of pCMVAR8.91 transfected 293-T cells. Cell lysates of mock (no DNA) transfected cells were also analysed by ELISA in parallel (lane 1). NO HIV-1 Gag antigen was detected frorn these cells. Detection of Gaa-RNase Tl bv ELISA in the niesence of Rev in transientlv transfected 2934 cells
Retroviral vector @g)
Figure 18 lysateç by ELISA detected no significant amount of HIV-1 Gag antigen as expected
(Fig. 18). These results suggest that the lack of production of Gag-RNase Tl cannot
be rescued by the coproduction of HtV-1 Rev. The pSV-Rev plasrnid was previously
shown to produce Rev; however, no assay was used to detect HIV-1 Rev in our
cotransfection experiment. Therefore, the possibility that the pSV-Rev plasmid did
not produce HIV-1 Rev in this experiment cannot be excluded. In addition, this
experiment was repeated using another rev expressing plasmid with similar results
as above (results not shown).
E. Testing Gag-RNase Tl and Mutant GagRNaw T1 Production in
Stable MT4 Transâuctants
Stable transduction of the MT4 cell line: MoTiN, GT, GTA, GTR, GTC, GTRC1,
GTRC2, mtGT, mtGTR, mtGTC, and rntGTRC retroviral vector constructs were
transfected into Psi-2 cells resulting in G418 resistant colonies. Colonies of stable transfectants were counted and pooled (Table tV). Psi-2 vector particles were collected and used to transduce PA317 cells resulting in G418 resistant colonies.
Colonies of stable PA317 transductants were counted and pooled (Table IV). PA317 vector particles were collected and used to transduce MT4 cells to generate G418
resistant cells. Two previous attempts were made to generate MT4 transductants using a single round of infection with PA317 vector particles. Each attempt at infection was done using either 16 pg/ml of polybrene or 40 pg/ml of DEAE dextran; however, G418 resistant cells could not be selected. Although, the titres of amphotropic vector particles were not rneasured, two rounds of infection were required in the third attempt to select for G418 resistant MoliN, GT, GTA, GTR,
GTC, GTRCP, rntGT, and rntGTRC transductants (Table IV), suggesting the titres were low. G418 selection ensured that each population consisted entirely of transduced cells as indicated by complete killing of untransduced cells in parallel plates within three weeks. GTRC1, rntGTRC and mtGTC transductants could not be selected using two rounds of infection; however, the transduction procedure was not attempted again since Gag-RNase Tl or mutant Gag-RNase Tl could not be detected in other stable transductants (see betow).
Detection of Gag-RNase T1 and mutant Gag-RNase Tl by ELlSA in stable MT4 transductants: Cell lysates were prepared from MT4 cells transduced with MoTiN,
GT, GTR, GTC, GTRC2, mtGT and mtGTRC and analysed by ELISA for the production of Gag-RNase Tl or mutant Gag-RNase Tl (Fig. 19). Cell lysates of plain
MT4 cells were also analysed in patallel (Fig. 19). The production of the fusion proteins was expected in MT4 cells transduced with the GTC, GTRC2, and rntGTRC retroviral vectors, which were designed to produce Gag-RNase Tl constitutively in the absence of Rev. However, the production of th8 fusion proteins detected by
ELISA in Iysates of cells transduced with GTC, GTRC2, and mtGTRC was not signifiant since it was no different from that detected in plain MT4 cells (Fig. 19).
The positive mntrol used was a lysate of HIV (HXB-2)-MT4 cells which routinely produced detectable amounts of HIV-1 Gag protein (Fig. 19). As expected, no significant production of Gag-RNase Tl was detected by ELISA in lysates of cel!s transduced with GT, mtGT or GTR. Cell lysates collected from MoTiN transduced cells contained no Gag-RNase Tl, as well.
F. Analysis of DNA and RNA Extracted From a Stable M4Transductant
by PCR and RT-PCR PCR analysb of total DNA extra- from MT4 œlls transduced with GTR: To determine the presence and integrity of the retroviral vector in stable transductants, total DNA extracted from MT4 cells transduced with GTR was analyzed for retroviral sequences using the NeoS'INeo3' and CMVS1/CMV3' primer pairs. A 337 bp product was detected, as expected, using the Ne&' /Neo3' primer pair (Fig. 20a, lane 2). whiie no product could be detected in the PCR using the CMVS/CMV3' primer pair
(Fig. 20b, lane 3) indicating that the sequences for the CMV promoter were absent in the transduced MT4 cells. PCR analysis was al- performed using total genomic
DNA extracted fmm untransduced MT4 cells and with a maxipreparation or CsCl preparation of GTR retroviral vector DNA. PCR analysis of genomic DNA from untransduced MT4 cells using both primer pairs yielded no PCR product confiming the absence of contaminating retroviral vector sequences (Fig. 20a1 lane 1 and Fig.
20b1 lane 2). PCR analysis with the GTR vector only using the NeoS1/Neo3' and
CMVS1/CMV3' primer pair yielded as expected a 337 bp and 703 bp PCR, respectively (Fig. 20a, lane 3 and Fig. 20b, lane 4). These results suggest that the lack of Gag-RNase Tl in GTR transductants was associated with proviral DNA rearrangements leading to a deletion. However, the absence of a PCR product can also result from the possibility that the GTR vector particles were contaminated with
MoTiN DNA or a poor sensitivity of the PCR reaction with the CMV5'lCMVSyprimer pair.
RT-PCR analysis of total RNA extracted from MT4 cells transduced with GTR:
RT-PCR analysis of total RNA extracted from MT4 cells transduced with GTR was done using the NeoS'Meo3' and T15'K13' primer pair. A 337 bp product Table IV
Production of stable MT4 Cell transductants
[ Retroviral vector 1 Number of Pd-? 1 Number of PA317 ( Sti ible MT4 cell colonies colonks tra rductants ------~- - CV 75 250 Se ected GT 300 250 Se ected - -- GTA 90 80 Se ected GTR 150 80 Se ected GTC 120 200 Se ected GTRC 50 80 -
, GTRC2 60 80 Se ected MtGT 60 100 Se ected MtGTR 57 100 Mt GTC 122 100 Mt GTRC 75 1O0 Se ected
' These could not be selected Figure 19. Detectbn for Gag-RNiaa Tl and mutant Gag-RN.- Tl by ELlSA in stable MT4 tmnsûuctants
5 X 10' MT4 cells transduced with MoTiN, GT, GTR. GTC, GTRC2. mtGT and mtGTRC were lysed and analyzed by ELISA. A lysate of 5 X 10' plain (untransduced) MT4 cells was analysed by ELlSA in parallel. A lysate of HIV-1 (HXB-2) MT4 infected cells (positive control) was also analyzed by ELlSA in parallel. Detection of Gaa-RNase Tl and mutant Gaa-RNase Tl bv ELISA in stable MT4 transductants
plain MoTiN GT GTR GTC GTRC2 mtGT mtGTRC positive MT4 control
Figure 19 Figure 20. PCR and RT-PCR analyrk of total DNA and RNA extracted from Ml4 cells transduced with GTR a. Detection of the neo gene by PCR. Total genomic DNA was extracted from MT4 cells transduced with GTR and analysed by 10 jd Taq PCRs using the NeoS'/NeoS primer pair. Amplification by the NeoS'Neo3' primer pair yielded a 337 bp PCR product (lane 2). PCR analysis was also done using total genomic DNA extracted from nontransduced MT4 cells. No PCR product was detected usirig the same primer pair (lane 1). PCR analysis of the GTR retroviral vector DNA was performed using the NeoWNeo3 primer pair which yielded a 337 bp product corresponding to the neo gene (lane 3). A Hind Ill digest of lamda DNA was resolved in parallel (lane 4) with the 564 bp cleavage product indicated. b. Detection of the CMV promoter by PCR. Total genomic DNA was extracted from MT4 cells transduced with GTR and analysed by 10 pi Taq PCRs using the CMV5'/CMV3' primer pair. Amplification by the CMVWCMV3' primer pair yielded no PCR product (lane 3). PCR analysis was also done using total genomic DNA extracted from plain MT4 cells. No PCR product was detected using the same primer pair (lane 2). PCR analysis of the GTR retroviral vector DNA was performed using the CMV5'/CMV3' pRrner pair which yielded a 703 bp PCR product corresponding to the CMV promoter (lane 4). A Hind III digest of lamda DNA was resolved in parallel (lane 1) with the 564 bp cleavage product indicated. c. Detection of retroviral vector transcript sequences by RT-PCR. Total RNA was extracted from MT4 cells transduced with GTR and analyzed by RT-PCR using the NeoS'/Neo3' and T15'/T13' primer pairs. RT-PCR analysis using the NeoS'fNeo3' primer pair yielded a 337 bp product conesponding to transcripts containing neo sequences (lane 1). No RT-PCR product could be detected using the TlSKI 3' primer pair (lane 2). RT-PCR analysis of total RNA extracted from nontransduced MT4 cells using the NeoS'/Neo3' primer pair yielded no product (lane 3). Also no product was detected upon RT-PCR analysis of RNA extracted from GTR transductants using the NeoS'/Neo3 primer pair and no RT enzyme (lane 4). A 10 pi Taq PCR using the T15'K13' primer pair and a maxipreparation of GTR retroviral vector DNA was done in parallel and yielded the 365 bp product corresponding to the RIgene (lane 5). Fig. 20a Fig. 2Ob
Fig. 20c corresponding to neo sequences was amplified using the NeoWNeo3' primer pair, demonstrating the production of transcripts wntaining neo sequences (Fig. 20c, lane
1). No band was detected by RT-PCR analysis using the T15'K13' pair (Fig. 20c, lane2) suggesting that a proviral DNA reanangernent may have led to deletion of the entire cmv-gtl cassette. RT-PCR analysis of the total RNA extracted from untransduced MT4 cells using the NeoS'Neo3' primer pair did not yield a product
(Fig. 20c, lane 3), confirming the specificity of the faction. Also, no band was detected by RT-PCR analysis of total RNA extracted from GTR transductants using the NeoWNeo3' primer pair in the absence of the RT enzyme during reverse transcription (Fig. 20c, lane 4), confirming the absence of contaminating cellular
DNA. The 365 bp rtl gene was amplified by PCR analysis of GTR vector DNA using the TlS'K13' primer pair, in parallel, to confirm the use of the correct primer pair and the size of the expected product (Fig. 20c, lane 5). These results suggest that the entire expression cassette has been deleted; however the absence of an RT-PCR product can alço result from the possibitity that DNA used to generate GTR vector particles was contaminated with MoTiN DNA or that the RT-PCR was not very sensitive with the TlS'ml 3' primer pair.
G. Generation of Cell Line for Studying the Mode of Inhibition of Gag-
RNaseT1 or Mutant Gag-RNase T1
Design: A cell line capable of producing replication incompetent HIV was constructed as a tool to assess which step in the viral life cycle the therapeutic gene product will inhibit. Such a ceII line is advantageous since the progression of the Me
cycle can be analyzed in a synchronouç manner. The cell Iine was called the HVP- packaging cell line and is designed to produce replication incompetent viral particles containing HVP retroviral vector RNA, which serves to replace al1 functions of HIV
RNA. The cell Iine can be transfected or transduced with the gtl or mutant gtl genes to analyze the mode of interference dunng late steps in the viral life cycle. Also, replication incompetent virus produced from the HVP-packaging cell Iine can also be used to infect target cells expressing aie gtl or mutant gtl genes to analyze the mode of interference during early steps in the viral Iife cycle.
Construction of the HVP-packaging cell Iine: The HVP-packaging cell Iine was generated by stable transfection of the HVP retroviral vector into the p6 cell line. The
HVP retroviral vector contains al1 &acting sequences necessary for packaging, reverse transcription and integration of HVP vector RNA (Fig. 21). The p6 cell line contains the HXBbPl Aenv and TlRevEnv constructs allowing it to produce virus-like particles (Fig. 21 ). Upon removal of tetracycline, the inducible promoter of TlRevEnv is trans-activated allowing the production of HIV-1 Rev and Env. The accumulation of Rev in tum upregulates the production of HIV-1 Gag, Pol and Vif from
HXBAPlAenv which also produces HIV-1 Tat (Fig. 21 ). ûetection of p24 antigen in culture supernatants of p6 cells (by ELISA) demonstrated maximum virus-like particle production between day 7 and day 9 post-tetracycline withdrawal (Fig. 22). The HVP retroviral vector was transfected into p6 cells and two ta three weeks after puromycin selection approximately 50 drug resistant colonies were observed. The colonies were pooled and maintained in medium supplemented with puromycin (0.6 pglml) and tetracycline (0.2 pg/ml).
Transduction of MT4 cells wiür HVP vector particka: MT4 cells were cocultured
(in duplicate) with the puromycin resistant cell line on day 6 post-tetracycline withdrawal. A sisve, allowing only virus-iike particles to pas, was used to prevent contamination of MT4 cells with the HVP-packaging cells. During the coculture experiment, the amount of vector parücles pioduced each day was determined by analysis of supernatants using ELISA using HIV-1 Gag antibodies (Fig. 23). Gag antigen was detected in the supernatant of HVP-packaging cells wltured in the presence of tetracycline (Fig. 23, day 0). However, the amount of Gag antigen present in the supernatant increased significantfy after withdrawal of tetracycline (Fig.
23, day 1).
Total cellular DNA and RNA was extracted 48 hr post-coculture (day 8 post- tetracycline withdrawal) for analysis by PCR and RT-PCR, respectively. Transduction of MT4 cells with the HVP vector was demonstrated by amplification of a 41 1 bp product via PCR analysis of total genomic DNA extracted from both sets of cocultured MT4 cells using the Gag5VGag3' primer pair (Fig. 24a, lane 2.3). PCR analysis, using the same primer pair, of HVP vector DNA (Fig. 24a. lane 4) yielded a
411 bp product corresponding to sequences within the HVP gag gene. fn addition
PCR analysis, using the same primer pair, with no template DNA yielded no PCR product confinning the absence of contaminating gag sequences and the specificity of the reacüon. RT-PCR analysis of total RNA extracted from cocultured MT4 cells
(using the GagS1/Gag3' primer pair) yieMed a 41 1 bp product wrresponding to gag sequences, demonstrating the expression of HVP genes in transduced cells (Fig.
24b, lane 1 and 2). RT-PCR analysis of RNA extracted from HIV-1 (HXB-2)-infected
MT4 cells (using the same primer pair) also yielded a 41 1 bp product (Fig. 24b, fane
3). No RT-PCR product was detected when the RT enzyme was omitted during reverse transcription (Fig. 24b. lane 4) confinning the absence of contaminating cellular DNA within the RNA preparation. Transduction and expression of HVP genes was further confirmeci by demonstraüng puromycin resistance of coculhired MT4 transductants, which were rnaintained for two months in selective medium without any signs of cytotoxicity. Puromycin selection ensured that the entire population consisted entirely of transduced cells as indicated by complete killing of plain MT4 cells in parallel plates within two weeks.
Thus, the HVP-packaging cell line released transducible vector particles into the supematant. Furthemore, the amount of HIV-1 Gag antigen detected in the supematant was ten fold greater than that obsenred with the p6 cell line, suggesting a significantly higher titre. Figure 21. Schemaic construction of the HVP-packaging cell II-.
The HVP-packaging cell line was constructed by transfacting HVP into the p6 cell One. The p6 cell line contains the HXBAPlAenv and TlRevEnv constructs allowing it to produce virus-like particies. Upon removal of tetracyclin, the inducible promoter of TIRevEnv is transactivated allowing the production of HIV-1 Rev and Env, The accumulation of Rev in tum upregulates the production of HIV-1 Gag, Pol and Vif from HXBAPl Aenv, which also produces HIV-1 Tat. The HVP retroviral vector contains al1 HIV cisacting sequences necessary for packaging, reverse transcription and integration. This figure is wmpiled from Yu et al., 1996. Schematic construction of the HVP-~ackaainacell Iine
p6 cell line:
Tetracycline withdrawal
env rre
Figure 21 Figure 22. Dutectbn of HWl Gag by EUSA from cuiture supernatant8 of induced p6 cells
Two million p6 ceils were seeded without tetracycline and medium supematants were analysed by ELISA for viral particle production. The cells were split every two days by seeding 2 X 10~cells.The peak virai particle production was detected on days 7 to 9. Detection of HIV-1 Gaa bv ELISA trom culture sucmrnatants of induced ~6 cells
day 3 day 5 day 7 day 8 day 9 mm(daya)
Figure 22 Figure 23. Detedion of HIV-1 Gag by EUSA from culure rugsrnatants of inducd HVP-pacicaging celk.
1.5 X 1o6 HVP-packaging cells were seeded on day O and tetracycline was withdrawn on day 1. Medium supernatants were analysed for production of replication incompetent HIV by ELISA using HIV-1 Gag antibodies. The peak of vector particle production was detected on days 4 to 9 post-tetracyclin withdrawal. MT4 cells were cocultured with the cell line (in duplicate) on day 6,7 and 8. Detectlon of HIV-1 Gaa bv ELISA from culture sumrnatants of Induced HVP-nackaalna cells
day O day 1 day2 day 3 day4 day 5 day 6 day 7 day 8 day 9 nm(days)
Figure 23 Figure 24. Transduction of Mi wlls using replication incompetent HN
b. PCR analysis of MT4 cells transduced with replication incompetent HIV. The T7- Gaw-Gag3 primer pair was used in 10pi PCR reactions to amplify HVP sequences from total DNA erttacted from MT4 cells cocultured (in duplicate) with the HVP-packaging cell line. The PCR products were resoived on a 1% agarose gel (lane 2 and 3) and migrated within the expected range of 41 1 bp corresponding to a fragment of the HIV-1 gag gene. A PCR reaction with the same primer pair using positive controt HVP DNA (lane 4) and no template (lane 5) was also resolved in parallel. A PCR product migrating within the expected range of 411 bp was detected using the HVP template (lane 4) and no product was obsewed using the primer pair alone (lane 5). One microgram of a Hind III digest of lambda DNA was resolved in parallel (lane 1 and 6) with the 564 bp product indicated. b. RT-PCR analysis of MT4 cells transduced with replication inmmpetent HIV. The T%Gag/TTGag3' primer pair was used in 10 pi Taq PCR reactions to amplify HVP cDNA sequences from total RNA extracted from MT4 cells cocultured (in duplicate) with the HVP-packaging cell line. The RT-PCR products were resolved on a 1% agarose gel (lane 1 and 2) and migrated within the expected range of 411 bp coresponding to a fragment of HIV-1 gag cDNA. An RT-PCR reaction with the same primers using positive controt HIV RNA (HXB-2) was resolved in parallel (lane 3) and yielded a product migrating within the expected range of 41 1 bp. FIT-PCR analysis was also done on RNA extracted from cocultured MT4 cells but without the RT enzyme. This reaction was resolved in parallel and yielded no product (lane 4). Fig. 24a
Fig. 24b
Figure 24 Chapter 4. D#scussion
A Discussion of Results
Retroviral vector construcfion: Overlap PCR was used to generate the cmv-gtl, rre and cte inserts for subcloning into the MLV retroviral vector. Overiap PCR is an ideal strategy to constnrct the inserts since there is no dependency on specific restriction sites (Horton et al., 1989); rather, flanking pnmers can be designed with tails containing the appropriate restriction sites to albw subcloning. The prirners were designed with at least six extra nucleotides flanking the restriction sites since restriction enzymes may fail to cleave at the ends of the PCR product (Moreira and
Noren, 1995). Each primer pair was tested for specificity by demonstrating the absence of a product using a template without the desired sequences and the presence of only one product with the correct size using a template with the desired sequences.
The inserts generated by PCR were agarose gel purified to remove prirners and polymerase enzyme which may interfere with the subsequent restriction enzyme digestion required for subcloning. Unlike the vectors, successful digestion of the inserts generated in this study could not be determined by agarose gel analysis since the cleaved and uncleaved products were similar in size. Control experiments were done in parallel for restriction enzyme activity. However, the only assay confirming that the PCR products were indeed digested was the retrieval of the desired recombinant after transfonning the Iigated products. The randorn joining of compatible ends during ligation can produce infinite cornbinations of which only one combination is wanted. Ligation processes can produce dimers, trimers, tetramers etc. with al1 possible combinations and orientations including cyclization. To reduce the possible combinations, a forced directional cloning strategy was empioyed to constnict the GT, GTRC and mtGTRC retroviral vectors. Such a strategy is prefened since an asymmetric Iigation will have a rate of cydization of vector alone or insert atone of zero- The only rate detennining step is the formation of large oligorners. Even then high order oligomers should not present a significant problem since large DNA will transfomi E. wli less efficiently.
Generally, low concentrations of the DNA were used to enhance the recombinant efficiency so that slow bimolecular associations between the reactants would be followed by unimolecular cyclization.
Forced directional cloning was used to construct the retroviral vector GT. For the construction of the GT retroviral vector, 3 out of 22 colonies screened by PCR were the desired recombinant as demonstrated by PCR and restriction enzyme analyses.
Thus, the recombinant efficiency was quite low at 14%. Colonies containing non- recombinant clones most likely arose from contaminating undigested or inwrnpletely digested MofiN plasmid DNA carried over during the isolation of the digested MoTiN cleavage product. In addition, the low frequency of recombinant clones may have resulted from inefficient cleavage of the terminal restriction endonuclease sites of the
PCR product.
Forced directional cloning using a tetrapartite ligation strategy was used to construct the retroviral vector GTRC. Four out of 45 colonies screened by PCR were the desired recombinant as demonstrated by PCR and restriction enzyme analyses. The recombinant efficiency was also low a? about 9%. The low recombinant frequency also suggests that MoTiN and GT retroviral vectors were undigested or incornpletely digested and cameci over during oie isolation of the digested products resulting in the formation of nonrecombinant mlonies. In addition, the trimolecular reaction followed by cyclization is a rare event. GTRC was designed to contain restriction sites such that sequences wuld be spliced out to create GTR and GTC retroviral vectors via an intramolecufar ligation. The recombinant efficiency ranged from approximately 50-
100%. which was expected, given that it was a unimolecular reaction. Again, undigested or incompletely digested retroviral vectors may have been carried over during the isolation of the digested product resuiting in the formation of colonies with nonrecombinant clones.
The retroviral vector mtGTRC was designed to express a mutant version of the gtl gene. The mutant gtl gene encodes a Gag-RNase Tl fusion protein with an inactive
RNase Tl domain. Overlap extension by PCR was used to create a fragment of the
RI gene containing the site-directed mutations (Ho et al., 1989). The PCR fragment was subsequently replaced into the wild type gtl gene in the GTRC retroviral vector to create the mtGTRC retroviral vector, The rnethod depended on the proximity of appropriate restriction sites. Since convenient restriction sites were available in the region of the HI gene to be mutated, the mutant DNA fragment could be arnplified from the GTRC retroviral vector and replaced back into the wild type gene using a tripartite ligation strategy. Two primers were designed in opposite orientations, with a
20 nucleotide cornplementary region. The overlap allows one strand from each fragment to act as a primer on the other, and extension resutts in production of the mutagenized PCR product. The primers were designed with the appropriate point mutations so that the wild type Hi540 and Glu58 codons were replaced with alanine codons. The two amino acid substituitons are sufficient to render the RNase Tl domain inactive (Steyaert and Wyns, 1993). Since flanking primers were not designed, the mutant DNA product was not amplified. Thus, large quantities of the initial primers were included in the reaction to make required amounts of the product.
The PCR product was subsequently subcioned into GTRC. The desired mutation was confirrned by restriction enzyme analysis using Mlu I for one out of three coionies suggesüng a recombinant frequency of 33%; although, such a small sample size would not reflect the total population of colonies.
The methods used to characterize the above recombinants in this study were restriction enzyme analysis and PCR. Thus, the means of identification relied only on product size. Therefore, we may not conclude that the particular constructs did contain the sequences intended. This observation may be especially significant since PCR was used to construct the retroviral vectors.
Construction of the cmv-gtl cassette by overlap PCR required the joining together of the cmv, gag and rfl PCR products. Thus, the gtl gene was subject to four different sets of amplification by PCR before being subcloned into the retroviral vector, MoTiN, to construct the GT retroviral vector. The rfl gene was again amplified by PCR from the parent retroviral vector, GT, two more times to construct the GTRC or mtGTRC retroviral vectors. Thus, the gtl gene would have undergone a total of six sets of amplification by PCR before constructing the GTRC or mtGTRC retroviral vectors.
Also, the cmv, ne and cte sequences wouM have undergone a total of two sets of amplification by PCR before constructing the GTRC and mtGTRC retroviral vectors. Pfu and Vent polymerases were used in the construction of the retroviral vectors to
reduce the chance of mutation since they have a 3' to 5' exonuclease activity. the average mutation rates (mutation frequencyhp/cyde) introduced by Pfu or Vent DNA
polymerase is 1.3 x los and 2.8 x IO*, respecbively (Cline et aL, 1996). This is
better aian Taq polymeraw whose average mutation rate is 8 x 10" (Cline et aL,
1996). In addition, Pfu and Vent polyrnerase do not kave extra terminal bases like
Taq DNA polymerase does; thus, the open reading frame is maintained when two genes are fuçed by overlap PCR without further modification. Also iarger amounts of template DNA were used to reduce the number of cycles required to generate
required amounts of product. Using a higher copy number of template should reduce the chances of undesired mutations. A sample containing a few copies of the DNA template would result in a greater Iikelihood of mutations since a misincorporation in an early amplification cycle would be propagated through subsequent cycles and
represent a signifiant portion of the final product. Starting with more of the specific target template allows for the generation of the final product after fewer cycles of
PCR amplification, thereby, decreasing the chances of an incorrect base being introduced by the polymerase.
Although the above practical and theoretical considerations suggest Mat the probability of introduction of mutations is low, only sequence analysis can finly allow us to conclude that the constructs do contain the sequences intended.
Detection of Gag-RNam Tl in E. colk The GT1, GT2, and GT3 recombinants were transformed into E. wli, induced with IPTG and allowed to produce Gag-RNase
Tl over time in growing cultures. Cnide preparations of soluble fractions were analyzed for the detecüon of antibody binding activity by ELISA using HIV-1 Gag antibodies (patient antiserum). All three fractions collected five hours post-IPTG induction had signif icant amounts of antibody binding activity compared to the control. The GT1 recombinant was subsequently chosen to wnstruct the GTRC and mtGTRC retroviral vectors. The detection of Gag-RNase Tl in crude soluble fractions was also shown by ELISA from induœd bacterial cultures transfonned with the GTRCl and GTRC2 recombinants. nie level of production of Gag-RNase Tl by both GTRC recombinants were similar to that praduced by the GT retroviral vector-
This was expected sinœ the instablilty of HIV-1 gag transcripts is restricted to mammalian cells. The GTRCt recombinant was subsequently chosen to construct the mtGTRC retroviral vector.
The detection of the Gag-RNase Tl fusion protein demonstrates that the design of the gtl cistron allowed for successful expression using the l7 promoter. Western
Blot analysis of the fusion protein was not done, but will be necessary to confirrn that a full length protein was produced. In addition, RNase Tl antiserum (see below) can be used to detect the that the RNase Tl domain is present within the fusion protein.
Bacterial expression of genes has most often resulted in insoluble products that must be solubilized under strong denaturing conditions and then renatured before antigen binding actnlity can be detected. The polyclonal pool of HIV-1 Gag antibodies used to detect the fusion protein in E. coli is predicted to contain antibodies that are able to bind conformational epitopes suggesting aie presence of correctly folded, imrnunoreactive protein. The proper folding of the fusion protein suggests that the functional properties of the HIV-1 Gag domain in the Gag-RNase Tl fusion protein are maintained. The rate of growth of bacterial cells producing Gag-RNase Tl, as demonstarted by
ELISA, were similar to control cells. When assessing the growth rate of bacterial cultures producing Gag-RNase Tl it is important that the growth rate of plasmid- containing bacteria is being assessed. The toxic effect of foreign proteins can lead to the loss of vectorantaining bacteria from the cultures. Since am picillin selection tends to be lost in cultures as the drug is degraded by the secreted f3-lactamase
enzyme and by the drop in pH that usualty accompanies bacterial fermentation
(Studier et ai., 1990). kanamycin was also used in the selection meduim. Thus, growth of bacterial cells could not be attributed to cells that lack the vector since both ampicillin and kanamycin were maintained throughout the time course. This suggests that the vector was maintained in a significant proportion of cells. This experirnent can be improved by using a plasmid producing a known toxic gene product to see the effects of toxicity on the growth rate of bacterial cells.
The lack of any obvious cell death observed in bacterial cells cannot necessarily be extrapolated to the lack of cytotoxicity in human cells. Cytotoxicity of Gag-RNase Tl fusion protein can be potentially due to the function of the Gag domain and/or the
RNase Tl domain. Since Gag contains a membrane binding domain, the fusion protein may be able to generate virus-like particles from the plasma membrane. E. coli cells do not have intracellular membrane networks and in addition contain a celi wall which may prevent any cytotoxicity due to such budding rnechanisms. Thus, any potentially cytotoxic properties of the fusion protein due to the Gag domain in human cells may not be sufficiently modeled in bacterial cells. The RNase Tl domain of aie fusion protein can also potentially exhibit toxic effects in human cells via cleavage of cellular RNA like mRNA or rRNA. Since cellular RNA is available for cleavage in E. wli, any potential toxic properties of the fusion protein due to the RNase Tl domain may be sufficiently modeled in E. wli. However, Iack of RNase activity of the Gag-RNase Tl fusion pmtein cannot be excfuded as a probable reason for lack of RNase mediated toxicity in bacteria.
RNase activity of the Gag-RNase 11 fusion protein was not fumer investigated at this stage since a result showing the lack of RNase activity would still not rule out that any of the HIV protease processed products of Gag-RNase Tl could be active in HIV infected cells or viral particles. In addition, lack of RNase activity of any of the proteolytically cleaved fusion pmducts of Gag-RNase Tl will not undermine Our strategy since the fusion protein can be designed to retain the HIV-1 protease cleavage site between the NC and RNase Tl domain.
Antigenic reactivity and specHlcity of RNase Tl antiserum: RNase Tl antibodies were raised in rabbits. Western Blot analysis using the RNase Tl antiserum was shown to detect a single protein of an apparent molecular weight of 13 kDa, when purified RNase Tl mixed with mammalian cell lysates was analyzed. This result combined with the observation that no protein was detected by Westem Blot analysis using the preimmune serurn confirrned the presence of an antibody population specific for antigenic deterrninants unique to RNase Tl.
Immunoprecipitation combined with Western Blot analyses of RNase Tl from a mammalian cell lysate was done to show that the antiserum does contain precipitating antibodies. Westem Blot analysis of RNase Tl (immunoprecipitated from the cell extract using the preimrnune serum) with RNase Tl antiserum detected no band. Westem Biot analysis of RNase Tl (immunoprecipitated from the cell extract using RNase Tl antiserum) with RNase Tl antiserum detected a single protein of an apparent molecular weight of 13 kDa corresponding to RNase Tl. The above observations confinn that the RNase Tl antiserum specifically precipitates proteins containing FiNase Tl antigens. No cross reactivity wuld be detected in this experiment; although, high molecular weight proteins may have been present but not detectable on the gel since they could be comigrating with the rabbit immunoglobulins present in the immunoprecipitate. However, analysis of MT4 cell iysates with Western Blot alone, using RNase Tl antiserum confims the absence of any cross reactivity with proteins produced by MT4 cells.
Future studies of HIV-infected cells expressing the gtl or mutant gtl genes with a combined irnmunoprecipitation and Western Blot analysis protocol is expected to allow for sensitive detection HIV Pro processed Gag-RNase Tl or mutant Gag-
RNase Tl without the need for concentrating large amounts of viral particles.
Transient and stabk cell systems to test expression of the gtt -ne: The expression of the gtl gene was tested in mammalian cells using transient and stable expression assays. Gag-RNase Tl could not be detected in cell lysates of 293-T cells transiently transfected with the retroviral vectors GT, GTR, GTC, and GTRC alone. Expression of the gtl gene was not expected from the GT and GTR retroviral vectors but was expected in the case of the GTC and GTRC retroviral vectorç since they contained the CTE. Lack of expression could not be attributed to the transfection assay and method of detection since the pCMVAR8.91 plasmid, when transfected in parallel, produced significant amounts of HIV-1 Gag protein. Thus,
293-T cells can produce quantities of antigenically active product, detectable by
ELISA from phsmids expressing the gag gene under wntrol of the human CMV promoter. However, no conclusions could be made as to whether the problem was at the level of transcription, mRNA stability, translation or protein stability.
The transfection conditions were subsequentfy varied using the GTC retroviral vector to determine if experimental conditions could be optimized. The primary factors that influence efficiency of calcium phosphate transfections are the amount of DNA in the precipitate, the fength of time the precipitate is left on the cells and the use and duration of a glycerol shock. These parameters were, thus, varied in pilot experiments. However, analysis by ELISA of transfected cell lysates under these varied conditions Hill didn't reveal the presence of Gag-RNase Tl. The retroviral vectors were subsequenlty co-transfected with an HIV-1 rev expressing plasmid, pSV-Rev, to see if the inability of the retroviral vectors to produce Gag-RNase Tl could be rescued by coproduction of HIV-1 Rev. Cell lysates of co-transfected 293-T cells were analyzed by ELISA and did not reveal the presence of the Gag-RNase Tl fusion protein. These results suggested that the retroviral vectors were unable to produce Gag-RNase Tl in mammalian cells. Use of a second rev expressing plasmid yielded the same results. The production of Rev was not assayed in these experirnents and it is, therefore, unclear whether a Rev-response was indeed induced. This experiment can be improved by using a control plasmid that manufactures a detectable gene product in a Rev-inducible manner to show the presence of a Rev-response.
The production of Gag-RNase Tl was subsequentiy tested in a stable system. The retroviral vectors were used to transduce MT4 cells. Stable MT4 transductznts were selected via resistance to G418. Gag-RNase Tl production was tested in MT4 cells transduced with MoTiN, GT, GTR, GTC, GTRC2 and mtGTRC. The gtl gene product was not expected in the GT cell lysate, since no post-ttanscnptional controf mechanisrn was provided in this retmviral vector. MT4 cells transduced with GTC,
GTRC2 and mtGTRC retroviral vectors were expected to produce Gag-RNase Tl constitutively. However, analysis of lysates of MT4 cells transduced with GTR, GTC,
GTRC2 and mtGTRC retroviral vectors by ELISA did not reveal the presence of any fusion protein.
The results of the transient cell system and stable ceil system both demonstrate the inability of the constitutive retroviral vectors to produce the fusion protein Gag-RNase
Tl or mutant Gag-RNase Tl in mammalian cells. Thus, a discrepancy does exist with regards to expression of the gtl gene in E. coliversus rnammalian cells.
The level of gene product in eukaryotes is a function of several variables which include promoter elements, intron requirements, 3' end formation, the context of the initiation codon, secondary structure and length of the S'UTR, sequences within the
S'UTR, localization and export of mRNA, mRNA stability and protein stability. These issues wiil be addresçed below.
The gtl gene and mutant gtl gene were designed under control of the human CMV promoter. The HIV-1 Gag protein was detected in transiently transfected 293-T cells using the pCMVAR8.91 plasmid indicating that the rate of RNA polymerization and the required transcription factors were sufficient for CMV driven expression of the
HIV-1 gag gene. Although, no sequenœ analysis was done, inactivation of the promoter may have occuned due to mutations introduced into the cmv sequence during cloning via PCR. There is no evidence of specific intron requirements for the expression of the HIV-1 gag gene. Previous constnicts allowed for the efficient expression of the HIV-1 gag gene without the requirement for splice sites (Trono et al., 1989; Smythe et al., 1994,
Bray et al., 1994). Thus, the gtl or rnt gtl genes are predicted to have no specific intron requirements.
The retroviral vectors were able to produœ the neo gene pioduct since stable transductants were resistant to the drug G418. This suggests that the required 3' end processing mechanisms are available in the 3' LTR for successful production of a gene product.
The context of the initiation codon of the gtl and mt gtl genes was maintained as in the wild-type HIV-1 gag gene expressed in the pCMVAR8.91 plasmid (Dull et al.,
1998). Thus, it is predicted that the context of the initiation codon is sufficient for gtl expression. The eukaryotic translation mode1 involves ribosomal scanning.
Ribosomal scanning is known to be inhibited by strong secondary stnicture in the 5'
UTR. Studies have shown that the HIV-1 packaging signal may cause significant translational inhibition of HIV-1 Gag mRNA in vitro (Miele et al., 1996). The packaging signal of HIV-1 is composed of four stem-lwps. Three are located just upstream and one just downstream of the AUG initiation codon of gag rnRNA. In vivo, the gag gene can be expressed efficiently in the absence of al1 three upstream stem-loop structures (Miele et al., 1996). Thus, in designing the 5' end of the gtl or mutant gtl genes ail three upstream stem loops were excluded, leaving only 8 nucleotides upstream of the ATG initiation codon. Thus, no extensive secondary structure is predicted to inhibit translation of the gtl or mutant gtl gene products. Sequences within the 3' UTR may effect the stability of the transcript; however, the
RRE and CTE elements have been shown to alkw efficient gene expression of the gag gene when included in the 3' UTR (Bray et al., 1994). Thus, it is predicted that the RRE andor CTE provide al1 the necessary information for the efficient stability and nuclear export of the gtl transcript. Furthemore, since resistance to G418 was observed in transfected/transduced cells, it is expected that the transcripts produced were stable. However, the Gag-RNase Tl or mutant Gag-RNase Tl proteins may be unstable in the mamrnalian cell systems used in this study since the determinants of protein stability in prokaryotes may differ substantially from eukaryotes.
The above considerations rnay be addressed by sequencing the cmv-gtl-ne-cte expression cassette to firmly understand if their was any genetic reason for the observed iack of detection of Gag-RNase Tl in mammalian cells.
In addition to mutations within the cmv-gtl-rre-cte expression cassette the design of the retroviral vector in this study may be a basis for the fack of production of the fusion proteins. Other studies have shown that proviral DNA rearrangements or promoter suppression have been associated with the design of muitigene retroviral vectors (Emerman and Temin, 1984; Ernerman and Temin, 1984b; Emerman and
Temin, 1986; Xu et al., 1989; McLachlin et al., 1993; Schott et al., 1996).
PCR analysis of total cellular DNA extracted from MT4 cells transduced with the GTR retroviral vector failed to yield an amplicon of the expected size; although other neo sequences could be detected. In addition, RT-PCR analysis of total RNA extracted from the same cefls revealed the absence of dl sequences within the transcript.
These preliminary results suggest that the entire cmv-gtl cassette was deleted. Thus, the iack of gtl expression in stable MT4 transductants may have been associated with proviral DNA rearrangements. However, the absence of a PCR or
RT-PCR product cannot be used to firmly conclude a deletion since the absence of a product may also result from a low sensiüvity of the PCR or RT-PCR. For example, it is not clear whether the PCR or RT-PCR analysis couid detect the intended sequences in a situation where it is known to be pressnt amid total cellular DNA or
RNA. Thus, it wiit be necessary in the future to analyze other stable transductants produced in this study and to design appropriate prirners to map the putative deletion. However, stable transfection of retroviral vector DNA into Psi-2 cells and subsequent transduction of PA317 and MT4 cells demonstrates efficient gene expression by the 5' LTR and intemal HSV MAR promoter. Possibly, G418 selection of the population of MT4 cells has enriched for a clone(s) containing a specific DNA rearrangement that abolishes gtl or mt gtl gene expression from the integrated proviral DNA. It has been previously documented that the functional selection for one promoter can lead to inactivation of the other promoter either through genetic or reversible epigentic phenornena (Emerrnan and Temin, 1984;
Emerman and Temin, 1986).
In retroviral vectors containing two promoters and two genes, selection for expression of one of the genes has been show to result in partial or entire suppression of the other closely Iinked gene (Ememan and Temin, 1984a; Emerman and Temin. 1986). The suppression of one promoter seems to be necessary for efficient expression from the other promoter. The suppression is cis-acting and reversible (Emerman and Temin, 1986). Thus, the expression of one cistron is epigenetically suppressed. The retroviral vecton used in this study have three promoters and two genes. The drug G418 (a translation inhibitor) induces either complete or partial growth inhibition in mammalian cells. The transposon Tn5 neo gene encodes neomycin phosphotransferase, an enzyme that metabolically inactivates G4l8 (Colbere-Garapin et al., 1981 ). Since adjacent promoters present in the same vector cm interfere with each other, a rare event silencing the intemal
CMV promoter through proviral DNA rearrangement or some other mechanism is
Iikely to increase the expression of the neo gene and therefore provide cells with a growth advantage in the presence of G418. Such cells gain a selective advantage with an increase in duration of G418 selection. It is possible that a similar mechanism resulted in the retroviral vectors constructed in mis st~dy.The retroviral vectors may have been subject to deletions because suppression of a downstream promoter by two upstream promoters is too profound to be tolerated. Therefore, only variants that delete the intemal promoter can express the neo gene at a levei above that needed to give drug resistant cells. Deletions can occur at regions of homology.
It is also possible that deletions are caused by the asymmetric jumping of reverse transcriptase during the production of ecotropic and amphotropic vector particles.
Indeed, retroviral vectors containing three promoters and two genes have also previously been shown to result in the deletion of the entire nonselected gene and promoter (Emerman and Temin, 1984b).
An explanation for observing such a phenomenon with the retroviral vectors constructed in this study may be unclear since Tev-RNase Tl was produced from a retroviral vector containing three closely linked promoters (Singwi et al., 1999). In addition, the construction of MLV retroviral vectors capable of expressing three inserted genes from independently transcribed mRNAs has been previously shown in another study (Overell et al., 1988). Transcription in both studies was controlled by the vector LTR and the intemal promoters HSV tk and SV4O. The data in both studies showed that a triple promoter retroviral vector can be stably transduced by
retroviral infection without proviral DNA rearrangement. The difference between the
results in this study and those obtained with the two other shidies remain to be
established. A possible expianation is the choice of promoters used since an obvious difference between this study and the others is that the CMV promoter was
chosen as opposed to the SV40 promoter. It is less likely that the vector backbone
itseff is inherentfy unstable since the tevtl gene could be expressed using the same
retroviral vector backbone (Singwi et al., 1999).
The lack of expression of the gtl gene in the transient system can only be
hypothesized since no analysis of proviral DNA or Gtl transcnpt levels were done.
Lack of expression could not be attributed to DNA stability since the same DNA was successful in selecting stable Psi-2 transfectants. Enrichment of cells containing a deletion of a closely linked promoter would not have been expected in the transient system since no selection period was applied during the experiments as in the case of MT4 cells. It is possible that the lack of expression from the constructs is due to some cis-acting phenornenon suppressing only the downstream CMV promoter.
Although, retroviral vectois expressing a selectable marker and a heterologous gene using three promoters have been shown to allow efficient expression after stable transfection, the results of other studies indicate that certain promoter combinations or DNA sequences may result in the functional inactivation of the promoter driving expression of the heterologous gene. Thus, in addition to mutations introdumd during cloning, a putative reason for the lack of expression of the gtl and mutant gtl genes is the use of closely linked promoters in the retroviral vectors used in this study. The requirement of closely linked promoters rnay entail a variety of genetic and epigentic phenemenon such as proviral DNA rearrangement and promoter silencing. Although the expression of oie selectable marker can be maintained. expression of the heterologous gene can be low or lost completely. Selective pressure may favour a structural rearrangement within the vector or promoter inactivation. In contrast, biscistronic vectors can more efficiently express two genes.
The genes are transcribed from the same prornoter and separated by an internat ribosome entry site (IRES) which ailows two cistrons to be translated independently from a single transcript (Cheng et al., 1997). The transcription of the genes is achieved coordinately thus reducing the chances that one of the genes wifl be downregulated over time. Biscistronic vectors should thus allow improved stability of gene expression. In addition, by circumventing the need for an intemal promoter the biscistronic vector allows for a smaller genorne size allowing for the insertion of larger genes. The gtl-ne-cte and mutant gtl-ne-cte cassettes are currently being subcloned into a biscistronic retroviral vector (see Future Studies).
Generation of replication incompetent HIV: An inducible fiela-based cell line capable of producing replication incompetent HIV was established and designated the HVP-packaging cd1 line. The HVP-packaging cell line can be used as a tool to assess the mode of inhibition of a therapeutic gene product early in the HIV Iife cycle versus late in the HIV life cycle.
In order to establish a cell line producing replication incompetent WIV, stable transfectants were selected for by puromycin selection after introducing the HVP constwct into aie adherent p6 cell Iine (Yu et al., 1996; Haselhorst et al., 1998). The p6 cell line is tetracycline-inducible (i.e. genes aie expressed upon rernoval of tetracycline) (Yu et al., 1996). The HIV-1 Gag antigen in the supernatant of p6 cells peaked between &y 7 and &y 9 post-tetracycline withdrawal. Thus, the p6 cells did allow efficient release of the viral proteins into the supernatant suggesting the formation of virus-like particles. The HVP plasmid was used to produce stable p6 transfectants. The HVP plasmid provides al1 the chacting sequences necessary for packaging, reverse transcription and integration. Since the HVP-packaging cell Iine is a HeLa-based cell line it does not express the HIV-1 Env receptor, C04. Therefore the producer ceII line is not expected to be infecfed with the virus it generates.
The stable introduction of HVP DNA into p6 cells allowed for the constitutive production of HIV-1 proteins since HVP produces HIV-1 Rev constitutively. The supernatant of the genetically modified packaging cell line which was maintained in tetracycline contained Gag antigens indicating that the HVP packaging cell Iine did indeed produce HIV-1 Gag constitutively. The constitutive production of HIV-1 Rev allows for the production of proteins from both the HVP and HXBAP1AEnv constructs. However, the HVP-packaging cell line still allows for the production of replication incompetent HIV in a tetracycline-inducible manner since the expression of the HIV-1 env gene, expressed by the Tl RevEnv construct, is stiIl tightly controlled by tetracycline withdrawal. Also, the efficiency of viral particle production seems to be better upon tetracycline withdrawal suggesting that once HIV-1 Env was produced in sufficient amounts, viral particle release was favoured. The HIV-1 Gag antigen detected in the first 24 days post-tetracycline withdrawal were most probably virus- like particles fonned by HIV-1 Gag alone. Ten-fold more HIV-1 Gag antigen was detected in supematants of HVP-packaging cells compared to p6 cells suggesting that the former is capable of producing high titre virus. The inducible expression of the env gene is advantageous since the constitutive production of HIV-1 Env was previously shown to be toxic to mammalian cells (Sodroski et al., 1986). The constitutive production of HIV-1 Rev, Tat, Gag, Pol, and Vif had no cytotoxic effects since the cells could be maintained in tetracycline for months while appearing healthy.
In order to demonstrate that the HVP-packaging cell line produces replication incompetent viral particles capable of allowing gene transfer, they were cocultured with the CWMT4 cells for approxirnateiy 48 hours (the amount of time required to complete one life cycle). A sieve was used to prevent any cross contamination of the
MT4 cells with the HVP-packaging cells. The detection of HVP DNA by PCR, using primers which amplified HIV-1 gag sequences, from total cellular DNA extracted from cocultured MT4 cells confins that the HVP vector particles allow for transduction of the HVP retroviral vector. Thus the HVP vector RNA is packaged into the vector particles, reverse transcribed and subsequently integrated. Gene expression was confinned by RT-PCR analysis, using prirners which amplified HIV-1 gag sequences, of totat cellular RNA extracted from cocultured MT4 cells. The use of DNase in the
RNA preparations and a control reaction without RT ensured the absence of contaminating DNA since the absence of intronic sequences in the region amplified would not allow for distinguishing between DNA and cDNA. This result indicates that the HVP viral particles allow for transduction and expression of HVP genes in the transduced cells. Thus, the HVP packaging cell line produces replication incompetent vector particles and can propogate the HVP retroviral vector DNA in a single round infection assay. Furtherrnore, it can be predicted that a single round infection can be assayed in genetically rnodified nondividing cells since the NLS of the MA domain should be functional. It can be argued that the HVP RNA and HVP
DNA detected from cocultured MT4 cells resuited from RNA and DNA mntaining viral particles attached to the surface of the cocultured MT4 cells and subsequently extracted with total cellular RNA and DNA However, the initiation of proviral DNA synthesis in the virion is a very rare event. Furthemore, MT4 cells cocultured with the replication incompetent HIV were puromycin resistant and maintained in medium containing drug for 2 months. No syncitium formation wuld be obsewed in puromycin resistant MT4 cells suggesting that replication competent retrovirus (RCR) was not produced. Theoretically though, the probability of RCR formation is fow in the HVP-packaging cell line since the chances of recombination between the three constructs, HVP, HXBAP1AEnv and TlRevEnv is low.
The HVP-packaging cell line was constructed for future use in testing the mode of inhibition of potentially therapeutic gene products like Gag-RNase Tl or mutant Gag-
RNase Tl. The cell Iine anbe transfected or transduced with the therapeutic gene to analyze the mode of interference during late stages of the viral life cycle such as viral RNA encapsidation, viral particle assembly and maturation, and infectivity of viral particles. For example, viral particles produced from the transfected or transduced HVPpackaging cell Iine can be analyzed for viral RNA and protein content. In addition, the viral particles can be used to infect a fresh batch of cells to test for their infectivity.
Replication incompetent HIV produced from the HVP-packaging cell line can also be used to infect target cells that are transduced with the therapeutic gene to analyze the mode of interference during early steps in the viral life cycle. Since the pools of cells are infected in a synchronous manner, they can be analyzed for the kinetics of appearance of fusion, integration, post-transcriptional events and translation. For example, the level of interference before integration can be detennined by quantitation of proviral DNA synthesis by PCR. The level of interference at the level of gene expression can be detennined by quantitating puromycin resistant colonies andor quantitating the amount of spliced and unspliced viral mRNA levels by RT-
PCR. The level of inhibition of translation of viral mRNA can also be detennined by
ELISA using HIV-1 Gag antibodies. In contrast, the mode of inhibition dunng multiple rounds of infection with HIV may be difficullt to detemine, since cells are infected asynchronously and variation in the kinetics of replication will occur between different rounds of infection. Furthemore, HIV infection rate constants will Vary wnsiderably during the course of the expenment where infected cells andor medium are periodically discarded to maintain appropriate cell densities.
B. Future Studier
The munne stem cell virus-based biscistronic retroviral vector, MGIN, will be used to express the gtl or mt gtl gene (Cheng et al., 1997). In parallel the cmv-gtl-ne-cte cassette will be sequenced to establish any underlying genetic causes for Jack of expression. MGlN has an IRES to circumvent a potential problem associated with closely Iinked promoters or a mutated CMV promoter. A retroviral vector is being constructed by subcloning the gtl -mede or mutant gtl -ne-cte cassette downstream of the IRES in the MGlN retroviral vector. An attractive alternative to the selectable drug-resistance genes is provided by fluorescent markers such as the green fluorescent protein gene (g@)from jellyfish A. victona (Chalfie et al., 1994)- Thus, selection of genetically modified cells can be achieved quickly by fluorescence- activated cell sorting as opposed to drug resistance which requires weeks of growth in selective media, likely resulting in a vanety of genetic and epigenetic phenornena.
The MGlN retroviral vector encodes for the gfp gene under control of the 5' LTR. Thus, the MGlN retroviral vector can allow for the produdon of two gene products without the need for any intemal promoters (Cheng et al., 1997).
Transient system: Expression of the gtl and mutant gt1 genes will be detennined by transiently transfecting 293-T cells with MGIN-based GTRC and mtGTRC retroviral vectors and analysis by ELISA. MGlN based (rnt)GTR and (mt)GTC retroviral vectors wiil be dehed fmm the parent retroviral vectors to test for Rev- inducible and constitutive production of Gag-RNase Tl and rnt Gag-RNase Tl in cotransfection experiments with a rev expressing plasmid. Transient transfection assays will also be done using the HVP-packaging cells to show heterochimeric assembly, and loss of infectivity of viral particles as follows: The viral particles will be analyzed for unprocessed, MA-CA-NGRNase Tl (60 kDa), and HIV Pro processed,
CA-NC-RNase Tl (45 kDa) and (mutant) NC-RNase Tl (20 kDa) fusion proteins by
Western Blot using RNase Tt antisenim. An in-situ RNase detection assay (Singwi et al., 1999) will also be used to detect RNase activity of processed products of Gag-
RNase Tl. Detection of the processed products will demonstrate the formation of heterochimeric viral particles. The heterochimeric viral particles will then be used to infect a fresh batch of HeLa CD4+ cells. A loss in infectivity will be quantitated by counting puromycin resistant colonies.
Stable system: The retroviral vector constructs will be used to transfect packaging cells to generate amphotropic vector particles. These particles will subsequently be used to transduce the human CD4+ lymphocytederived MT4 cell line. Since a biscistronic vector does not allow the expression of two genes to be independently regulated, the production of vector partictes for gene delivery require that the vector genomic RNA be produced constitutivefy. The gtl or mt gt1 cistron is predicted to destabalize the transcript by virtue of the INS elements. Thus, the CTE element will be required for stable production of vector RNA. The Rev-inducible retroviral vector wiil be cotransfected in packaging cells with HIV-1 Rev for stable production of vector
RNA. Proviral DNA integrity will be detemined in transduced MT4 cells by PCR.
Also, RT-PCR will be used to detect expression by the retroviral vector in transduced cells. Production of Gag-RNase Tl and mutant Gag-RNase Tl in transduced cells will also be assessed by ELISA. Any toxicity due to Gag-RNase Tl and mutant Gag-
RNase Tl will b8 detemined by a cellular growth curve. Stable MT4 transductants will be infected with HIV-1 and virus production will be monitored over time to test the efficacy of Gag-RNase Tl and mutant Gag-RNase Tl mediated inhibition of virus replication. Aboul-ela F, Karn J, Varani G (1996). Structure of HIV-1 TAR RNA in the absence of ligands reveals a novel conformation of the trinucleotide bulge. Nucleic Acids Res. 24: 3974-81.
Achord AP, Lewis RE, Brackin MN, Cruse JM (1 997). HM-DQB1 markers associated with human immunodeficiency virus type I disease progression. Pathobiology. 65: 21 (ES.
Aiken C and Trono O (1995). Nef stimulates human immunodeficiency virus type 1 proviral DNA synthesis. J Virol. 69: 5048-56-
Akkina RK, Walton RM, Chen ML, Li QX, Planelles V, Chen IS (1996). High-efficiency gene transfer into CD% cells with a human irnmunodeficiency virus type 1-based retroviral vector pseudotyped with vesicular stomatitis virus envelope glycoprotein G- 3 Virol. 70: 2581- 5
AI-Harthi L and Roebuck KA (1998). Human immunodeficiency virus type-1 transcription: role of the 5-untranslated leader region (review). Int J Mol Med.1: 875-81.
Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, Berger EA (1996). CC CKRS: a RANTES, MIP-lalpha, MIP-1beta receptor as a fusion cofactor for macrophage- tropic HIV-1. Science. 272: 1955-8
Allay JA, Persons DA, Galipeau J, Riberdy JM, Ashmun RA, Blakely RL, and Sorrentino BP(1998). In vivo selection of retrovirally transduced hemetopoietic stem cells. Nat. Medicine 4: 1136-40-
Arts EJ, Mak J, Kleiman L, Wainberg MA (1994). Mature reverse transcriptase (p66/p51) is responsible for low levels of viral DNA found in human immunodeficiency virus type 1 (HIV- 1). Leukemia. Suppl 1: S175-8.
Artzi HB, Shemesh J, Zeelon E, Amit 6, Kleiman L, Gorecki M, Panet A (1996). Ribonuclease H activity during initiation of reverse transcription using tRNA(lys)/RNA pn'merltemplate of human immunodeficiency virus. Arch Biochern Biophys. 325: 209-1 6.
Askjaer P, Jensen TH, Nilsson J, Englmeier L, Kjems J (1998). The specificity of the CRM1- Rev nudear expott signal interaction is mediated by RanGTP. J Biol Chem. 273: 33414-22.
Baltimore O. Gene therapy (1988). Intracellular immunization. Nature. 335: 395-6.
Becker Y (1996). Transfer of antivirals to skin Langerhans cells-a novel approach to anti-HIV treatment by 'antiviral peplotion'. Acta Biochirn Pol. 43175-81.
Benko DM, Schwartz S, Pavlakis GN, Felber BK (1990). A novel human immunodeficiency virus type 1 protein, tev, shares sequences with tat, env, and rev proteins. J Virol. 64: 2505- 18.
Bogerd HP, Huckaby GL, Ahmed YF, Hanly SM, Greene WC (1991). The type I human T- cell leukemia virus (HTLV-t) Rex tranç-activator binds directly to the HTLV-I Rex and the type 1 human immunodeficiency virus Rev RNA response elements. Proc Natl Acad Sci U S A. 88: 5704-8
Bour S, Geleziunas R, Wainberg MA (1995). The human immunodeficiency virus type 1 (HIV-1) CD4 receptor and its central role in promotion of HIV-1 infection. Microbioi Rev. 59: 63-93.
Bray M, Prasad S, Dubay JW, Hunter E, Jeang KT, Rekosh D, Hammarskjold ML (1994). A small element from the Mason-Pfizer rnonkey virus genome makes human irnmunodeficiency virus type 1 expression and replication Rev-independent. Proc Natl Acad Sci U S A.. 91: 1256-60.
Bukovsky AA, Dorfman T, Weimann A, Gottlinger HG (1997). Nef association with human immunodeficiency virus type 1 vinons and cleavage by the viral protease. J Virol- 71 : 1013-8
Bukrinsky MI, Haggerty S, Dempsey MP, Sharova N, Adzhubel A, Spi& L, Lewis P, Goidfart, D, Ememan M, Stevenson M (1993). A nuclear localization signal within HIV-1 matrix protein that govems infection of non-dividing cells. Nature. 365: 666-9.
Bushman FD, Fujiwara T, Craigie R (1990). Retroviral DNA integration directed by HIV integration protein in vitro. Science. 249: 1555-8.
Campbell LH, Borg KT, Amgo SJ (1996). Differential effects of intronic and exonic locations of the human immunodef iciency virus type 1 Rev-responsive element. Vi rology. 21 9: 423-31.
Cao Y and Suresh MR (1998). Bispecific antibodies as novel bioconjugates. Bioconjug Chem 9: 635-644.
Cara A, Rybak SM, Newton DL, Crowiey R, Rottschafer SE, Reitz MS Jr, Gusella GL (1998). Inhibition of HIV-1 replication by combined expression of gag dominant negative mutant and a human ribonuclease in a tightly controlled HIV-1 inducible vector. Gene Ther. 5: 65-75.
Chalfie M, Tu Y, Eusl Chen YL, Trono O, Camaur D (1998). The proteolytic cleavage of human immunodeficiency virus type 1 Nef does not correlate with its ability to stimulate virion infectivity. J Virol. 72: 31 78-84. Cheng 1, Ou C, Murray O, Tong X, Zhang YA, Chen BP, Hawley RG (1997). A GFP reporter system to assess gene transfer and expression in human hematopoietic progenitor cells. Gene Ther. 4: 1013-22. Chui DW and Owen RL (1994). AlDS and the gut. J. Gastroenterol. Hepatol. 9: 291-303. Chun TW, Stuyver L, Mizell SB, Ehler LA, Mican JAM, Baseler M,, Uoyd AL, Nowak MA Fauci AS (1997). Preçence of an inducble HIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA 94: 13193-1 31 97. Clark O, Reitman M, Studitsky V, Chung J, Westphal H, Lee E, Felsenfeld G (1993) Chromatin structure of transcriptionally active genes. Cold Spring Harb Symp Quant Bi01 58:1 -6 Cline J, Braman JC, Hogrefe HH (1996) PCR fidelity of pfu DNA polyrnerase and other thermostable DNA polymerases. Nucleic Acids Res. 24: 3546-51. Colbere-Garapin F, Horodniceanu F, Kourilsky P, Garapin AC (1981). A new dominant hybrid selective marker for higher eukaryotic cells. J Mol Biol. 150: 1-14. Collins KL, Chen BK, Kalams SA, Walker BD, Baltimore D (1998). HlV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature. 391 : 397-401. Cujec TP, Okamoto H, Fujinaga K, Meyer J, Chamberlin H, Morgan DO, Peterlin BM (1997). The HIV transactivator TAT binds to the CDK-activating kinase and activates the phosphorylation of the carboxy-terminal domain of RNA polymerase II. Genes Dev. 11: 2645-57. D'Agostino DM, Felber BK, Hamson JE, Pavlakis GN (1992). The Rev protein of human immunodeficiency virus type 1 promotes polysomal association and translation of gag/@ and vpdenv mRNAs. Mol Cell Biol. 12: 1375-86. Daly TJ, Cook KS, Gray GS, Maione TE, Rusche JR (1989). Specific binding of HIV-1 recombinant Rev protein to the Rev-responsive element in vitro. Nature. 342: 816-81 9. Damgaard CK, Dyhr-Mikkelsen H, Kjems J (1998). Mapping the RNA binding sites for hurnan immunodeficiency virus type4 gag and NC proteins within the complete HIV-1 and -2 untranslated leader regions. Nucleic Acids Res. 26: 36674676. Darlix JL, Lapadat-Tapolsky M, de Rocquigny H, Roques BP (1995). First glirnpses at structure-function relationships of the nucleocapsid protein of retroviruses. J Mol Biol 254: 523-37. Davey RT Jr, Boenning CM, Herpin BR, Batts DH, Metcalf JA, Wathen L, Cox SR, Polis MA, Kovacs JA, Falloon J, et al (1994). Use of recombinant soluble CD4 Pseudomonas exotoxin, a novel immunotoxin, for treatment of persons infected with human imrnunodeficiency virus. J Infect Dis. 170: 1180-1188. Dean M, Carrington M, WinWer C, Huttley GA, Smith MW, Allikmets R, Goedert JJ, Buchbinder SP, Vittinghoff E, Gomperts E, Donfield S, Vlahov D, Kaslow R, Saah A, Rinaldo C, Detels R, O'Brien SJ (1996). Genetic restriction of HIV-1 infection and progression to AlDS by a deletion allele of the CKRS structural gene. Hemophilia Growth and Development Study, Multicenter AlDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science. 273: 1856-62. De Guzman RN, Wu ZR, Stalling CC, Pappalardo L, Borer PN, Summers MF (1998). Structure of the HIV-1 nucleocapsid protein bound to the SL3 psi-RNA recognition e!ement. Science. 279: 384-8. Decroly E, Wouters S, Di Bello C, Lazure C, Ruysschaert JM, Seidah NG (1996). Identification of the paired basic convertases implicated in HIV gp160 processing based on in vitro assctys and expression in C04(+) cell tines. J Biol Chem. 271 : 30442-50. Deng H, Liu R, Ellrneier W, Choe S, Unutmaz D, Burkhart M, Di Marzio P, Marrnon S, Sutton RE, Hill CM, Davis CB, Peiper SC, SchalI TJ, Littman DR, Landau NR (1996). Identification of a major co-receptor for primary isolates of HIV-1. Nature. 381: 661-6. Oenton G, Sekowski M, Spencer DI, Hughes 00, Murray A, Denley H, Tendler SJ, Price MR (1997). Production and characterization of a recombinant anti-MUC1 çcFv reactive with human carcinomas. Br J Cancer. 76: 614-621. DeStefano 53, Mallaber LM, Fay PJ, Bambara RA (1994). Quantitative analysis of RNA cleavage dunng RNA-directed DNA synthesis by human immunodeficiency and avian myeloblastosis virus reverse transcriptases. Nucleic Acids Res. 22: 3793-800. Dettenhofer M and Yu XF (1999). Highly purified human immunodeficiency virus type 1 reveals a virtual absence of Vif in virions. J Virol. 73: 146017. Deutscher M (1990) Ribonucleases. Introduction. Biochimie. 72: 769. Ding SF, Noronha J, Joshi S (1998). Co-packaging of sense and antisense RNAs: a novel strategy for blocking HIV-1 replication. Nucleic Acids Res. 26: 3270-8. Dingwall C, Emberg 1, Gait MJ, Green SM, Heaphy S, Kam J, Lowe AD, Singh M. Skinner MA, Valerio R (1989). Human irnmunodeficiericy virus 1 tat protein binds trans-activation- responsive region (TAR) RNA in vitro. Pm. Natl. Acad. Sci. U S A. 86: 692506929. Domachowske JB, Bonville CA, Dyer KD, Rosenberg HF (1998a). Evolution of antiviral activity in the ribonuclease A gene superfamily: evidence for a specific interaction between eosinophil-derived neumtoxin (EDiVRNase 2) and respiratory syncytial virus. Nucleic Acids Res. 26: 5327-32. Domachowske JB, Dyer KD, Adams AG, Leto TL, Rosenberg HF (1998b). Eosinophil cationic protein/RNase 3 is another RNase A-family ribonuclease with direct antiviral activity. Nucleic Acids Res. 26: 3358-63. Doranz BJ, Rmer JI Yi Y, Smyth RJ, Samson M. Peiper SC, Parmentier MI Collman RG, Doms RW (1996). A dual-tropic primary HIV-1 isolate that uses fusin and the beta- chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. CeIl- 85: 1149-58. Dorfman T, Mammano F, Haseltine WA, Gottlinger HG (1994). Role of the matrix protein in the virion association of the human immunodeficiency virus type 1 envelope giycoprotein. J Virol. 68: 1689-96 Drake RR, Neamati N, Hong H, Pilon AA, Sunthankar PI Hume SD, Milne GW, Pommier Y (1998). Identification of a nucleotide binding site in H1V-1 integrase- Proc Natl Acad Sci U S A. 95: 41 70-5. DuIl T, Zufferey RI Kelly M, Mandel RJ, Nguyefl M, Trono O, Naldini L (1998). A third- generation lentivirus vector with a conditional packaging system. J Virol. 72: 8463-71. Dunbar CE, Cottler-Fox M, O'Shaughnessy JA, Doren S, Carter C, Berenson R, Brown S, Moen RC, Greenblatt JI Stewart FM, et al (1995). Retrovirally marked CD34-enriched peripheral blood and bone manow cells contribute to long-term engraftment after autologous transplantation. Blood. 85: 3048-57. Dynan WS (1989). Modularity in promoters and enhancers. Cell. 58: 14. Earl PL, Moss 6, Doms RW (1991). Folding, interaction with GRP7&BiP, assembly, and transport of the human immunodeficiency virus type 1 envelope protein. J Virol. 65: 2047-55. Egan MA, Carruîh LM, Rowell JF, Yu X, and Siliciano RF (1 996). Human immunodeficiency virus type 1 envelope protein endocytosis mediated by a highly conseived intrinsic internalization signal in the cytoplasmic domain of gp41 is suppressed In the presence of the pr55- precursor protein. J. Virol. 70: 6547-6556. Ehrlich LS, Fong S, Scarfata S, Zybarth G, Carter C (1996). Partitioning of HIV-1 Gag and Gag-related proteins to membranes.Biochemistry. 35: 393343. Ernerman MI Malim MH (1998). HIV-1 regulatory/acceçsory genes: keys to unravelling viral and host cell biology. Science. 280: 1880-1883. Emerman M and Temin HM (1986). Quantitative analysis of gene suppression in integrated retrovirus vectors. Mol Cell Biol. 6: 792-800. Emerman M and Temin HM (1984a). Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism. Cell. 39: 449-67 Emerman M and Temin HM (1984b). High-frequency deletion in recovered retrovirus vectors containing exogenous DNA with promoters- J Virol. 50: 42-9. Endrich MM, Gehrig P, Gehring H (1999). Maturation-induced Conformational Changes of HIV-1 Capsid Protein and Identification of Two High Affinity Sites for Cyclophilins in the C- terminal Domain. J Biol Chem. 274: 5326-5332. Erard M, Barker DG, Amalric F, Jeang KT and Gatignol A (1998). An ArgiLys-rÏch Core Peptides Mimics TRBP Binding ta the HIV-1 TAR RNA upper-stemAmp. J. Mol. Biol. 279: 1085-1 099. Finkel TH, Tudor-Williams G, Banda NK, Cotton MF, Curie1 T, Monk C, Baba TW, Ruprecht RM, Kupfer A (1995). Apoptosis occurs predominantly in bystander cells and not in productively infected cells of HIV- and SlV-infecteci lymph nodes. Nat Med. 1: 129-34. Fouchier RA, Meyer BE, Simon JH, Fischer U, Albright AV, Gonzalez-Scarano F, Malim MH (1998). Interaction of the human immunodeficiency virus type 1 Vpr protein with the nuclear pore complex. J Virol. 72: 6û04-13 Franke EK, Yuan HE, Luban J (1994). Specific incorporation of cyclophilin A into HIV-1 virions. Nature. 372: 359-62. Franzusoff A, Volpe AM, Josse D, Pichuantes S, Wolf JR (1995). Biochemical and genetic definition of the cellular protease required for HIV-1 gp160 processing- J Bi01 Chem. 270: 3154-31 59. Fraser P, Grosveld F (1998). Locus control regions, chromatin activation and transcription. Cun Opin Cell Biol. 10: 361-5. Freed EO (1998). HIV-1 gag proteins: diverse functions in the virus life cycle. Virology. 251: 1-1 5. Freed EO and Martin MA (1994). HIV-1 infection of nondividing cells. Nature. 369:f 07-8. Friesen WJ, Darby MK (1998). Specific RNA binding proteins constnicted from zinc fingers. Nat Stnict Biol. 5: 543-6. Fuentes GM, Rodriguez-Rodriguez L, Fay PJ, Bambara RA (1995). Use of an oligoribonucleotide containing the polypurine tract sequence as a primer by HIV reverse transcriptase. J Bi01 Chem. 270: 28169-76. Fukumori T, Kagawa S, lida S, Oshima Y, Akari H, Koyama AH, Adachi A (1999). Rev- dependent expression of three species of HIV-1 mRNAs (Review). Int J Mol Med. 3: 297-302. Gallay P. Hope T, Chin O, Trono O (1997)- HIV-1 infection of nondividing cells through the recognition of integrase by the irnportinkaryopherin pathway. Proc Natl Acad Sci U S A. 94: 9825-30. Gallay P, Stitt V, Mundy C, Oettinger M, Trono O (1996). Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import. J Virol. 70: 1027-32. Gallay Pl Swingler S, Song J, Bushman F, Trono D (1995). HIV nuclear import is govemed by the phosphotyrosine-mediated binding of matnx to the core domain of integrase. Cell. 83: 569-76. Gallo RC, Sarin PS, Gelmann EP, Robert-Guroff M, Richardson E, Kalyanaraman VS, Mann Dl Sidhu GD, Stahl RE, Zolla-Pazner S, Leibowitch J, Popovic M (1983). Isolation of human T-cell leukemia virus in acquired immune deficiency syndrome (AIDS). Science. 220: 865-7. Gandhi RT, Chen BK, Straus SE, Dale JK, Lenardo MJ, Baltimore D J (1998). HIV-1 directly kills CD4+ T cells by a Fas-independent mechanism. Exp. Med. 187: 1113-22. Garcia-Martinez LF, Mavankal G, Peters P, Wu-Baer F, Gaynor RB (1995). Tat functions to stimulate the elongation properties of transcription complexes paused by the duplicated TAR RNA element of human immunodeficiency virus 2. J Mol Biol. 254: 350-63- Gardner JP, Rosenrweig M, Marks DF, Harper D, Gaynor K, Fallon RJ, Wall DA, Johnson RP, Scadden DT (1998). T-lymphopoietic capacity of cord blood-ûerived CD34+ progenitor cells. Exp. Hematol. 26: 991-9. Gaudieri S, Leelayuwat C, Townend DC, Mullberg J, Cosman D, Dawkins RL (1997). Allelic and interlocus cornparison of the PERB11 multigene family in the MHC. Immunogenetics. 45: 209-1 6. Gaulton GN, Scobie JV, Rosenzweig M (1997). HIV-1 and the thymus. AIDS. 11: 403-414. Gewaix A, Schwarz L, Law P, Ho AD, Looney D, Lane T, Wong-Staal F (1997). Gene therapy targeting peripheral blood CD34+ hematopoietic stem cells of HIV-infected individuals. Hum. Gene Ther. 8: 2229-38. Gitti RK, Lee BM, Walker J, Surnmers MF, Yoo S, Sundquist WI (1996)- Structure of the amino-terminal core domain of the HIV-1 capsid protein. Science -273: 231 -5. Gotte M, Maier G, Onori AM, Cellai L, Wainberg MA, Heumann H (1999). Temporal coordination between initiation of HIV (+)-strand DNA synthesis and primer removal. J Biol Chern. 274: 11 1 59-69, Gotte M, Fackler S, Hermann 1, Perola E, Cellai L, Gros H3, Le Grice SF, Heumann H (1995). HIV-1 reverse transcriptase-associated RNase H cleaves RNNRNA in arrested complexes: implications for the mechanism by mich RNase H discriminates between RNA/RNA and RNNDNA. EMBO J- 14: 833-41. Grant MD, Smail FM, Rosenthai KL (1994). Cytotoxic T-lymphocytes that kill autologous CD4+ lymphocytes are associated with CD& lymphocyte depletion in HIV-1 infection. J Acquir Immune Defic Syndr. 7: 571-9. Greenberg ME, lafrate Al, Skowronski J (1998). The SH3 domain-binding surface and an acidic motif in HIV-1 Nef regulate trafficking of ctass I MHC complexes. EMBO J. 17: 2777- 89. Gumrnuluru S and Emerman M (1999). Cell cycle- and vpr-mediated regulation of human immunodeficiency virus type 1 expression in primary and transformed 1-cell Iines. J Virol. 73: 5423-30. Hakoshima T, Tanaka M. ltoh T, Tomita KI, Amisaki T, Nishikawa S, Morioka H, Uesugi S, Ohtsuka E, lkehara M (1991). Hydrophobie effects on protein/nucleic acid interaction: enhancement of substrate binding by mutating tyrosine 45 to tryptophan in ribonucfease Tl. Protein Eng. 4: 793-9. Harada K, Martin SS, and Frankel AD (1996). Selection of RNA-binding peptides in vivo. Nature. 380: t 75-1 79. Harada K, Martin SS, Tan R, and Frankel AD (1997). Molding a peptide into an RNA site by in vivo peptide evolution. Proc. Natl. Acad. Sci. USA. 94: 11887-11892. Harris MP and NeiI JC (1994). Myristoylation-ciependent binding of HIV-1 Nef to CD4. J Mol Biol. 241: 136-42 Harrison GS, Long CJ, Curiel TJ, Maxwell F, Maxwell IH (1992). Inhibition of human imrnunodeficiency virus4 production resulting from transduction with a retrovirus containing an HIV-regulated diphtheria toxin A chain gene. Hum Gene Ther. 3: 461-9. Harrison GS, Maxwell F, Long CJ, Rosen CA, Glode LM, and Maxwell IH (1991). Activation of a diptheria toxin A gene by expression of human immunodeficiency virus-1 tat and rev proteins in transfected cells. Human Gene Ther. 2: 53-60. Haselhorst D, Kaye JF, Lever AM (1998). Development of cell lines stably expressing human immunodeficiency virus type 1 proteins for studies in encapsidation and gene transfer. J Gen Virol. 79: 231-7 Haseltine WA (1991). Molecular biology of the human immunodeficiency virus type 1. FASEB J. 5: 2349-60. Heaphy S, Finch JT, Gait MJ, Kam J, Singh M (1991). Human immunodeficiency virus type 1 regulator of virion expression, rev, forms nucleoprotein filaments after binding to a purine- rich 'bubble' located within the rev-responsive region of viral mRNAs. Proc Natl Acad Sci U S A. 88: 7366-70. Heaphy S, Dingwall ClEmberg 1, Gait MJ, Green SM, Kam J, Lowe AD, Singh MlSkinner MA (1990). HIV-1 regulator of virion expression (Rev) protein binds to an RNA stem-loop structure Iocated within the Rev mnseelement region, Cell, 60. -93 Heinemann U and Saenger W (1983). Crystallographic study of mechanism of ribonuclease Tlatalysed specif ic RNA hydrolysis. J Biomol Struct Dyn. 1: 523-38. Henderson BR, and Percipalle P (1997). Interactions between HIV Rev and nuclear import and export factors: the Rev nuclear localisation signal mediates specific binding to human importin-beta. J Mol Biol. 274: 693-707. Herbein G, Mahlknecht U, Batliwalla F, Gregersen P, Pappas T, Butler J, O'Brien WA, Verdin E (1998). Apoptosis of CD8+ T cells is mediated by macrophages through interaction of HIV gp120 with chemokine receptor CXCR4. Nature. 39S:l89-194. Hesselgesser J, Taub D, Baskar Pl Greenberg Ml Hoxie J, Kolson DL, Horuk R (1998).Neuronal apoptosis induced by HIV-1 gp120 and the chemokine SDF-1 alpha is mediated by the chemokine receptor CXCR4. Cun. Biol. 8: 595-8. Ho DD (1998). Toward HIV eradication or remmission: The tasks ahead. Science. 280: 1866- 1867. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989). Site-directed mutagenesis by overiap extension using the polymerase chain reaction. Gene. 77: 51-9. Horton RM, Hunt HO, Ho SN, Pullen JK, Pease LR (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77: 61-8. Huang S, Law Pl Young O, Ho AD (1998). Candidate hematopoietic stem cells from fetal tissues, umbilical cord blood vs. adult bone manow and mobilized peripheral blood. Exp. Hematol. 26: 1162-71. Huang Y, Carnichael GC (1996). Role of polyadenylation in nucleocytoplasmic transport of mRNA. Mol Cell Biol. 16: 1534-42. Hung M, Patel P, Davis S, Green SR (1998). Importance of ribosomal frameshifting for human immunodeficiency virus type 1 particle assembly and replication. J Virol. 72: 4819-24. Ikeno M, Grimes 6, Okazaki Tl Nakano Ml Saitoh K, Hoshino Hl McGill NI, Cooke Hl Masumoto H (1998). Construction of YAGbased mammalian artif icial chromosomes. loannidis JP, O'Brien TRI Rosenberg PS, Contopoulos-loannidis DG, Goedert JJ (1998). Genetic effects on HIV disease progression. Nat. Med. 4: 536. Ise1 ClWesthof ElMassire C, Le Grice SF, Ehresrnann 6, Ehresmann C, Marquet R (1999). Structural basis for the specificity of the initiation of HIV-1 reverse transcription. EMBO J. 18: 1038-1048. Jacobs E, Gheysen D, Thines O, Francotte M, de Wilde M (1989). The HIV-1 Gag precursor Pr55gag synthesized in yeast is rnyristoylated and targeted to the plasma membrane. Gene. 79: 71-81. Jacque JM, Mann A, Ensien H, Sharova N, Brichacek B, Davis RJ, Stevenson M (1998)- Modulation of HIV-1 infectivity by MAPK, a virion-assaciated kinase. EMBO J. 17: 2607- 2618. Jenkins Y, McEntee M, Weis K, Greene WC (1998). Characterization of HIV-1 vpr nuclear import: analysis of signals and pathways. Cell Biol. 143: 875-85. Johnston MI, and Torrence PF (1984). The role of interferon-induced proteins, double stranded RNA and 2'-5'-oligoadenylate in the interferon-mediated inhibition of viral translation. Interferon, Volume 3: Mechanism of Production and Action (RM Friedman, ed), pp. 189-298. Elsevier, New York. Joshi SIJoshi RL (1996). Molecular biology of human immunodeficiency virus type-1. Transf us Sci. 17: 351-78. Joshi SIVan Bninschot A, Asad S, van der Elst 1, Read SE, Bernstein A (1991). Inhibition of human immunodeficiency virus type 1 multiplication by antisense and sense RNA expression. J Viroi. 65: 5524-30 Junker U, Baker J, Kalfoglou CS, Veres G, Kaneshima H, Bohnlein E (1997). Antiviral potency of drug-gene therapy combinations against human immunodeficiency virus type 1. AlDS Res Hum Retroviruses.13: 139542. lkuta K, Kameoka M, Luftig RB. AlDS pathogenesis: the role of accessory gene mutations, leading to formation of long-lived persistently infected cells and/or apoptosis-inducing HlV-1 particles. Virus Research. 52: 145-1 56; 1997. Kaplan AH, Manchester M, Swanstrom R (1994). The activity of the protease of hurnan immunodeficiency virus type 1 is initiated at the membrane of infected cells before the release of viral proteins and is required for release to occur with maximum efficiency. J Viroi. 68: 6782-6. Kaptein LC, Breuer M, Valerio 0, van Beusechem VW (1998). Expression pattern of CD2 locus control region containing retroviral vectors in hernopoietic cells in vitro and in vivo. Gene Ther. 5: 320-30. Karawya EM, and Alwabel AHA (1996). Elevated levels of ribonucleases in serum of patients with liver disease. Saudi Medical J. 17: 42-46. Karlsson S (1997). Gene therapy of haematopoietic ceils. J lntern Med Suppl. 740: 95-9. Kami O, Friedler A, Zakai N, Gilon C, Loyter A (1 998). A peptide denved from the N-terminal region of HIV-1 Vpr promotes nuclear import in perrneabilized cells: ducidation of the NLS region of the Vpr. FEBS Lett. 429: 421-5. Kass SV, Pruss D, and Wolffe AP(1997). How does DNA methylation repress transcription. Trends in Genetics. 13: 444-449. Katz RA, Gravuer K, Skalka AM (1998). A prefened target DNA structure for retroviral integrase in vitro. J Biol Chem. 273: 24190-5. Katz RA, Merkel G, and Skalka AM (1996). Targeting of retroviral integrase by fusion to a heterologous DNA binding domain: In vitro activities and incorporation of a fusion into viral particles. Virology. 217: 178-190. Kawano Y, Tanaka Y, Misawa N, Tanaka R, Kim JI, Kimura T, Fukushi M, Sano K, Goto T, Nakai M, Kobayashi Tl Yamamoto N, Koyanagi Y (1997). Mutational analysis of human immunodeficiency virus type 1 (HIV-1) accessory genes: requirement of a site in the nef gene for HIV-1 replication in activated CD& T cells in vitro and in vivo. J. Virol. 71: 8456- 8466. Kaye JF, Richardson JH, Lever AM (1995)- Cis-acting sequences involved in human immunodeficiency virus type 1 RNA packaging. J Virol. 69: -92- Keen NJ, Churcher MJ, Karn J (1997). Transfer of Tat and release of TAR RNA during the activation of the hurnan immunodeficiency virus type-1 transcription elongation complex. EMBO J. 16: 5260-72. Kelly JK (1996). Replication rate and evolution in the human immunodeficiency virus. J. Theor. Bioi. 180: 359-364. Kilby JM, Hopkins S, Venetta TM, DiMassimo 8, Cloud GA, Lee JY, Alldredge L, Hunter E, Lambert D, Bolognesi O, Maîthews Tl Johnson MR, Nowak MA, Shaw GM, Saag MS (1998). Potent suppression of HlV-1 replication in humans by T-20, a peptide inhibitor of gp4l-mediated virus entry. Nat Med. 4:13O2-7. Kim JK, Palaniappan C, Wu W, Fay PJ, Bambara RA (1997)- Evidence for a unique mechanism of strand transfer from the transactivation response region of HlV-1. J Bi01 Chem. 272: 16769-77. Kim JS, Soucek J, Matousek J, Raines RT (1 995). Mechanism of ribonuclease cytotoxicity. J. Biol. Chem- 270: 31097-31102. Kolson DL, Lavi E, Gonzalez-Scarano F(1998). The effects of human immunodeficiency virus in the central nervous system. Adv Virus Res. 50: 1-47. Komada F, Nishiguchi K, Tanigawara Y, lshida M, Wu XY, twakawa S, Sasada R, Okumura K (1997). Protective effect of transfection with secretable superoxide dismutase (SOD) (a signal sequence-SOO fusion protein coding CONA) expression vector on superoxide anion- induced cytotoxicity in vitro. Biol Pham Bull. 20: 530-6. Kwong PD, Wyatt R, Robinson J, Sweet RW, and Sodroski J (1998). Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature. 393: 648-659. Lacy 08, Stevens RC (1998). Unraveling the structures and modes of action of bacterial toxins. Curr Opin Struct Biol. 8: 778-784. Laemmli UK, Tjian R (1996). A nuclear traffic jam - unraveling multicomponent machines and compartments. Cun Opin Cell Biol. 8: 299-302. Laker C, Meyer J, Schopen A, Friel J, Heberlein C, Ostertag W, Stocking C (1998). Host cis- mediated extinction of a retrovirus permissive for expression in embryonal stem cells during differentiation. J. Virol. 72: 339-48. Lama J, Mangasarian A, Trono D (1999). Cell-surface expression of CD4 reduces HIV-1 infectivity by blocking env incorporation in a nef- and vpu-inhibitable manner. Curr Biol. 9: 622-31. Lapham CK, Ouyang J, Chandrasekhar 6, Nguyen NY, Dimitrov DS, Golding H (1996). Evidence for cell-surface association between fusin and the CD4-gp120 complex in human cell lines. Science. 274: 602-5. Lawrence JB, Cochrane AW, Johnson CV, Perkins A, Roseri CA (1991). The HIV-1 Rev protein: a model system for coupled RNA transport and translation. New Biol. 3: 1220-32. Lee FS, and Vallee BL (1 989). Binding of placental ribonuclease inhibitior to the active site of angiogenin. Biochemistry- 28: 3556-3561. Lee FS, Fox EA, Zhou HM, Strydom DJ, and Vallee BL (1988). Primary structure of human placental ribonuclease inhibitor. Biochemistry. 27: ûSSû553. Lee-Huang S, Huang PL, Sun Y, Huang PL, Kung HF, Blithe DL, Chen HC (1999). Lysozyme and RNases as anti-HIV components in beta-core preparations of human chorionic gonadotropin Proc Natl Acad Sci U S A.96: 2676-81. Lengyel P (1993). Tumor supressor genes: news about the interferon connection. Proc. Natl. Acad. Sci. 90: 5893-5895. Levy-Mintz P, Duan L, Zhang H, Hu 6, Domadula G, Zhu M, Kulkosky J, Bizub-Bender O, Skal ka M, Pomerantz RJ (1996). lntracelfular exp-on of single-chain vaiable fragments to inhibit early stages of the viral life cycle by targeting human immunodeficiency virus type 1 integrase. J. Virol. 70: 8821-8832. Lewin B (1998). The mystique of epigenetics. Cell. 93:301-3. Li X, Quan Y, Arts EJ, Li 2, Preston BD, de Rocquigny H, Roques BP, Darlix JL, Kleiman L, Parniak MA, Wainberg MA (1996). Human immunodeficiency virus Type 1 nucleocapsid protein (NCp7) directs specific initiation of minus-strand DNA synthesis primed by human tRNA(Lys3) in vitro: studies of viral RNA molecules mutated in regions that flank the primer binding site. J Virol. 70: 4996-5004. Li XY, Green MR (1998). The HIV-1 Tat cellular coactivator Tat-SF1 is a general transcription elongation factor. Genes Dev. 12: 2992-6. Liem SE, Ramezani A, Li X, Joshi S (1993). The development and testing of retroviral vectors expressing trans-dominant mutants of HIV-1 proteins to confer anti-HIV-1 resistance. Hum Gene Ther. 4: 625-34. Lloyd A (1996). HIV infection and AIDS. PN G Med. J. 39:174-80. Lock M, Grwnberg ME, lafrate Al, Swigut T, Muench J, Kirchhoff F, Shohdy N, Skowronski J (1999). Two elements target S1V Nef to the AP-2 clathrin adaptor complex, but only one is required for the induction of CD4 endocytosis. EMBO J. 18: 2722-33. Lodge R, Subbramanian RA, Forget J, Lemay G, Cohen EA (1998). MuLV-based vectors pseudotyped with truncated HIV glycoproteins mediate specific gene transfer in CD4+ peripheral blood lymphocytes. Gene Ther. 5: 655-664. Mahalingam S, Ayyavoo V, Patel M, Kieber-Ernmons T, Weiner DB (1997). Nuclear import, virion incorporation, and cell cycle anesUdifferentiation are mediated by distinct functional domains of human immunodeficiency virus type 1 Vpr. J Virol. 71: 6339-47. Mak J, Jiang M, Wainberg MA, Hammarskjold ML, Rekosh 0, Kleiman L (1994). Role of Pr160gag-pol in mediating the selective incorporation of tRNA(Lys) into human immunodeficiency virus type 1 particles. J Virol. 68: 2-72. Mangasarian A, Piguet V, Wang JK, Chen YL, Trono D (1999). Nef-induced CD4 and major histocompatibility complex class I (MHC-1) dom-regulation are governed by distinct determinants: N-terminal alpha helix and proline repeat of Nef selectively regulate MHGI trafficking. J Virol. 73: 1964-73. Mann DA, Mikaelian 1, Zemrnel RW, Green SM, Lowe AD, Kimura T, Singh M, Butler PJ, Gait MJ, Kam J (1994). A molecular rheostat. Co-operative rev binding to stem I of the rev- response element modulates hurnan immunodeficiency virus type-1 late gene expression. J Mol Biol. 241 : 193-207. Mann DL, Gartner S, Le Sane F, Buchow H, Popovic M (1 990). HIV-1 transmission and function of virus-infected monacytes/macrophages. J Immunol. 144: 2152-8. Mann R, Mulligan RC, Baltimore D (1983). Construction of a retrovirus packaging mutant and its use to produce helper-free defective retrovirus. CeIl, 33: 153-9. Martinez-Oyanedel J, Choe HW, Heinemann U, Saenger W (1991). Ribonuclease Tl with f ree recognition and catalytic site: crystal structure analysis at 1.5 A resolution, J Mol Biol. 222: 335-52. Matsuda 2,Yu X, Yu QC, Lee TH, and Essex M (1993). A virion-specific inhibitory molecule with therapeutic potentiai for human immunodificiency virus type 1. Pm-Natl, Acad. Sci. USA 90: 3544-3548. Mayers DL (1997). Prevalence and incidence of resistance to ridovudine and other antiretroviral dnigs. Am. J. Med. 102:70-75. Mclachlin JR, Mitterder N, Daucher MB, Kadan M, Eglitis MA (1993). Factors affecting retroviral vector function and structural integrity. Virology. 195: 1-5. Melekhovets YF, Joshi S (1996). Fusion with an RNA binding domain to confer target RNA specificity to an RNase: design and engineering of Tat-RNase H that specifically recognizes and cleaves HIV-1 RNA in vitro. Nucleic Acids Res. 24: 1908-191 2. Michael Nt, Louie LG, Rohrbaugh AL, Schultz KA, Dayhoff DE, Wang CE, Sheppard HW (1997). The role of CCRS and CCR2 polymorphisms in HIV-1 transmission and disease progression. Nat. Med. 3: 1160-2- Mikaelian 1, Krieg M, Gait MJ, Kam J (1996). Interactions of INS (CRS) elements and the splicing machinery regulate the production of Rev-responsive mRNAs. J Mol Biol. 257: 246- 64. Miele G, Mouland A, Ham'son GP, Cohen E, Lever AM (1996). The human immunodeficiency virus type 1 5' packaging signal structure affects translation but does not function as an internal ribosome entry site structure. J Virol, 70: 944-51. Miele G, Mouland A, Harrison GP, Cohen E, Lever AM (1996). The hurnan immunodeficiency virus type 1 5' packaging signal structure affects translation but does not function as an internal ribosome entry site structure. J Virol. 70: 944-51. Miller AD, Buttimore C (1986). Redesign of retrovirus packaging celf lines to avoid recombination leading to helper virus production. Mol Cell Biol. 6: 2895-902. Mizrahi V, Lazarus GM, Miles LM, Meyers CA, Debouck C (1989). Recombinant HIV-1 reverse transcriptase: purification, primary structure, and polymerase/ribonuclease H activities. Arch Biochem Biophys. 273: 347-58. Moore PB, Zhong Q, Husslein T, Klein ML (1998). Simulation of the HIV-1 Vpu transmembrane domain as a pentamenc bundle. FEBS Lett. 431 : 143-8. Moreira RF, Noren CJ (1995). Minimum duplex requirements for restriction enzyme cleavage near the termini of linear DNA fragments. Biotechniques.19: 56, 58-9. Morgan RA, Walker R. Gene therapy for AIDS using retroviral mediated gene transfer to del iver HIV-1antisense TAR and transdominant Rev protein genes to syngeneic lymphocytes in HIV-1 infected identical twins (1996). Hum. Gene Ther. 7: 1281-306. Mosier DE, Gulizia RJ, Maclsaac PD, Torûett BE, Levy JA (1993). Rapid loss of CD4+ T cells in human-PBL-SCID mice by noncytopathic HIV isolates. Science. 260: 689-92. Movassagh M, Desmyter C, BaiIlou C, ChapeCFemandes S, Guigon M, Klatzmann D, Lemoine FM (1998). High-level gene transfer to cord blood progenitors using gibbon ape leukemia virus pseudotype retroviral vectors and an improved clinically applicable Protocol. Hum. Gene mer- 9: 225-34. Munaux O, De Rocquigny H, Roques BP, Paoletti J (1996). NCp7 activates HIV-1Lai RNA dimerization by converting a transient lwp-loop complex into a stable dimer. J Biol Chern. 271: 33686-92. Nable GJ. From rhyme to reason (1998). Nature 392: 3-4. Naldini L, Blomer U, Gailay P, Ory 0, Mulligan R, Gage FH, Vema IM, Trono D (1996)- In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272: 263-7. Natsoulis G and Boeke JD (1991). New antiviral strategy using capsid-nuclease fusion proteins. Nature. 352: 632-635. Newton DL, llercil O, Laske DW, Oldfield E, Rybak SM, and Youle RJ (1992). Cytotoxic Ribonuclease Chimeras. J. Biol. Chem. 267: 19572-19578. Newton DL, Xue Y, Boque L, Wlodawer A, Kung HF, and Rybak, SM (1997). Expression and characterization of a cytotoxic human-frog chimeric ribonuclease: potential for cancer therapy. Protein Engng. 10: 463-470. Newton DL, Xue Y, Olson KA, Fett JW, and Rybak SM (1996). Angiogenin single-chain immunofusions: Influence of peptide linkers and spacers between fusion protein domains. Biochemistry. 35: 545553. Noel D, Pelegrin M, Mann M, Biard-Piechaczyk M, Ourlin JC, Mani JC, and Piechaczyk M (1997). In vitro and ln vivo secretion of cloned antibodies by genetically modified myogenic cells. Hum. Gene mer. 8: 1219-1229. Nowak MA, Bangham CR (1996). Population dynamics of immune responses to persistent viruses. Science. 272: 74-9. Nowak MA, May RM, Sigmund K (1995). Immune responses against multiple epitopes. J. Theor. Biol. 7: 325-53. Ohno H, Aguilar RC, Fournier MC, Hennecke S, Cosson P, and Bonifacino JS (1997). 1ntemction of endocytic signais f rom the HIV-1 envelope glycoprotein complex with menmbers of the adaptor medium chain family. Virology. 238: 305-315. Osterman HL, Walz FG Jr (1978). Subsites and catalytic mechanism of ribonuclease Tl: kinetic studies using GpA, GpC, GpG, and GpU as substrates. Biochemistry. 17: 4124-30. Ostrowski MA, Justement SJ, Catanzaro A, Hallahan CA, Ehler LA, Mizell SB, Kumar PN, Mican JA, Chun TW, Fauci AS (1998). Expression of chemokine receptors CXCR4 and CCRS in HIV-1-infected and uninfected individuals. J. Immunol. 6: 319HOl. Overell RW, Weisser KE, Cosman D (1988). Stably transmitted triple-promoter retroviral vectors and their use in transformation of primary mammalian cells. Mol Cell Biol. 8: 1803-8. Park IW and Sodroski J (1996). Targeting a foreign protein into virion particles by fusion with the Vpx protein of simian immunodeficiency virus. J. Acquir. Immune. Defic. Syndr. 11: 341- 350. PasquineIli AE, Emst RK, Lund E, Grimm Cl Zapp ML, Rekosh Dl Hammarskjold ML, Dahlberg JE (1997). The constitutive transport element (CTE) of Mason-ffizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 16: 7500-10. fatterson S, English NR, Longhurst H, Balfe Pl Helbert Ml Pinching Al, Knight SC (1998) Analysis of human immunodeficiency virus type 1 (HIV-1) variants and levels of infection in dendritic and T cells from symptomatic HIV-1-infected patients. J Gen Virol. 79: 247-57. Paul Ml Mazumder S, Raja N, Jabbar MA (1998). Mutational analysis of the human immunodeficiency virus type 1 Vpu transrnembrane domain that promotes the enhanced release of virus-like particles from the plasma membrane of mammalian cells. J Virol. 72: 127û-9. Paulous S, Emenan M, Keller R, Montagnier L, Cordonnier A (1992). Functional mapping of the rev-responsive element of hurnan immunodef iciency virus type 2 (HIV-2): influence of HIV-2 envelope-encoding sequerices on HIV-1 gp120 expression in the presence or absence of Rev. J Gen Virol. 73: 1773-80. Pedersen Hl Holder S, Sutherlin OP, Schwitter U, King OS, and Schultz PG (1998). A method for directed evolution and functional cloning of enzymes. Proc. Natl. Acad. Sci. USA. 95: 10523-10528. Pelegrin Ml Marin Ml Noel D, and Pieschaczyk M (1998). Genetically engineered antibodies in gene transfer and gene therapy. Hum. Gene Ther. 9:2165-2175. Pelegrin M, Mann Ml Noel O, Delrio M, Saller R, Stange JI Mitzner S, Gunzberg WH, and Piechaczyk M (1998). Systemic long-term delivery of antibodies in immunocompetent animals using cellulose sulphate capsules containing antibody-producing cells. Gene Ther. 5: 828-834. Perelson AS, Essunger Pl Cao Y, Vesanen Ml Huriey A, Saksela K, Markowitz Ml Ho DD (1997). Decay characteristics of HIV-1-infected compartments during combination therapy. Nature. 387:188-91. Perrin-Tricaud ClDavoust J, Jones IM (1999). Tagging the hurnan irnmunodeficiency virus gag protein with green fluorescent protein. Minimal evidence for colocalisation with actin. Virology. 255: 20-5. Piguet V, Gu F, Foti M, Dernaurex N, Gruenberg J, Carpentier JL, Trono D (1999). Nef- induced CD4 degradation: a diacidic-based motif in Nef functions as a lysoçomal targeting signal through the binding of beta-COP ifi endosomes. CeIl- 97: 63-73. Pincus SH (1 996). Therapeutic potential of anti-HIV immunotoxins. Antiviral Res. 33: 1-9. Pischinger K, Zimmermann K, Eibl MM, Mannhalter JW (1998). Cornparison of early events during infection of human and chimpanzee peripheral blood mononuclear cells with HIV-1. Arch Virol. 143: 2û65-76. Plavec Il Voytovich A, Moss K, Webster Dl Hanley ME, Escaich SI Ho KE, Bohnlein El DiGiusto DL (1996). Sustained retroviral gene marking and expression in lymphoid and myeloid cells derived from transduced hematopoietic progenitor cells. Gene Ther. 3: 717-24. Poon B, Grovit-Ferbas K, Stewart SA, Chen ISY (1998a). Cell cycle arrest by Vpr in HIV-1 vinons and insensitivity to antiretroviral agents. Science. 281 : 266-9. Poon DT, Li G, and Aldovini A (1998b). Nucleocapsid and matrix protein contrbutions to selective human immunodeficiency virus type 1 genomic RNA packaging. J. Virol. 72: 1983 1993. Pop MF (1996). In vitro analysis of the HIV-1 second strand-transfer reaction. Biochim Biophys Acta. 1307: 193-204. Quaas R, McKeuwn Y, Stanssens P, Frank R, Btocker H, Hahn U (1988). Expression of the chernically synthesized gene for n'bonuclease Tl in Escherichia coli using a secretion cloning vector. Eur J Biochem-173: 617-22 Radar C, Cheresh DA, and Barbas CF (1998). A phage display approach for antibody humanization: Designed combinatorial V gene libraries. Proc- Natf. Acad. Sci. USA. 95: 8910-891 5. Raftopoulos H, Ward M, Leboulch P. Bank A (1997)- Long-terni transfer and expression of the human Seta-globin gene in a mouse transplant rnodel. Blood. 90: 3414- 3422. Ramezani A, Oing SF, Joshi S (1997). Inhibition of HIV-1 replication by retroviral vectors expressing monomeric and multimeric hamrnethead ribozymes- Gene Ther. 4: 861-7- Rausch DM, Lifson JD, Padgett MP, Chandrasekhar B, Lendvay J, Hwang KM, Eiden LE (1992). CD4(81-92)-based peptide derivatives. Structural requirements for blockade of HIV infection, blockade of HIV-induced syncytium formation, and virostatic activity in vitro.Biochern Pharmacol. 43: 1785-96. Reichel A, Rother U, Werner J, Rechel F (1976). On the transport of various endogenous plasma proteins from blood to peripheral lymph in man. Lymphology. 1976. 9: 118-21. Richardson JH, Child LA, Lever AM (1993). Packaging of human immunodeficiency virus type 1 RNA requires cis-acting sequences outside the 5' leader region. J Virol. 67: 3997- 4005. Riddell SR, Elliot M, Lewinsohn DA, Gilbert MJ, Wilson L, Manely SA, Lupton SD, Overell, Reynolds TC, Corey L, and Greenberg PD (1996). T-cell mediated rejection of gene modified HIV-infected patients. Nat. Medicine. 2: 216-223. Rizvi TA, Schmidt RD, Lew KA (1997). Mason-Pfizer monkey virus (MPMV) constitutive transport element (CTE) functions in a positiondependent manner. Virology. 236: 118-29. Robbins PB, Skelton DC, Yu XJ, Halene S, Leonard EH, Kohn 06 (1998). Consistent, persistent expression from modified retroviral vectors in murine hematopoietic stem cells. Proc. Natl. Acad. Sci. U S A. 95: 10182-7. Robinson D, Elliott JF, Chang W (1995). Retroviral vector with a CMV-IE/HIV-TAR hybrid LTR gives high basal exprebsion levels and is upregulated by HIV-1 Tat. Gene Ther. 2: 269- 78. Roger M (1 998). Influence of host genes on HIV-1 disease progression. FASEB J. 12: 625- 32. Ross J (1995). mRNA stability in mammalian cells. Microbiological Reviews (W.K. Joklik, ed.), pp. 423-450. American Society for Microbiology, Washington, DC. Ross TM, Oran AE, Cullen BR (1999). Inhibition of HIV-1 progeny virion release by celi- surface CD4 is relieved by expression of the viral nef protein. Cun Biol. 9: 613-21. Rowell JF, Stanhope PE, Siliciano RF (1995). Endocytosis of endogenously synthesized HIV- 1 envelope protein. J. Imrnunol. 155: 473-488. Roy S, Delling U, Chen CH, Rosen CA, Sonenberg N (1990). A bulge structure in HIV-1 TAR RNA is required for Tat binding and fat-mediated trans-activation. Genes Dev. 4: 1365-73. Rybak SM, Saxena SK, Ackerman EJ, and Youle RJ (1991). Cytotoxic potential of ribonuclease and ribonuclease hybrid proteins. J. Biol. Chem. 266: 21202-21207. Rybak SM., Hoogenboom HR, Meade HM, Raus JCM, Schwartz D, and Youle RJ (1992). Humanization of immunotoxins. Pm. Natl Acad. Sci. USA. 89: 3165-31 69. Sabatino DE, Do BQ, Pyle LC, Seidel NE, Girard W, Spratt SK, Orlic D, Bodine DM (1997). Amphotropic or gibbon ape leukemia virus retrovirus binding and transduction correlates with the level of receptor mRNA in human hematopoietic cell lines. Blood Cells Mol. Dis- 23: 422- 33. Salmedel K, West JT, Hunter E (1999). A conserveci tryptophan-rich motif in the membrane- proximal region of the human immunodeficiency virus type 1 gp41 ectodomain is important for Env-rnediated fusion and virus infectivity. J Virol. 73: 2469-80. Samson M, Libert F, Doranz BJ, Rucker J, Liesnard Cs Farber CM, Saragosti S, Lapoumeroulie C, Cognaux J, Forceille C, Muylderrnans G, Vertiofstede C, Burtonboy G, Georges M, lmai T, Rana S, Yi Y, Smyth RJ, Collman RG, Doms RW, Vassart G, Parmentier M (1996). Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature. 382: 722-5. Saxena SK, Gravell M, Wu YN, Mikulski SM, Shogen K, Ardelt W, and Youle RJ (1996). Inhibition of HIV-1 production and selective degradation of viral RNA by an amphibian ribonuclease. J. Biol. Chem. 271 :20783-20788. Schier R, Jacquellin B, Apell G, McCall A, Adams GP, Malmqvist M, Weiner LM, and Marks JD (1996). Isolation of high affinity rnonomeric human anti-c-erbB-2 single chain Fv using aff inity-dnven selection. J. Mol. Bio. 255:2&43. Schneider R, Campbell M, Nasioulas G, Felber BK, Pavlakis GN (1997). Inactivation of the human immunodeficiency virus type 1 inhibitory elements allows Rev-independent expression of Gag and Gaglprotease and particle formation. J Virol. 71 :4892-903. Schnierle ES, Stitz J, Bosch V, Nocken F, Merget-Millitzer H, Engelstadter M, Kurth R, Groner 6, Cichutek K (1997). Pseudotyping of murine leukernia virus with the envelope glycoproteins of HIV generates a retroviral vector with specificity of infection for CD4 expressing cells. Proc. Natl. Acad. Sci. U S A. 94: 8640-5 Schott B, lraj ES, Roninson IB (1996). Effects of infection rate and selection pressure on gene expression from an intemal promoter of a double gene retroviral vector. Somatic CelI Molec. Genetics. 22: 291 -309. Schubeler D, Maas K, Bode J (1 998). Retargeting of retroviral integration sites for the predictable expression of transgenes and the analysis of cis-acting sequences. Biochemistry. 37: 11 907-1 4. Schubert U, Anton LC, Bacik 1, Cox JH, Bour S, Bennink JR, Orlowçki M, Strebel K, Yewdell JW (1 998). CD4 glycoprotein degradation induced by human immunodeficiency virus type 1 Vpu protein requires the function of proteasornes and the ubiquitin-conjugating pathway. J Virol. 72: 228û-8. Schumann G, Qin L, Rein A, Natsoulis G, and Boeke JD (1996)- Therapeutic effect of gag- nuclease fusion protein on retrovirus-infected cell cultures. JI Virol. 70: 4329-4337. Schwartz MD, fiore D, Panganiban AT (1997). Distinct functions and requirements for the Cys-His boxes of the human immunodeficiency virus type 1 nucleocapsid protein during RNA encapsidation and replication. J Virol. 71 :92959305. Schwartz SIFelber BK, and Pavlakis GN (1 992). Distinct RNA sequences in the gag region of human immunodeficiency virus type 1 decrease RNA stability and inhibit expression in the absence of Rev protein. J. Virol. 66: 150-159. Shapiro R, and Vallee EL (1991). Interaction of human placental ribonuclease with placental ribonuclease inhibitor. Biochemistry. 30, 224602255. Shimano R, lnubushi RI Fukumori Tl Tamaki Ml Oshima Y, Kawamura M. Adachi A (1998). Suppression of HIV-2 replication by HIV-1 gag mutants. Biochem Biophys Res Commun. 248: 41 8-21. Shterrnan NI Elroy-Stein O, Morad Il Arnitsur M, and Kaufmann G (1995). Cleavage of the HIV replication primer ~RNA~~.~in human cells expressing bacterial anticodon nuclease. Nucleic Acids Res. 23: 1744-1749. Shukla RR, Kimmel Pt, Kumar Ajit (1994). Human Immunodeficiency Virus Type 1 Rev- responsive element RNA binds to host ceIl-specific proteins. J. Virol. 68: 2224-2229. Sieber V, Pluckthun A, and Scmid FX (1998). Selecting proteins with improved stability by a phagebased method. Nat. Biotech. 16:955-960. Sikes ML, Gomez RJ, Song J, Oltz EM (1998). A developmental stage-specific promoter directs germline transcription of D beta J beta gene segments in precursor T lymphocytes. J. Immunol. 161: 1399-1405. Simon JH, Sheehy AM, Carpenter EA, Fouchier RA, Malim MH (1999). Mutational analysis of the human immunodef iciency virus type 1 Vif protein. J Virol. 73: 2675-81. Sinclair AM, Agrawal YP, Elbar E, Agrawal R, Ho AD, Levine F (1997). Interaction of vesicular stomatitis virus-G pseudotyped retrovirus with CDW and CD& CO380 hematopoietic progenitor cells. Gene Ther. 4: 91 8-27. Singwi SIRamezani A, Ding SF, Joshi S (1999). Targeted RNases: a feasibility study for use in HIV gene therapy. Gene Therapy. 6: 913-921. Skripkin E, Paillart JC, Marquet R, Ehresmann BI Ehresmann C (1994). Identification of the pnmary site of the human immunodeficiency virus type 1 RNA dimerization in vitro. Proc Natl Acad Sci U S A. 91 :4945-9 Smythe JA, Sun D, Thomson M, Markham PD, Reîtz MS Jr, Gallo RC, Lisziewicz J (1994). A Rev-inducible mutant gag gene stably transfened into T lymphocytes: an approach 30 gene therapy against hurnan immunodeficiency virus type 1 infection. Proc Natl Acad Sci U S A. 91 : 3657-3661. Sobol RW, Hendemon EE, Kon N, Shao J, Hitzges P, Mordechai E, Rechenbach NL, Charubala RI Schirmeister H, Pfleiderer W, and Suhadolnik RJ (1995). Inhibition of HIV-1 replication and activation of RNase L by phosphorothioate/phosphodiester 2'. 5'- oligoadenylate derivatives. J. Biol. Chem. 270: 5963-5978. Sodroski J, Goh WC, Rosen C, Campbell K, Haseltine WA (1986). Role of the HTLV-III/LAV envelope in syncytium formation and cytopathicity. Nature. 322: 470-4. Soosan Ghazizadeh, Joseph M. Carroll, Lome B. Taichman (1 997). Repression of Retrovirus mediated transgene expression by Interferons: Implications for Gene Therapy. J. of Virol. 71: 9163-91 69. Sorrentino BP, Brandt SJ, Bodine Dl Gottesman Ml Pastan 1, Cline A, Nienhuis AW (1992). Selection of drug-resistant bone marrow cells in vivo after retroviral transfer of human MDR1. Science. 257: 99-1 03. Stauber RH. Pavlakis GN (1998). Intracellular trafficking and interactions of the HIV-1 Tat protein. Virology. 252: 126-S. Strizki JM, Albnght AV, Sheng H, O'Connor M, Pemn L, Gonzalez-Scarano F (1996). Infection of pnmary human microglia and monocyte-derived macrophages with human immunodeficiency virus type 1 isolates: Evidence of differential tropism. J Virol. 70: 7654-62. Stnible KA, Pratt RD, Gitterman SR (1997). Toxicity of antiretroviral agents. Am. J. Med. 102: 65-69. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185: 60.89. Suhadolnik RJ, Reichenbach NL, Hitzges P, Sobol RW, Peterson DL, Henry B et al (1994). Upregulation of the 2-5A synt hetase/RNase L antiviral pat hway associated with chronic fatigue syndrome. Clin. Infect. Disease Suppl 1:S96-104. Sun LQ, Pyati J, Smythe J, Wang L, Macpherson J, Gerlach W, Symonds G (1995). Resistance to human immunodeficiency virus type 1 infection conferred by transduction of human peripheral blood lymphocytes with ribozyrne, antisense, or polymeric t rans-activation response element constructs. Proc Natl Acad Sci U S A. 92: 727207276. Tabemero C, Zolotukhin AS, Valentin A, Pavlakis GN, Felber BK (1996). The posttranscriptional control elernent of the simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J Virol. 70: 5998-601 1. Tai IT, and Sun AM (1993). Microencapsulation of recombinant cells: A new deiivery system for gene therapy. FASEB J. 7: 1061 -1 û69. Talbott R, Kraus G, Looney O, Wong-Staal F (1993). Mapping the deteminants of human immunodeficiency virus 2 for infectivity, replication efficiency, and cytopathicity. Proc Natl Acad Sci U S A. 90:4226-30. Tanaka AS, Tanaka M, Komuro K (1998). A highly efficient method for the site specific integration of transfected plasmids into the genome of mammalian cells using purified retroviral integrase. Gene. 21 6: 67-76. Thali M, Furrnan C, Helseth E, Repke H, Sodroski J (1992). Lack of correlation between soluble CDeinduced shedding of the human immunodeficiency virus type 1 exterior envelope glycoprotein and subsequent membrane fusion events. 3 Virol. 66: 5516-24. Thomsen S, Vogt B, von Laer D, Heberlein C, Rein A, Ostertag W, Stocking C (1998). Lack of functional Pit-1 and Pit-2 expression on hematopoietic stem cell Iines. Acta Haematof. 99: 148-55. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS,Jones JM (1998). Embryonic stem cell lines derived from human blastocysts. Science. 282: 1145-7. Tomassini M, Magrini L, Bonni S, Lambiase A, and Bonni S (1994). lncreased serum levels of eosinophil cationic protein and eosinophil-denved neurotoxn (protein X) in vernal keratoconjunctivitis. Ophthalmol. 101, 18ûû-1811. Trono D, Feinberg ME, Baltimore O (1989). HIV-1 Gag mutants can dominantly interfere with the replication of the wild-type virus. Cell. 59: 113-20. Tniant R, Cullen BR (1999). The arginine-n'ch domains piesent in human irnmunodeficiency virus type 1 Tat and Rev function as direct importin beta-dependent nuclear localization signals. Mol Cell Biol. 19: 1210-7. Uchida N, Sutton RE, Friera AM, He D, Reitsma MJ, Chang WC, Veres G, Scollay R, and Weissman IL (1998). HIV, but not leukemia virus, vectors mediate high efficiency gene transfer into freshly isolated GO/G1 human hematopoietic stem cells. Proc. Natl. Acad. Sci. USA. 95: 11939-1 1944. Van Zonneveld Al, van den Berg MM, van Meijer M, Pannekoek (1995). Identification of functional interaction sites on proteins using bacteriophage-displayed random epitope li braries. Gene. 167:49-52. Van Wamel JL, Berkhout B (1998). The first strand transfer during HIV-1 reverse transcription can occur either intramolecularly or intermoleculariy. Virology. 244: 245-51. Van Brocklin M, Fems AL, Hughes SH, and Federspiel MJ (1997). Expression of a murine leukemia virus gag-E. coli RNase Hl fusion polyprotein significantly inhibits vinis spread. J. ViroI. 71: 331 2-3318. Varani G, Nagai K (1998). RNA recognition by RNP proteins during RNA processing. Annu Rev Biophys Biornol Struct. 27: 407-445 Vicentini AM, Kieffer B, Matthies R, Meyhack, B, Hemrnings BA, Stone SR, and Hofsteenge J (1990). Protein chernical and kinetic characterization of recombinant porcine ribonuclease inhibitor expressed in Saccharomyces cerevisae. Biochernistry. 29, 8827-8834. von Laer O, Thomsen S, Vogt 6, Donath M, Kruppa J, Rein A, Ostertag W, Stocking C (1998). Entry of amphotropic and 1OAl pseudotyped murine retroviruses is restricted in hernatopoietic stem cell lines. J. Virol. 72: 1424-30. Wang CT, Stegeman-Olsen J, Zhang Y, Barklis E (1994). Assembly of HIV GAG-B- galactosidase fusion proteins into virus particles. Virology. 200: 524-34. Wang JC, Doedens M, Dick JE (1997). Primitive human hematopoietic cells are enriched in cord blwd compared with aduh bone marrow or mobilized peripheral blood as measured by the quantitative in vivo SCID-repopulating cell assay. Blood. 89: 3919-3924. Wang L, WitherÎngton C, King A, Gerlach WL, Carr A, Penny R, Cooper D, Symonds G and Sun LQ. Preclinical characterization of an anti-tat ribozyme for therapeutic application. Human Gene Therapy. 9: 1283-1291. Wang LM, Zhou AM, Vasavada S, Dong BH, Nie HQ, Church JM et al. (1995). Elevated Ievels of 2'5'4inked oligoadenylate-dependent ribonulease L mur as an early event in colorectal tumoflgenisis. Clin. Cancer Res. 1, 1421-1 428. Warren MK, Rose WL, Cone JL, Rice WG, Turpin J, Anglish NR, Longhurst H, Balfe Pl Helbert M, Pinching Al, Knight SC (1996). Differential infection of CD34+ cell-derived dendritiq cells and monocytes with lymphocyte-tropic and monocyte-tropic HIV-1 strains. J. Virol. 70: 7654-62. Wei CM, Gibçon M, Spear PG, Scolnick EM (1981). Construction and isolation of a transmissible retrovirus containing the src gene of Harvey murine sarcoma virus and the thymidine kinase gene of herpes simplex vinis type 1. J Virol. 39: 93544. Weissman D, Rabin RL, Arthos J, Rubbert A, Dybul M, Swofford R, Venkatesan S, Farber JM, Fauci AS (1997). Macrophage-tropic HIV and SIV envelope proteins induce a signal through the CCRS chemokine receptor. Nature, 389: 981-5. Welker R, Harris M, Cardel B, Krausslich HG (1998). Virion incorporation of human immunodeficiency vinis typ8 1 Nef is mediateci by a bipartite membrane-targeting signal: analysis of its role in enhancement of viral infectivity. J Virol. 72: 88334. Weerasinghe M, Liem SE, Asad S, Read SE, Joshi S (1991). Resistance to human immunodeficiency virus type 1 (HIV-1) infection in human CD& lymphocyte-denved cell lines conferred by using retroviral vectors expressing an HIV-1 RNA-specific ribozyme. J Virol. 65: 55314. Whitaker RED (1997). Re-a-ng the virological approach to HIV pathogenesis: Can it exptain AlDS as an immunological disease? J. Theor. Biol. 187: 45-56. WHO (1998). Global AlDS sunreillance. Part II.Wkly Epidemiol Rec. 73: 3814. Wiegers K, Rutter G, Schubert U, Grattinger M, Krausslich HG (1999). Cyclophilin A incorporation is not required for human immunodeficiency virus type 1 particle maturation and does not destabilize the mature capsid. Virology. 257: 261-74. Winter G (1998). Synthetic human antibodies and a strategy for protein engineering. FEBS Lett. 430: 92-94. Woffendin C, Ranga U, Yang Z, Xu L, Nabel GJ (1996). Expression of a protective gene- prolongs survivai of T cells in human immunodeficiency virus-infected patients. Proc. Natl. Acad. Sci. U S A. 93: 2889-2994. Wolinsky SM, Korber BT, Neumann AU, Daniels M, Kunstman KJ, Whetsell AJ, Furtado MR, Cao Y, Ho DD, Safrit JT. Adaptive evolution of human imrnunodeficiency virus-type 1 during the natural course of infection. Science. 272: 53742. Wong-Staal F, Poeschla EM, Looney DJ (1998). A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-linfected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV-1 RNA. Hum. Gene Ther. 9: 2407-25. Wu L, Gerard NP, Wyatt R, Choe H, Parolin C, Ruffing N, Borsetti A, Cardoso AA, Desjardin E, Newman W, Gerard C, Sodroski (1996). CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5. Nature. 384: 179-83. Wu X, Liu H, Xiao H, Kim J, Seshaiah P, Natsoulis G, Boeke JO, Hahn BH, and Kappes JC (1995a). Targeting foreign proteins to human imrnunodeficiency virus particles via fusion with Vpr and Vpx. J. Virol. 69: 3389-3398. Wu Y, Saxena SK, Ardelt W, Gadina M, Mikulski SM, De Lorenzo C, D'Alessi0 G, Youle RJ (1995b). A study of the intracellular routing of cytotoxic ribonucleases. J Biol Chem. 27O:l7476-17481. Wu YN, Mikulski SM, Ardelt W, Rybak SM, and Youle RJ (1 993). A cytotoxic ribonuclease. J. Biol. Chem. 268: 10686-10693. Wyatt R, and Sodroski J (1998). The HIV-1 envelope glycoproteins: Fusogens, antigens, and immunogens. Science. 280: 1884-1 888. Xu 1, Yee JK, Wolff JA, Friedmann T (1 989). Factors affecting long-term stability of Moloney murine leukemia virus-based vectors. Virology.171: 33141. Yajima T, Kanda T, Yoshiike K, Kitamura Y. Retroviral vector targeting human cells via c-Kit- stem cell factor interaction (1 998). Hum. Gene Ther. 9: 779-87. Yankulov K, Bentley O (1 998). Transcriptional control: Tat cofactors and transcriptional elongation.Cun Biol. 8: R447-9. Yin L, Braaten O, Luban J (1998). Hurnan immunodeficiency virus type 1 replication is rnodulated by host cyclophilin A expression levels. J Virol. 72: 6430-6 Youle RJ, Newton D, Wu YN, Gadina M, Fîyûak SM (1993). Cytotoxic nbonucleases and chimeras in cancer therapy. Crit Rev Ther Drug Carrier Syst. 10:l-28. YouIe RJ, Wu YN, Mikulski SM, Shogen K, Hamilton RS, Newton D, D'Alessio G, Gravell M (1994). RNase inhibition of human immunodeficiency virus infection of H9 cells, Proc. Natl- Acad. Sci. USA. 91: 6012-6016. Yu Hl Jetzt AE, Ron Y, Preston BD, Dougherty JP (1998). The nature of human immunodeficiency virus type 1 strand transfers. J Biol Chem. 273: 28384-91. Yu H, Rabson AB, Kaul M, Ron Y, Dougherty JP (1996). Inducible human immunodeficiency virus type 1 packaging ceil lines. J Virol. 70: 4530-7 Yu Q, Morrow CD (1999). Complernentarity between 3' teminal nucleotides of tRNA and primer binding site is a major deteminant for çelection of the tRNA primer used for initiation of HIV-1 reverse transcription. Wrofogy. 254:160-8. Zarling JM, Moran PA, Haffar O, Diegel M, Myers DE, Kuelbeck V, Ledbetter JA, Uckun FM (1991). Inhibition of HIV-1 replication in seropositive patients8CD& T-cells by pokeweed antiviral protein-monoclonal antibody conjugates. Int J Immunopharmacol. Suppl 1: 63-8. Zhou Y, Chandran 6, Wood C (1997). Transcriptional patterns of the pCD41 (U27) locus of human hepesvirus 6. J Virof. 71: 342û-30- Zolotukhin AS, Valentin A, Pavlakis GN, Felber BK (1994). Continuous propagation of RRE(- ) and Rev(-)RRE(-) human immunodeficiency virus type 1 molecular clones containing a cis- acting element of simian retrovirus type 1 in human peripheral blood lymphocytes. Zufferey R, Nagy O, Mandel RJ, Naldini L, Trono D (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol.15: 871-5 Appendix A Appendix A is derived from the manuscript, 'Targeted RNases: a feasibility study for use in HIV gene therapy", authored by Sanjeev Singwi, Ali Ramezani, Shi-Fa Ding and Sadhna Joshi. This manuscript has been published in Gene Therapy. My major contribution was Figure 3b and 4 and the wnting of the manuscript. Targeted RNases: a feasibility study for use in HIV gene therapy S Singwi, A Ramezani. SF Ding and S Joshi Department of Medical Cenetics and Mimbiology, Facdty of Medicine. Univusity of Toronto. Canada ln troduction of these rnolecdes cleave HIV RNA resdting in a perma- nent loss of RNA function and act in a catalytic manner Acquired immunodeficiency syndrome (AIDS)is caused thus cequiring low concentrations to be effective. by the human immunodefidency virus o.whkh uiti- Ribozyme activity in vivo requires that the nudeotides mately destroys the immune system. The major targets within the HIV RNA target site($) be conserved. of HN infection are the CD4+ T lymphocytes and Mutations outside the target site can also affect ribozyme monocytes/maaophages. Rendering these cek resistant activity by creating secondary structures. which rnay to HN replication via gene therapy shodd result in sig- sterically hinder target site accessibiliy to the ribozyme. nifiant reduction. if not complete elimination. of HlV in Given the high rnutagenic rate of HIV. the emergence of infected individuals. The therapeutic gene rnay express HIV escape mutants is thus highly probable. In contras. RNAs (ie antisense RNAs. sense RNAs and ribozymes) there is littie latitude for the emergence of HIV escape and/or proteins (ie receptors. tmmdorninant mutants. mutants in RNase-based strategies where deavage is not single-chah andbodies and RNases) that interfere with dependent on a conserved target sequence- the virus life cycle.14 Therapeutic benefit rnay be Nases rnay be designed to: (1) confer sefective toxiaty obtained if the interfering RNA/protein moIecuIes inhibit to W-infected ceh; (2) deave RNA present within virus HIV replicadon for a sustained period of time and the particles yielding non-infectious progeny virus: or (3) inhibition is not overcome by a mutation(s) within the cleave HIV RNA within the ce11 inhibithg progeny virus HIV genome. Aiso the therapeutic gene, if acquired by production. The ktapproach rnay be accomplished by HIV via recombination. shouid not confer any advantage HIV nans-aaivator of transcription mat)- and/or regu- to the virus, lator of expression of virion proteins (Rev)-inducible With the exception of ribozyme-and RNase-based stra- e~pression~~of a 'cytotoxic RN~S~'."~Strategies based on tegies. most exisdng gene therapy strategies require stoi- the second approach have been designed by using Fiision chiomeuic binding of interfering moledes to HIV proteins containing the HIV-1 virion protein R (Vpr) or RNA/protein moledes. Consequently. an excess of the HIV-2 virion protein X (Vpx) domain and the bacterial interfering rno!ecuies is required to shift the equiiibrium Staphylococcaf nudease (SN) domain.1° The fusion pro- towards the bound form. Furthemore. since the HïV teins were shown to be packaged into progeny virus: RNA/protein is not consumed in the reaction. a slight however. they were susceptible to HN protease deav- shift in the equilibrium may be suffident to permit HlV agem Use of HIV pmtease-resistant 'packageable RNa- replication to proceed beyond the inhibitory step. ses or CO-administrationof HIV protease inhibitors rnay allowing virus to repllcate. On the other hand. ribozyme- be required for this strategy to work The third approach and RNase-based strategies rnay be preferred since both requires selective degradation of HIV RNA within the infected ceii without causing cytotoxidty. Most exisdng Correspondence: S ]oshi. Department of Meàfcal Cenetics and Micm RNases deave single-stranded RNAs at a specific ribonu- bfology, 150 CoUege Srnet. 1212, Faculty of Medldne. University of deodde or double-stranded RNAs at any ribonucleo- Tomnto. Tomnco. Oncario M5S 3EZ Cana& tide." but do not poses target RNA specifidty. A Recelved 17 JuIy 1997: accepted 31 December 1998 'targeted RNase' rnay be designed by king a ribonucleo- Figure 5 uIhlbftlon d HW-1 rrpifcation in stable MI4 hrandunanrs expdng Tm-RN= Tl. HIV-1 (NL4-3 main) suscepffbllryof MolN (-04 and MoTN-TevTl (-O-) uansducai MTI cellr lniiins were jmiümd usfng (a) 30 ng (pz4 equfvalentl ai HN-I Tor 2 h or (b) IO0 ng (pz4 equivalent) of HN-I for 6 h îhe amounc of HIV-t p24 antigen pmtIn the MLed dlculture mpcmacanrs is shown at various thne fntecyalz. Figun 6 PCR and RT-PCR analysis of HN-1-~ccfcdMT4 VanSdu~ntsto demine the mode oifnhibicionof Tev-RNase TI. Samples were analyzed hm the MV-1 dyllenge experiment &un in Figure Sb. (a) PCR analysis co atm the prrsuice of HN-1provirus DNA synthesized lollowing intëcüon On &y 6 after MV-1 IniKtllon genomfc DNA hm MoTN (lane 2) or Mo?lV-TevT1 @ne 3) rransduced MT4 celis was analyred by PCR using Vpr-5' and Vpu-J primes spdlleally to mpf@ a 424 bp region wftlifn the HIV-1 provfral DNA A wnvol PCR using no DNA was ab perîionned (lane 1). (bl Ri-PCR anaiysis to detm the praence of W-1 RNA roUowing inîecüon On day 6 after HW-1 inlection. mal RNA hm MoTN Oane 2) or MoTNTevTI (lane 3) transducai MT4 œiis was anafynd by RT-PCRusing Vpr-9 and Vpu-J prirners ro ampi@ a 424 bp region spedlFc to HIV-1 RNA. A conml RT-PCR using no RNA war abpufonned (lane 1). cells were seleaed for 4 days. The pools of PBL transduc- RT-PCR analyses of genomic DNA and total cellular tans lacking or expressing Tev-RNase Tl were then chal- RNA. respectively. from MoTN and MoTN-TevT1 vector lenged with 1.5 ng (pz4 equivalent) of a cünical isolate vansduced PBLs on day 3 after infection. A 460 bp PCR of HIV-1. The amount of HCV-1 p24 antigen released in product. spedfic for W-1 DNA. was present in both the ce11 culture supernatants was measured over time. MoTN and MoTN-TevT1 tranxiuced PBLs (Figure 8b. Virus production in PBLs cransduced with MoTN-TevTl lanes 2.3). RT-PCR of total cellular RNA resulted in was delayed as compared with PBLs transduced wirh amplification of a 460 bp product from control MoTN MoTN (Figure 7). Tev-RNase TI RNA expression was transduced PBLs (Figure 8c. lane 2) but not from MoTN- shown by RT-PCR analysis of total cellular RNA on day TevTl transduced PBLs (Figure 8c. lane 3). suggesting 12 after infection from the MoTN-TevT1 transduced chat Tev-RNase Tl interferes with the virus life cycle after PBLs. A 331 bp product was detected contiming the integration by decreasing the level of HIV-1 transaïpts. presence of Tev-RNase Tl RNA in MoTN-TevT1 tram- To confirrn inhibition after integration. the HIV-1 provi- duced PBLs (Figure Sa. lane 2). As expected, no Rï-PCR rus DNA levels in the two ceU types were analyzed by a product spedfic for Tev-RNase Tl RNA could be semi-quantitative PCR method. Under these conditions. detected in control PBLs vansduced with the MoTN vec- a iinear relationship exists between the amount of DNA tor (Figure Sa. lane 1). The presence of HIV-1 provirus used and the intensity of the PCR product (Figure 9. lanes DNA and HIV-1 RNA was also determined by PCR and 5-13}. Semiquantitative PCR analysis of genomic DNA ------The above results demonstrate the efficacy of Tev- 91 7 RNase Tl in delaying HXV-1 replication in hurnan PBLs and also substantiate that Tev-RNase Tl acts after inte- gration by redudng the level of HIV-1 transcripts. An RNase may be used in antiviral therapy for destruc- tion of infeaed ~eils."~for inactivation of virion RNA.1° or for inactivation of viral RNA within the infeaed ~ells.~~~~For HIV gene therapy. the first approach rnay be developed by providing ceIls susceptible to infection with a 'cytotoxic RNase' which wouid. upon induction by a vira1 regdatory pr~tein.'.~cause selective death of ceiis that do become infeaed by HIV. The second approach requires that ceiis be provided with a 'pack- ageable Nase' so that virion RNA is inactivateci. This Figure 7 Lnhfbirion ofHN-1npiicataon in PBL naraduccants cxpressfng approach invoives interference in the late phase of the Tev-RNase Tl. HN-1 su~eptfbiiiryof MoTN (-B-) and MoTN-TevTZ virus Iife cyde such that the progeny virus produced (44 vansduced PBLs. Inlections m done ~t~ing1.5ng (pz4 from the geneticaily modfied ceUs is non-infectious. equivaient) of a dlnlcal isolate of W-1 Tor 16h nie amount ofMV-1 pz4 antigen present in the Wected ceil culture suprnatant Is shown at Although this strategy is airned at inhibiting subsequent various tfme intervais. rounds of infection. the genetically modifîed ceils that become infected may be suxeptibIe to a ceil-mediated immune response or rendered non-functiond with resulted in amplification of 460 bp products with simiIar regards to immune function because production of virai intensities from both infected MoTN (Figure 9. lane 1) proteins is still maintained Shce gene therapy for HIV and MoTN-TevTl (Figure 9. lane 2) transduced PBLs. is aimed at reconstituting an W-resistant immune sys- suggesting that a similar amount of HN-1 provirus DNA tem. the genetically rnodified cells must not only inhibit was present on day 3 after Infection in PBts lacking or virus replication but also maintain normal cell functions. expressing Tev-RNase Tl. Since the arnot.int of HIV-1 Although the two strategies can potentially inhibit virus provirus DNA detected in the two celi types is sirnilar. replication. they also confer negative selection to the gen- Tev-RNase Tl does not interfere with the HIV-1 iife cycle etically modifieci ce&. Therefore. their efficacy rnay before proviral DNA htegration Therefore. Tev-mase depend on genetic modification of all celis in the immune TI does not seem to deave the incorning virion RNA system so that upon eiiminadon of infected celIs and in before reverse transcription. This observation combined the absence of new infections. unuifected celis wiil wîth the la& of HIV-1 RNA detected by RT-PCRsuggests repopulate the immune systern. In conuast. the third that Tev-RNase Tl acts by decreasing the level of HIV-1 approach requires that celis be provided with a 'targeted RNA produced in the infected ce11 after integration. RNase' for viral RNA inactivation within the ceil. Conse- Figure 8 (a) Tev-RN= Tl RNA exprcrslon. &) hW-1 provfnts DNA and (c) HIV-1 RNA production In HIV-1-ùzîiècred PBL transductants. (a) RT- PCR analysis ru detect the prauir;e of Tcv-RN= Tl RNA and Ccuular GAPDH RNA On &y 12 afw utleaion. total RNA hmHN-1 idected MoTN (lane 1) or hfooTN-TevTl &me 2) vansducrd PBk was rrwse trarrwfkd usfng the Pm-J primer which is sjn?d6c for vecror sequencer wirNn the Tev-RNase T1 RNA- Tlie cDNA was ikn PCR arnpIf6af using T-S and R-3 primes multing in a 331 bp pduct spedlic for Tev-RNase Tl RNA GAPDH-S and GAPDH-3' prima were usai for Rî-PCR ampli6catfon of a MEO bp tvgfon withln the ceU& WDHRNA hmMoTN Me3) and MoTN-TevTI Oane 4) rramduced PBk (b) PCR analysis ro detm thc presence of HN-1 provirus DMryntkfied hUowlng Infeaion On day 3 aïfer HN-1 Mection. genonùc DNA hmMoîN (iane 2) or MoTN-TevT1 (lane 3) uansàuaxf PBLr was anal@ by PCR using Gag-!ï and Gag-3' primes- niis primer palr dows spdl5c arnpüûcatfon ofa 460bp mgion Wthh the HiV-1 gemme. A mntml PCR usfng no DNA was ahperformed (lane 1). (cl RT-PCR analyslr to detect the pmem of HN-1 RNA folowfng Mdon On day 3 &er HIV-1 iniéction. focal RNA hmMollV (lane 2) or MoTN-TevT 1 (lane 3) vansduced PBLs war anal- by RT-PCR using Gag-S and Gag-3' prmnA contml RT-PCR using no RNA was aise performed (lane 1). Figure 9 Semiquandtadw PCR anal* of W-1 provlntr DNA on &y 3 aAn HN-1 cftaiiengc of PBL transductants. HN-1 provfnrr DNA conrent of MoTN Oane 1) and Mo'TN-TevTI (lane 2) ~UCCdPBLs was analped by umi-quantftatlve PCR of total cell&u DNA. A 4ôû bp wonwfrhfn Che HN-1 provfrus DNA was ampW ustng Gag-S and Gag-3' prlmcrs (lan6 1 and 2). In parallei. GapS and Gap3 primes were useci Co ampl@ a 122 bp regfon wfthfn the endogcnous GAPDH gu~(lane 3 and 4). TnLr prlmcr pair wzir used as an Intanai wnml CO mure that an equal amount of total DNA was analyacd In the MoTN and MoTN-TMI Uarrsdttccd PBL sampiu Connol exporfmenn were periïorrned to demonstrate a Ifnear relatlomhip beoveen the Incemiry of the PCR producr and the amount of DNA d.For GAPDH DNA. 0.01 (lane 5). 0.1 (lane 6) and 1 (lane 7) pg of rotal œüuiar DNA wem usecf and for HN-1 DNA. IO (Ianc 8). 100 (lane 9). IWO &ne 10). 5000 Me11). 50 000 (lanr 12). and 500 000 (lane 13) CO* 0fpNL4-3 DM m* tEN-I proviral DNA w-1 W- uscd quently. seleaive destruction of virai RNA wiil be achi- infected cells. thereby inhibiting subsequent steps in the eved early in the virus life cyde without destroying the virus life cycle. Although. in vim we have dernonstrated ce11 and potentiaiiy alIowing maintenance of normal cell that Tev-RNase Tl is enzyrnatically functional. it cannot functions. Those cells expressing the targeted RNase be ded out that Tev-RNase Tl may aiso aa ui vivo by wodd inhibit viral replication. maintain viability and sterically interfering with Tat-mediated activation eventually out-compte the ceik susceptible to infection. of HIV gene expression or Rev-mediated HIV RNA By natural selecdon. the immune system could thus be export since both of these modes of inhibition would also reconstituted with a population of resistant and func- result in reduced levels of W-1RNA. tional cells. The enzymatic function of Tev-RNase Tl. as shown in We present here data supporthg the feasibility of a tar- ~Ïûu.suggests that Tev-RNase Tl cm deave substrate geted RNase approach in Ki'V gene therapy. The targeted RNA non-spedficaily. However. ladc of toxicity despite RNase. Tev-RNase Tl. was shown to be enzyrnatimlly active protein production suggests that intracellularly functional. htracellular expression of Tev-RNase Tl in Tev-RNase Tl does not deave non-specifidy. Tev- MT4 cells and hurnan PBLs resulted in a significant delay RNase Tl specifiaty in vivo is expected to be dependent of a laboratory strain and a clinical isdate of HIV-1. on the initial binding event of HIV-1 Tev to TAR or RRE respectively. Tev-RNase Tl was shown to interfere with within HIV RNA and the proxirnity of the catalytic the W-1life cycle after integration. Also. cells express- domain to guanylate residues. The initial binding event ing Tev-RNase Tl were viable and showed no signs of by the Tev domain is expected to occur with up to a 10'- toxidty. fold higher afhity than the RNase Tl domain. Therefore. In order to understand the mode of interference of Tev- Tev-RNase Tl is expected to cIeave HIV-1 RNA at avail- RNase Tl. MT4 transductants were infected at a higher able guanylate residues within and outside the TAR and viral dose and the HIV-1 provirus DNA and HIV-1 RNA RRE regions. Bacteria. higher plants and mammals utilize content in the cells was monitored over a 6-day period. several RN- for host defense. These Nases are cyto- These experimental conditions were expected to rep- toxic since they appear to reach the cytosol of cells by a resent better the effeas of Tev-RNase Tl in initial rounds receptor-mediated pathway where they can readily of HIV-1 infection since viral spread was Iimited. On day degrade cellular RNA.= HIV-1 Tev contains a nuclear 3 after infection. sirnilar levels of provirus DNA were localization signal and is mainly localized within the detected by PCR in MoTN and MoTN-TevTl transduced nucleus.t1 Therefore. Tev-RNase Tl is predicted to cleave MT4 cells. whiïe HIV-1 RNA was undetectable by RT- HIV-1 RNA primarily with the nudeus. The absence of PCR in both ce11 types. On day 6 after infection. RT-PCR cytotoxicity suggests that nuclear host RNA is not avail- results demonstrated that HIV-1 RNA in cek expressing able for deavage by Tev-RNase Tl. The emerging view Tev-RNase Tl was significantly reduced as compared of nudear structure involves the existence of compart- with control ceiis. These results were confirmed in trans- ments of heterogeneous RNA-protein complexes duced PBLs chalienged with a clinical isolate of Hnr-1. involved in RNA rnetabolism like splicing. transport. PCR analysis of cellular DNA under semi-quantitative polyadenylation and stabiiization.JgTherefore. the com- PCR conditions on day 3 after infection revealed similar partmentalization of nudear bodies within the nucleus HIV-1 provirus DNA levels in the two ce11 types. whereas during RNA metobolisrn may prevent any association of RT-PCRanalysis of total cellular RNA dernonstrated sig- nuclear host RNA-protein complexes with Tev-RNase nificancly reduced levels of HN-1 RNA in cells express- Tl. Host nuclear RNA exclusion in combination wirh the ing Tev-RNase Tl as cornpared with control ceUs. Taken spedfic affinity and companmentalization of Tev-RNase together. these results suggest that Tev-RNase Tl rnay Tl with HN RNA may thus be important factors con- not cleave the incoming virion RNA and therefore does tributing to the efficacy of Tev-Wase Tl with regards to not interfere with steps during the virus Ufe cycle viral inhibition and lack of toxïcity in the cell. between viral entry and provirus DNA integration. An effective targeted RNase strategy is expected to Rather. Tev-RNase Tl seems to act by spedfically reduc- depend on both the cleavage effidency and specificity. ing the level of HIV-1 u-ansccipts producec! within the For HIV gene therapy. the cleavage efficiency and speci- 919 fidty codd be further improved by using an RNase with The amphotropic MoTN and MoTN-TevT1 vector par- separable RNA binding and catalytic domains.lo A fusion ticles (500 4) were used to ducethe MT4u-a ce11 Iine protein containing Tev and only the catalytic domain of (2 x 106 cells). as described previ~usly?~~~Gd 18-resistant such an RNase should allow cleavage that would solely pools of stable MT4 nansductants lacking or expressing depend on the specifidty of target RNA-binding by the Tev-RNase Tl were each selected for 3 weeks and used RNA-binding motif of Tw. The use of targeted RNases without any doning. in Hn/ gene therapy ahraises the issue of potential Human peripheral blood mononuclear cells were iso- immunogenidty. Targeted RNases containing TAR- or lated from fresh heparinized blood samples from hedthy RRE-binding domainslu3 and an RNase domain of donors by Ficoil-Hypaque gradient centrifugation, Celis human origin may aiieviate this problem-" were washed once with phosphate-buffered saline (PBS) This study demonstrates for the first time the feasibility and cultured at a density of 1x 10' celIs/ml in RPMI 1640 of a targeted RNase approach for human gene therapy. containlng 10% fetal bovine serum. 20 unitdm1 of human Strategies are being developed to improve on the design recombinant interleukui (IL)-2 (Boehringer Mannheim. of this and other RNases to increase their and-HIV poten- Mannheim. Gerrnany). and 5 &ml of phytohemaggluti- tial further. ln addition. fusion constnicts using targeted nin (Sigma. St Louis. MO. USA) for a day at 37°C. The DNases. lipases and proteases may invite other opport- suspension ceils were coueaed and cultured for 2 more unities for selective depdation of HIV provirus DNA, days, mer 85% of these cells represented T lymphocytes the vinon ll pfd bilayer and viral pmteins. respectively. as determined by flow cytomeay analysis using T celi- spedfic monoclonal antibodies- PBLs (I x 106 cells) were then mixed with 1 ml of amphotropic MoTN and MoTN- Materials and methods TevTl vector particles (with 16 )rg/rnl polybrene and 20 unitdm1 IL-2) and centrifuged at 200 g for 1 h at 32°C Vector constnrctions and then cultured for 16 h at 32OC. Ceils were then incu- The tevT1 gene was constructeci by a two-step PCR as bated for 6 h at 37°C in the presence of L2-sup- described previo~sly~~using Pfu DNA polymerase plemented medium The uansducfion procedure was car- (Stratagene. La Joua. CA. USA). The Nase Tl gene was ried out for a total of three times. Twenty-four hours after amplified by PCR using the pAZTln template and the the third transduction. cells were cultured for 4 days in TevTl junction-5' (5'-AGT-CAC-GAGCTA-AAGAAG IL-2supplemented medium containing G418 (500 pg/rnl) CTT-GCGACT-ACA-CTT-3') and Tl-3' (5'-CTA-AAG and for another 5 days without selection. Cells were ATC-TCT-ATGTAC-AIT-CM-CGA-ACT-37primers. checked periodimlly for growth and viability. This PCR product. containing the RNase Tl coding region, and the Tev-5' primer (5'-GTC-TGC-AGC-ATA- Tev-RNase TI expmssion in MT4 ceII3 and PBLs TGA-TGGAGC-CAGTAGATC-C-3')were used in a Total ceiiular RNA was extraaed from MoTN and second PCR to amplify the tev gene from the pTev plas- MoTN-TevT1 tranxluced MT4 cells or PBLs4' and in,- rnidmZ1The resulting 943 bp PCR product contained an bated with DNase RQ1 (Promega. Madison. WI. USA). NdeI restriction site. the tevTl coding region. and a BglLl RT-PCR analysis of totai ceiiular RNA from stable MT4 restriction site. This DNA was digested with NdcI and transductants was then performed as dexribed pre- BgliI and cloned at the NdeI and BamHI sites within the E. viou~ly.~The TevT1-5' and TevT1-3' primer pair was coli expression vector. PET-15b (Novagen. Madison. WI. used to ampiij. a 943 bp produa specific for Tev-RNase USA). The resulting vector was referred to as PET-TevT1. Tl RNA. The GAPDH-5' (Y-CCA-CCC-ATGGCA-AAT- The tevTl gene and the SV40 promoter were then sub- TCC-ATG-GCA-3') and GAPDH-3' (5'-TCT-AGA-CGC- cloned in a retroviral vector. Moï?3J," as foiiows: two- CAGGTC-AGGTCC-ACC-3') primer pair was used as a step PCR was performed to amplify a cassette containing control to deten the 600 bp product specific for cellular the SV40 promoter driving tevTl gene expression. in the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) fi rst PCR TevT1-5' (SCAT-ATC-GAA-TïC-ACC-ATG RNA. FtT-PCR products were anaiyzed by 2% agarose gel GAGCCA-GTA-GAT-CC-3') and TevT1-3' (Y-GCG electrophoresis. RT-PCR analysis of totai cellular RNA CA T-CGA-ET-ATGTAC-Am-CAA-CGA-AGT-3') pïi- from PBL transductants was performed in a similar man- mers were used to amplify the tevT1 gene from the PET- ner except that RNA extraaed on day 12 after HN-1 TevTl plasmid. This PCR product and the SV-S primer infection was analyzed using the following primers. A (5'-CGG-AAGATC-TM-TAGGAC-TCA-CTA-T-3')WCXC! 3' primer (PPT-3'. 5'-AAC-AGA-AGC-GAGAAGCG33. then used in a second PCR using the pB1-SVR68'* tem- designed specifically to recognize veaor sequences plate. to arnplify the SV40 promoter upstrearn of the within the Tev-RNase Tl RNA. was used during reverse tevTl codiig region. The resulting PCR product con- transcription The cDNA was then ~~~-am~lifi-edusing tained a BgEi restriction site. the SV40 promoter. the T-5' (5'-GTGTïGCiT-TCA-TTGCC-3')and R-3' (5'- tevT1 gene and a Cld restriction site. This cassette was CCA-GAA-GTï-CCA-CAA-TC-3') primers to detect a digested with BglII and CIaI and doned at the BamHI and 331 nudeotide region within the Tev-RNase Tl RNA. Cld sites within the MoTN vector. The correct done wa MoTN and MoTN-TevTl uansduced MT4 cells (1 x 106 referred to as MoTN-TevTi. cells) were also analyzed for Tev-RNase Tl protein pro- duction. Celis were washed three times with PBS and Transduction of MT4 ce113 and PBLs then lysed for 45 min on ice in a buffer (400 pl) containing Amphotropic MoTN and MoTN-TevT1 vector particles phenylmethylsulfonyl fluoride (100 &ml; Sigma). apro- were produced and their titen determined as described tinin (1 mg/rnl; Boehringer Mannheim). and Triton X-100 pre~iously.'~The titers of MoTN and MoTN-TevT1 vec- (1%). Celi lysates were centrifuged for 10 min at 10 000 tor particles were approxirnately 1 x 105 colony-forming g. Supernatants were collected and Tev-RNase Tl activity units per ml, each. was detected by an in situ RNase activity assay as fol- lows. Samples were subjm to electrophoresis on a 0.1% HIV-1 RNA. The DNA from transduced PBLs on day 3 SDS-12% polyacrylamide gel embedded wfth denatureci after HIV-1 infection was also analyzed under semi- turnip yellow mosaic virus RNA (lm gg/ml) as quantitative PCR conditions. The Gag-5' and Gag-3' pri- described pre~ioiily.~except that no DIT was induded mers were used to amplify the 460 bp gag coding region in the loading buffer. Prestained high molecular weight within HIV-1 provirus DNA. and Gap-5' (S-TCT-ACT- protein standards (GIBCO. Burlington. Canada) were GGC-Ga-GCC-AAG33 and Gap-3' (5'-TCT-AGA-CGG analyzed in parallei. Foliowing electrophoresis. the gel CAGGTC-AGG3') prirners were used to amplify a was rinsed four to five tirnes with water and shaken 122 bp region within the cellular GAPDHDNA and RNA. gentiy at room temperature for 1 h in 300 ml of buffer PCR was performed as describeci previously. except that containhg 50 mM Tris-Cl (pH 7.4) and 2 rnM EDTA (pH the following modifications were made to ensure that a 8.0) to remove SDS and allow protein renaturation This iinear relationship dtsbetween the input DNA concen- buffer was replaced and the incubation continued over- tration and the intensity of the PCR products The 3' pri- night at 37°C to aUow Tev-RNase Tl rnediated deavage mers were 5'-end labeled as describeci previousIyt6 using of RNA The gel was then stained with ethidium bromide yq-ATP (Amersham. Oakvllle. Canada: 6000 Ci/mmoI) (1 pglrnl) and the zone of clearance due to RNase and the concentration of 5' and 32P-labeled activity was viewed under W Ught (approxirnately 1.3 x 106 cp.m.fpg) 3' primers was inaeased to 5 pgf ml- After 25 cycies of PCR an aliquot Growth cutves of stable MT4 aiansductan& lacking or was analyzed by 2% agarose gel elearophoresis followed expressing Tev-RNase Tl by exposure to a phosphor screen and scanning by Storm Cells were cultured for over 6 months without any signs phosphorimager (Molecular Dynamics. Sunnyvale. CA. of toxicity. The growth curves of stable MT4 transduc- USA). To ensure that these condittons allow serni-quanti- tants were determfned by performing a viable ceU count tative amplification. Gap-5' and Gap-3' pnmers were (by twan blue exdusion) over a IO-day period, used to PCR arnpllfy 1.10 and 100 pg/rnl of cellular gen- omic DNA. and Gag-5' and Gag-Y primers were used to HIV-1 susceptibilQ of MT4 and PBL transductants PCR ampi@ 10 to 500 000 copies of HIV-1 pNL4-3 plas- expressing Tev-RN- TI mid. The pools of actively dividing stable MT4 transductants lacking or expressing Tev-Nase Tl protein (2 x IO6 ceiis) were each infected with the HN-1 suain M.4-3.'9 CeUs Ackno wledgements using were infected as described previou~ly5"~ either 30 This work is supported by gants from the National ng (p24 equivalent) of HIV-1 for 2 h or LOO ng (pz4 h. Health and Research Development Program and Medical equivaient) of HIV-1 for 6 Transduced PBLs (5 x 106 Research Council of Canada. We thank Dr Y Melekhovets cells) were infected with 1.5 ng (p24 equivalent) of a clini- This for MoTN-TwTl vector constmction. The clinical isolate cal isolate of HIV-1 for 16 h at 37°C. isolate was of HIV-1 was received from Dr SE Read. The following obtained from a pediatric patient infected with HTV-1. reagents were obtained through the AiDS Research and Cetis were then washed twice with RPMI 1640 medium. Reference Reagent Program. Division of AIDS. NIAiD. resuspended in 750 pi of the same medium containing 20 MH: HW-1 strain NL4-3 from Dr RC GaiIo. pNL4-3 units/rnl IL-2 and incubateci at 37°C. The culture super- from Dr A Adachi: MT4 ce11 iine from Dr D Richman: natants were collected every 3 days and replaced with pHEnv from Dr EO Freed and Dr R Risser. Plasmids fresh medium. The amount of HIV-1 p24 antigen released pTev. pAZT1. pB1-SVR68 and pHXBASVCat were in the ce11 culture suDernatant was measured bv enzvrne Hahn. linked immunoaorbént assay -A: ~bbott.-~hi~a~o.received from Dr B Felber. Dr U Dr AW Cochrane IL. USA). and Dr EA Cohen. respectively. -kW-i-infected cek were also tested for the presence of HIV-1 DNA and RNA. Genomic DNA and totai cellu- References lar RNA were extracteci from HN-1-infected MT4 and PBL transductants lacking or expressing Tev-RNase Tl. GUboa E. Smith C. Gene therapy for infectious diseases: the The DNA and RNA were analyzed by PCR and KT-PCR AiDS rnodel. Trends Genet 1994: 10: 139-144. respectively. as described previouslyYa DNA and RNA Lever AM. Cene therapy for HIV infection. Br Med Bull 1995: samples from MT4 transductants challenged with HN-1 51: 149-166. Medina MF. Rarnezani A. Joshi S. Anri-HN-l gene therapy. (100 ng p24 equivaient) were analyzed on day 3 and day TdiSd 1996: 17: 109-120. 6 after infection using a 5' primer within the HIV-1 vpr Harrison CS et aL Activation of a diphtheria toxin A gene by coding region (Vpr-5': 5'-ATA-CTï-GGGCAG-GAG expression of HN-1 Tat and Rw pmteins in transfected cek. TGGAAGC-3') and a 3' primer within the W-1 vpu Hum Cene 77w 1991: 2: 53-60. coding region (Vpu-J'; Y-CTA-TGGACC-ACA-CAA- Uem SE Ramezani A. U X. Joshi S. The dweIoprnent and test- CTA-TTGC-33. This primer pair was designed to amp- hg of retrovirai vecton expressing tramdominant mutants of li@ a 424 bp region within HIV-1 genomlc DNA and HN-1 pmteins to confer anti-HN-1 resistance. Hum Gene ïJm unspliced and singly spliced HIV-1 RNA. Analysis of 1993: 4: 625-634. DNA and RNA samples from PBL transductants was per- 6 Uckun F et ai. in vivo &cacy of B43 (anti-CDl9)-pokeweedanci- formed on day 3 after HIV-1 infection using the Gag-5' virai proteln immunotoxin agafnst BCL-1 murine B ceil leuke- mia 31~1992: 79: 2649-2ôô1. (5'-ATA-TCA-TAT-GTA-ATA-CGA-CTC-ATA-TAGGGC- 7 Wu YN et aL A cymtoxic Nase. Study of the rnechanisrn of GAGAGGAAGCTGCAGAAT-GGGA-3') and the oncorme cytotoxidty. J Bi01 Chem 1993: 268: 10686-10693. Gag-3' (5'-GCC-GCC-GAGATC-TAC-TAG3') primers. 8 Rybak S. Sawena SK. Ackerrnan EJ. Yode RJ. Cytotoxtc potential This primer pair was designed to arnpIify a 460 bp gag of RNase and RNase hybrid pmteins. j Bi01 Chem 1991: 266: coding region within HIV-1 provirus DNA and wispliced 21202-2 1207. 921 9 Marlani C. Goldberg RB. Leemans J. Engin& male stdty 30 Roy S et al A bulge structure in HIV-1 TAR RNA fs required in plants. Spp Soc Exp Bi01 1991; 45: 271-279. for Tat blnding and Tac-mediated trans-activation Cena Dev 10 Wu X et al. Targetfng forelgn pmteIns to HIV partides via fusion 1990; r: 13654373. with Vpr and Vpx. J Vlrol 1995; 69: 33894398. 31 Heaphy S et aL HIV-1 regulator of Rev pmtein binds to an RNA Il Son-entino S. Ubonati M Structure-hinction reladonships in stem-loop smcture Located withLn the Rev-responsive element hurnan RNases: main distinafve features of the major RNase region Ccll1990: 60: 685-693, types. FEBS Lett 1991; 401: 1-5. 32 H;tkoshinÿi T et al Hydrophobie effects on protein/nuciefc add 12 Jones KA. Taking a new TAK an Tat tracas-activation Guicr Dcv interactton: enhancernent of substnte binding by rnueting ym- 1997: 11: 2593-2599. sine 45 to tryptophan Ln RNase Tl. holein hg1991: 1: 793-799. 13 Shulcia RR. KIrnmel PL, Kumac A HIV Rw-responsive eiement 33 Emerman M et al. The spedtidty of the HIV-2 mactivator is RNA binds to host ceil-spedfic pmtelns. J Vhl 1994: 68: dlfferent fmrn that of HIV-1. EMBO / 1987: 6: 3755-3760. 2224-2229. 34 Lewis N. WLlllamr J. Rekash D. Hamrnarskjold ML. Idencifi- 14 Luo Y et ai Functional analys& of interactrons between Tat and catton of a &acting eiement in HIV-2 chat is responsive to the the UaniFactivation response element of HIV-1 in ceils. J %l HIV-1 Rwand human T ceil leukemia virus types Z and LI Rex 1993; 67: 5617-5622 profefns. J hl1990: 61: 1690-1697- 15 Charpentier B. Snia F. RosM M. A dynamlc In vfw view of 35 Eiangovan B. Subramanian T. Chinnadurai G. Functional com- the HN-1 Rev-RRE interaction I Mol Bi01 1997: 950-962. parfson of the basic domains of the Tat protetns of HIV-1 and 16 Melekhovets W. loshi S Fuçion with an RNA bindina domain 2 in Cnmactivation J VlroI 1992: 66.2û31-2036. to confer target &A sped6dty u, an RN- desfgn idengin- 36 Rasenthai AL. Lach SA Nudtast detection £nSDSpofyacry- eering of Tac-RNase H chat spedfically fecognizes and deaves Iamide gel elmphoresis. Anal Blochm 1977: 80: 76-90, HIV-1 RNA h~ vitm. Nudefc Ad& Rcs 1996; 24: 1906-1912, 37 Saxena SK et ai lnhibitlon of HCV-1 production and selective Hostomsky Z et aL Reconstitution in vltrr, of RNase H activity degradation of vLral RNA by an amphibian RN=. J Bi01 Chem by using purifid N-terminai and C-termLnal domains of HIV- 1996; 271: 20783-20788. 1 revese transaiptase. Proc Nad Acad Sd USA 1991; 1: 1148- 38 Kim JS. Soucek J. Matousek J. Raines Ri- Mechanism of RNase 1 152. ~yt~to~fdty.J Bi01 Ch1995: 270: 3 1097-3 1102. Cirino NM et al. Divaient cation modulation of the RNase func- 39 Moen PT. Smith KP. Lawrence JB. Compartmentalizatfon of spe- tions of HIV reverse nanxrlptase. Biochunfstry 1995; 34: 9936 dfic pre-mRNA metaboiism: an ernergfng view- klum Mol Genet 9943. 1995; 4: 1779-1789. Salfeld J et aL A Mpanlte HIV-1 Tac-Env-Rev fision protein. 40 LL M. ChetlandUrai BS. Kejing 2. Nichoison AW. RNase ïü EMBO J 1990; 9: 965-970. deavage of a bacteriophage TI pmcessing signal. Divaient cat- Takahashi K. The StniCNre and function of RNase Tl. J Biochun ion spedfidty and spedtic anion effects. Nudeic Acidr Res 1993: 1971; 70: 945-960. 21: 1919-1925. Benko DM. Sdiwartz S. Povlakis GN. Felber BK. A novel HN- 4 1 Magii MC et aL ModuIadon of gene expression in multiple hem- 1 protein Tev shares sequences with Tat Env and Rev proteins. atopoiedc œil lineages foïlowing retroviral vemr gene mfer. J Vhl 1990; 64: 2505-25 18. Pnic Nad Acad Sd USA 1987; 84: 789-793. 42 Olsen HS et al. Mutational analysis of the HIV-1 Rev pmtein and Solomin L. Felber BK. Pavlakis GN. DüFerent sites of interaction AIDS for Rw. Tw and Rex proteins within the RRE of HïV-1. J Virol its target sequence. the Rev responsive element. J 1991: 4: 558-567- 1990: 64: 6010-6017. 43 A. L A. HS b HW uan- Joshi S. Van Bcunschot Robson Bernstein Efficient repli- Mancebo et al. P-TEFb kinase required for Tat cation. integration. and packagfng of retroviral vectors modifieci scriptional activation in vivo and in vfm. Gens Dev 1997: II: LTR containhg the packaging signal. Nucleic Adds Ra 1990: 18: 2633-2644. HN 4223-4226. Hendersan BR. Perdpalle P. Interactions between Rev and 44 Pauweis R et al Sensitive and rapid assay on Mi-4 cek for nudear impon and export factors: the Rev nuclear localization detectlon of antivirai compounds against the AIDS virus. j Vlrol signal mediates spedfic binding to hurnan impordn-p. J Mol Bi01 Merhods 1987: 16: 171-185. 1997: 274: 693-707. 45 Larder BA Darby G. Richman DD. HIV with reduced sensitivity Sdiwartz S. Felber BK. Pavlakis GN. Distinct RNA sequences to Udovudine (A2Tl isolates during prolonged therapy. Sdence in the gag reglon of HN-1 decrease RNA stability and inhibit 1989; 243: 173 1-1734, expression in the absence of Rev prorein. J VhI1992; 66: 1% 46 Cohii H et al. Inhibition of W-1 muItipiication in a human 159. CD4' lymphocytlc œü Une expressing antisense and sense RNA Ruhl M et ai. Eukaryotic initiation factor SA is a cellular farget molecules containhg HN-1 padcaging signal and RRE of the HN-1 Rev activation domain medfating narrr-activation. element(s). Anrisense Res Dev 1994: 4: 19-26. j Ce11 Bi01 1993: 123: 1309-1320. 47 Chomezynski P. Sacchi N. Single-step method of RNA isolation Quaas R et al. Expression of the chemlcaily synthesized RNase by add guanidinium Lhiocyanate-phenolttilomfom extraction. Tl in E wli ushg a secretion doning vector. Eur J BiodKm 1988: Anal Bioclwn 1987: 162: 156-159. 173: 617-622. 48 Ramezani A. Joshi S. Comparative analysis of hehighly con- Backrnann j et al. Extendeci kinetic anaiysis of RNase TI varfants serveci sites within the HIV-1 RNA for their susceptibility to leads to an improved scheme for the reacüon medianisni. hammerhead ribozyme-mediated deavage in vfuo and in vivo. Blochem Biophjs Res Commun 1994: 199: 213-219. Ancisense Nud Add Dng Dev 1996: 6: 229-235. Steyaeri j. Wyns L. Functional interactions among the Hidû. 49 Adam A et al. Production of AIDS-aswdated retrovirus in Glu58 and His92 catalysts of RNase Tl as studied by double human and non-human cek transfected with an infectious mol- and triple mutants. J Mol Bi01 1993: 229. 770-781. ecular done. J Vtml 1986; 59: 204-291.