Investigation of an Amyotrophic Lateral Sclerosis-Associated Profilin 1 Mutant

Investigation of an amyotrophic lateral sclerosis-associated profilin 1 mutant

Merryn Brettle

A thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy (Medicine) at the University of New South Wales, 2019.

Neurodegeneration and Repair Unit

Department of Anatomy

School of Medical Sciences

University of New South Wales Thesis/Dissertation Sheet

Surname/Family Name : Brettle Given Name/s : Merryn Elise Abbreviation for degree as give in the University calendar : PhD Faculty : School of Medical Sciences School : Anatomy Thesis Title : Investigation of an amyotrophic lateral sclerosis-associated profilin 1 mutant

Abstract 350 words maximum: (PLEASE TYPE)

Amyotrophic lateral sclerosis (ALS) is a devastating disease that has no cure. Mutations in profilin 1 were identified as a cause of familial ALS in 2012. We investigated the impact of expressing mutant profilin 1 in cultured primary neurons and in spinal cords during mouse development. Our data from studies using transfected primary hippocampal mouse neurons show that profilin 1 C71G expression results in increased dendritic spine density. These results show that expression of profilin 1 C71G alters cell morphology. We developed a novel mouse model with expression of PFN1 C71G targeted to α-motor neurons in the spinal cord during development. Adult mice had no transgene expression. When the embryos of these mice were analysed, they showed evidence of reduced neuronal outgrowth and abnormal brain development. Adult mice had no transgene expression. These mice presented with motor deficits and a reduction in the number of motor neurons in the spinal cord. Further analysis of these motor neurons in these mice revealed reduced levels of TDP and ChAT. Although profilin 1 C71G was only expressed during development, adult mice presented with some ALS-associated pathology and motor symptoms. This study highlights the effect of profilin 1 during neurodevelopment and the impact that this may have in amyotrophic lateral sclerosis.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

…………………………………………………………… ……………………………………..……………… ……….……………………...…….… Signature Witness Signature Date The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

i ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………......

ii INCLUSION OF PUBLICATIONS STATEMENT

UNSW is supportive of candidates publishing their research results during their candidature as detailed in the UNSW Thesis Examination Procedure.

Publications can be used in their thesis in lieu of a Chapter if: • The student contributed greater than 50% of the content in the publication and is the “primary author”, ie. the student was responsible primarily for the planning, execution and preparation of the work for publication • The student has approval to include the publication in their thesis in lieu of a Chapter from their supervisor and Postgraduate Coordinator. • The publication is not subject to any obligations or contractual agreements with a third party that would constrain its inclusion in the thesis

Please indicate whether this thesis contains published material or not. This thesis contains no publications, either published or submitted for publication ☐ (if this box is checked, you may delete all the material on page 2)

Some of the work described in this thesis has been published and it has been ☒ documented in the relevant Chapters with acknowledgement (if this box is checked, you may delete all the material on page 2)

This thesis has publications (either published or submitted for publication) ☐ incorporated into it in lieu of a chapter and the details are presented below

CANDIDATE’S DECLARATION I declare that: • I have complied with the Thesis Examination Procedure • where I have used a publication in lieu of a Chapter, the listed publication(s) below meet(s) the requirements to be included in the thesis. Name Signature Date (dd/mm/yy) Merryn Brettle

Postgraduate Coordinator’s Declaration (to be filled in where publications are used in lieu of Chapters) I declare that: • the information below is accurate • where listed publication(s) have been used in lieu of Chapter(s), their use complies with the Thesis Examination Procedure • the minimum requirements for the format of the thesis have been met. PGC’s Name PGC’s Signature Date (dd/mm/yy)

i iii COPYRIGHT STATEMENT

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………......

iv Abstract

C71G was only expressed during development, adult mice presented with some ALS- associated pathology and motor symptoms. This study highlights the effect of profilin 1 during neurodevelopment and the impact that this may have in amyotrophic lateral sclerosis.

v Acknowledgements

Undoubtedly when writing these acknowledgements, I will forget someone, and for that

I am sorry in advance. Although this Thesis is something that I can be proud of, I would not have gotten here without the support from my peers and supervisors.

Holly Stefen completed the later stages of the behavioural work on the Hb9 V5-PFN1 mice. She also does all the little ins and outs of everything in the NRU laboratory, an essential cog in the relentless lab machine. She is also a damn fine person, one of the best kind of people. She is selfless and kind. A person that I am proud to have worked with and one that I will call my friend long after I finish this Thesis and PhD. The support that she has given me throughout the last few years has been invaluable and is difficult to measure. Furthermore, it is hard to put the appreciation I have into words.

You rock Stefen.

Aleksandra Djordjevic will make an amazing Dr, actual medical doctor mind you.

Sandra was there for the beginning of the project, but her influence remains. Her blunt and to the point advice that holds no prisoners has always been refreshing and greatly appreciated. She has also helped to edit parts of the Thesis. Sandra is hard-working and strong willed. The sheer determination of this woman is inspiring. Another kind person that I am proud to call my friend.

Over the years, many students have come and gone from the NRU. I have had the challenge and pleasure of teaching them. At times this has been challenging, and I apologise for the times I stuffed it up. I really did do my best and learnt a lot along the way. Thank you especially to Dominic Jean Richard Dit-Bressel and Josephine Chan, two honours students that contributed different bits and pieces throughout the project.

Some of these contributions have been directly used and referenced in the Thesis, while others have contributed to data that didn’t make it into the final Chapter structure, but that were appreciated just the same. Dominic took the images for figure 3.2.3.2. Dr

Alexandra Suchowerska completed the confocal imaging for figure 3.2.1.2. Dr Sandra

Fok assisted with lightsheet imaging for figure 4.2.1.3. If you need to know anything about microscopes, this woman knows it. Her depth of knowledge is incredible.

I need to thank various members of my co-supervisor’s lab. Thank you Josefine Bertz for various advice and reagents. She knows where everything is in that chaotic lab. Her smile is infectious, and she is a beautiful person. Troy Butler, Amadeus G, Claire

Stevens (Swanson) helped with various mouse monitoring or by teaching me techniques. Dr Fabien Delerue completed the blastocyst injections for the generation of

Thy1.2 V5-PFN1C71G and Hb9 V5-PFN1C71G transgenic mice. Magdalena P, Julia van der Hoven and Dr Annika van Hummel harvested mice 12m and older (mice for figures in Chapter 5). Alex Volkerling for reading through my thesis and picking up a bunch of inconsistencies, chur chur bru. Alex V and Kristie Stefanoska for some epic student dinner parties. Wei Siang Lee and Alex V for being legends and s troopers on the conference trip to the US.

Andre Bongers and Marco Gruwel. Marco Gruwel completed the preparation and imaging of the brains. We wish to thank Marco and Andre, as well as the National

Imaging Facility.

I want to thank Professor Lars Ittner, my co-supervisor, for the immense knowledge that he holds. I have learned many lessons in your lab and am grateful for that.

vii

Professor Thomas Fath, my supervisor, for the support and guidance. After being in your lab for over 6 years, it is strange to have it coming to an end. I wish you the best for your research and appreciate what you have taught me.

To the anatomy staff, thank you for the pep talks and chats. Especially, Irina and

Michelle, who are shining examples of strong, intelligent women. Thank you to

Nicodemus Tedla and John Wilson, who gave me sound career advice and taught me a lot about tertiary education.

Now that the work crew have been acknowledged, I want to thank my friends and family. Kate Montgomery for the coffee breaks and breakfast dates. All the friends that were there for me when times were tough, and life was chaotic.

Thank you to my Mum who has always got my back, no matter how stubborn I am. You also hold the Brettle clan together, no matter how different we are. Your strength and fierce intensity have rubbed off… Like you have always said, I come from a long line of strong women.

Thank you to my partner Luke. I have never met such a supportive and kind man before.

I appreciate all those times that I leaned on you for support and encouragement. You constantly boosted my spirits and reminded me of my worth. You and the boys gave me a new perspective on what really matters in life. I am in a happy space in my life, and part of that is due to your optimism (vs my pessimism) and knowing that I have someone that I can depend on.

I also want to have a special mention for my father, John Brettle. It has been over 10 years since you passed. I hope that you would be proud of who I have become and how hard I have worked to get to this point in my life. You’ll never walk alone.

viii

Publications during the completion of this Thesis

Brettle M, Suchowerska AK, Chua SW, Ittner LM, Fath T (2015). Amyotrophic lateral sclerosis-associated mutant profilin 1 increases dendritic arborisation and spine formation in primary hippocampal neurons. Neuroscience Letters, 609, 223-228.

An H, Brettle M, Lee T, Heng B, Lim CK, Guillemin GJ, Lord MS, Klotzsch E, Geczy CL, Bryant K, Fath T, Tedla N (2016). Soluble LILRA3 promotes neurite outgrowth and synapses formation through high affinity interaction with Nogo 66. Journal of Cell Science, 29, 1198-1209.

Brettle M, Patel S, Fath T (2016). Tropomyosins in the healthy and diseased nervous system. Brain research Bulletin, 126, 311-323.

Patel S, Fok SYY, Stefen H, Tomanić T, Parić E, Herold R, Brettle M, Djordjevic A, Fath T (2017). Functional characterisation of filamentous actin probe expression in neuronal cells. PLoS One, 12(11): e0187979.

Stefen H, Suchowerska A, Chen BJ, Brettle M, Kuschelewski J, Gunning P, Janitz M, Fath T (2018). Tropomyosin isoforms regulate distinct cellular pathways in undifferentiated and differentiated B35 neuroblastoma cells. FEBS, 8, 570-583.

Stefen H#, Hassanzadeh-Barforoushi A#, Brettle M#, Fok SYY, Tedla N, Barber T, Warkiani ME, Fath T (2018). A novel microfluidic device-based neurite outgrowth inhibition assay reveals the neurite outgrowth-promoting activity of tropomyosin Tpm3.1. (# indicates co-first author). Cell Mol Neurobiol. Doi:10.1007/s10571-018- 0620-7.

Brettle M, Stefen H, Djordjevic A, Fok SYY, Chan JW, van Hummel A, van der Hoven J, Przybyla M, Volkerling A, Ke YD, Delerue F, Ittner LM, Fath T (2019). Developmental Expression of Mutant PFN1 in Motor Neurons Impacts Neuronal Growth and Motor Performance of Young and Adult Mice. Front Mol Neurosci, 12:123, Doi:10.3389/fnmol.2019.00231.

Selected abstracts

Oral presentations

Brettle M, Stefen H, Chan J, Djordjevic A, Fok S, Delerue F, Ke YD, Ittner LM, Fath

T. “Novel mouse model of an amyotrophic lateral sclerosis-associated profilin 1 mutation”; Oral Presentation at ANS, Sydney, Australia, December 2017.

Brettle M, Suchowerska AK, Chua SW, Ittner LM, Fath T. “Functional Analysis of

ALS-Associated Mutations of Profilin 1 In Primary Mouse Neurons”; Oral Presentation at Kioloa Neuroscience Colloquium, ANU coastal campus Kioloa, Australia, April

2016.

Fath T, Brettle M, Suchowerska AK, Chua SW, Ittner LM. “Amyotrophic Lateral

Sclerosis-associated profilin I mutations impact dendritic morphology of central nervous system neurons”; Nanosymposium at Society for Neuroscience, Chicago, USA,

October 2015.

Brettle M, Suchowerska AK, Chua SW, Ittner LM, Fath T. “Functional Analysis of

ALS-Associated Mutations of Profilin 1 In Primary Mouse Neurons”; Oral presentation at the Asia-Pacific FTD and MND Meeting, University of Sydney, Australia, October

2015.

Poster presentations

Brettle M, Stefen H, Chan J, Djordjevic A, Fok S, Delerue F, Ke YD, Ittner LM, Fath

T. “Novel mouse model of an amyotrophic lateral sclerosis-associated profilin 1 mutation”; Poster at SfN, Washington DC, United States, November 2017.

Brettle M, Stefen H, Djordjevic A, Chan J, Fok SYY, Delerue F, Ke YD, Ittner LM,

Fath T. “Mouse Model of an ALS-associated PFN1 Mutation”; Poster at Inter-

university Neuroscience and Mental Health Conference, WSU Campbelltown campus,

Sydney, Australia, September 2017.

Brettle M, Stefen H, Djordjevic A, Chan J, Fok SYY, Delerue F, Ke YD, Ittner LM,

Fath T. “Novel Mouse Model of an ALS-associated PFN1 Mutation”; Poster at ANS,

Hobart, Australia, December 2016.

Brettle M, Stefen H, Chan J, Djordjevic A, Fok S, Delerue F, Ke YD, Ittner LM, Fath

T. “Novel Mouse Model of an ALS-associated PFN1 Mutation”; Poster at BCDBM-

CADD meeting, Brisbane, Australia, September 2016.

Brettle M, Suchowerska AK, Chua SW, Ittner LM, Fath T. “Functional Analysis of

ALS-associated Profilin 1 Mutations in Primary Mouse Neurons”; Poster at

ISN/APSN/ANS, Cairns, Australia, August 2015.

Prizes awarded

Australian Postgraduate Award at UNSW, Feb 2015 – August 2018.

SoMS Travel Award for $1800 to attend Neuroscience 2017, Washington DC, United

States, November 2017.

ANS Student Travel Grant for $300 to attend the 36th Meeting of the Australasian

Neuroscience Society, Hobart, Australia, December 2016.

Paper of the month (SoMS, UNSW) for “Soluble LILRA3 promotes neurite outgrowth and synapses formation through high affinity interaction with Nogo 66”. Febuary 2016.

ANS Student Travel Grant for $300 to attend 25th Biennial Meeting of the International

Society for Neurochemistry Jointly with the 13th Meeting of the Asian Pacific Society for Neurochemistry in Conjunction with the 35th Meeting of the Australasian

Neuroscience Society, Cairns, Australia, August 2015.

Paper of the month (SoMS, UNSW) for “Amyotrophic lateral sclerosis-associated mutant profilin 1 increases dendritic arborisation and spine formation in primary hippocampal neurons”. October 2015

xii

Abbreviations used in this Thesis

ABP – actin binding proteins ALS – amyotrophic lateral sclerosis ALS2 – Alsin/Rho guanine nucleotide exchange factors ANG – Angiogenin Arp2/3 – actin-related protein 2/3 ATXN2 - Ataxin 2 BDNF – Brain derived neurotrophic factor BMAA – β-Methylamino-L-alanine BRP – Brunchpilot BSA – Bovine serum albumin C21ORF2 – chromosome 21 open reading frame 2 C9ORF72 – chromosome 9 open reading frame 72 CCNF – Cyclin F Cdc42 – Cell division control protein 42 homolog ChAT – Choline Acetyltransferase CHCHD10 – Coiled-coil-helix-coiled-coil-helix domain containing 10 CHMP2B – Chromatin modifying protein 2B DAB – 3,3’-Diaminobenzidine DCTN1 – Dynactin DIV – Days in vitro DMEM – Dulbecco’s modified eagle medium E9.5 – embryonic day 9.5 ELP3 – Elongator acetyltransferase complex subunit 3 EMG – Electromyograph EtOH – Ethanol F-actin – Filamentous actin fALS – Familial ALS FIG4 – SAC1 lipid phosphatase domain FTD – Frontotemporal dementia

xiii

FUS – Fused in sarcoma G-actin – Globular actin GFAP – Glial fibrillary acidic protein H&E – Hematoxylin and Eosin HBS – Hepes buffered saline HBSS – Hank's buffered salt solution HEK293T – Human embryonic kidney cells HNRNP2B1 – Heterogenous nuclear ribonucleoprotein 2B1 HNRNPA1 – Heterogenous nuclear ribonucleoprotein A1 Hsp70 – 70kDa heat shock protein Iba1 – Microglia/macrophage-specific calcium-binding protein IHC – Immunohistochemistry KIF5A – Kinesin family member 5A KD – Knock down KO – Knock out LB – Lysogeny broth LW – Low weight MATR3 – Matrin 3 MRI – Magnetic resonance imaging NCR – Nuclear to cytoplasmic ratio NEFH – Neurofilament heavy NEK1 – Serine/threonine-protein kinase Nek1 NMJ – Neuromuscular junction NW – Normal Weight O/N – overnight OD – Optical density OPTN – optineurin P0 – postnatal day 0 PBS – phosphate buffered saline PDL – Poly D lysine PFA – paraformaldehyde PFN1 – profilin 1 xiv

PFN2 – Profilin 2 Prp – Prion promoter PVDF – Polyvinylidene fluoride rAAV – Recombinant adeno-associated virus RGMa – Repulsive guidance molecule family member RNP – Ribonucleoprotein particle RT – Room temperature sALS – Sporadic ALS SEM – Standard error of the mean SETX – Senataxin SOC – Super optimal broth with catabolite repression SOD1 – Cu/Zn binding superoxide dismutase SPG11 – Spatacsin SQSTM1 – Sequestosome 1 TBK1 – TANK-binding kinase 1 TBS – Tris buffered saline TBST – Tris buffered saline with 1% Tween 20 TBSTx – Tris buffered saline with 0.1% Triton X-100 TDP – TAR DNA-binding protein TDP-43 – TAR DNA-binding protein 43 Tg – Transgenic TUBA4A – Tubulin alpha 4A UBQLN2 – Ubiquilin 2 VAPB – Vesicle-associated membrane protein VASP – Vasodilator-stimulated phosphoprotein VCP – Valosin-containing protein WASP – Wiskott-Aldrich syndrome protein WAVE – WASP family verprolin-homologous protein Wt – Wild-type

Table of contents

Thesis/Dissertation sheet ...... i

Originality statement ...... ii

Inclusions of publications statement ...... iii

Abstract ...... v

Acknowledgements ...... vi

Publications during the completion of this Thesis ...... ix

Selected abstracts ...... x

Prizes awarded ...... xii

Abbreviations used in this Thesis ...... xiii

Table of contents...... xvi

List of figures ...... xxii

List of tables ...... xxvi

1 Introduction ...... 2

Amyotrophic lateral sclerosis ...... 2

Epidemiology and risk factors of disease ...... 2

Clinical presentation and progression ...... 5

Diagnosis ...... 7

Treatments ...... 9

Prognosis ...... 10

xvi

ALS genes and disease models...... 12

Identification of ALS genes ...... 12

In vivo models of ALS ...... 17

Profilin 1 and ALS ...... 21

Identification of ALS-associated PFN1 mutations ...... 21

PFN1 function ...... 23

PFN1 interactions ...... 26

Cytoskeleton and ALS ...... 27

Function of ALS-associated PFN1 mutants ...... 28

Molecular mechanisms of ALS ...... 30

Aims of this project...... 32

2 Methods ...... 34

Equipment and reagents ...... 34

Animal handling and care ...... 47

Molecular biology ...... 47

Generation of plasmids ...... 47

Generation of V5-PFN1C71G transgenic mice ...... 49

Genotyping ...... 50

Production of competent Escherichia coli ...... 50

Transformation of Escherichia coli ...... 51

Plasmid amplification ...... 51

xvii

Cell culture ...... 52

Human embryonic kidney cells ...... 52

Mouse primary hippocampal and cortical neurons...... 52

Mouse primary motor neurons ...... 53

Lipofectamine transfections ...... 54

Recombinant adeno-associated virus ...... 55

Generation of recombinant adeno-associated virus ...... 55

Purification of recombinant adeno-associated virus ...... 56

Testing purity of rAAV and calculating genomic viral titre ...... 57

Stereotactic rAAV injections in P0 mice ...... 58

Western blotting ...... 59

Lysate harvest and tissue collection ...... 59

Sonication and protein measurement ...... 60

Western blotting ...... 60

Immunocytochemistry ...... 61

Immunohistochemistry ...... 61

Harvest of mice...... 61

Tissue processing and sectioning ...... 62

Immunohistochemistry ...... 62

Imaging ...... 64

Microscopy ...... 64

xviii

Image analysis ...... 64

Wholemount staining and lightsheet imaging ...... 65

Magnetic resonance imaging ...... 65

Mouse testing ...... 66

RotaRod ...... 66

Forelimb grip strength ...... 66

Wire test ...... 67

Pole test ...... 67

Beam test ...... 67

Survival ...... 68

Statistical analysis ...... 68

3 Pilot studies on PFN1C71G ...... 71

Introduction ...... 71

Results ...... 73

ALS-associated PFN1 increases spine formation and results in PFN1

aggregation in primary hippocampal neurons ...... 73

Characterization of motor neuron cultures ...... 77

Characterisation of recombinant adeno-associated viruses for use in vitro

and in vivo ...... 79

No evidence of cytoplasmic inclusions was found in primary motor

neurons expressing V5-PFN1C71G...... 83

Expression of V5-PFN1 in rAAV mouse model ...... 83

xix

rAAV mouse model of PFN1/ALS did not generate a motor phenotype . 86

Thy1.2 V5-PFN1C71G transgenic mice do not express the transgene ...... 88

Discussion ...... 93

4 Developmental characterisation of Hb9 V5-PFN1C71G mice ...... 98

Introduction ...... 98

Results ...... 101

Timeline of V5-PFN1C71G expression driven by the Hb9 promoter ...... 101

V5-PFN1C71G is expressed in motor neurons at embryonic ages ...... 115

No evidence of TDP-43 pathology in Hb9 V5-PFN1C71G mice ...... 117

Impact of mutant PFN1 expression on neurite outgrowth in vivo ...... 119

Mutant PFN1 expression impacts brain development ...... 121

Expression of mutant PFN1 impacts Mendelian inheritance ...... 125

Discussion ...... 127

5 Behavioural and histological characterisation of Hb9 V5-PFN1C71G mice ...... 135

Introduction ...... 135

Results ...... 138

Hb9 V5-PFN1 expression in adult mice across all ages ...... 138

Weight Timeline of Hb9 V5-PFN1 C71G mice ...... 139

RotaRod performance of Hb9 V5-PFN1C71G mice ...... 144

Fore limb grip strength timeline Hb9 V5-PFN1C71G mice ...... 148

Wire test performance of Hb9 V5-PFN1 C71G mice ...... 150

Pole test performance of Hb9 V5-PFN1 C71G mice ...... 152

Beam test performance of Hb9 V5-PFN1 C71G mice...... 156

Survival of Hb9 V5-PFN1C71G mice ...... 160

Hb9 V5-PFN1C71G summary of motor performance ...... 162

Motor neuron counts of Hb9 V5-PFN1C71G mice ...... 164

Evidence of pathology in Hb9 V5-PFN1C71G mice ...... 167

Discussion ...... 175

6 Discussion ...... 185

The neuronal subtype specific effect of PFN1C71G ...... 185

Expression of V5-PFN1C71G causes a developmental phenotype ...... 186

Phenotypes in Hb9 V5-PFN1C71G mice are only partially reversed when

transgene expression is switched off ...... 189

The cytoskeleton and ALS pathogenesis ...... 193

Concluding remarks ...... 196

7 References ...... 198

xxi

List of figures

Figure 1.3.1.1. Identified mutations summary of ALS-associated PFN1 mutants…………………………………………………………………………………22

Figure 1.3.2.1. Profilin mediates the polymerisation of F-actin………………..25

Figure 3.2.1.1. Spontaneous aggregates of mutant V5-PFN1C71G showed no immunoreactivity with TDP……………………………………………………………74

Figure 3.2.1.2. Mutant PFN1 increases dendritic spine density in hippocampal neurons…………………………………………………………………………………76

Figure 3.2.2.1. Cultures have an enrichment of neurons with a typical motor neuron morphology……………………………………………………………………78

Figure 3.2.3.1. PFN1 overexpression and V5 expression in vitro in primary cortical neurons………………………………………………………………………..80

Figure 3.2.3.2. V5 expression in vitro in primary cortical neurons……………81

Figure 3.2.3.3. V5 expression in vitro in primary motor neurons……………..82

Figure 3.2.4.1. Cytoplasmic inclusions of TDP were not found in primary motor neurons expressing V5-PFN1C71G…………………………………………………..84

Figure 3.2.5.1. V5 expression in the brains of rAAV injected mice…………..85

Figure 3.2.6.1. Behavioural testing on rAAV mouse model shows no significant motor deficit…………………………………………………………………………..87

Figure 3.2.7.1. Thy1.2 plasmid maps and genotyping………………………...89

xxii

Figure 3.2.7.2. Thy1.2 V5-PFN1C71G transgenic mice do not express V5 or overexpress PFN1……………………………………………………………………..90

Figure 3.2.7.3. Thy1.2 V5-PFN1C71G transgenic mice do not express

V5……………...... 91

Figure 4.2.1.1. Transgenic Hb9 V5-PFN1C71G embryos express EGFP…...102

Figure 4.2.1.2. Profile of V5-PFN1C71G expression throughout development………………………………………………………………………….104

Figure 4.2.1.3. Lightsheet imaging of V5-PFN1C71G embryos reveals the spatial distribution of V5-PFN1C71G in E10.5 Tg embryos………………………..106

Figure 4.2.1.4. Transgenic E10.5-11.5 Hb9 V5-PFN1C71G embryos have PFN1 overexpression in V5 positive regions………………………………………………107

Figure 4.2.1.5. Transgenic E12.5-14.5 Hb9 V5-PFN1C71G embryos have PFN1 overexpression in V5 positive regions………………………………………………109

Figure 4.2.1.6. Transgenic V5-PFN1C71G mouse embryos have significantly overexpress PFN1…………………………………………………………………...112

Figure 4.2.2.1. V5-PFN1C71G is expressed in motor neurons at embryonic ages………………………………………………………………………………….116

Figure 4.2.3.1. Mutant PFN1 expression does not induce a TDP pathology in the neural tubes of Hb9 V5-PFN1C71G mice…………………………………………..118

Figure 4.2.4.1. Mutant PFN1 expression impacts neurite outgrowth in vivo...120

xxiii

Figure 4.2.5.1. A portion of transgenic Hb9 V5- PFN1C71G embryos have abnormal brain development………………………………………………………..122

Figure 4.2.5.2. MRI analysis of the brains of adolescent Hb9 V5- PFN1C71G mice…………………………………………………………………………………124

Figure 4.2.6.1. Loss of Mendelian inheritance in 2 week old Hb9 V5-PFN1C71G mice…………………………………………………………………………………126

Figure 5.2.1.1. Transgenic Hb9 V5-PFN1C71G adult mice do not express V5-

PFN1C71G………………………………………………………………………….139

Figure 5.2.2.1. Transgenic V5-PFN1C71G mice weigh less than Wt littermates……………………………………………………………………………140

Figure 5.2.2.2. Transgenic V5-PFN1C71G mice yield two separate weight groups in older mice…………………………………………………………………142

Figure 5.2.3.1. Transgenic V5-PFN1C71G mice have early deficits on

RotaRod………………………………………………………………………….…..145

Figure 5.2.3.2. Aged transgenic Hb9 V5-PFN1C71G mice have some deficits on

RotaRod………………………………………………………………………….…..147

Figure 5.2.4.1. Transgenic V5-PFN1C71G mice have limited deficits in forelimb grip strength………………………………………………………………………….149

Figure 5.2.5.1. Transgenic V5-PFN1C71G mice have some deficits on wire test……………………………………………………………………………………151

xxiv

Figure 5.2.6.1. Male Tg V5-PFN1C71G mice take longer to descend on pole test…………………………………………………………………………………..153

Figure 5.2.6.2. Male TgV5-PFN1C71G mice have a higher percentage of failing the pole test task……………………………………………………………………..155

Figure 5.2.7.1. Transgenic V5-PFN1C71G mice take longer to cross on horizontal beam test…………………………………………………………………157

Figure 5.2.7.2. Female TgV5-PFN1C71G mice have significantly more events when challenged with Beam test……………………………………………………159

Figure 5.2.7.3. Male 6m old TgV5-PFN1C71G mice are more likely to fail the beam test……………………………………………………………………………..160

Figure 5.2.8.1. Survival Curves of Hb9 V5-PFN1C71G mice………………161

Figure 5.2.10.1. Transgenic animals have less motor neurons than wild type littermates……………………………………………………………………………165

Figure 5.2.10.2. No difference in motor neuron counts between low weight and normal weight transgenic animals…………………………………………………...166

Figure 5.2.11.1. TDP and ChAT images from 18m old Hb9 V5-PFN1C71G mice…………………………………………………………………………………168

Figure 5.2.11.2. Motor neurons from Tg animals have lower ChAT intensity…………………………………………………………………………….169

Figure 5.2.11.3. Motor neurons from aged Tg animals have lower TDP intensity…………………………………………………………………………….170 xxv

Figure 5.2.11.4. Transgenic motor neurons with low ChAT intensity also tend to have lower TDP intensity………………………………………………………….171

Figure 5.2.11.5. Spinal cords from aged transgenic animals have microgliosis………………………………………………………………………..173

Figure 6.1.1.1. Summary of Developmental Phenotype…………………...188

Figure 6.1.1.2. Summary of Phenotype of Adult Mice…………………….190

List of tables

Table 1.1 Summary of ALS genes (1)…………………………………………..14

Table 1.2 Summary of ALS genes (2)……………………………………….15-16

Table 2.1. Equipment……………………………………………….……………34

Table 2.2. Consumables…………………………………………………………35

Table 2.3. Reagents…………………………………………………………..36-38

Table 2.4. Buffers and solutions……………………………………………...39-41

Table 2.5. Antibodies…………………………………………………………….42

Table 2.6. Molecular biology……………………………………………………43

Table 2.7. Plasmids……………………………………………………………...43

Table 2.8. Primers……………………………………………………………….44

Table 2.9. PCR settings…………………………………………………………45 xxvi

Table 2.10. Software……………………………………………………………46

Table 3.1 Profilin 1 aggregation………………………………………………74

Table 3.2 Motor neuron culture……………………………………………….78

Table 3.3 Significance summary for rAAV PFN1/ALS mice………………...88

Table 4.1 Statistics summary of V5 and PFN1 expression in Hb9 V5-PFN1C71G mice………………………………………………………………………………..114

Table 5.1 Weight of 6-16m mice stats table…………………………………143

Table 5.2 RotaRod significance of 6-16m old mice…………………………148

Table 5.3 Hb9 V5-PFN1C71G summary of motor performance……….162-163

Table 5.4 Significance summary of motor neuron counts…………………...165

Table 5.5 Summary of statistics for ChAT and TDP intensities…………….170

xxvii

Chapter 1:

Introduction

1 Introduction

Amyotrophic lateral sclerosis

Amyotrophic lateral sclerosis (ALS) is a complex and devastating neurodegenerative disease. It is characterised by the loss of corticospinal neurons and the alpha motor neurons that they project to, resulting in denervation of neuromuscular junctions and eventual muscle atrophy (Gordon 2013). There is no cure for ALS and the disease has an average course of 3 years post-diagnosis (Rowland and Shneider 2001).

Histopathological hallmarks such as TAR DNA-binding protein 43 (TDP-43) positive inclusions and gliosis occur in both sporadic (sALS) and familial (fALS) forms of the disease (Neumann et al. 2006, Swarup et al. 2011). Although only 5-10% of ALS cases are familial (Renton et al. 2014), studying the underlying pathomechanisms of fALS is a vital tool in understanding how these mutations independently cause similar pathologies. Understanding pre-symptomatic changes could reveal novel drug targets.

Additionally, the generation of novel mouse models is imperative, as they provide a model to study pathological changes over time.

Epidemiology and risk factors of disease

The overall prevalence of ALS is a contentious issue, and it is difficult to define a global number of cases per 100,000 people due to the heterogeneity of the disease (for a review see (Chio et al. 2013)). An incidence of 1-2 cases per 100,000 people is a commonly used figure (Logroscino et al. 2010, Arthur et al. 2016). ALS has a higher prevalence in men than women and can be sporadic or familial (Renton et al. 2014). The average age of onset of sALS is 58-63y old and 47-52y old for fALS (Kiernan et al.

2011). ALS effects Caucasians more than other ethnic groups, and the incidence of ALS

appears to be on the rise (Luna et al. 2017). However, this is likely due to the aging population (Arthur et al. 2016).

Whilst we know what causes the majority of fALS cases, more needs to be done to define the risk factors of sALS. Review articles attempt to bridge the gap in knowledge, with much needed critical analysis of the literature, but these reviews have limitations

(for a comprehensive review see (Luna et al. 2017)). There are different potential risk factors for ALS including environmental, occupational and lifestyle factors (Castanedo-

Vazquez et al. 2018, Riancho et al. 2018). However, given the complex nature of ALS, it is not surprising that attempts to classify risk factors often generates conflicting results.

For instance, when investigating if exposure to metals increases the risk of developing

ALS, some papers show a positive correlation (Malek et al. 2014), while others show no significant adverse impact (Yu et al. 2014). The same two studies show that exposure to fertilisers has a positive correlation with the development of ALS. The impact of some observations is harder to decipher. For instance, higher levels of education are associated with lower incidence of ALS (Qureshi et al. 2006, Malek et al. 2014, Yu et al. 2014). However, it is unclear whether this is causative, or indicative of the typical occupational risks of those with lower education levels.

Environmental factors that have been implicated include β-methylaminoalanine

(BMAA), heavy metals, fertilisers, pesticides, electromagnetic fields, and infective agents (Luna et al. 2017, Castanedo-Vazquez et al. 2018, Riancho et al. 2018). BMAA was implicated as an environmental factor of ALS through studying clusters of increased incidences. Some communities had extremely high rates of over 100 cases per 100,000 people (Gajdusek 1963, Riancho et al. 2018), 50x higher than the average

incidence. The classification of BMAA as a risk factor has led to it being studied extensively in attempts to elucidate the role it plays in ALS and other neurodegenerative diseases (for a review see (Nunn 2017)).

Lifestyle factors that have been implicated in ALS include physical activity, alcohol consumption, smoking, occupation, education level, socioeconomic status, and diet

(Luna et al. 2017, Riancho et al. 2018). Some of these factors can be intertwined with one another or with environmental factors. For instance, there is a link between social drinking and smoking, hence confounding results on either category (Luna et al. 2017).

Other factors can give “dose-dependent” results. Physical activity gives an interesting insight to the complexity of ALS risk factors. In the United States, ALS is known as

Lou Gehrig disease, due to the notoriety of the professional baseball player Lou Gehrig and his publicised battle with ALS. Various studies have tried to address the question of whether professional athletes have an increased risk of ALS and if increased physical activity levels correlate with ALS incidence (Chio et al. 2009). A study by Gallo in

2016 showed that increased physical activity correlated with a decreased incidence of

ALS in a dose-dependent manner (Gallo et al. 2016). A systematic review tried to compare professional athletes and people that complete regular physical exercise

(Lacorte et al. 2016), however, due to the heterogeneity in data collection across various studies, the ability to draw conclusions was limited.

The consensus appears to be that physical activity reduces the incidence of ALS, but the incidence is increased after a certain threshold of physical activity is exceeded. These results can be confounded as head trauma is a risk factor for neurodegenerative diseases, including ALS (Chen et al. 2007, Gavett et al. 2010, Peters et al. 2013, DeKosky and

Asken 2017). As athletes are more likely to sustain repeated head trauma. Is the excessive physical activity itself having a detrimental impact on the incidence of ALS 4

or is there an increase associated with the increased risk of head trauma itself? A few studies tried to bridge the gap in information to control for the impact of head trauma.

Cross-country skiers with the fastest finishing time and that participated in more than four events had an increased incidence of ALS when compared to controls (people that registered, but never competed). Participants who finished with times >180% higher than the winners time, had a lower incidence of ALS when compared to controls (Fang et al. 2016). The use of cross-country skiers removes the potential impact from head trauma, while maintaining a level of high endurance sport (Fang et al. 2016). This supports the hypothesis that physical exercise reduces the risk of ALS, until a certain threshold. Analyses such as these are beneficial, but more consistent testing is necessary to collate data in systematic reviews.

Identification of risk factors for ALS is useful information, as it ties into the pathogenesis of the disease. Risk factors, such as BMAA, give researchers additional pieces to the puzzle of ALS pathogenesis. However, the confounding nature of epidemiological studies make it hard to decipher what is a risk and what is not.

Furthermore, attempting to isolate this web of variables is not possible in some cases.

Clinical presentation and progression

Jean-Martin Charcot’s lectures on diseases of the nervous system delivered at La Salpê trière were translated and published in 1881 (Charcot et al. 1881). The disease progression, described by Charcot, remains an accurate description of ALS even after more than a century has passed (Rowland 2001).

The disease is named amyotrophic for the muscle atrophy that patients experience, and lateral sclerosis for the observations that the lateral columns of the spinal cord are hard when palpated at autopsy (Charcot et al. 1881, Rowland and Shneider 2001). The

primary distinctive feature that Charcot noticed was the rapid progression of the disease, with the average time of three years between the first symptoms and death, a figure that holds true today (Charcot et al. 1881, Rowland and Shneider 2001). The feature that differentiates ALS from other forms of motor neurone disease, such as primary lateral sclerosis, is the progressive degeneration of corticospinal neurons and the alpha motor neurons that they project to. Patients clinically present with hyperreflexia and spasticity, associated with corticospinal neuron lesions, as well as, muscle atrophy, weakness and fasciculations, associated with alpha motor neuron lesions (Charcot et al. 1881, Gordon

2013). Characterisation of the fasciculations, present in ALS, has assisted clinicians in differentiating between ALS and other conditions such as multifocal motor neuropathy

(Rowland and Shneider 2001, de Carvalho et al. 2017).

Onset can be either limb or bulbar, with limb onset being more common (Logroscino et al. 2008, Logroscino et al. 2010). Muscle weakness precedes muscle atrophy, with two thirds of patients first presenting with the symptoms in their upper limbs. Early ALS symptoms manifest themselves as weakness, loss of dexterity and difficulty walking

(Charcot et al. 1881, Gordon 2013). Charcot noted that after onset of weakness, patients often experience mass atrophy in all four limbs. Despite muscle weakness and atrophy, fasciculations and hyperreflexia can still be observed, typically in the legs. As the atrophy of muscles continues, patients tend to present with increased rigidity and the occurrence of fasciculations and spasms decreases (Charcot et al. 1881, Rowland and

Shneider 2001). Sensory functions are typically kept intact, eye movements are preserved until advanced stages, and the bladder is unaffected (Charcot et al. 1881,

Rowland 2001, Gordon 2013).

As the disease progresses, additional symptoms become more prevalent. In most cases, bulbar symptoms are present in later stages of disease (Charcot et al. 1881, Gordon 6

2013), if initial symptoms are bulbar in nature, the prognosis is poor (Chio et al. 2009).

Common signs of bulbar progression include atrophy and fasciculation of the tongue, with patients experiencing dysarthria as a result. This may be followed by dysphagia, sialorrhea, and paralysis of the orbicularis oris muscle. Respiratory symptoms can begin with a persistent weak cough and dyspnoea from minimal physical exertion (Charcot et al. 1881, Gordon 2013). Eventually, due to loss of phrenic nerve function, death typically occurs due to respiratory failure (Niedermeyer et al. 2018). As Charcot lamented in the late 1800s “The prognosis, up to the present, is of the gloomiest. There does not exist, as far as I am aware, a single example of a case where, the group of symptoms just described having existed, recovery followed. Is this doom final? The future alone can decide”.

Although many aspects of Charcot’s original characterisation of ALS hold true today, we have made several improvements. For instance, ALS is part of a disease continuum with frontotemporal dementia (FTD) (Geser et al. 2009, Burrell et al. 2016, Ratti et al.

2016). Approximately 15% of ALS patients present with both ALS and FTD (Gordon

2013). There are also similarities in genetic aetiology in both conditions, with some mutations within a family causing ALS in one patient and FTD in another (Menon et al.

2015). Improvements have also been made in diagnosis and treatment as discussed below.

Diagnosis

Diagnosing neurological disorders can be complex and stringent criteria are essential.

This is not only for treatment, but also for the inclusion of confirmed patients for clinical trials and epidemiological studies. The El Escorial diagnostic criteria were developed in 1994, revised in 2000 and have been the global standard for ALS

diagnosis (Brooks 1994, Brooks et al. 2000). The Awaji diagnostic algorithm integrates electromyograph (EMG) and neurophysiological data into a single algorithm. This algorithm increases the sensitivity of the El Escorial criteria (Carvalho and Swash

2009). Patients can be classified as having either clinically definite, clinically probable, probable or suspected ALS (Beghi et al. 2002). The King’s criteria is emerging as the standard for ALS staging, with recent updates to standard operating procedures

(Balendra et al. 2019).

However, there are some problems with the El Escorial criteria (for review see (Agosta et al. 2015)). In part, these problems are a result of the heterogeneity of ALS and the lack of biomarkers for corticospinal neuron degeneration. As previously mentioned,

ALS and FTD are part of a disease continuum and 50% of ALS patients experience some cognitive impairment. Classifications of cognitive impairment are not incorporated into the classifications for the El Escorial criteria (Ludolph et al. 2015).

Not having this feature may have implications in the clinical trial performance of these patients due to the associated prognosis (to be addressed in section 1.1.6.).

Also, despite the inclusion of EMG recordings via the Awaji algorithm, fasciculations can have varied aetiology, so further classification of these recordings would benefit the sensitivity of the criteria. The impact of cortical hyperexcitability has been shown to have a differential effect on different muscles (Menon et al. 2018). These studies give insight to the pathogenesis of ALS and provide improved understanding of which muscles are affected which could improve drawing more accurate conclusions from

EMG testing.

Treatments

Treatments for ALS are palliative rather than curative. Some treatments are aimed at prolonging survival whilst others focus on improving quality of life for patients. There are only two FDA-approved drugs for ALS treatment, Riluzole and Edaravone

(Rothstein 1996, Takei et al. 2017). Despite many attempts to develop treatments, many drugs fail in clinical trial stages (Ittner et al. 2015, Petrov et al. 2017).

Riluzole is a drug that targets ALS hyperexcitability by blocking presynaptic glutamate release (Rothstein 1996). However, further characterisation of Riluzole has shown that it has a wide-range of neural effects if administered in high doses (Bellingham 2011).

Two landmark studies on Riluzole led to its approval for ALS treatment in 1996, and both showed that Riluzole significantly improved survival rates of patients in the treatment group (Bensimon et al. 1994, Lacomblez et al. 1996). A subsequent Riluzole study including patients with advanced disease, showed no significant impact on the survival of late-stage ALS patients (Bensimon et al. 2002). This indicated that treatment was more effective in earlier disease states. A comparative review showed that Riluzole only increased survival by 2-3 months (Miller et al. 2012), a figure that has resulted in controversy due to the low impact relative to the cost of treatment. While the figure of

2-3 months may seem like a small figure, it was the first drug to have a significant impact since the description of ALS in the late 1800’s. When looking further into the data, it is important to note, that Riluzole treated patients had significantly lower percentage of mortality at 12 months post-treatment, than placebo-treated controls

(Miller et al. 2012). They also determined that 1 in 11 patients had death delayed past

12 months, but that the heterogeneity of ALS could contribute to the variation in the effectiveness of the drug (Miller et al. 2012).

The second drug, approved by the FDA for ALS treatment was a free radical scavenger,

Edaravone. Edaravone was tested in clinical trials for safety, and was shown to slow the development of physical symptoms in ALS patients (Edaravone Als 16 Study 2017,

Takahashi et al. 2017, Takei et al. 2017, Writing and Edaravone 2017, Writing Group

On Behalf Of The Edaravone Als 17 Study 2017). However, no survival data are currently available for Edaravone.

Procedural interventions can be utilised to increase patient quality of life. As the disease progresses and patients experience an increase in dysphagia, a feeding tube can help to prevent malnutrition (Gordon 2013). However, whether a gastrostomy increases either survival or quality of life is still a contentious issue (Chio et al. 2009, Gordon 2013).

Due to the gradual reduction in respiratory function in ALS patients, non-invasive ventilation is part of the standard of care and extends survival (Gordon 2013,

Khamankar et al. 2018, Niedermeyer et al. 2018).

The natural history of the disease has been altered with improvements in patient care and overall quality of life. However, much needs to be done to find an effective treatment to slow the progression of ALS. The heterogeneity in ALS symptomology and disease progression makes it difficult to provide uniform care for patients and is an obstacle to developing effective treatments.

Prognosis

The heterogeneity of ALS can be further explored by looking at prognosis. The average disease course is 3 years, however, 5-10% of patients live for more than 10 years (Chio et al. 2009). Other patients have an extremely aggressive progression, surviving only months.

Several factors impact ALS disease progression and therefore prognosis. A number of studies have found a correlation between bulbar onset and poor prognosis (Chio et al.

2009). Although men have a higher incidence of ALS, there seems to be no impact of sex on prognosis. There is an inverse correlation between age and prognosis, with older patients experiencing faster degeneration (Gordon 2013, Gordon et al. 2013).

Patients who are initially diagnosed by El Escorial criteria as having clinically definite

ALS, have a poor prognosis (Agosta et al. 2015). By contrast, patients who have incomplete forms of motor neuron disease (progressive muscular atrophy etc) have a better prognosis when compared with patients that present with classical upper and lower motor neuron symptoms (Chio et al. 2009). One of the restrictions of the El

Escorial criteria is the reduced ability to detect incomplete forms of MND, therefore, these prognostic factors could be associated. Additionally, patients who are initially classified as clinically definite ALS cases will typically have aggressive symptoms and a faster diagnosis. A short delay between symptom onset and diagnosis is also associated with poor prognosis (Chio et al. 2009). The interplay between prognostic factors must be considered to understand the true impact on disease progression.

To further emphasise the relationships between prognostic factors, patients with ALS and FTD have a poorer prognosis than patients with ALS only (Gordon 2013).

Approximately 15% of ALS patients have FTD and upwards of 50% of ALS patients present with some cognitive impairment (Chio et al. 2009, Gordon 2013). The impact that impairment has on the treatment choices of these patients may play a role in the subsequent poor prognosis.

Different mutations causing fALS can be associated with particularly aggressive forms of the disease. However, when comparing prognosis between sALS and fALS patients, there is no overarching effect (Chio et al. 2009). The consistent difference between sALS and fALS is age of onset, with fALS presenting 10y earlier. However, considering the correlation between poor prognosis and late age of onset, one may expect that fALS would have a better prognostic profile.

Increased understanding of factors impacting ALS prognosis would provide insight into the impact of potential treatments in a clinical trial setting.

ALS genes and disease models

The analyses of sALS epidemiology, disease progression and prognosis are complex and often confounding. The identification of genes that cause fALS has given a remarkable insight into ALS pathogenesis. The first fALS gene was identified in 1993

(Rosen et al. 1993). Since then, a total of 30 ALS-associated genes have been identified, largely due to the improved techniques in next-generation sequencing (Koboldt et al.

2013). The identification of ALS-associated genes has opened the door to both in vitro and in vivo models of ALS pathogenesis. Studying the impact of fALS genes has provided important information about specific disease mechanisms. The section will outline the genes that have been identified in ALS pathogenesis and explore in vivo models of disease.

Identification of ALS genes

Mutations in the Cu/Zn binding superoxide dismutase (SOD1) gene were the first identified cause of fALS (Rosen et al. 1993). Since SOD1 mutations were first identified, a plethora of other mutations have been uncovered including mutations in the genes encoding TAR DNA binding protein (TDP), fused in sarcoma (FUS),tubulin

alpha 4A (TUBA4A), and Kinesin family member 5A (KIF5A) (Sreedharan et al. 2008,

Kwiatkowski et al. 2009, Johnson et al. 2010, Smith et al. 2014). Hexanucleotide expansions in chromosome 9 open reading frame 72 (C9ORF72) have also been identified as a cause of ALS (DeJesus-Hernandez et al. 2011, Renton et al. 2011).

Expansions in C9ORF72 are the most common cause of fALS, followed by mutations in SOD1, TDP-43 and FUS (Renton et al. 2014). For an overview of genes causing

ALS, see Table 1.1 and 1.2. These tables have ALS-associated gene listed in order of the date of identification and details on the function of the mutated gene. The complexity of ALS is highlighted in Table 1.2 which shows that there is no clear consensus in which genes are considered to cause, as opposed to being implicated in

ALS pathogenesis. Other genes have previously been sorted into low or high risk. There has been suggestion that ALS has a multistep pathogenesis with both genetic and environmental components (Chio et al. 2018). A correlation study, examining this hypothesis, suggested that patients with genetic forms of the disease had a reduced number of “steps” before neurodegeneration occurred (Chio et al. 2018). Additionally,

SOD1 mutations, C9ORF72 expansions and TDP-43 mutations had different levels of acceleration in this model (Chio et al. 2018). Studies such as this reinforce the heterogeneity of ALS and highlight the complexity of ALS pathogenesis.

Table 1.1: Summary of ALS genes (1)

Gene ID Full Name Function SOD1 Cu/Zn binding superoxide dismutase Oxidative stress; Proteostasis Intracellular transport (axonal and NEFH Neurofilament heavy dendritic) SETX Senataxin RNA/DNA helicase Alsin/Rho guanine nucleotide ALS2 Vesicle trafficking exchange factors DCTN1 Dynactin Cytoskeleton; Axonal transport VAPB Vesicle-associated membrane protein Protein homeostasis; Vesicle trafficking ANG Angiogenin Angiogenesis CHMP2B Chromatin modifying protein 2B Vesicle trafficking TARDBP TAR DNA binding protein 43 RNA metabolism FUS Fused in sarcoma RNA metabolism Elongator acetyltransferase complex ELP3 RNA metabolism subunit 3 FIG4 SAC1 lipid phosphatase domain Vesicle trafficking VCP Valosin-containing protein Protein homeostasis; Vesicle trafficking OPTN Optineurin Protein homeostasis; Vesicle trafficking ATXN2 Ataxin 2 RNA metabolism SPG11 Spatacsin Transmembrane protein C9ORF72 Chromosome 9 open reading frame 72 DENN protein SQSTM1 Sequestosome 1 Ubiquitination; autophagy UBQLN2 Ubiquilin 2 Protein homeostasis PFN1 Profilin 1 Cytoskeletal dynamics Heterogenous nuclear HNRNPA1 RNA metabolism ribonucleoprotein A1 Heterogenous nuclear HNRNP2B1 RNA metabolism ribonucleoprotein 2B1 Cytoskeletal organisation; Axonal TUBA4A Tubulin alpha 4a transport MATR3 Matrin 3 RNA metabolism; Ribostasis Coiled-coil-helix-coiled-coil-helix CHCHD10 Mitochondrial function domain containing 10 TBK1 TANK-binding kinase 1 Autophaghy Cytoskeletal organisation; DNA damage NEK1 Serine/threonine-protein kinase Nek1 and cell cycle CCNF Cyclin F Protieostasis C21ORF2 Chromosome 21 open reading frame 2 Cytoskeletal organisation KIF5A Kinesin family member 5A Cellular transport

Table 1.2: Summary of ALS genes (2)

Renton Causing Implicated Leblond High risk Low Risk

Chia Renton Leblond et al et al et al Gene ID 2018 2014 2014 fALS sALS Juvenile Reference (Rosen et al. SOD1 Y 1993) (Figlewicz et al. 1994, Al- NEFH Y Chalabi et al. 1999) (Chen et al. SETX Y 2004) (Hadano et al. ALS2 Y 2001, Yang et al. 2001) (Münch et al. DCTN1 Y 2004) (Nishimura et al. VAPB Y 2004, Nishimura et al. 2004) (Greenway et al. ANG Y Y 2006, van Es et al. 2011) (Parkinson et al. CHMP2B Y Y 2006) TARDBP Y (Sreedharan et al. 2008) (Kwiatkowski et FUS Y Y al. 2009, Vance et al. 2009) (Simpson et al. ELP3 Y 2009) (Chow et al. FIG4 Y Y 2009) (Johnson et al. VCP Y 2010) (Maruyama et OPTN Y al. 2010) (Elden et al. ATXN2 Y 2010, Hart et al. 2012)

(Hentati et al. SPG11 Y 1998, Orlacchio et al. 2010) (DeJesus- Hernandez et al. C9ORF72 Y Y 2011, Renton et al. 2011) (Fecto et al. SQSTM1 Y 2011)et al., 2011 (Deng et al. UBQLN2 Y Y 2011) PFN1 Y (Wu et al. 2012) (Kim et al. HNRNPA1 Y 2013) (Kim et al. HNRNP2B1 Y 2013) (Smith et al. TUBA4A Y Y 2014) (Johnson et al. MATR3 Y Y 2014, Leblond et al. 2016) (Bannwarth et CHCHD10 Y Y al. 2014) (Cirulli et al. TBK1 Y Y 2015) (Brenner et al. NEK1 Y Y 2016, Kenna et al. 2016) (Williams et al. CCNF Y Y 2016) (Wheway et al. C21ORF2 Y Y 2015) (Nicolas et al. KIF5A Y 2018)

The classification of ALS genes as causative or as risk factors is complicated. This is highlighted in Table 1.2, where some reviews classify a gene as causing ALS, whereas others consider it as a low-risk susceptibility gene, as is the case with sequestosome1

(SQSTM1). The complexity is increased when considering genes that cause atypical

ALS, such as juvenile onset. Senataxin (SETX), Alsin/Rho guanine nucleotide exchange factors (ALS2), and Spatacsin (SPG11) all cause a juvenile onset ALS and are considered to be a high risk susceptibility in the Leblond review (Leblond et al. 2014). 16

However, the Renton review classifies these genes as being “implicated” in ALS pathogenesis, rather than genes that are known “to carry ALS mutations” or causative

(Renton et al. 2014).

Some fALS mutations are also associated with sALS. Of the 30 identified mutations or expansions, 12 are associated with both forms of disease, and three are only associated with sALS. The line between causative factors between fALS and sALS is becoming increasingly intertwined. This could be expected, given the similarities between fALS and sALS in disease presentation, progression and prognosis. Approximately 15% of sALS cases are associated with mutations or expansions (Chia et al. 2018, Nicolas et al.

2018). Genes implicated in sALS include C9ORF72, TUBA4A, MATR3, NEK1, and

C21ORF2 (Renton et al. 2014, Smith et al. 2014, Wheway et al. 2015, Brenner et al.

2016, Kenna et al. 2016, Leblond et al. 2016, Chia et al. 2018). Genes associated with fALS and sALS can be grouped according to function.

Different pathways have been implicated in ALS pathogenesis including RNA metabolism, protein homeostasis and cytoskeletal organisation. In section 1.3.4. the role of the cytoskeleton in ALS will be discussed. The identification of novel mutations that cause ALS contributes to the understanding of ALS pathogenesis. The collective analysis of these genes has elucidated pathways impacted in ALS. The data contributes to an increased understanding of both fALS and sALS. Animal models, which recapitulate disease pathology are valuable tools for investigating ALS, and such models will be discussed in the following section.

In vivo models of ALS

SOD1 mouse models have been extensively studied and are the best characterised models of ALS (McGoldrick et al. 2013, Ittner et al. 2015). SOD1 mutations account

for 12% of fALS and 1% of sALS cases (Renton et al. 2014). The first paper on

SOD1G93A mutant mice described an increased mortality with a progressive paralysis and motor neuron loss (Gurney 1994). Various behavioural studies have been carried out with SOD1 mutant mice, with different mutations and various copy numbers providing variations in phenotypes (Vinsant et al. 2013, Vinsant et al. 2013, Tremblay et al. 2017). Refined protocols have made testing for disease progression more sensitive

(Weydt et al. 2003, Mancuso et al. 2011, Rocha et al. 2013). The line between presymptomatic and symptomatic stages of ALS has been redefined in the SOD1 mouse model, with the detection of more subtle motor changes. In 2003, Weydt and colleagues showed that transgenic SOD1 mice started to show motor deficits at 12 weeks of age with hind and fore limb tremors, as well as decreased performance in the RotaRod and the paw grip endurance test (Weydt et al. 2003). A study in 2011 by Mancuso and colleagues utilised the Digigait and revealed significant changes in the hind limbs of transgenic mice at 8 weeks, with more pronounced hind limb changes from 12 weeks

(Mancuso et al. 2011). The electrophysiological profile of transgenic SOD1 mice shows an enhancement of synaptic transmission detected in the phrenic-nerve diaphragm neuromuscular junction (NMJ) in 6wk old mice (Rocha et al. 2013). Changes in the

SOD1G93A mice can be observed as early as P21, with reduced dendritic spines and increased EPSC frequency in layer 5 pyramidal neurons (Fogarty et al. 2015). The early changes may suggest a compensatory mechanism preceding the pathological effects of the mutations.

Cortical hyperexcitability and extra-motor brain involvement are features of ALS pathology (Abdulla et al. 2014, Menon et al. 2015). Hippocampal specific changes were observed antecedent to motor deficits in SOD1G93A mice (Quarta et al. 2015). Quarta and colleagues reported deficits in anxiety and spatial learning of SOD1 mice at 4wk of

age, which correlated with a loss of parvalbumin interneurons in the CA1 and CA3 region of the hippocampus (Quarta et al. 2015). The presence of cortical hyperexcitability has also been recapitulated in SOD1 mice (Pieri et al. 2009).

Glutamatergic alterations in layer V cortical neurons and altered firing of spinal motor neurons have been found in SOD1G93A mice (Saba et al. 2016)

Despite the knowledge that SOD1 models have contributed to the understanding of ALS pathogenesis, mutations in SOD1 cause different histopathological features when compared with other fALS mice. While SOD1 mice typically present with cytoplasmic inclusions, they lack the TDP-43-positive inclusions, which are present in the majority of sALS and fALS cases, and form in a distinct aggregation process (Kwong et al. 2007,

Van Deerlin et al. 2008, Farrawell et al. 2015). Whilst SOD1 models serve a purpose in drug screening, it has been suggested that the failure of clinical trials for ALS therapeutic targets could be due to the differing pathomechanisms in the SOD1 model of disease (Ittner et al. 2015). To identify and assess therapeutic targets with a better chance of clinical relevance, additional ALS-associated mouse models are necessary.

Although mutations in TARDBP only account for 4% of fALS and less than 1% of sALS cases, TDP-43 inclusions are a common histopathological feature across both sALS and fALS (Kwong et al. 2007, Renton et al. 2014). TDP-43 is encoded by the

TDP gene and typically has a nuclear localisation. However, in disease, TDP-43 localises in the cytoplasm and forms aggregates (Van Deerlin et al. 2008, Ling et al.

2013). TARDBP KO mice are embryonically lethal at E7.5 and heterozygous KO mice develop motor deficits (Kraemer et al. 2010). SOD1 KO mice have also been found to have an impacted neuromuscular junction and accelerated muscle loss (Deepa et al.

2019). This not only shows that TDP-43 is essential for embryonic formation, but also that a reduction of TDP-43 and SOD1 selectively impacts motor function. 19

TDP-43 mouse models have revealed similar pathologies to SOD1 mice, with a more pronounced overlap with frontotemporal dementia (Ke et al. 2015). Marked deficits in motor function were detected in 12wk old iTDP-43A315T mice with Rotarod, pole and grip strength tests. These deficits could be partially rescued by turning off the expression of the transgene (Ke et al. 2015). Cognitive deficits and hippocampal changes were also present in the mice and typically preceded motor deficits, which is similar to findings in other ALS mouse models (Thielsen et al. 2013, Ke et al. 2015,

Quarta et al. 2015). The iTDP-43A315T mice also showed severe motor deficits at 12m old (van Hummel et al. 2018). These deficits were accompanied by a loss of layer V corticospinal neurons that manifested into a progressive reduction in the thickness of the motor cortex. No alpha motor neuron loss was observed in these mice, but despite this, muscle fibres were smaller in transgenic animals (van Hummel et al. 2018). Similar to

SOD1 mice, early electrophysiological changes have also been observed in layer 5 pyramidal neurons of transgenic TDPQ331T mice (Fogarty et al. 2016). A model expressing a TDP-43 mutation under the control of a prion promoter has also been generated, however, these mice have been shown to have sudden death and gastrointestinal issues (Wegorzewska et al. 2009, Hatzipetros et al. 2014). This is important to consider when interpreting models with ubiquitous expression of transgenes. TDP-43 aggregation is associated with other forms of fALS and sALS

(Dennis and Citron 2009, Maruyama et al. 2010, Moser et al. 2013), suggesting that

TDP-43 pathology is a point of convergence in ALS progression.

Expansions in C9ORF72 are the most common genetic cause of ALS (Renton et al.

2014, Chia et al. 2018). C9ORF72 has punctate expression in the neuropil of E18, P1 and P7 mice, and showed strong expression in the cytoplasm of cortical neurons from

2wk onwards (Atkinson et al. 2015). This indicates that C9ORF72 plays a role during

different stages of development. There is evidence that the number of the expansions has an impact on the penetration of ALS and the aggressiveness of the phenotype produced (Batra and Lee 2017, Van Mossevelde et al. 2017). Numerous mouse models expressing the hexanucleotide expansion of C9ORF72 have been generated with varying results (Chew et al. 2015, Batra and Lee 2017). One model of C9ORF72 expansions presented a model that had variable penetrance of symptoms, with a subset of mice presenting with a decreased survival and rapid degeneration of motor function

(Liu et al. 2016). The generation of mouse models of fALS provides much needed tools that can be utilised to dissect out different stages of ALS pathogenesis.

Profilin 1 and ALS

Identification of ALS-associated PFN1 mutations

Mutations in the profilin1 (PFN1) gene were identified as a rare cause of fALS in 2012

(Wu et al. 2012). Although the cytoskeleton has been indirectly implicated in ALS pathology in the past (Collard et al. 1995, Jablonka et al. 2004), the identification of

ALS-associated PFN1 mutations was the first direct link of the actin cytoskeleton in

ALS pathology. The study by Wu and colleagues identified four novel ALS-associated mutations in PFN1; C71G, M114T, E117G and G118V (Wu et al. 2012). Mutations at

E117 have since been found in sALS patients (Yang et al. 2013). Subsequent ALS- associated PFN1 mutations have been identified in both fALS and sALS patients, including A20T, T109M, Q139L and R136W (Chen et al. 2013, Ingre et al. 2013, Smith et al. 2015). Despite the relevance of these mutations due to the involvement of the cytoskeleton, mutations in PFN1 only cause less than 1% of fALS cases and are only present in a subset of cohorts (Daoud et al. 2013, Lattante et al. 2013, Tiloca et al. 2013,

Zou et al. 2013).

The mutations, initially described by Wu and colleagues (Wu et al. 2012), are in amino acids that are conserved across mouse, rat and human, as well as in profilin 2 (PFN2)

(Fig 1.3.1.1.). However, the mutation identified by Ingre and colleagues (Ingre et al.

2013) is not in an amino acid that is conserved in PFN2. There have been two studies published with mouse models expressing mutant PFN1 and one drosophila model (Yang et al. 2016, Fil et al. 2017, Wu et al. 2017). These models will be addressed in Chapters

3, 4, and 5.

Figure 1.3.1.1. Identified mutations summary of ALS-associated PFN1 mutants

1.3.1.1 The point mutations of PFN1 that were identified by Wu et al. (C71G, M114T, E117G

and G118V) and Ingre et al. (T109M) are conserved across mouse and rat PFN1-

coding regions. In addition, all except T109M are also conserved within the PFN2-

coding region.

PFN1 function

There are four isoforms of profilin in mice and humans (Krishnan and Moens 2009).

PFN1 is ubiquitously expressed, while PFN2 is predominant in the brain and nervous system (Krishnan and Moens 2009, Murk et al. 2012). PFN2 can be alternatively spliced into PFN2a and PFN2b, however, PFN2a has a higher expression in brain tissue

(Lambrechts et al. 2000). Although PFN1 and PFN2 are both expressed in the brain, they impact different signalling pathways and have different binding partners (Witke et al. 1998, Michaelsen et al. 2010, Murk et al. 2012).

PFN1 is an actin binding protein (ABP) (Kwiatkowski and Bruns 1988). Actin is one of the three major components of the cytoskeleton and is one of the most abundant proteins in eukaryotic cells (Xue and Robinson 2013). Actin is required for a variety of processes in cells including motility, intracellular transport, morphogenesis and structural dynamics (Akin and Mullins 2008, Flynn et al. 2009, Korobova and Svitkina

2010, Lewis et al. 2011). Diverse populations of actin filaments with distinct structural and dynamic properties are vital for these cellular processes, and although the structure of filamentous actin (F-actin) is highly conserved (Erickson 2007), the addition of ABPs gives actin its versatility (for review see (Gunning et al. 2015)). ABPs regulate dynamics and stability of actin filament populations in the cell, which can then determine the function of actin. Dysfunction in the actin cytoskeleton has been extensively studied in neuronal function and development as well as in neurodegenerative diseases (Curthoys et al. 2014, Brettle et al. 2016, Stefen et al. 2016).

The implications of actin and ALS will be addressed in section 1.3.4.

PFN1 is ubiquitously expressed and has dual functions in both actin filament and microtubule dynamics (Kwiatkowski and Bruns 1988, Nejedla et al. 2016). PFN1

mediates the exchange of ADP-actin to ATP-actin, therefore enhancing actin filament extension (Fig 1.3.2.1.) (Mockrin and Korn 1980, Wen et al. 2008). PFN1 can also play an inhibitory role in actin filament polymerisation, as high cellular concentrations of

PFN1 result in its binding to the fast growing end of the actin filament (Fig 1.3.2.1.)

(Courtemanche and Pollard 2013). The role that PFN1 plays in priming G-actin to bind to the barbed end of the actin filament is dependent on formin (Kovar et al. 2006). In systems that lack formins, PFN1 inhibits actin filament elongation. This impact is reminiscent of the initial proposed function of PFN1, as it was considered to be an actin sequestering protein.

In recent years, PFN1 has been recognised as a regulator or G-actin localisation (Vitriol and Zheng 2012, Lee et al. 2013). Discussions of actin dynamics tend to focus heavily on F-actin, with the view that G-actin is a simple building block (Gunning et al. 2015).

However, this sentiment is shifting, with guardians of monomeric actin becoming increasingly appreciated (Xue and Robinson 2013, Skruber et al. 2018). PFN1 localises to the leading edge of membranes and actively recruits G-actin to build F-actin filaments with the help of thymosin-β4 (Lee et al. 2013). Actin-rich growth cones in neurons require PFN1 for accurate outgrowth and pathfinding (Vitriol and Zheng 2012,

Lee et al. 2013). This may be in part due to the recruitment of G-actin, as well as the regulatory role that PFN1 has in controlling other ABPs, such as actin-related protein

2/3 (Arp2/3) (Blanchoin et al. 2000, Henty-Ridilla and Goode 2015, Rotty et al. 2015).

PFN1 and PFN2 are both found at the synapse despite functioning in independent neuronal signalling pathways (Neuhoff et al. 2005, Murk et al. 2012). PFN2 is found in the majority of synapses, especially inhibitory synapses (Murk et al. 2012). Although

PFN1 is only found in a small proportion of post-synaptic compartments, both isoforms have been shown to co-localise (Murk et al. 2012). The addition of brain-derived 24

neurotrophic factor to hippocampal cultures results in a marked increase in the number of post-synaptic compartments containing PFN1 (Ackermann and Matus 2003). PFN1 affects synaptic structure in hippocampal neurons by regulating the actin cytoskeleton in an activity dependent manner (Ackermann and Matus 2003). This induces changes in dendritic spine morphology and the structure of the presynaptic compartments (Murk et al. 2012). PFN1 has been shown to regulate the Arp2/3 complex, a regulation which is dependent on the ability of PFN1 to bind to actin monomers (Rotty et al. 2015). Arp2/3 plays a major role in dendritic spine morphology and structure, as well as growth cone dynamics (Wegner et al. 2008).

Figure 1.3.2.1. Profilin mediates the polymerisation of F-actin

1.3.2.1 Profilin binds to G-actin and catalyses ADP-actin to ATP-actin nucleotide exchange.

This allows for the extension of F-actin at the barbed end (A). If the cellular

concentration of profilin is too high, it binds to the barbed end of actin, thus inhibiting

filament extension (B).

In addition to the regulation of the actin cytoskeleton, PFN1 can influence microtubule dynamics (Nejedla et al. 2016). The indirect interaction between microtubules and

PFN1 was observed by Witke and colleagues in 1998 (Witke et al. 1998). PFN1 colocalises with microtubules (Nejedla et al. 2016). This is partially dependent on formin, as the localisation of PFN1 to microtubules is altered with formin inhibition

(Nejedla et al. 2016). Knockdown of PFN1 alters microtubule dynamics and increases microtubule acetylation (Nejedla et al. 2016). The functional impact that PFN1 has on both actin and microtubules, gives it a unique role between the two cytoskeletal systems. The interplay between actin and microtubules is complex (Dogterom and

Koenderink 2018). Future studies should aim to address how PFN1 functions effect the intricate crosstalk between actin and microtubules.

PFN1 interactions

Although profilins have a major role in the formation of F-actin, they also have a range of other significant binding partners (for review, see (Witke 2004)). Interestingly, all

ALS-associated mutations described in the profilin gene have been in PFN1 rather than the neuronal specific PFN2 (Wu et al. 2012). This is despite the mutations identified by

Wu et al. being found in amino acids that are conserved across PFN1 and PFN2 (Fig

1.3.1.1.). PFN1 has a poly-L-proline binding cleft that is independent from the actin binding region (Metzler et al. 1994). Binding partners of PFN1 include annexin 1, drebrin, gephyrin, Wiskott-Aldrich syndrome protein (WASP) and WASP family verprolin-homologous protein (WAVE) (Reinhard et al. 1995, Mammoto et al. 1998,

Miki et al. 1998, Suetsugu et al. 1998, Witke et al. 1998, Abdulla et al. 2014). Through the interaction with such ligands, PFN1 plays a role in the formation of specific actin filament populations, such as those present micro spikes and synaptic scaffolding

(Mammoto et al. 1998). ALS-associated PFN1 mutations could have an impact on actin 26

filament populations, due to downstream effects on poly-L-proline ligands. There is no current literature on this topic.

Actin, clathrin, valosin-containing protein (VCP) and 70kDa heat shock protein (hsp70) form a complex with PFN1 that is thought to play a role in endocytosis (Witke et al.

1998). Clathrin and VCP are both involved in vesicle transport (Keen et al. 1979,

Pleasure et al. 1993). VCP mutations are a cause of fALS (Johnson et al. 2010) and

VCP plays a role in mitochondrial uncoupling leading to reduced ATP levels

(Bartolome et al. 2013). Understanding if ALS-associated PFN1 mutations alter this complex formation could link PFN1 function to mitochondrial dysfunction or to abnormalities in endocytosis, both of which are features of ALS pathogenesis (Jung et al. 2002, Devon et al. 2006, Lin and Beal 2006).

Cytoskeleton and ALS

The identification of ALS-associate PFN1 mutations was the first direct link between the actin cytoskeleton and ALS pathogenesis (Wu et al. 2012). However, other genes encoding cytoskeletal proteins have previously or subsequently been implicated.

Mutations in neurofilament heavy (NEFH), dynactin (DCTN1), TUBA4A,

Serine/threonine-protein kinase Nek1 (NEK1), and KIF5A have all been linked with fALS (Al-Chalabi et al. 1999, Münch et al. 2004, Smith et al. 2014, Brenner et al. 2016,

Nicolas et al. 2018).

Mutations in TUBA4A impacted microtubule dynamics and had an increased propensity for aggregation (Smith et al. 2014). Although KIF5A mutations were identified, there is no experimental data on the functional impact of the mutations on the protein function (Nicolas et al. 2018). KIF5A is part of the kinesin family (Miki et al.

2001). Kinesins associate with microtubules and are molecular motors responsible for

the transport of a variety of organelles and other cargos (Miki et al. 2001). The identification of these mutations emphasises the importance of cytoskeletal regulation in

ALS pathogenesis. The unique ability of PFN1 to regulate both actin and tubulin dynamics makes it an intriguing candidate for further study.

Function of ALS-associated PFN1 mutants

The study by Wu and colleagues that first identified the ALS-associated PFN1 mutations identified 4 mutations C71G, M114T, E117G and G118V. The study showed that 3 of the 4 mutants had a reduced ability to bind to actin (Wu et al. 2012). They also showed that expression of 3 of the 4 mutants in primary mouse motor neurons resulted in a decreased axon length and a reduced filamentous to globular actin ratio in growth cones (Wu et al. 2012). Aggregations were shown in primary motor neurons and N2A cells, although the aggregations were only quantified in N2A cells. The authors proposed that the ALS-associated PFN1 mutants rendered the protein incapable of binding to actin, hence disrupting actin dynamics, which could lead to the pathogenic role of the mutations in ALS (Wu et al. 2012).

Subsequent studies on the ALS-associated PFN1 mutations have further explored this hypothesis and have explored the functional changes in the protein. Figley and colleagues showed that ALS-associated PFN1 mutations altered stress granule formation in yeast and identified an interaction between PFN1 and ataxin 2 (Figley et al.

2014). Ataxin 2 can be found in cortical actin in yeast and is a regulator of ribonucleoprotein particles (RNPs) (Nonhoff et al. 2007, Michelot et al. 2010). When

RNA binds to RNA binding proteins, the complexes formed are called RNPs and altered RNP dynamics have been shown in various other ALS-associated gene mutations, including TDP-43, FUS and VCP (Bosco et al. 2010, Liu-Yesucevitz et al.

2010, Baron et al. 2013, Buchan et al. 2013). The finding that ALS-associated PFN1 mutations have an impact on stress granule formation shows that the mutations could converge in similar pathogenic pathways to other ALS-associated mutations.

Single point mutations in PFN1 appear to lead to functional changes in the ability of the protein to bind to actin (Wu et al. 2012). Two studies in 2015 investigated the structural changes in the proteins of the ALS-associated PFN1 mutations C71G, M114T, E117G and G118V. Del Poggetto and colleagues showed that the mutations altered the native state of the protein, increased aggregation in a manner that correlated with the structural changes and increased susceptibility to urea (Del Poggetto et al. 2015). A study by

Boopathy and colleagues showed that the ALS-associated PFN1 mutants had an increased protein turn over in vitro due to conformational changes resulting in the protein being marked for degradation (Boopathy et al. 2015). Both studies found that

C71G, M114T, G118V and E117G were ordered from most affected to least affected in terms of aggregation propensity (Boopathy et al. 2015, Del Poggetto et al. 2015). The order of the most to least severe mutations were similar to the findings by Wu and colleagues (Wu et al. 2012).

PFN1 mutations do not have a predictable result when analysed with an actin polymerisation assay. PFN1 mutants had the same impact as wild-type (Wt) PFN1 on inhibiting actin polymerisation with increasing concentrations (Boopathy et al. 2015).

However, despite the presence of the mutations, PFN1 maintains an inhibitory function.

This indicates that the binding abilities of mutant PFN1 may not be quite as simple as first thought.

A study from our laboratory investigated the impact of ALS-associated PFN1 mutations on hippocampal neuron morphology. We found that expression of PFN1 C71G in

hippocampal neurons increased dendrite length and arborisation (Brettle et al. 2015). No significant changes were observed in axon length or arborisation. These results showed that PFN1 C71G has differential effects on neuron morphology, both in neuronal sub types when compared to the Wu and colleagues’ study and in different cell compartments, ie dendritic and axonal compartments. This indicates that the role of

PFN1 may vary in specific neuronal subtypes. Further characterisation of these subtypes is necessary to be able to interpret these results. For instance, information on the abundance and differential function of various ABPs in neuronal subtypes could help to elucidate why PFN1 mutations have differential effects.

The C71G, M114T and G118V mutations identified by Wu and colleagues appear to have the most significant results overall (Wu et al. 2012, Figley et al. 2014, Boopathy et al. 2015, Del Poggetto et al. 2015). By contrast the E117G mutation appears to be a less pathogenic variant. E117G mutations have also been found in sporadic ALS cases, leading the mutation to be classified as a risk factor for ALS (Fratta et al. 2014).

Specifically, PFN1C71G appeared to have the most significant impacts on function and protein structure (Wu et al. 2012, Del Poggetto et al. 2015), thus this is the mutation that was selected to be investigated in this thesis.

Molecular mechanisms of ALS

Cortical excitability, hippocampal dependent behavioural changes and interneuron loss have been shown to precede motor neuron degeneration (Ke et al. 2015, Menon et al.

2015, Quarta et al. 2015), it is important to understand what make motor neurons susceptible to degenerative cues. Alterations to the structures of neurons also precede neurodegeneration. Morphological changes to the dendrites of layer 5 pyramidal neurons and the end plates of NMJs could be the first step in ALS pathogenesis, perhaps

even driving the cortical hyperexcitability (Tremblay et al. 2017, Chand et al. 2018).

Motor neurons are the longest cells in the human body, with axons from corticospinal neurons extending from the motor cortex in the brain to interneurons residing in the spinal cord. Alpha motor neurons have axons that can exceed 1 meter long, extending from the spinal cord and innervating muscles throughout the body.

Axonal transport is important in neurons, especially MNs due to their size. The transport of proteins and organelles along the axon is vital to cellular function, as local translation at the NMJ is limited (Chevalier-Larsen and Holzbaur 2006). Axonal transport can be slow or fast, anterograde or retrograde, and distinct cargos are carried by different molecular motors (McEwen and Grafstein 1968, Verhey et al. 1998,

Hafezparast et al. 2003). Whilst a small percentage of actin and other proteins are translated in axons (Eng et al. 1999, Lee and Hollenbeck 2003), the main pool of axonal actin is transported as G-actin with profilin and cofilin via slow axonal transport (Mills et al. 1996). Slowed axonal transport has been shown to precede neurodegeneration and mitochondrial dysfunction in SOD1 mutant mice (Williamson and Cleveland 1999,

Magrane et al. 2012). There have been no studies on the impact of ALS-associated

PFN1 mutations on axonal transport. Now that KIF5A has been identified as a cause of fALS, it may increase the likelyhood that axonal transport is a point of convergence in

ALS pathogenesis.

Mitochondria are energy producing organelles that are essential in regions with a high metabolic demand, such as growth cones or synapses, and are typically found at high densities in these actin-rich regions (Morris and Hollenbeck 1993, Li et al. 2004). The axonal transport of mitochondria is via fast transport, however, this can be slowed by interruption of actin dynamics (Ligon and Steward 2000). Evidence of mitochondrial dysfunction has been shown in various ALS mouse models (Martin et al. 2009, Xiao et 31

al. 2018). Characterising how the ALS-associated PFN1 mutations impact axonal transport and mitochondrial dynamics could provide information about how the mutations contribute to ALS pathology.

Other potential mechanisms of ALS include altered protein homeostasis, RNA metabolism, autophagy and vesicle trafficking (Ling et al. 2013, Droppelmann et al.

2014, Morgan and Orrell 2016, Bonafede and Mariotti 2017).

Aims of this project

The aims of this projects are to generate mouse models of ALS, expressing disease- associated PFN1 mutants, to gain new insight into the pathogenesis of ALS. We aim to generate models with expression in different neuronal subtypes. We will then compare the impact of the mutations in these models to elucidate the role that PFN1 plays in different neuronal subtypes.

Once these models have been generated, the behaviour and motor performance will be characterised with a battery of tests. A histological characterisation will follow to assess if pathology is present.

Overall, we aim to provide some insight into the role that PFN1 plays in neuronal function and how the disruption of this function may lead to ALS.

Chapter 2:

Methods

2 Methods

Equipment and reagents

Table 2.1: Equipment

Equipment Manufacturer/Supplier 1.0mm glass plates Bio-Rad Laboratories 10µL micro-injection syringe Hamilton AxioSkop 40/Axiocam fluorescence microscope Zeiss BioDoc-it UVP Block heater SBH 130D Stuart Centrifuge 5415 R Eppendorf Chemidoc Bio-Rad Laboratories Class II biological safety cabinet Thermo scientific Cooling wire grid Aldi Curved forceps Fine Science tools CP1000 Film processor AGFA Dumont #5 forceps Fine Science tools Grip strength meter Chatillon, AMETEK Haemocytometer Neubauer Incubator for primary cells Binder Laminar flow hood (heraeus) Thermo scientific World Precision Micro4 micro syringe pump controller Instruments Microcentrifuge Lab Gear Microinjection needle Hamilton Microtome Leica Microwave for gels LG Milli-Q Element water purification system Millipore Nanodrop ND-1000 spectrophotometer Nanodrop Nikon Eclipse TiE Nikon Olympus BX51 microscope Olympus Orbital shaker Infors HT pH meter Hanna instruments edge PowerPac 300 Bio-Rad Laboratories RHS-1 microwave vacuum histoprocessor Milestone RotaRod Ugo Basile Shandon excelsior processor Thermo scientific Vibra-cell sonicator Sonics Stratagene qPCR machine Agilent Technologies

Thermomixer Eppendorf Tissue floating bath XH1003 Premiere Trans-blot SD semi-dry electrophoretic transfer cell Bio-Rad Laboratories Ultra centrifuge optima L-90K Beckman Coulter Ultra centrifuge rotor: 70 Ti Beckman Coulter Ultra-fine micro-dissecting scissors Fine Science tools Water bath (bacteria work) Julabo Water bath (cell culture) Grant JB nova Western blot rocker Ratek X Ray film cassette Fiji Film

Table 2.2: Consumables

Consumables Manufacturer 13mL round bottomed tubes BD Bioscience 13mm, 0.2µm syringe filter unit Sigma-Aldrich 24-well plates Corning 2ml Cryovial Greiner Amicon 100,000 MWCO Ultra-15 centrifugal filter units VWR International Glass bottomed plates In vitro Scientific Glass coverslips HD Scientific Glass coverslips ø 10mm, #1.0 thickness Menzel Glass coverslips ø 12mm, #1.5 thickness Menzel Glass slide superfrost plus white (cell culture) Thermo Fisher Scientific Needles BD Bioscience PVDF (Polyvinylidene fluoride) membrane Immobilon Millipore Quick seal ultracentrifugation tubes Beckman Safe-lock tube Eppendorf Superfrost ultra plus glass slides Thermo Fisher Scientific Syringes BD Bioscience T75 flasks Corning X-Ray film Fuji Film

Table 2.3: Reagents

Reagent Manufacturer 10x PCR buffer Roche 16% Paraformaldehyde ProSciTech 1kb plus DNA ladder Bioline 1x trypsin (primary culture) Sigma-Aldrich 2,2,2'-nitrilotriethanol Sigma-Aldrich 30% Acrylamide/bis Solution Bio-Rad Laboratories 50bp DNA ladder Bioline 5x blue loading dye Bioline ABC elite kit Vector laboratories Acetic acid Sigma-Aldrich Agarose powder Bioline Ampicillin Sigma-Aldrich B27 supplement (50x) Life Technologies Benzonase endonuclease Sigma-Aldrich Boric acid Sigma-Aldrich Bovine serum albumin (BSA) Sigma-Aldrich Bradford assay Bio-Rad Laboratories BDNF Sigma-Aldrich Bromophenol blue Sigma-Aldrich Calcium chloride (CaCl2) Sigma-Aldrich Coomassie brilliant blue R staining solution Sigma-Aldrich DAPI (4',6-diamidino-2-phenylindole) Thermo Fisher Scientific Deoxyribonuclease I (Dnase) Sigma-Aldrich Developer G153 (A and B) AGFA Dimethyl sulfoxide (DMSO) Thermo Fisher Scientific DNase I for virus titre Sigma-Aldrich DNase I reaction buffer Sigma-Aldrich dNTPs Roche DPX Mountant Sigma-Aldrich Dulbecco's Modified Eagle Media (DMEM)/high glucose Life Technologies Dynabeads magnetic beads Life Technologies Eosin HD Scientific Ethanol Merck Ethidium bromide Sigma-Aldrich Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich Fixer reagent G354 AGFA Fluoromount-G Southern Biotech 36

Foetal bovine serum (FBS) Thermo Fisher Scientific Glutamax Invitrogen Glycerol Sigma-Aldrich Hank's balanced salt solution (HBSS) 10x Sigma-Aldrich Hematoxylin Sigma-Aldrich Hepes Thermo Fisher Scientific Horse serum Gibco IMDM cell culture medium Life Technologies Kanamycin Sigma-Aldrich Laminin Invitrogen L-Glutamine Life Technologies Lipofectamine LTX Life Technologies Low melting temperature agarose Thermo Fisher Scientific Luminata crescendo eastern HRP substrate Merck Magnesium chloride (MgCl2) Sigma-Aldrich Nail polish, clear Sally Hansen Neurobasal medium Life Technologies OptiPrep density gradient medium Sigma-Aldrich Paraffin Merck Penicillin streptomycin (Pen Strep) Thermo Fisher Scientific Penicillin-streptomycin Life Technologies Pfu turbo DNA polymerase Agilent pGEM-T easy vector system Promega pGEM-T easy vector system I Kit Promega Phenol Red Sigma-Aldrich Poly-D-lysine hydrobromide (PDL) Sigma-Aldrich Potassium chloride (KCl) Sigma-Aldrich Precision plus all blue standard Bio-Rad Laboratories Prolong gold antifade mountant Life Technologies Protease inhibitor Roche Proteinase K New England Biolabs Purelink hipure filter maxi Life Technologies Purelink hipure filter midi Life Technologies QIAquick gel extraction kit Qiagen Skim milk Coles brand Sodium azide Sigma-Aldrich Sodium chloride (NaCl) Sigma-Aldrich Sodium deoxycholate Chem Supply Sodium dodecyl sulfate (SDS) Bio-Rad Laboratories Sodium hydroxide Labscan Sodium phosphate dibasic Na2HPO4 Sigma-Aldrich Sodium pyruvate Life Technologies

Sodium tetraborate Sigma-Aldrich Sucrose Sigma-Aldrich Super optimal broth with catabolite repression (SOC) Bioline TM SuperScript® VILO cDNA synthesis kit Invitrogen SYBR green, 2x mastermix Applied Biosystems T4 DNA ligase Thermoscientific Taq Roche Taq DNA polymerase Roche Tripsin solution from porcine pancreas 10x Sigma-Aldrich Tripsin/EDTA Sigma-Aldrich Triton-X100 Sigma-Aldrich Trizma base Sigma-Aldrich TRIzol Life Technologies Tween20 Sigma-Aldrich Urea Sigma-Aldrich Water (Dnase and Rnase free) Sigma-Aldrich Water for cell culture Sigma-Aldrich Water for irrigation Baxter Xylene Thermo Fisher Scientific β-mercaptoethanol Sigma-Aldrich

Table 2.4: Buffers and solutions

Basic solutions 4% Paraformaldehyde 16% PFA diluted in 1x PBS (PFA) Phosphate buffered 0.1 M NaCl, 2.7 M KCl, 0.015 M Na2HP04, in ddH2O, pH saline (PBS), 10x 7.2 Tris buffered saline 0.05 M Tris-Hcl, 0.15 M NaCl, in ddH2O. pH7.5 (TBS) 10x Tris glycine (10x) 0.25 M Tris, 1.92 M glycine in ddH2O Tris-acetate-EDTA 242g Tris, 57.1mL glacial acetic acid, 100mL 0.5M EDTA (TAE) 50x (pH 8.0), made up to 1L in ddH2O

Molecular biology 2.3 Alkaline lysis buffer 25mM NaOH, 0.2mM EDTA; pH 12 Neutralisation buffer 40mM Tris-HCl; pH 5 10g tryptone, 5g yeast extract, 10g sodium chloride in Lysogeny broth 500mL water 10g Tryptone, 5g yeast extract, 10g sodium chloride, 7.5g Lysogeny broth agar agar, in 500mL water

Cell culture solutions 2.4 1.24g boric acid and 1.9g sodium tetraborate in 400mL of Borate buffer MilliQ water Poly-D-lysine coating 0.1mg/mL of Poly-D-Lysine in borate buffer Heat inactivated foetal FBS heat inactivated at 55°C for 30min bovine serum (HI FBS) High glucose DMEM, 10% HI FBS, 5mL Penstrep, 5ml L- HEK medium glutamine Hanks buffered salt 10x HBSS diluted to 1x in water for irrigation, adjusted to a solution (HBSS), 1x pH pH of 7.3 with NaOH 7.3

Plating medium DMEM with 10% HI FBS, filter sterilized Mouse primary neuron 2% B27 and 0.25% glutamax in Neurobasal Medium medium Laminin coating 2.5µg/mL of laminin diluted in 1x HBSS Optiprep MN gradient 1.06g/mL optiprep in 1x HBSS Motor neuron complete 2% B27, 1% glutamax and 0.1% BDNF in neurobasal medium medium

rAAV solutions 2.5 High glucose DMEM/ 10% heat-inacitvated FBS (30min, HEK medium 55C), 5ml PenStrep, 5ml Glut-L IMDM medium IMDM, 5% heat-inactivated FBS 281mM NaCl/100mM HEPES/1.5mM Na2HPO4 (pH 7.05- 2x HBS 7.09)

Virus storage solution 50 mM Tris (pH7.6)/150 mM NaCl 10X PBS MK 10mM MgCl2 and 25mM KCl in 10x PBS 56% Iodixinol gradient 108mL Optiprep, 90µL phenol red, 12mL 10x PBS MK (120mL) 40% Iodixinol gradient 80mL Optiprep, 12mL 10x PBS MK, 28mL sterile water (120mL) 25% Iodixinol gradient 62.5mL Optiprep, 90µL phenol red, 15mL 10x PBS MK, (150mL) 72.5mL sterile water 15% Iodixinol gradient 50mL Optiprep, 90µL phenol red, 20mL 10x PBS MK, (200mL) 100mL NaCl, 30mL sterile water Coomassie destain 30% methanol, 10% acetic acid, in MilliQ.

Western blot solutions 2.6 50mM Tris-HCl (pH 7.5), 1% Triton X100, 0.5% Sodium 1x RIPA deoxycholate, 0.1% SDS, 150mM NaCl, 1mM EDTA, 1mM EGTA, 1x Protease inhibitor, in ddH2O

50% 1M Tris, pH 6.8, 20% glycerol, 20% β-mercaptoethanol, 4x Sample buffer 10% of 20% SDS, bromophenol blue TBST 1x Tris buffered saline with 0.1% Tween20 BSA Blocking buffer 5% BSA in TBST Skim milk blocking 5% Skim milk powder in TBST buffer 3.33mL 30% acrylamide, 3.37mL 1M Tris pH 8, 2.71mL 10% Resolving gel MilliQ, 100µL 10% SDS, 75µL 10% APS, 4µL TEMED 4.15mL 30% acrylamide, 3.37mL 1M Tris pH 8, 1.9mL 12.5% Resolving gel MilliQ, 100µL 10% SDS, 75µL 10% APS, 4µL TEMED 266µL 30% acrylamide, 250µL 1M Tris pH 6.8, 1.45mL Stacking gel MilliQ, 20µL 10% SDS, 75µL 10% APS, 2µL TEMED Running buffer 10% Tris glycine (v/v), 3 mM SDS, in ddH2O. Transfer buffer 10% (v/v) 10 x Tris glycine, 20% methanol, in ddH2O.

Immunocytochemistry solutions 2.7 Permeabilisation 0.1% triton-X100 in 1x PBS solution Immunocytochemistry 2% FBS in 1x PBS blocking buffer

Immunohistochemistry solutions 2.8 Immunohistochemistry blocking buffer - 3% horse serum, 2% BSA in 1xPBS, filter sterilised Standard Immunohistochemistry blocking buffer - 3-5% H2O2, in 50% EtOH Peroxidase Destain 1% acetic acid, 70% EtOH Solution A 0.1M citric acid Solution B 0.1M sodium citrate tribasic dihydrate 9mL solution A, 41mL solution B, made up to 500mL with Citrate buffer ddH2O

Wholemount solutions 2.10 0.05M Tris-HCl pH 7.5, 0.15M NaCl, with 0.1% triton X- TBSTx 100 and 0.1% of sodium azide WhMount BB 10% horse serum diluted in TBSTx 50% (w/v) sucrose, 25% (w/v) urea, 10% (w/v) 2,2,2'- CUBIC R2 nitrilotriethanol and 0.1% (v/v) triton X-100

Table 2.5: Antibodies

Antibody Type Details Company ICC WB Anti α-tubulin Primary Mouse monoclonal IgG Sigma-Aldrich 1/10000 Anti β-3- tubulin Primary Mouse monoclonal IgG Sigma-Aldrich 1/500 Anti β-3- tubulin Primary Chicken polyclonal IgY Millipore 1/500 Anti C4 Actin Primary Mouse monoclonal IgG Abcam 1/500 Anti ChAT Primary Goat polyclonal IgG Millipore 1/100 Anti GFAP Primary Mouse monoclonal IgG Sigma-Aldrich 1/400 Anti Iba1 Primary Rabbit polyclonal IgG Wako 1/200 Anti MAP2 Primary Chicken polyclonal IgY Abcam 1/2500 Anti Parvalbumin Primary Rabbit polyclonal IgG Abcam 1/100 Anti p75NTR Primary Goat polyclonal IgG R&D system 1/250 Anti PFN1 Primary Rabbit monoclonal IgG Abcam 1/250 1/10000 Anti Tau1 Primary Mouse monoclonal IgG Millipore 1/200 Anti TDP-43 Primary Rabbit polyclonal IgG Proteintech 1/200 Anti V5 Primary Mouse monoclonal IgG Invitrogen 1/200 Mouse monoclonal; Anti V5-HRP Conjugated Invitrogen 1/10000 Conjugated to HRP

Anti Phalloidin; Conjugated to Conjugated Atto-Tec 1/500 Phalloidin-565 Atto-565

Anti Phalloidin; Conjugated to Conjugated Atto-Tec 1/500 Phalloidin-647 Atto-647

Donkey anti mouse IgG; Donkey anti Secondary Conjugated to Alexa Fluor Invitrogen 1/500 mouse 488 488

Donkey anti rabbit; Donkey anti Secondary Conjugated to Alexa Fluor Invitrogen 1/500 rabbit 488 488

Donkey anti mouse; Donkey anti Secondary Conjugated to Alexa Fluor Invitrogen 1/500 mouse 647 647

Sheep anti Sheep anti rabbit; Secondary GE healthcare 1/10000 rabbit HRP Conjugated to HRP

Sheep anti Sheep anti mouse; Secondary GE healthcare 1/10000 mouse HRP Conjugated to HRP

Table 2.6: Molecular biology

Enzyme Company Purpose EcoRI Takara Insertion of PFN1 gene insert into pLVX-IRES-puro NotI Takara Preparation of pEX12 vectors for blastocyst injection PmeI NEB Insertion of PFN1 gene insert into pHb9-IRES-EGFP PvuI Takara Preparation of pEX12 vectors for blastocyst injection SpeI Takara Insertion of PFN1 gene insert into pHb9-IRES-EGFP XbaI Takara Insertion of PFN1 gene insert into pLVX-IRES-puro XhoI Takara Insertion of PFN1 gene insert into pEX12 Preparation of pHb9-IRES-EGFP vectors for blastocyst injection Insertion of PFN1 gene inserts into pAM CBA

Table 2.7: Plasmids

Plasmid Source Reference (if applicable) pGEM-T easy Promega pLVX-IRES-puro Clontech pAM CBA Harasta et al., 2015 pEX12 Caroni, 1997 pHb9-IRES-EGFP Addgene Wilson et al., 2015

Table 2.8: Primers

Primer Name Primer Sequence 5’- GGgaattcATGggtaagcctatccctaaccctctcctcggtctcgattctacg V5-PFN1 Forward GCCG GGTGGAACGCCTACATC - 3’ PFN1 Amplification V5-PFN1 Reverse 5’- GGtctagaTCAGTACTGGGAACGCCGAAGG - 3’ V5-PFN1 for pHb9 F 5’- GGgtttaaacCACCATGggtaagcctatccctaacc - 3’ V5-PFN1 for pHb9 R 5’- GGactagtTCAGTACTGGGAACGCCGAAG - 3’ V5-PFN1 for pEX12 F 5’- GGctcgagCACCATGggtaagcctatccctaacc - 3’ V5-PFN1 for pEX12 R 5' - GGctcgagTCAGTACTGGGAACGCCGAAG - 3’ 5’- CACTTGGGGGCCAGAAAGGTTCGGTGATCCGGG - Site-Directed V5-PFN1 C71G F 3’ 5’- CCCGGATCACCGAACCTTTCTGGCCCCCAAGTG - Mutagenesis V5-PFN1 C71G R 3’ Sequencing T7 5’- AATACGACTCACTATAG - 3’ SP6 5’- ATTTAGGTGACACTATAG - 3’ pHb9seq_F1 5' - GTTTCCGGCTGCGACTTTATTG - 3' pHb9seq_IRES_R 5' - GCGGCTTCGGCCAGTAACG - 3' pEX12seq_F 5’- GTCCTACCAGCTGGCTGACC - 3’ pEX12seq_R 5’- CGTTTCTCCCCATGTTCTGAG - 3’ PFN1_F 5' - AACGCCTACATCGACAACCTCA - 3' PFN1 Genotyping PFN1_R 5' - CTCTTGGTACGAAGATCCATGC - 3'

Table 2.9: PCR settings

Amplification of PFN1 from cDNA, pGEM-Teasy or Colony screening Reagent Volume (µL) PCR Settings Water 14.95 95°C 3 min 1x dNTPs 1 95°C 50 sec Forward primer (10µM) 0.4 64°C 50 sec Reverse primer (10µM) 0.4 68°C 3 min 30x 10X buffer 2 68°C 10 min 1x cDNA 1 4°C Forever Pfu turbo (Thermoscientific) or Taq polymerase (Roche) 1 or 0.25 DNA 1

Site-directed mutagenesis Reagent Volume (µL) PCR Settings Water 13 95°C 30 sec 1x dNTPs 2 95°C 30 sec Forward primer (10µM) 1 64°C 1 min Reverse primer (10µM) 1 68°C 15 min 30x 10X buffer 2 4°C Forever Pfu Turbo (Thermoscientific) 1 DNA 1

PFN1 genotyping Reagent Volume (µL) PCR Settings Water 15.6 95°C 2 min 1x dNTPs 0.4 95°C 30 sec Forward primer (10µM) 0.4 64°C 30 min Reverse primer (10µM) 0.4 72°C 1 min 35x 10X buffer 2 4°C Forever Taq (Roche) 0.2 DNA from tail lysis 1

rAAV genomic titre qPCR

Reagent Volume (µL) PCR Settings Water 3 95°C 10 min 1x Forward primer (10µM) 1 95°C 15 sec Reverse primer (10µM) 1 60°C 1 min 40x SYBR green 10 95°C 15 sec Diluted virus 5 60°C 1 min 60°C 15 sec

Table 2.10: Software

Software Manufacturer National Institutes of 3D Slicer software Health Abobe Photoshop Adobe Adobe Illustrator Adobe Excel Microsoft Office GraphPad Prism GraphPad National Institutes of ImageJ Health Microplate Manager Bio-Rad Laboratories MxPro qPCR Agilent Technologies Neurolucida MBF Bioscience Neurolucida Explorer MBF Bioscience Word Microsoft Office

Animal handling and care

All animal experiments have been approved by the Animal Care and Ethics Committee of UNSW Sydney. Mice were group housed in individually ventilated cages on a 12h light/dark cycle and were housed in groups of 3 to 6 (Allentown, USA). Cages contained Anderson's 1/8th inch corn cob bedding (Tecniplast, Italy) and were enriched with wooden chew sticks, red transparent plastic houses and paper nesting material. The mice had access to water and chow containing 3.5g/kg omega-3 fatty acid derived from fishmeal ad libitum (Mouse Breeder Diet, Gordon’s Specialty Stockfeeds, Australia).

Mice that underwent stereotaxic injections were monitored daily for a week post injection, then twice a week until endpoint. Transgenic mice were monitored weekly until endpoint.

Molecular biology

Generation of plasmids

TRIzol was used to extract RNA from human embryonic kidney 293 cells (HEK293T) using TRIzol reagent (Life Technologies) and was transcribed to cDNA using the

SuperScript® VILOTM cDNA synthesis kit (Invitrogen) according to manufacturer’s instructions. Primers (Macrogen) were designed to amplify human PFN1 from cDNA with the addition of an N-terminal V5 epitope tag and flanking restriction enzyme sites.

PFN1 was amplified using Pfu Turbo DNA polymerase (Agilent) by polymerase chain reaction (PCR).

Point mutations were introduced into PFN1 in the pGEM-T easy vector following the manufacturer’s protocol (Promega). The c.211T>G nucleotide exchange that results in a

C71G amino acid switch was introduced by site-directed mutagenesis. Primers were designed to be between 25-45 bases long with the single point mutation in the centre,

the GC% was a minimum of 40 and the melting temperature ≥78°C. The mutations were introduced by PCR, followed by a nucleotide removal and a DpnI (Takara) digest to break down the methylated DNA. The mutation was confirmed by sequencing

(Macrogen).

The pLVX-IRES-puro vector (Promega) was used for the transient expression of V5-

PFN1Wt and V5-PFN1C71G in neurons. The V5-PFN1Wt and V5-PFN1C71G fragments were subcloned into pLVX-IRES-puro with EcoRI (Takara) and XbaI (Takara).

Plasmids for recombinant adeno-associated virus (rAAV) were generated by subcloning

V5-PFN1Wt and V5-PFN1C71G into pAM CBA (Harasta et al. 2015) with XhoI.

The pEX12 vector was used for the generation of the Thy1.2 mouse model (Caroni

1997). V5-PFN1C71G was subcloned into pEX12 with XhoI (Takara).

For the generation of the Hb9 mouse model, V5-hPFN1C71G was cloned into the PmeI and SpeI sites of the pHB9-MCS-IRES-EGFP (mHb9 promoter) [TJ#103], which was a gift from Thomas Jessell (Addgene plasmid # 16283) (Wilson et al. 2005).

The PFN1 inserts and the respective vectors were digested with restriction enzymes for

2h at 37°C and 300rpm in a thermomixer (Eppendorf). The restriction enzymes used were dependent on the sites within the multiple cloning sites of the vectors and the sites attached to the ends of the PFN1 inserts (see Table 2.6).Digested expression vectors and

PFN1 inserts were mixed with a 5x blue loading dye (Bioline) and run on a 0.8-1% 1x

Tris-acetate-EDTA (TAE) agarose gel with 0.1µg/mL of ethidium bromide, with a 1kb plus or 50bp DNA hyperladder (Bioline) used as a molecular weight marker.

Electrophoresis was run at 120V for 40-60min, before extracting bands with a

QIAquick Gel Extraction kit or imaged with BioDoc-it (UVP).

The purified, linearized vectors were then dephosphorylated with calf intestinal alkaline phosphatase (CIAP, Promega), according to manufacturer’s instructions for 30min at

37°C and 300rpm in a thermomixer (Eppendorf). A nucleotide removal kit (Qiagen) was used to remove the phosphatase and buffers.

Purified human PFN1 inserts were ligated into the linearized vectors using T4 DNA ligase (Thermoscientific). The 10µL reaction was incubated overnight at 4°C, in which the PFN1 inserts were ligated into the appropriate vectors.

Generation of V5-PFN1C71G transgenic mice

For the generation of the Thy1.2 transgenic mouse a fragment of DNA containing the

Thy1.2 promoter and V5-PFN1C71G encoding DNA was excised from pEX12 using NotI

(Takara) and PvuI (Takara).

A fragment containing the mHb9 promoter, V5-PFN1C71G encoding DNA, an IRES site followed by EGFP and a polyA sequence was obtained via XhoI (Takara) digestion of the pHb9-V5-PFN1C71G plasmid.

The fragments were purified for pronuclear injection. Fertilized C57Bl/6 oocytes were injected with the fragment for the generation of transgenic mice (Ittner and Gotz 2007).

Founders were identified by PCR. The purification of the fragments and pronuclear injections were carried out by Dr Fabien Delerue. One mouse line was successfully generated per construct (Thy1.2-V5-PFN1C71G and pHb9-V5-PFN1C71G) and expression levels of the mutant protein were analysed by immunohistochemistry.

Genotyping

Tails were lysed in alkaline lysis buffer in a thermomixer for 1h at 95ºC and 1,000rpm.

An equal volume of neutralisation buffer was added, and the samples were spun for

5min at 4ºC and 14,000rpm in a 5415 R centrifuge (Eppendorf). The DNA from the lysed tails was used for genotyping. Experiments in this Thesis on Thy1.2 V5-PFN1C71G mice were completed with heterozygous transgenic mice (Wt/Tg) and Wt littermates

(Wt/Wt). Experiments in this Thesis on Hb9 V5-PFN1C71G mice were completed with heterozygous transgenic mice (Wt/Tg) and Wt littermates (Wt/Wt).

Production of competent Escherichia coli

DH5-α, an engineered Escherichia coli (E.coli) line for optimum transformation efficiency (Hanahan et al. 1991), were made competent using an in-house protocol.

Briefly, an aliquot of DH5-α was grown in 5mL of sterile lysogeny broth (LB) overnight (37°C, 200rpm for a maximum of 16h). The following day this pre-culture was expanded into 500mL of LB and grown at 37°C until reaching an optical density

(OD) of 0.6, measured on a spectrophotometer. The bacteria were centrifuged at 3,000g and 4°C for 10min. The supernatant was removed, and the pellet was washed in 30mL of ice cold 50mL CaCl2 before another centrifugation step. This wash was repeated 3 times and each time the supernatant was discarded. After the final wash, the pellet was resuspended in 50mM CaCl2 and placed on ice for 1h, inverting the tubes every 10min.

The bacteria were pelleted again and were resuspended in 4.5mL of 50mM CaCl2 and

0.5mL of glycerol (Sigma-Aldrich). The bacteria were then aliquoted (0.1mL/1.5mL safe-lock tube), snap frozen in liquid nitrogen and stored at -80°C.

Transformation of Escherichia coli

Competent E.coli were put on ice to thaw for 10min before 50µL were aliquoted into pre-chilled 13mL round bottomed tubes (BD Bioscience). The 10µL ligation reaction was added to the bacteria and left to incubate on ice for 30min. The bacteria were heat- shocked in a water bath (Julabo) at 42°C for 45sec and put on ice to recover for 2min.

Super optimal broth with catabolite repression (SOC) (Bioline) was pre-warmed and

250µL were added to each transformation tube. The bacteria were incubated in an orbital shaker (Infors HT) at 37°C and 200rpm for 1h. The entire reaction was plated on

100µg/mL ampicillin (Sigma-Aldrich) or 100µg/mL kanamycin (Sigma-Aldrich) LB agar plates and incubated overnight at 37°C.

Plasmid amplification

Bacteria were grown in LB in an orbital shaker and incubated overnight at 37°C. A 5mL aliquot of bacteria was pelleted and then resuspended in 500µL of LB. The bacterial suspension was transferred to a pre-labelled screw top tube and 500µL of glycerol was added. The suspension was mixed and then stored at -80°C.

For the amplification of plasmids, a small amount of glycerol stock was scrapped with a pipette tip and added into a 13mL tube with 5mL of LB broth with either ampicillin or kanamycin. Bacteria for midi or maxi preparations were grown for 8h in the 5mL LB volume in an orbital shaker at 37°C. The pre-culture was transferred into a larger volume of LB with antibiotics, 150mL for midiprep and 250mL for maxiprep, and grown in an orbital shaker and incubated overnight at 37°C. Midi and Maxi preps were completed as per manufacturer’s instructions (Invitrogen). The purity and concentration of DNA was assessed with a ND-1000 Spectrophotometer (Nanodrop). DNA was considered as being pure if the ratio of A260/A280 was between 1.8 and 2.0.

Cell culture

Human embryonic kidney cells

Coverslips (ø 10mm, #1.0 thickness, glass; Menzel) were autoclaved and stored in sterile conditions before placing into 24-well plates (Corning). Coverslips were coated poly-D-Lysine coating (PDL, Sigma-Aldrich), by incubation with PDL overnight at

37°C and washed twice for 30min with sterile MilliQ water. HEK293T were cultured in

HEK medium on T75 flasks. When cells reached 70% confluency, they were passaged by detaching the cells with 1% trypsin EDTA (Sigma-Aldrich) and diluting them appropriately.

Mouse primary hippocampal and cortical neurons

Coverslips (ø 12mm, #1.5 thickness, glass; Menzel) were plated in 24-well plates

(Corning) and coated with PDL (Sigma-Aldrich) by incubating overnight at 37°C. The coverslips were washed 2x with sterile MilliQ water.

Hippocampal and cortical neurons were prepared from E16.5 embryos from C57Bl6 mice, as described previously (Fath et al. 2009). In brief, mice were euthanized by cervical dislocation. The embryos were removed from the uterus and embryonic sacs.

After the embryos were anaesthetized, the brains were removed with curved forceps

(Fine Science tools), and a sagittal cut was made to halve the brains. The meninges were peeled off using Dumont #5 forceps (Fine Science tools) and the midbrain was pinched off. The hippocampi were dissected out using ultra-fine micro-dissecting scissors (Fine science tools). The hippocampi were collected, and the cortex was broken into smaller pieces.

The tissue was then enzymatically digested at 37°C with 1x trypsin (Sigma-Aldrich); hippocampal tissue for 20min and cortical tissue for 40min. Deoxyribonuclease I

(DNase, Sigma-Aldrich) was added at a concentration of 1mg/mL to reduce clumping of cells. The hippocampal tissue was washed with DMEM, containing 10% FBS

(Thermo Fischer Scientific), before being triturated sequentially with fire-polished

Pasteur pipettes with wide and narrow openings. Cortical tissue was triturated in the

HBSS (Sigma-Aldrich) in the presence of trypsin and DNase as the larger pieces of tissue require a more extensive enzymatic digestion. Cells were then centrifuged to remove any debris and counted with a haemocytometer (Neubauer). Cells were plated in

DMEM with 10% FBS at a density of 7x104 cells per well on 24-well plates or 1.5x106 cells on a 6cm plate.

After 2h, the medium was changed to mouse primary culture medium. The cultures did not require any additional medium changes and were grown for up to 28 days in vitro

(DIV). The cells were maintained at 37°C and 5% CO2 in a humidified atmosphere.

Mouse primary motor neurons

Coverslips were coated with PDL as described in section 2.3.2 above and coated with

2.5µg/mL of Laminin (Invitrogen), diluted in HBSS and incubated overnight at 4°C.

Before the dissection, the plates were brought up to room temperature (RT).

Lower motor neurons were cultured from E13.5 embryos from C57Bl6 mice. In brief, the uterus, containing the embryos, was collected in 1x HBSS. The embryos were removed from the uterus and embryonic sacs and put on ice in fresh HBSS for 1min.

The heads and tails were removed, and the embryos were positioned with the dorsal side exposed. The skin from the embryos was removed to give access to the neural tube,

which was dissected out using two sets of Dumont #5 fine forceps. The meninges and dorsal root ganglia were removed, and the spinal cords were collected.

The neural tubes were incubated with 1x trypsin for 20min at 37°C. DNase was added to reduce clumping. The neural tubes were washed with 10mL of pre-warmed HBSS, then the tissue was left to settle before all but 1.5mL of the supernatant was removed.

The tissue was slowly dissociated to a single-cell suspension by sequentially triturating with fire-polished Pasteur pipettes with wide and narrow openings. The Pasteur pipettes were washed with a 3.5% bovine serum albumin (BSA) in 1x HBSS solution prior to commencing trituration, this prevented the delicate tissue sticking to the sides of the glass pipette. The cell suspension was added to a 3.5% BSA in 1x HBSS solution.

Cells were pelleted by centrifuging them at 120g for 10min. The supernatant was removed, and the cells were resuspended in 2mL of 1x HBSS. The suspension was then layered on top of OptiPrep motor neuron gradients and centrifuged at 400g for 25min.

The area of the interface between the HBSS and the OptiPrep gradient marked the area of concentrated motor neurons and was collected. The cells were centrifuged at 700g to pellet the cells, and the supernatant was removed. The cells were resuspended in motor neuron complete medium and counted with a haemocytometer and then plated at a density of 5x104 cells per well in 500µL motor neuron complete medium. At 2 DIV,

500µL of motor neuron complete medium was added. The cells were maintained at

37°C and 5% CO2 in a humidified atmosphere.

Lipofectamine transfections

Primary mouse hippocampal neurons were transfected with V5-PFN1-WT or V5-

PFN1-C71G in pLVX-IRES-puro and a control mNeongreen construct, at 3 with

Lipofectamine LTX (Life Technologies). Before transfection, 500µL of conditioned

medium were removed from the cells and transferred into an adjacent empty well. The lipid complex was prepared by adding 200ng of plasmid and 0.6µL of Lipofectamine®

LTX to 100µL of neurobasal medium and briefly vortexing. The complex was incubated at RT for 25min. 100µL were added to the well. After an hour, the medium was changed, using the conditioned medium set aside in the adjacent well.

Recombinant adeno-associated virus

Generation of recombinant adeno-associated virus

The generation of recombinant adeno-associated viruses (rAAV) was performed as previously described (Harasta et al. 2015). In brief, HEK293T cells were plated on

15cm dishes at 12x106 cells/dish on day 1. Five dishes were plated per virus. On day 2,

3 hours before the transfection, the medium was changed to IMDM, containing 5%

FBS. Cells were transfected using CaCl2. Plasmids were diluted in 6.3mL water (Sigma-

Aldrich), 125µg of packaging helper plasmid (pF∆6), 60µg of capsid plasmid (pNLrep) and 62.5µg pAM CBA, containing either GFP, V5-PFN1Wt, or V5-PFN1C71G. The mixture was vortexed and 700µL of 2.5M CaCl2 were added. The mixture was vortexed again and incubated at RT for 5min.

After incubation, 7mL of 2x HBS were added dropwise while vortexing the DNA and

CaCl2 complex. The mixture was then heavily vortexed until it had a slight cloudy appearance. 2.8mL were then added to each plate of cells. On day 3, 14-16hr post- transfection, the medium was changed to 20mL of HEK medium.

On day 5, 60-70 post-transfection, the virus was harvested. The medium was removed, and the cells were washed in 1x PBS. The cells were scraped down in 5mL of fresh 1x

PBS and centrifuged at 350g for 30min. The supernatant was removed, and cells were resuspended in 9mL of virus storage solution. 55

Next, the cells were lysed in preparation for purification. First, 500µL of 10% sodium deoxycholate (Sigma-Aldrich) and 2µL of benzonase (Sigma-Aldrich) were added to the cell suspension and incubated at 37°C for 30min. The mixture was inverted to mix sporadically. NaCl was added for a final concentration of 1M, then incubated at 56°C for 30min. To finish the lysis, 4 freeze-thaw cycles were completed. The lysed cells were pellets by centrifuging at 4,000g at 4°C for 30min. The supernatant, containing the virus, was collected and spun again.

Purification of recombinant adeno-associated virus

Four iodixanol solutions (54%, 40%, 25% and 15%) were prepared for the purification of the rAAVs. The solutions were carefully layered into quick seal ultracentrifugation tubes (Beckman Coulter). The 54% gradient was added to the tube first, followed by

40%, 25% and 15%. The virus solution was layered on top of the iodixanol layers and the tube was topped up with 1x PBS. The tubes were capped and carefully weighed to 4 decimal places. To separate the virus, the tubes were centrifuged in an Optima L-90K ultracentrifuge (Beckman Coulter) at 68,000 RPM and 18°C for 90 min. After centrifugation, the virus was concentrated in 40% iodixanol layer. The layers on top of the 40% layer were removed slowly, and the 40% layer was collected (~2.5mL).

The concentrated virus was transferred to an Amicon 100,000 MWCO Ultra-15 centrifugal filter units, topped up to 10mL with 1x PBS. The purified solution was centrifuged at 3,000g and 4°C for 10min. The flow through was discarded and the tube was topped up with 1x PBS before repeating the centrifugation. These steps were repeated until the volume, remaining in the concentration unit, was only 150-200µL. By this stage, all the iodixanol had been washed out and the purified virus was concentrated in 1x PBS. The concentrated virus was collected, then 200µL of 1x PBS was used to

wash down the sides of the concentrating unit and added to the concentrated virus. To ensure sterility, the concentrated virus (~400µL) was filtered through a 0.2µm syringe filter (13mm). At this stage the virus was aliquoted and stored at -80°C. To maintain the stability of the virus and viral capsid, freeze-thaw cycles were avoided and once thawed, aliquots of the virus were stored at 4°C for 2wk.

Testing purity of rAAV and calculating genomic viral titre

Purified rAAV was run on a 12.5% acrylamide gel, as outlined in section 2.6., until

100-50bp were separated. The gel was washed 3x in MilliQ to remove any salts from the running buffer. The gel was incubated in Coomassie Brilliant Blue (Sigma-Aldrich) at RT on a rocker (Ratek) for 30min, until bands became visible. The gel was then washed in Coomassie destain solution for 15-30min, until the background staining was removed, and the bands were visible. The gel was imaged on a Chemidoc (Bio-Rad

Laboratories).

Viral samples were prepared in duplicate. For the calculation of the viral load, 0.5µL of

DNaseI, 5µL of 10x DNaseI reaction buffer and 43.5µL of sterile water were added to

1µL of concentrated virus and incubated at 25°C for 15min. This removed unpackaged

DNA from the virus solution. To inhibit the DNase I activity, 1µL of

Ethylenediaminetetraacetic acid (EDTA) was added to the solution and incubated at

70°C for 10min. To break down the plasmid capsid, 0.5µg of Proteinase K (NEB) were diluted in 49.5µL of 1x PBS and added to the virus solution. The solution was incubated at 65°C for 1h, before being inactivated at 95°C for 20min.

Quantitative PCR was used to quantify the genomic titre of rAAV. After the processing of the virus, it had been diluted 1:100. For the calculation of the viral titre, the virus was

further diluted 1:20 and 1:50 in sterile water for final dilutions of 1:2,000 and 1:5,000.

Plasmids of pAM CBA were diluted and used as a standard for qPCRs. The volumes were calculated, using the ThermoFisher DNA copy number and dilution calculator

(https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular- biology/molecular-biology-learning-center/molecular-biology-resource-library/thermoscientific-web-tools/dna-copy-number-calculator.html). The concentrations of standards used were 1010, 108, 106, 104 and 102 copies of DNA.

For qPCR, the viral samples were analysed in duplicate and the standards in triplicate.

The PCR was carried out with primers outlined in Table 2.8 and with PCR settings in

Table 2.9. The titre was calculated by measuring the relative absorbance of the viral samples to the standards, using MxPRO software (Agilent Technologies).

Stereotactic rAAV injections in P0 mice

Viruses of a titre between 1x1013 – 1x1014 genomic copies per mL were used for P0 stereotactic injections. As the pups were injected on the day of birth (P0), the needle was able to pierce through the developing skull and into the brain. Pups were anaesthetised on ice prior to injections. The pup was placed on a pre-cooled piece of

Styrofoam surrounded by ice. Due to the size of the pup the pup was lined up to be injected by eye rather than by coordinates.

Once the pup was in place, 7µL of virus was drawn up into the syringe using the micropump (World Precision Instruments). The needle was inserted into the brain of the mouse pup in 3 different locations bilaterally as previously described (Ittner et al. 2016).

The injections sites were completely approximately 1mm either side on the sagittal suture, in the forebrain region (approximately 0.5mm anterior to bregma), in

cortical/hippocampal region (approximately 0.5mm anterior to lambda), and in the mid- hind brain region. In each location, 1µL of virus was injected at a rate of 33nL/sec.

After the injections, the pup was held by hand until the pup had warmed up to body temperature and began to move. Once the pup was moving, it was placed in a recovery cage that was on top of a heat mat set to 42°C.

Western blotting

Lysate harvest and tissue collection

Cells were grown to the appropriate DIV and the lysates were harvested. The lysates were harvested on ice to prevent protein degradation. The cell medium was aspirated, and the cells were washed twice in 3mL of 1x PBS. Excess 1x PBS was aspirated and

200µL of 1x RIPA were added to the dish. Cells were scraped down and collected.

Lysates were transferred to a pre-labelled safe-lock tube (Eppendorf), snap frozen in liquid nitrogen and stored at -80°C.

Adult mice were anaesthetised, and cardiac perfusions were performed. In brief, the mice received an intraperitoneal injection of 12.5mg/kg ketamine and 2.5mg/kg xylazine. Anaesthesia was assessed via toe pinch reflex, the animals were pinned by the fore and hind limbs, the rib cage was cut, and the heart was exposed. An 18G needle was inserted into the left ventricle, while simultaneously cutting the right atrium. A volume of 10mL of ice-cold phosphate buffered saline (PBS) was used to remove blood. The right hemisphere of the brain was collected, snap frozen in liquid nitrogen and stored at -80°C. Tissue was weighed and homogenised in 5x the weight of tissue in

1x RIPA buffer.

Sonication and protein measurement

Cell and tissue samples were sonicated with a Vibra-cell (Sonics). A Bradford assay

(Bio-Rad Laboratory) was performed to assess the protein concentrations of the samples. BSA standards were prepared in lysis buffer. The Bradford assay was run on samples and standards in triplicate, according to manufacturer’s details. The absorbance was measured on a SpectraMax plate reader (Bio-Rad Laboratories), and the concentrations were calculated by measuring the relative absorbance of the samples to the standards on Microplate manager software (Bio-Rad Laboratories). The lysates were diluted with 4x Sample Buffer, to a 1x dilution.

Western blotting

All blots were loaded with 5µL Precision Plus All blue standard (Bio-Rad Laboratories) in the leftmost lane. Cell and tissue lysates were loaded at equal total protein levels onto a 10 or 12.5% SDS-page gel prepared in 1.0mm glass plates (Bio-Rad Laboratories).

The gel was run until the appropriate level of separation of the proteins, based on the separation of the protein bands in the Precision Plus All blue standard lane. Proteins were transferred to a PDVF membrane (Millipore), using the Trans-Blot SD Semi-dry electrophoretic transfer cell (Bio-Rad Laboratories). The membranes were blocked in

5% BSA or 5% skim milk (Coles brand), diluted in TBST for 2h at RT.

The membranes were then probed with primary antibodies (see table 2.5), diluted in blocking buffer O/N at 4°C. Membranes were washed 2x 10min in TBST and 2x 10min in 1x TBS. Membranes were probed with secondary antibodies (see table 2.5), diluted in blocking buffer and incubated for 1h at RT. Membranes were washed again 2x 10min in TBST and 2x 10min in 1x TBS. Bands were visualized, using Luminata™ Crescendo

Western HRP substrate (Millipore) and a ChemiDoc™ MP System (Bio-Rad

Laboratory).

Immunocytochemistry

Cells were fixed for 20min in 4% PFA (ProSciTech) and washed twice with 1x PBS.

Coverslips were incubated with permeabilization buffer for 5 min, rinsed twice in PBS and blocked for 30min. Fixed cells were incubated for 1h at RT with primary antibodies

(see table 2.5), diluted in blocking solution. Coverslips were rinsed five times with 1x

PBS and incubated for 40min at RT with secondary antibodies (see table 2.5) and

DAPI, diluted in blocking solution. The coverslips were rinsed 5x in PBS, and coverslips were mounted onto Superfrost Plus white glass slides (ThermoFisher

Scientific) with Prolong Gold antifade mounting medium (Life Technologies).

Immunohistochemistry

Harvest of mice

C57Bl6 female mice were bred with Hb9 V5-PFN1C71G Wt/Tg males under a timed mating protocol. The time of plug check was considered as embryonic day 0.5 (E0.5).

Pregnant females were euthanised by cervical dislocation at E9.5-14.5, embryos were harvested, and immersion-fixed in cold 4% paraformaldehyde (PFA, Proscitech) for 90-

120min, depending on the age of the embryo. Postnatal day 0 (P0) pups were decapitated and immersion-fixed in 4% PFA for 24 hours.

Adult mice were anaesthetised, and cardiac perfusions were performed, as outlined in section 2.5.2. To remove blood and commence fixation, the mouse was perfused with

1x PBS then 4% PFA. Brains and spinal cords were collected, and immersion-fixed in

4% PFA for 24h before commencing processing.

Tissue processing and sectioning

Embryos and adult tissues were processed through an ethanol gradient then into xylene and paraffin. P0 pups were processed in a similar manner, except prior to processing, the pups were cut 4 times in cross-section. The samples were incubated at room temperature (RT) for 2 x 30min in 70% (w/v) Ethanol (EtOH) (Merck), 2 x 30 min in

96% EtOH, 2x 30min in 100% EtOH, 3x 1h in xylene (Thermo Fisher Scientific) and at

62ºC for 3x 80min in paraffin (Merck). The samples were embedded in paraffin in the appropriate orientation, with spinal cords being cut into 2mm block and embedded in a grid.Paraffin blocks were sectioned on a microtome (Leica) at 3µm for brains, 5µm thickness for spinal cords, embryos and P0. The sections were collected on Superfrost

Ultra Plus slides (Thermo Fisher Scientific) and allowed to dry at room temperature

(RT) overnight (O/N).

Immunohistochemistry

Sections were baked at 60°C for 2 hrs, then rehydrated for staining. The slides were incubated in xylene for 2x 10min, 100% EtOH for 2x 3min, 96% EtOH for 2x 3min,

70% EtOH for 2x 3min. The slides were then stored in water until staining.

For hematoxylin and eosin (H&E) staining, slides were immersed in hematoxylin

(Sigma-Aldrich) for 4min, dipped in destain solution for 10sec before being washed under running water for 10min. The sections were counterstained in eosin (HD

Scientific) for 10sec, dipped 3x in water and taken back through the EtOH gradient and xylene. Glass coverslips (HD Scientific) were mounted on the slides with DPX (Sigma-

Aldrich).

If the sections were to be used for antibody staining (both immunofluorescence and peroxidase), they were put through an antigen retrieval program in a vacuum histoprocessor (Milestone) in citrate buffer (see table 2.4). If the sections were to be used for peroxidase staining, they were blocked in an IHC peroxidase blocking solution for 40min at RT.

Sections for antibody staining were then blocked for 60min at RT in an IHC blocking solution. Primary antibodies were diluted in blocking solution and incubated O/N at

4°C. Slides were washed 3x with 1x PBS, before being incubated with secondary antibodies for 2h at RT.

Sections for immunofluorescence were washed 3x with 1x PBS and glass coverslips were mounted on the slides with Fluoromount-G (Southern Biotech).

Sections for 3,3’-Diaminobenzidine (DAB) staining were incubated with tertiary antibodies that were prepared 30-60min before use, by diluting the ABC elite kit

(Vector laboratories) 1:500 in 1x PBS. Sections were washed 3x in 1x PBS, and tertiary antibodies were incubated at RT for 1-2h.

The slides were washed 3x 1x PBS before the DAB chromogen mix was added and incubated at RT for 15min. The slides were washed in H2O with agitation for 5min. The slides were rinsed in 1x PBS and counterstained with hematoxylin. Slides were taken back through the EtOH gradient and xylene before being mounted with DPX and glass coverslips.

Imaging

Microscopy

Brightfield imaging of sections was completed on a BX51 (Olympus). Fluorescence imaging of sections and cells was completed on either a BX51 (Olympus) or Axioskop

40 (Zeiss). Confocal images were acquired on a FluoView FV1000 confocal microscope (Olympus), using the UplanSApo 60 x 1.35 NA oil immersion objective. Z- stacks were taken at 0.4µm intervals, with four images taken per cell. Whole embryos were imaged on an Eclipse TiE (Nikon).

Image analysis

All image analysis was performed on Neurolucida software or Fiji (Fiji is just ImageJ)

(Schindelin et al. 2012). Adobe Photoshop was used to combine images and prepare them for figures. Images for figures were cropped and compiled in Adobe Illustrator.

For the analysis of dendritic spines, spines from 20µm sections were counted at a distance of 50µm from the soma. Projections with a thin, stubby or mushroom spine shape were counted as dendritic spines.

For motor neuron counts on adult spinal cords, ChAT-positive neurons were counted per ventral horn. Spinal cords were embedded in a grid pattern to enable the identification of cervical, thoracic and lumbar regions. Cervical sections were identified by the pronounced ventral horns. Thoracic sections had a comparatively smaller cross- sectional area than cervical and lumbar sections, with a small grey area pattern. Lumbar regions were identified as having large ventral horns with a thin grey area adjacent to the central canal. Sacral sections were excluded.

Wholemount staining and lightsheet imaging

Embryos were washed in TBSTx, blocked in wholemount blocking solution for 4h at

RT, incubated with primary antibody O/N at RT with agitation.

Embryos were then washed 3x 2h with TBSTx at RT with agitation and incubated with secondary antibody O/N at RT with agitation. After incubation with the secondary they were washed 3x 2h with TBSTx at RT with agitation.

Embryos were mounted in low melting temperature agarose (Sigma-Aldrich), using a

3mL syringe with the end cut off. Prior to imaging, embryos were cleared for 24h at RT with CUBIC reagent 2 and gentle agitation.

The embryos were imaged on a Zeiss Lightsheet Z.1 with a 5x 0.16 NA clearing detection objective and 10x excitation objectives. The chamber was filled with CUBIC reagent 2 to match the refractive index of the specimen. Z-Stack images of the embryo were acquired at 0° and 180° with an interval of 3.86 mm.

Magnetic resonance imaging

Mice were perfused with 4% PFA as outlined in section 2.7.2.

Brains were imaged as previously described (Ke et al. 2015). Brains were immersed in

0.2 % v/v Gd-DTPA + 9 g/l NaCl/H2O solution for 24–48h at 21°C. This was to reduce

T1 relaxation time of the brain tissue. The brains were then transferred into a 1.3 mm

ID, 2ml Cryovial (Greiner) and submersed in Perfluoro-Polyether Fomblin™ 6Y for susceptibility matching. High-resolution anatomical imaging of the brain samples was performed in a 9.4-T Bruker BioSpec 94/20 Avance III micro-imaging system (Bruker).

This system was equipped with BGA-12S HP gradients with maximum strength 660 mT/m and slew rate 4570 Tm/s. It had a dedicated 15 mm Quadrature Receive/Transmit

RF-coil (Bruker) to optimize MR signal. An optimized, isotropic 3D Fast Low Angle 65

Shot (FLASH) pulse sequence protocol in coronal slice orientation was used for image acquisition. The protocol had the following major parameters: TE = 6ms, TR = 100ms,

FA = 40°, FOV = 15 × 15 × 8mm, matrix = 200 × 200 × 106, Image Resolution =

75μm3 (isotropic), Eff. Spectral BW = 51,020 Hz, Total acquisition time with 2 ADC averages: 1h and 10min per specimen.

Brains were extracted and fixed, then handed across to Andre Bongers and Marco

Gruwel. Marco Gruwel completed the preparation and imaging of the brains. We wish to thank Marco and Andre, as well as the National Imaging Facility.

Total brain volume and regional analysis was manually segmented using 3D Slicer software (NIH) (Fedorov et al. 2012).

Mouse testing

For all motor testing, mice were placed in the testing 1 hr prior to the commencement of testing for acclimatisation purposes.

RotaRod

RotaRod (Ugo Basile) was used as a measure of motor performance, as previously described (Ke et al. 2015). For the first motor testing at 1m old, the mice were subjected to two training days on the accelerating RotaRod, on the third day the time to fall was recorded and analysed. For mice 2m and older, no additional training sessions were completed. Acceleration mode on RotaRod (7-60rpm) was used over 120sec. Each mouse had 4 attempts per session and the longest time spent on the rotating wheel was taken for analysis.

Forelimb grip strength

Forelimb grip strength was measured using a grip strength meter (Chatillon, AMETEK)

(Fidler et al. 2011, Bodea et al. 2017). The animal held a thin metal wire with both fore 66

limbs and was pulled away by the tail in a horizontal direction. The highest force exerted after 5 attempts was taken for analysis.

Wire test

As a measure of strength endurance, the time for which the mice could hang inverted on a wire grid (Aldi) was measured. Mice were placed onto a wire grid, which was slowly inverted over a Perspex box, once all 4 paws were gripping the wire, as described previously (van Hummel et al. 2018). A training session was run on the morning of the test. Each mouse at training prior to the first time that they were challenged with the wire-test task. Two trials were performed per mouse, and the time taken for the mice to fall was measured with a maximum time of 180sec.

Pole test

The strength and coordination of the mice was tested with pole test. Mice were placed facing upwards at the top of a vertical pole (diameter 0.8cm by 47.5cm long). The challenge was for the mice to turn and descend the pole (van Hummel et al. 2018). The time taken to turn and descend was measured. A training session was run on the morning of the test. Each mouse at training prior to the first time that they were challenged with the pole test task. A maximum time of 120sec was imposed and mice that slipped or fell were given the maximum time. Mice were given 2 training sessions on the morning of the test. Mice completed 2 trials in the afternoon and the average time was analysed.

Beam test

As another test of strength and coordination, mice were challenged to cross a horizontal beam that was suspended over water in the bottom of a plastic tub (Garbuzova-Davis et al. 2001). The time taken to cross the beam was measured, with a maximum time of 67

120sec. A training session was run on the morning of the test. Each mouse at training prior to the first time that they were challenged with the beam test task. The number of adverse events (foot slips, resting on the belly, or slipping underneath the beam while still holding on) were measured. If a mouse fell off and into the water, it was given the maximum time. The mice had 2 trials on the beam in the morning of the test. During the test, the mice had 2 trials and the average time to cross was analysed.

Survival

Any deaths of Hb9 V5-PFN1C71G mice were recorded with the time and cause of death.

Ethics were approved by the Animal Care and Ethics Committee of UNSW Sydney. If the condition of mice deteriorated, the mice were ethically euthanised, in accordance with ethics approval. Mice that were ethically euthanised, or that were found dead in their cages, were used for the analysis of survival data.

Statistical analysis

Data was collected and organised on Excel (Microsoft) and analysed in GraphPad Prism

(GraphPad Software).

It was observed that some data did not have a Gaussian distribution. Consequently, normality of data was assessed using D’Agostino and Pearson omnibus normality test.

Data with two groups that had Gaussian distribution was analysed by student’s T-tests and non-Gaussian was analysed by a Mann-Whitney test. Data with more than 2 groups and across multiple time points was analysed with one-way ANOVA. Ratios of data were analysed with Chi-squared analysis and the appropriate degree/s of freedom. For example, when analysing the rate of failure on the beam test. Using a chi-squared analysis we can assess the likelihood of the increased % of fails is down to the only variable being tested, whether the mice are Tg or Wt. Assess the chi-squared value then

the probability that the increase in failures is dependent on the genotype, therefore there is only one degree of freedom in this case. Survival data were analysed with a log-rank

(Mantel-cox) test.

Chapter 3:

Pilot Studies on

PFN1C71G

3 Pilot studies on PFN1C71G

Introduction

Mutations in PFN1 were identified as a cause of familial ALS in 2012 (Wu et al. 2012).

Although cytoskeletal dysfunction had previously been implicated in ALS pathogenesis, the identification of these mutations directly linked the actin cytoskeleton to ALS pathology. The mutations identified by Wu and colleagues were all within the actin binding region of PFN1. Primary mouse motor neurons transfected with the ALS- associated PFN1 mutants had reduced axonal outgrowth and a reduced ability to bind to actin (Wu et al. 2012). As PFN1 is a crucial actin binding protein, an inability to bind to actin could impact a variety of neuronal functions, such as neurite outgrowth.

We know that PFN1 is vital for neurite outgrowth, especially by regulating the actin cytoskeleton in the growth cone (Lee et al. 2013). The role that PFN1 plays is not restricted to motor neurons. So why do these mutations cause ALS, a disease that seems to selectively cause the degeneration of motor neurons?

In 2015, our lab showed that ALS-associated PFN1 mutations have a significant impact on the morphology of hippocampal neurons (Brettle et al. 2015). Specifically, primary mouse hippocampal neurons, transfected with PFN1C71G, had increased dendritic outgrowth and arborisation, but no significant changes in axonal outgrowth. When taken with the results from Wu and colleagues, this indicated that ALS-associated PFN1 mutants have a neuronal subtype-specific impact (Wu et al. 2012, Brettle et al. 2015).

Some questions remained, such as: what impact does this mutation have in more mature neurons? Can we find evidence of a neurodegenerative hallmark, such as aggregation, in neurons expressing V5-PFN1C71G? How does the impact of PFN1C71G differ between hippocampal neurons and motor neurons?

Mouse models of fALS are essential for understanding the molecular pathogenesis. The generation of novel mouse models, achieved by injecting recombinant adeno-associated virus (rAAV) into postnatal mice, provides a valuable tool to dissect out disease pathogenesis. The spread of virus in animals can be controlled, depending on the time after birth when the injections are done, injection sites and the serotype of the virus

(Aschauer et al. 2013, Chakrabarty et al. 2013, Dirren et al. 2014, Ayers et al. 2015).

The first C9ORF72 mouse model was generated using rAAV. These mice showed TDP-

43 positive inclusions, cortical neuron loss as well as behavioural and motor deficits at

6m of age (Chew et al. 2015). Mice with UBQLN2 mutations were also generated using rAAV technology. These mice presented with a clasping phenotype and motor deficits at 3-4m old and had mutant UBQLN2 in insoluble brain lysate fractions (Ceballos-Diaz et al. 2015). In this way, rAAV injections provide a fast and efficient protocol for the generation of novel mouse models.

The first results Chapter of this Thesis aimed to explore the impact of PFN1C71G on cultured hippocampal neurons. The second aim was to establish tools to further investigate the role of PFN1 in ALS. The final aim was to characterise a novel rAAV and Thy1.2 promoter-driven mouse model of ALS expressing mutant PFN1.

Results

ALS-associated PFN1 increases spine formation and results in PFN1

aggregation in primary hippocampal neurons

Our laboratory previously showed that hippocampal neurons transfected with V5-

PFN1C71G had increased dendritic outgrowth and arborisation (Brettle et al. 2015).

These cells also had sporadic incidences of aggregation of PFN1 in neurons transfected with V5-PFN1C71G (Brettle et al. 2015). To assess how common these aggregations were, we analysed what proportion of hippocampal neurons transfected with V5-

PFN1C71G presented with aggregation and whether these aggregates were positive for

TDP-43. Previously, Wu and colleagues showed that PFN1 aggregation could induce

TDP-43 aggregation in N2A cells (Wu et al. 2012). Hippocampal cultures were transfected at 3 DIV with V5-PFN1Wt or V5-PFN1C71G. Cells were fixed at either 4 or 5

DIV and stained for TDP-43 (green) and V5 (red) (Fig 3.2.1.1. A-D). The arrow shows an area of V5-PFN1C71G aggregation (Fig 3.2.1.1. B), which is negative for TDP-43 (Fig

3.2.1.1. C). TDP-43 maintains a nuclear localisation despite the presence of PFN1 aggregation. A total of 468 neurons expressing V5-PFN1Wt, and 214 neurons expressing

V5-PFN1C71G, were analysed for the presence of PFN1 aggregation. No aggregation was found in neurons expressing V5-PFN1Wt. Although only 6 neurons (2.8%) expressing V5-PFN1C71G had aggregation, this was significant when analysed with a chi-squared test (Table 3.1). This test showed that there was less than a 0.01% chance that the aggregation was independent of the expression of V5-PFN1C71G. Although V5-

PFN1C71G induced PFN1 aggregation in hippocampal neurons, no cytoplasmic inclusions of TDP-43 were found.

Figure 3.2.1.1. Spontaneous aggregates of mutant V5-PFN1C71G showed no immunoreactivity with TDP-43

3.2.1.1 Hippocampal neurons were analysed at 4 and 5 DIV for the presence of protein

aggregates. Shown is an example of a neuron (4 DIV) expressing V5-PFN1C71G. Note

that the V5 positive inclusion is not positive for TDP-43 (arrow in insert).

Scale bars = 20µm. (Brettle et al., 2015)

Table 3.1: Profilin 1 aggregation

Wt C71G Aggregation V5-PFN1 V5-PFN1 Total Chi squared Normal 468 208 676 Value 13.237 With Aggregates 0 6 6 Probability ≤0.0001 Total 468 214 682 % with aggregates 0 2.804

We next investigated the impact of V5-PFN1C71G on mature hippocampal cultures.

Hippocampal cultures were transfected at 3 DIV with cell filler mNeonGreen alone or in combination with V5-PFN1Wt, or V5-PFN1C71G. Cultured neurons were fixed at 19

DIV to allow for mature cultures to develop dendritic spines and were stained for V5

(Fig 3.2.1.2. A-F). mNeonGreen (green) and V5 (red) were imaged on a FluoView

FV1000 confocal microscope. Images were taken with the UplanSApo 60 x 1.35NA oil objective. Cells analysed in this study fit the profile of pyramidal neurons, as they were multipolar with 3-8 dendrites per cell. Image J was used to analyse the number of spines in 20µm long segments of dendrites, 50µm from the soma. Analysis of dendritic spine density showed that neurons expressing V5-PFN1C71G had a significantly higher density when compared to V5-PFN1Wt and mNeonGreen controls (Fig 3.2.1.2. G). Data were analysed with one-way ANOVA and graphed with SEM (**p≤0.01). Expression of V5-

PFN1C71G impacts the morphology of young developing neurons, as well as the dendritic spine density of mature hippocampal neurons in vitro.

Figure 3.2.1.2. Mutant PFN1 increases dendritic spine density in hippocampal neurons

3.2.1.2 Hippocampal neurons expressing NeonGreen alone, or in combination with V5-

PFN1Wt or V5-PFN1C71G, were analysed at 19 DIV for dendritic spine density (A-F).

Dendritic spine density was significantly increased in neurons expressing V5-

PFN1C71G, compared with V5-PFN1Wt and NeonGreen controls (G). Analysed with

one-way ANOVA; **p≤0.01; graphed with SEM. Scale bars = 20µm. (Brettle et al.,

2015)

Characterization of motor neuron cultures

To assess the impact of PFN1C71G in different neuronal subtypes, a motor neuron culture was established in the laboratory. Morphology of the neurons was analysed to ensure that they had a motor neuron morphology consistent with other published protocols

(Wiese et al. 2010, Conrad et al. 2011, Southam et al. 2013). Motor neurons were cultured, and fixed at 2 and 3 DIV. The cultures were stained with β-3 tubulin (green; neuronal specific) and Map2 (red) (Fig 3.2.2.1. A-B). Motor neurons were enriched in the culture and had a striking appearance. Properties included a large soma, 4-8 short dendrites and a distinct, long axon (Fig 3.2.2.1. A-B). Analysed motor neurons showed the extent of dendritic and axonal growth between 2 and 3 DIV (Table 3.2). Growth of the primary axon was particularly characteristic of motor neurons, with a growth of over

200µm in 24 h of culture (Table 3.2). The cultures were stained for different neuronal markers and confirmed as motor neurons (data not shown; refer to Honours Thesis,

Dominic Jean-Richard Dit Bressel, 2015). The cultured primary mouse motor neurons had a morphology similar to other published models.

Figure 3.2.2.1. Cultures have an enrichment of neurons with a typical motor neuron morphology

3.2.2.1 Motor neuron cultures were fixed at 4 DIV and stained for β-3 tubulin (green) and

MAP2 (red) (B). Tubulin was used to visualise the morphology of the cells (A). Scale

bar = 20 µm.

Table 3.2: Motor neuron culture

2 DIV 3 DIV

Primary Axon 131.33 ± 359.27 ± length (µm) 27.2 46.95 Dendrite 5.17 ± 0.17 5.6 ± 0.51 number Primary Dendrite 25.67 ± 2.47 31.77 ± 2.82 Length (µm) Cell body 16.21 ± 1.24 20.76 ± 1.27 Diameter (µm)

Characterisation of recombinant adeno-associated viruses for use in vitro

and in vivo

Lipofectamine transfection methods were useful for preliminary studies on the impact of PFN1C71G but had limitations due to a low transfection efficiency. Transduction of neuronal cells with rAAVs yields a higher efficiency (Howard et al. 2008). To further investigate the impact of V5-PFN1C71G, we generated rAAVs to express either V5-

PFN1Wt or V5-PFN1C71G. First, we confirmed successful purification of viral particles by running the purified virus and crude virus on a 12.5% SDS page gel. Staining of the gel with Coomassie revealed a dark band at 62kDa, and two higher lighter bands at 72 and 87kDa, indicating the presence of viral particles (Fig 3.2.3.1. A).

Next, we aimed to address whether these rAAVs would express in primary cortical neurons. These neurons were transduced at 0 DIV and lysed at 16 DIV. Expression of

V5-PFN1Wt or V5-PFN1C71G was analysed by Western blot. Expression of the rAAV was confirmed using V5 and PFN1 antibodies. A noticeable increase in PFN1 expression was observed in the transduced samples when compared with the non- transduced control samples (expressing endogenous profilin) (Fig 3.2.3.1. B). Blots show that cells transduced with V5-PFN1Wt or V5-PFN1C71G rAAV overexpress PFN1 and express V5, when compared to control cells (Fig 3.2.3.1. B). Actin and α-tubulin were used as loading controls Results show that the rAAVs expressed V5-PFN1Wt or

V5-PFN1C71G in primary cortical neurons in vitro.

Figure 3.2.3.1. PFN1 overexpression and V5 expression in vitro in primary cortical neurons

3.2.3.1 AAVs were purified, run on a gel and stained with Coomassie blue to confirm the

presence of viral particles at 87, 72 and 62 kDa (A). Primary cortical neurons were

transduced with AAV and harvested at 16 DIV. Overexpression of PFN1 and

expression of V5 was confirmed by western blotting of cell lysates (B). Actin and

tubulin were loading controls (B).

Next, we sought to confirm the expression of V5 via immunocytochemistry. Infective titres of rAAVs were investigated on cortical neurons in collaboration with other laboratory members (see Honours Thesis, Dominic Jean-Richard Dit Bressel, 2015).

Cortical neurons were transduced with a high titre of rAAV on the day of plating (0

DIV), fixed at 5 DIV and stained for V5 (green) and β-3 tubulin (red). Images were taken on a Zeiss Axioskop 40 with a 20x objective. We confirmed V5 expression in cortical neurons transduced with V5-PFN1Wt rAAV (Fig 3.2.3.2.).

Figure 3.2.3.2. V5 expression in vitro in primary cortical neurons

3.2.3.2 Primary cortical neuron cultures were either not transduced or transduced at 0 DIV

with V5-PFN1Wt rAAV. Cells were fixed in 4% PFA at 5 DIV and stained for V5

(green) and β-3 tubulin (red). V5 expression was observed in neurons transduced with

V5-PFN1Wt (A-F). Scale bar = 10 µm.

To validate the expression in primary motor neurons, cultures were transduced with V5-

PFN1Wt or V5-PFN1C71G on the day of plating. Cultures were fixed at 14 DIV with 4%

PFA and stained for β-3 tubulin (green) and V5 (red). Images were taken on a Zeiss

Axioskop 40 with a 20x objective. We confirmed that transduced primary motor neurons were positive for V5-PFN1Wt and V5-PFN1C71G (Fig 3.2.3.3.). 81

Figure 3.2.3.3. AAV expression in vitro in primary motor neurons

3.2.3.3 Primary motor neuron cultures were transduced 0 DIV with V5-PFN1Wt or V5-

PFN1C71G and fixed in 4% PFA at 14 DIV. Cells were stained for β-3 tubulin (green)

and V5 (red). V5 expression was observed (A-F). Scale bar = 20 µm.

No evidence of cytoplasmic inclusions was found in primary motor neurons

expressing V5-PFN1C71G

After the validation of the motor neuron culture and rAAVs, they were used for some functional analysis in a collaborative study (see Honours Thesis, Dominic Jean-Richard

Dit Bressel, 2015). In this Thesis, we investigated whether motor neurons expressing

V5-PFN1C71G presented with cytoplasmic TDP-43 localisation. Motor neurons were transduced with V5-PFN1Wt or V5-PFN1C71G rAAVs on the day of plating. Motor neurons were fixed at 14 DIV and stained for TDP-43 (green) and V5 (red). In both conditions, TDP-43 maintained a nuclear localisation (Fig 3.2.4.1. A-H). No evidence of TDP-43 pathology was found in motor neurons expressing V5-PFN1C71G.

Expression of V5-PFN1 in rAAV mouse model

Stereotactic injections of rAAVs (GFP, V5-PFN1Wt, V5-PFN1C71G) were completed on

C57Bl/6 mice at P0. Brains were collected from PBS perfused Wt and transgenic animals at 3m old, and half the brain was snap frozen. Tissue was homogenised in

1xRIPA buffer and expression of V5 was confirmed by western blotting of brain lysates

(Fig 3.2.5.1. A). Expression of V5 was observed in brain homogenates from V5-PFN1Wt and V5-PFN1C71G rAAV mice, whilst no V5-expression was observed in GFP rAAV mice (Fig 3.2.5.1. A). The expression of V5-PFN1C71G appeared to vary between different mice. The other half of the brain was fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Sections were stained for

V5 and imaged on a Zeiss Axioskop 40 with a 20x objective. Brain sections from mice injected with V5-PFN1Wt and V5-PFN1C71G were positive for V5 (Fig 3.2.5.1. B-G). We confirmed the expression of V5 in the cortex of rAAV injected mice.

Figure 3.2.4.1. Cytoplasmic inclusions of TDP-43 were not found in primary motor neurons expressing V5-PFN1C71G

3.2.5.1 Primary motor neuron cultures were transduced 0 DIV with V5-PFN1Wt or V5-

PFN1C71G rAAV and fixed in 4% PFA at 14 DIV. Cells were stained for TDP-43

(green) and V5 (red). No cytoplasmic inclusions of TDP-43 were observed (A-H).

Scale bar = 20 µm.

Figure 3.2.5.1. V5-PFN1 expression in the brains of rAAV injected mice

3.2.5.2 Expression of V5-PFN1Wt and V5-PFN1C71G in rAAV injected mice was confirmed by

western blotting of brain lysates (A). Sections were stained for V5-PFN1 (red). No

V5-PFN1 expression was observed in the cortex of GFP AAV injected mice (B, E).

V5-PFN1 expression was observed in the cortex of V5-PFN1Wt and V5-PFN1C71G

AAV injected mice (C, D, F, G). Scale bar = 50 µm.

rAAV mouse model of PFN1/ALS did not generate a motor phenotype

Motor performance of mice injected with rAAV (GFP, V5-PFN1Wt, or V5-PFN1C71G) at

P0 was analysed at 6wk and 3m old. Mice were challenged with accelerating rotarod to assess coordination and motor performance. There was no significant difference in the latency to fall in any group at either 6wk or 3m old (Fig 3.2.6.1. A, B). Fore limb grip strength of mice was tested, and there was no significant difference between any group at either 6wk or 3m old (Fig 3.2.6.1. C, D). When the strength and endurance of the mice was tested with a hanging wire test, significant difference was detected between any group at 6wk or 3m old (Fig 3.2.6.1. E, F). Data with Gaussian distribution were analysed with ordinary one-way ANOVA (A-D), data with non-normal distribution were analysed with a Kruskal-Wallis test (E, F), and graphed with SEM. Despite mice expressing V5-PFN1C71G, no motor deficits were found at 6wk or 3m old.

Figure 3.2.6.1. V5-PFN1 rAAV mouse models exhibit no significant motor difference in

RotaRod, grip strength or wire test

3.2.6.1 Mice were challenged with accelerating RotaRod (A and B). Strength of forelimb grip

was tested (C and D). Mice were challenged with wire test (E and F). Data analysed

showed no significant difference between the three groups of mice; eGFP, V5-PFN1Wt

or V5-PFN1C71G AAV in any test of motor performance (A-F). Gaussian data were

analysed with ordinary one-way ANOVA (A-D), and data with non-normal

distribution (Wire) were analysed with a Kruskal-Wallis test (E, F). N = 7-13 animals

per group; graphed with SEM.

Table 3.3: Significance summary for rAAV PFN1/ALS mice

6wk 3m Significance Summary sig p-value sig p-value GFP vs V5-PFN1 Wt ns 0.5904 ns 0.5249 RotaRod GFP vs V5-PFN1 C71G ns 0.7675 ns 0.3735 V5-PFN1 Wt vs V5-PFN1 C71G ns 0.8994 ns 0.9857 GFP vs V5-PFN1 Wt ns 0.8800 ns 0.8707 Grip Strength GFP vs V5-PFN1 C71G ns 0.8245 ns 0.7028 V5-PFN1 Wt vs V5-PFN1 C71G ns 0.4781 ns 0.3463 GFP vs V5-PFN1 Wt ns >0.9999 ns >0.9999 Wire Test GFP vs V5-PFN1 C71G ns 0.3564 ns 0.1995 V5-PFN1 Wt vs V5-PFN1 C71G ns 0.3110 ns 0.1667

Thy1.2 V5-PFN1C71G transgenic mice do not express the transgene

To study the impact of V5-PFN1C71G expression in vivo, we generated a novel mouse model. A Thy1.2 promoter was used to drive pan-neuronal expression of V5-PFN1C71G

(Fig 3.2.7.1. A-D) (Caroni 1997). The generation of Thy1.2 V5-PFN1C71G transgenic mice was confirmed with genotyping, a positive band indicated a transgenic mouse (Fig

3.2.7.1. E).

Figure 3.2.7.1. Thy1.2 plasmid maps and genotyping

3.2.7.1 V5- PFN1C71G was inserted into pEX12 at the XhoI restriction enzyme site (A). The

preservation of C71G mutation was confirmed by sequencing (B, C). The schematic

shows the Thy1.2 promoter that will drive neuronal specific expression of V5-

PFN1C71G (D). Mice were confirmed as transgenic with a genotyping PCR, with

transgenic mice showing a positive band (E).

Brains and spinal cords from Wt and transgenic Th1.2 mice were collected from PBS perfused Wt and transgenic animals at 3m old. Half the brain was sub dissected, then brain regions and spinal cords were snap frozen. Tissue was homogenised in 1xRIPA buffer. Western blotting of lysates form brain regions and spinal cords was completed, and membranes were probed for PFN1 and V5 (Fig 3.2.7.2. A). Elevated levels of PFN1 were not detected, and no V5 expression was detected in any tissue from transgenic

Thy1.2 V5-PFN1C71G. Although a double band was detected in the hippocampus of both

Wt controls and transgenic mice, it is not evidence of overexpression.

Figure 3.2.7.2. Thy1.2 V5-PFN1C71G transgenic mice do not express V5 or overexpress

PFN1

3.2.7.2 Brains and spinal cords were collected from PBS perfused Wt and transgenic (Tg)

animals at 5 weeks old and sub dissected. Tissue was homogenised in 1xRIPA buffer

and 100µg of protein was loaded into each well. No V5 expression or PFN1

overexpression could be found in the cerebellum (CB), hippocampus (Hip), cortex

(CTX), midbrain (Mid), brain stem (BS) or spinal cords (SC) of Wt or Tg mice (A, B).

The other half of the brain was fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Sections were stained for PFN1 (green) and V5 (red). Images were taken on a Zeiss Axioskop 40 with a 20x objective. Brain sections from Wt and transgenic showed no expression of V5 (Fig 3.2.7.2. A-R).

Although transgenic Thy1.2 V5-PFN1C71G mice were generated with pronuclear injections, no expression of the transgene was detected.

Figure 3.2.7.3. Thy1.2 V5-PFN1C71G transgenic mice do not express V5-PFN1C71G

3.2.7.3 Brains were collected from perfused Wt and transgenic (Tg) animals at 5 weeks old.

All tissue was fixed in 4% PFA, processed through an ethanol gradient and xylene,

paraffin embedded and sectioned. Wt and Tg tissues were stained for V5. Sections

were imaged on an Olympus BX51. Results show no positive staining for V5 in the

brainstem, cortex or hippocampus of Wt or Tg animals (A-R). Scale bars = 50 µm.

Discussion

Analysis of the effect of V5-PFN1C71G expression in different neuronal subtypes is beneficial when trying to determine the role of mutant PFN1 in ALS pathogenesis. Our lab has shown that V5-PFN1C71G expression has a differential impact on cultured hippocampal neurons and motor neurons. Hippocampal neurons expressing V5-

PFN1C71G have increased dendritic complexity, with no change in axonal outgrowth

(Brettle et al. 2015). On the other hand, motor neurons have decreased dendritic and axonal outgrowth (Wu et al. 2012, Jean-Richard Dit Bressel 2015). Our study has shown that expression of V5-PFN1C71G significantly increases dendritic spine density in mature cultured hippocampal neurons (Fig 3.2.1.2.). Over 50% of ALS patients present with some cognitive impairment, which adds to the heterogeneity of ALS (Phukan et al.

2012, Gordon 2013). Reduction in hippocampal volume is present in ALS patients and this reduction has been emulated in a TDP-43 mouse model of ALS (Abdulla et al.

2014, Ke et al. 2015, Machts et al. 2018). Patients analysed with fMRI were shown to have an increase in hippocampal activity over time, despite having a decrease in motor performance (Stoppel et al. 2014), which could be due to increased spine density or activity. Future studies could characterise the morphological and electrophysiological profiles of different neuronal subtypes, expressing ALS-associated mutants. This would help to elucidate the physiological impact of ALS mutants on the circuitry of the brain, and why motor neurons are so susceptible to death in ALS.

This Thesis shows that only a small percentage (2.8%) of cultured hippocampal neurons, expressing V5-PFN1C71G presented with aggregates (Table 3.1). These cells did not have TDP-43 pathology (Fig 3.2.1.1.). The study that identified ALS-associated

PFN1 mutants in 2012, showed that 60% of N2A cells transfected with V5-PFN1C71G presented with aggregates (Wu et al. 2012). There was no evidence of TDP-43 positive 93

cytoplasmic inclusions in our cultured motor neurons transduced with V5-PFN1C71G

(Fig 3.2.4.1.). However, there appeared to be some evidence of an altered staining pattern in cells transduced with V5-PFN1C71G. This difference requires further analysis of the levels of TDP-43 in the nucleus and cytoplasm of cells expressing V5-PFN1C71G.

We have completed this analysis in the in vivo model presented in Chapter 5. However,

Wu and colleagues found that cultured motor neurons transfected with V5-PFN1C71G presented with TDP-43 positive cytoplasmic inclusions (Wu et al. 2012). This difference could be associated with different expression levels, i.e., a higher expression could have a more pronounced effect on aggregation. The transfection or transduction method could also impact cell health, but this is hard to interpret without a corresponding nuclear marker in the Wu and colleagues’ study (Wu et al. 2012).

We validated a newly established motor neuron culture in our laboratory (Fig 3.2.2.1.)

(Table 3.2) and characterised the expression of in-house-produced rAAVs, expressing

V5-PFN1Wt and V5-PFN1C71G (Fig 3.2. 3.1-3.). Protocols for the enrichment of motor neurons from embryonic spinal cords were tested, and aspects from each were combined to generate an improved and cost-effective protocol. The resulting protocol is based on modified protocols, reported by different publications: (Fath et al. 2009, Wiese et al. 2010, Conrad et al. 2011, Southam et al. 2013). The resulting cultures had neurons with motor neuron morphology, which was in line with that presented by Wiese and colleagues (Wiese et al. 2010). By 3 DIV, the axons of motor neurons in our laboratory were 359.27µm ± 46.95 in length. This is similar to the axons of motor neurons in the

Wiese study, that measured 500µm at 7 DIV (Wiese et al. 2010). These cultures and the rAAVs generated in our laboratory, are tools that are now being utilised by other lab members for in vitro studies. Due to the time constraints, no further in vitro studies were

carried out in the context of this project. The remaining data in the Thesis will be concerning the generation of novel ALS mouse models expressing V5-PFN1C71G.

As rAAV mouse models are a valuable tool to study disease pathology, we generated a cohort of mice to study the impact of V5-PFN1Wt or V5-PFN1C71G expression in vivo.

Behavioural testing at 6wk and 3m old showed that mice expressing V5-PFN1C71G had no motor deficits when challenged on RotaRod, hanging wire test or fore-limb grip test

(Fig 3.2.6.1.). Although rAAV mouse models can present with a motor phenotype within 3m (Ceballos-Diaz et al. 2015), it can take longer for the phenotype to develop

(Chew et al. 2015). Another potential problem is the level and reproducibility of mutant

PFN1 expression. The first PFN1 /ALS mouse model publication showed that symptom onset had an expression dependent relationship (Yang et al. 2016). One of the limitations of rAAV mouse models is the variability of expression in each individual mouse. The western blots of the rAAV mice show that V5-PFN1C71G mice had variable expression of the mutant protein. Although this was not quantified, there are two possible reasons for this variability. The first is that the expression pattern generated in the rAAV mice was variable, the second is that the mutant protein had an increased turnover due to the instability of the protein. The generation of rAAV transduced mice was completed concurrently with the generation of the Thy1.2 and Hb9 mouse models.

Due to the presentation of a phenotype in the Hb9 V5-PFN1C71G mouse model (to be presented in Chapter 4 and 5), the rAAV mouse model was not repeated as these mice presented with no motor deficit in the preliminary study.

We generated a Thy1.2 mouse model to study the impact of V5-PFN1C71G, when expressed in a pan-neuronal setting. We confirmed the genotype of transgenic mice by

PCR (Fig 3.2.7.1.). However, when analysing expression levels of PFN1 and V5

(Fig3.2.7.2-3.), no expression of the transgene was detected. A limitation of this study was the lack of densitometric analysis of PFN1 levels in the Thy1.2 V5-PFN1C71G mice.

When no expression of V5 was detected and PFN1 was not discernibly expressed, we decided to move on to the other mouse model that had been generated. Due to the timeline of this Thesis, the generation of the Thy1.2 V5-PFN1C71G-expressing mouse model was not further pursued.

A more recent publication reported a Thy1.2 promoter-drivenV5-PFN1C71G-expressing mouse model that presented with motor deficits and paralysis (Yang et al. 2016). The age of symptom onset for these mice was reduced with a homozygous expression of

V5-PFN1C71G driven by the Th1.2 promoter, indicating that the level of V5-PFN1C71G overexpression is linked with the aggressiveness of the disease (Yang et al. 2016). The model that we proceeded within this Thesis is the subject of the next two Chapters, the

Hb9 V5-PFN1C71G mouse line.

Chapter 4:

Developmental

Characterisation of

Hb9 V5-PFN1C71G mice

4 Developmental characterisation of Hb9 V5-PFN1C71G mice

Introduction

PFN1 has an impact on a variety of cellular functions, such as cell division, neurite outgrowth and cell migration (for a review see (Witke 2004)). PFN1 KO mice are embryonically lethal and do not progress past blastocyst stage (Witke et al. 2001), thus showing that PFN2a cannot compensate for PFN1 during development. However, heterozygous PFN1 KO mice are viable and do not present with any abnormalities in brain development (Witke et al. 2001). Conditional PFN1 KO mice are viable and can be used as tools to dissect out the specific role of PFN1 in development (Kullmann et al.

2012). The role of PFN1 in cell migration has been extensively studied with regards to cancer biology (Bae et al. 2009, Ding et al. 2014, Cheng et al. 2015), but also in development (Kullmann et al. 2012). Specifically, PFN1 is important for radial cerebellar granule cell migration (Kullmann et al. 2015). In the developing hippocampus, activation of the sonic hedgehog signalling pathway results in increased levels of PFN1 and increased axon elongation (Yao et al. 2015). The overexpression of

ALS-associated PFN1 mutants has been shown to reduce axonal outgrowth in primary motor neurons (Wu et al. 2012). In primary hippocampal neurons, the expression of

PFN1C71G resulted in an increased dendritic outgrowth, whilst not impacting axonal outgrowth (Brettle et al. 2015). PFN1 is the main profilin isoform present during development and has also been implicated in the developmental neurological disorder

Fragile X (Michaelsen-Preusse et al. 2016). This highlights the importance of PFN1 and the actin cytoskeleton in the development of juvenile synapses. The role of PFN1 in neuronal development and outgrowth appears to be, in part, specific for different neuronal populations. Given the dramatic impact that low levels of PFN1 can have

during neurodevelopment, there is a question that remains unanswered. What impact do

ALS-associated PFN1 mutants have during development?

Sporadic and familial ALS present with similar symptoms and histopathological features (Neumann et al. 2006, Swarup and Julien 2011). However, the peak age of onset differs with sporadic disease presenting on average between 58-63 years, and familial presenting at 47-52 years old (Kiernan et al. 2011). Although there are a vast array of mouse models of ALS, the majority of studies do not focus on developmental changes that are present in these animals. Some of the studies which have delved into the physiology of ALS embryos have found alterations in the formation of synaptic connections. The spinal cords of SOD1 mice have been shown to have an increased ratio of excitatory synapses (Avossa et al. 2006). Furthermore, SOD1G93A transgenic mice have reduced dendritic arborisation and hyperexcitability as early as E17.5 (Martin et al. 2013). The loss of α-motor neurons in the spinal cord also occurs much earlier than previously thought (Vinsant et al. 2013, Vinsant et al. 2013). Collectively, this indicates that morphological alterations during neurodevelopment can impact the electrophysiological properties of developing α-motor neurons and potentially prime them for an early neuronal death. The discovery of the C9ORF72 hexanucleotide expansions, present in both familial and sporadic disease, emphasised that genetic involvement is also present in sporadic cases (DeJesus-Hernandez et al. 2011, Renton et al. 2011). Despite common risk factors and genetic involvement in both sporadic and familial disease, familial typically presents 10 years before sporadic disease. Could neurodevelopmental changes account for disease presentation of familial ALS, preceding the average presentation of sporadic cases?

The development of the central nervous system is a tightly regulated process.

Homeobox genes guide this development and are responsible for ensuring the 99

regionalisation of tissue and the differentiation of cell types (Rubenstein 2011,

Philippidou and Dasen 2013). Homeobox Hb9 is required for the consolidation of motor neuron identity. Mutating Hb9 can change the migration of motor neurons and transiently alter gene expression in chick embryos (Arber et al. 1999). The delicate regulation of the developing central nervous system and the role that PFN1 plays in the migration and outgrowth of neurons, presents a unique and novel way to address the impact of ALS-associated PFN1 mutants.

We sought to assess the impact that the expression of an ALS-associated PFN1 mutant has in the developing nervous system. To evaluate the impact of ALS-associated PFN1 mutation C71G, we designed a mouse model with PFN1C71G expression driven by the

Hb9 promoter. The homeobox gene Hb9 plays an important role in motor neuron differentiation and expression switches on between E9.5 and E10.5 (Arber et al. 1999).

The purpose of the experiments in this Chapter are to characterise the developmental phenotype of the novel Hb9 V5-PFN1C71G mice.

100

Results

Timeline of V5-PFN1C71G expression driven by the Hb9 promoter

V5-PFN1C71G expression was driven by a Hb9 promoter, followed by an IRES and

EGFP sequence. Therefore, any cells expressing V5-PFN1C71G would also separately express EGFP. As our first step of confirming expression of the transgene, we detected the EGFP tag. Hb9 V5-PFN1C71G embryos were collected at the indicated embryonic day and fixed in 4% PFA. Embryos were imaged on a Nikon Eclipse TiE to detect

EGFP expression driven by the Hb9 promoter. Overlays of phase contrast images and

EGFP signals were generated to determine the spatial localisation of EGFP expression.

EGFP expression was observed in the neural tube area (arrow) and the developing brain

(arrowhead) of transgenic E10.5 embryos (Fig 4.2.1.1 A, D). In transgenic E11.5 embryos, the EGFP expression could be seen in the neural tube and the developing nerve bundles (Fig 4.2.1.1 B, E). In the E12.5 transgenic embryos, expression could still be observed (Fig 4.2.1.1 C), however, due to the reduction in translucency, the expression became more difficult to resolve.

To ensure the expression of V5-PFN1C71G, spinal cords were dissected from P2 pups and homogenised in RIPA. Equal protein concentrations were diluted in 4x sample buffer to a final concentration of 1x. Protein samples were run on a 15% acrylamide gel, transferred to a PVDF membrane, and probed for V5. A faint band can be observed at

15kD in the transgenic samples (Fig 4.2.1.1 F), consistent with V5-PFN1C71G expression. The genotype of Hb9 V5-PFN1C71G embryos and mice was determined by

PCR, with a positive band indicating that the animals were transgenic (Fig 4.2.1.1 G).

After confirmation of transgene expression, we could then move onto a histological characterisation of expression.

101

Figure 4.2.1.1. Transgenic Hb9 V5-PFN1C71G embryos express EGFP and V5-PFN1

A E10.5 B E11.5 C E12.5

D E10.5 E E11.5

Tg Wt F20kD G

15kD

10kD

4.2.1.1 Overlays of phase contrast images and EGFP signals, show the spatial localisation of

the EGFP expression in the neural tube area (arrow) and the developing brain

(arrowhead) of transgenic E10.5 embryos (A, D). In transgenic E11.5 embryos, the

EGFP expression could be seen in the neural tube and the developing nerve bundles

(B, E). In the E12.5 transgenic embryos, expression could still be observed (C).

Expression of V5-PFN1C71Gcould be confirmed by western blotting of tissue from the

spinal cords of P2 transgenic pups (F). Mice were confirmed as transgenic with a

genotyping PCR, with transgenic mice showing a positive band (G). Scale bars =

200µm.

102

To characterise the temporal expression of V5-PFN1C71G embryos, at various developmental stages, P0 pups and mature brains from perfused animals were collected and analysed. All tissue were fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Wt and transgenic tissues were stained for V5-DAB and imaged on an Olympus BX51 microscope. Wt embryos had no expression of V5-PFN1C71G at any time point, E9.5-14.5, P0 or 1m (Fig 4.2.1.2. A-H).

At E9.5 transgenic embryos showed no expression of V5-PFN1C71G (I). V5 positive staining can be seen in the basal plates of the neural tube of transgenic E10.5-14.5 embryos (Fig 4.2.1.2. J-N) (Brettle et al. 2019). There was some expression in cells in the anterior horn of the spinal cord in transgenic P0 pups (Fig 4.2.1.2. O). There is no

V5 expression in the spinal cords of transgenic 1m old mice (Fig 4.2.1.2. P). V5-

PFN1C71G is expressed in the basal plates of the neural tubes in embryos. Some expression was still found in P0 pups, but the expression appears to be lower than in embryos. By 1 month old, no expression of the transgene was observed. This is due to the Hb9 promoter turning off after birth.

103

Figure 4.2.1.2. Profile of V5-PFN1C71G expression throughout development

4.2.1.2 Wt and transgenic (Tg) tissues were stained for V5-DAB. Wt embryos have no

expression of V5-PFN1C71G (A-H). E9.5 Tg embryos show no expression (I). V5-

PFN1C71G positive staining can be seen in the basal plate of the neural tube of Tg

E10.5-14.5 embryos (J-N). Cells in the anterior horn of the spinal cord in Tg P0 pups

show limited V5-PFN1C71G expression (O, Arrows), and no V5-PFN1C71G expression

in the spinal cords of Tg 1m mice (P) (Brettle et al. 2019).

104

To further characterise the spatial localisation of V5-PFN1C71G, transgenic embryos were collected at E10.5, fixed in 4% PFA. Whole embryos were stained for GFP and

V5, mounted in low melting temperature agarose and cleared with CUBIC. The embryos were imaged on a Zeiss Lightsheet Z.1 with a 4x clearing objective.

Transgenic E10.5 embryos had GFP (green) and V5-PFN1C71G (red) expression (Fig

4.2.1.3 A, B). The figure shows a mouse embryo in side-view and rotated 45°.

Expression was present through the length of the neural tube in the lateral basal plates

(arrows), in the axonal bundles extending from the neural tube, and in the mid-hindbrain junction of the developing brain (arrowhead) (Fig 4.1.3 C, D). With lightsheet imaging we confirmed the spatial distribution of V5 expression throughout the lateral basal plates of the neural tube in E10.5 embryos

With the confirmation of V5-PFN1C71G expression, we then investigated the level of

PFN1 overexpression in V5 positive tissue. Sections were double immunolabeled with

V5 (green) and PFN1 (red) and imaged on a Zeiss Axioskop 40. There was no residual

GFP fluorescence after the tissue processing step without antibody staining (data not shown). No V5 expression was observed in the neural tubes of Wt E9.5–11.5 embryos

(Fig 4.2.1.4. A-C). Ubiquitous PFN1 expression was observed in the neural tubes of Wt

E9.5–11.5 embryos (Fig 4.2.1.4. D-I). The sections for images in figure 4.2.1.4. are from the lumbar region of the neural tube. Sections of neural tube from transgenic E9.5 embryos had no significant V5 expression and no significant PFN1 overexpression (Fig

4.2.1.4. J, M). V5 expression was observed in the neural tubes of transgenic E10.5 and

11.5 embryos (Fig 4.2.1.4. K, L). Overexpression of PFN1 was observed in these V5 positive regions (Fig 4.2.1.4. N, O, Q, R). This confirmed the expression of PFN1C71G in the V5 positive areas, and hence showed that V5 is an appropriate marker of transgene expression (Brettle et al. 2019).

105

Figure 4.2.1.3. Lightsheet imaging of V5-PFN1C71G mouse embryos reveals the spatial distribution of V5-PFN1C71G in E10.5 transgenic embryos

4.2.1.3 Whole embryos were stained for GFP and V5-PFN1C71G and imaged on a Zeiss

Lightsheet Z.1. The rendered images show GFP (green) and V5 (red) expression in a

transgenic (Tg) embryo (A, B). V5-PFN1C71G expression is present throughout the

length of the neural tube in the lateral basal plates (arrows), in the axonal bundles

extending from the neural tube, and in the mid-hindbrain junction of the developing

brain (arrowhead). Scale bars = 500µm (Brettle et al. 2019).

106

Figure 4.2.1.4. Transgenic E10.5-11.5 Hb9 V5-PFN1C71G embryos have PFN1 overexpression in V5 positive regions

107

4.2.1.4 Sections were stained for V5 (green) and PFN1 (red). No V5 expression or PFN1

overexpression was detected in Wt embryos (A-I). Transgenic (Tg) E9.5 embryos had

neglegable V5 expression (J). Sections from Tg E10.5 and E11.5 embryos had V5

expression and PFN1 overexpression in the anterior protion of the neural tube in the

lumbar region of the neural tube (K, L; N, O; Q, R). Scale bar = 50µm.

No V5 expression or PFN1 overexpression was observed in the neural tubes of Wt

E12.5-14.5 embryos (Fig 4.2.1.5. A-I). V5 expression was detected in the anterior horn of neural tubes from transgenic E12.5-14.5 embryos (Fig 4.2.1.5. J-L). An increase in

PFN1 expression was observed in these V5 positive regions of transgenic E12.5-14.5 embryos (Fig 4.2.1.5. M-R) (Brettle et al. 2019).

108

Figure 4.2.1.5. Transgenic E12.5-14.5 Hb9 V5-PFN1C71G embryos have PFN1 overexpression in V5 positive regions

109

4.2.1.5 Sections were stained for V5 (green) and PFN1 (red). No V5 expression or PFN1

overexpression was detected in Wt embryos (A-I). Sections from transgenic (Tg)

E12.5 - E14.5 embryos had V5 expression and PFN1 overexpression in the anterior

protion of the neural tube (J - R). Scale bar = 50µm (Brettle et al. 2019).

Next, we quantified the expression of V5 and PFN1. The mean grey value was measured in the images using FIJI. Firstly, we confirmed that significant expression of

V5 commences in transgenic embryos at E10.5 (Fig 4.2.1.6. A), with signal intensities at E9.5 remaining at levels comparable with the background levels of Wt embryos.

Next, we confirmed that the expression of V5 positively correlated with the increasing

PFN1 expression (Fig 4.2.1.6. B). This correlation was found to be significant (p =

0.0142).

We analysed the mean grey value of PFN1 in the anterior portion of the neural tube in

Wt embryos, in V5 negative areas of the neural tube in transgenic embryos and in V5 positive areas of transgenic embryos. There were no significant V5 positive areas in transgenic embryos at E9.5. There was no significant difference in PFN1 levels between

Wt and transgenic in V5 negative areas (Fig 4.2.1.6. C). There was a slight increase in

PFN1 levels in V5 positive regions in transgenic E10.5 embryos, but this was only significant when compared to transgenic V5 negative areas (Fig 4.2.1.6. D). V5 positive areas of transgenic E12.5 embryos had a significant increase in PFN1 expression (2.25 fold higher) when compared with Wt E12.5 embryos (Fig 4.2.1.6. E) (Brettle et al.

2019). Similarly, transgenic E14.5 embryos had a significant increase of PFN1 in V5 positive areas (2.11 fold higher), when compared with Wt E14.5 embryos (Fig 4.2.1.6.

F) (Brettle et al. 2019). These data show that expression of V5-PFN1C71G by the Hb9 110

promoter results in a 2-fold increase in PFN1 levels in a region of anterior portion of the neural tube of transgenic embryos. Statistics for this section were analysed with either one-way ANOVA (Fig 4.2.1.6. A, D, E, F), by computing Pearson’s correlation coefficients (Fig 4.2.1.6. B), or with students t-tests (Fig 4.2.1.6. C). Significance is

*p≤0.05, ****p≤0.0001; graphed with SEM.

In this section we characterised the temporal and spatial expression of V5 and PFN1 in

V5-PFN1C71G mice. The expression is consistent with published data on the Hb9 promoter. The transgene is expressed in embryos E10.5+ and waning by P0. The expression of the transgene is not present by 1m old.

111

Figure 4.2.1.6. Transgenic V5-PFN1C71G mouse embryos have significantly overexpress

PFN1

112

4.2.1.6 V5 expression was significantly increased in transgenic (Tg) E10.5 embryos when

compared to Wt littermates and Tg E9.5 embryos (A). V5 expressions levels had a

positive correlation with PFN1 expression levels in Tg E10.5 embryos (B). Analysis

of Tg embryos was split into V5 negative and V5 positive areas. There is no

significant increase of PFN1 expression in Tg E9.5 embryos (C). Tg E10.5 embryos

have a significant increase of PFN1 in V5 positive areas when compared to V5

negative areas (D). Tg E12.5 and E14.5 embryos have a significant increase of PFN1

in V5 postive areas when compared to V5 negative areas in Tg and Wt embryos (E,

F). Analysed with one-way ANOVA (A, D, E, F), by computing Pearson’s correlation

coefficients (B), or with students t-tests (C); *p≤0.05, ****p≤0.0001; graphed with

SEM (Brettle et al. 2019).

113

Table 4.1: Statistics summary of V5 and PFN1 expression in Hb9 V5-PFN1C71G mice

V5 Expression E9.5 vs 10.5 Sig P-value E9.5 Wt vs. E9.5 Tg ns 0.9859 E9.5 Wt vs. E10.5 Wt ns 0.705 E9.5 Wt vs. E10.5 Tg **** <0.0001 E9.5 Tg vs. E10.5 Wt ns 0.9239 E9.5 Tg vs. E10.5 Tg **** <0.0001 E10.5 Wt vs. E10.5 Tg **** <0.0001

E10.5 Correlation of V5 and PFN1 expression Sig? P-value PFN1 vs V5 expression * 0.0142 1.833 ± Slope 0.6474 R square 0.3814

E9.5 PFN1 expression Sig? P-value PFN1 in Wt vs PFN1 in Tg ns 0.1213

E10.5 PFN1 expression Sig? P-value PFN1 in Wt vs. PFN1 in Tg (V5 neg) ns 0.7901 PFN1 in Wt vs. PFN1 in Tg (V5+) ns 0.3769 PFN1 in Tg (V5 neg) vs. PFN1 in Tg (V5+) * 0.0314

E12.5 PFN1 expression Sig? P-value PFN1 in Wt vs. PFN1 in Tg (V5 neg) ns 0.9788 PFN1 in Wt vs. PFN1 in Tg (V5+) **** <0.0001 PFN1 in Tg (V5 neg) vs. PFN1 in Tg (V5+) **** <0.0001

E14.5 PFN1 expression Sig? P-value PFN1 in Wt vs. PFN1 in Tg (V5 neg) ns 0.965 PFN1 in Wt vs. PFN1 in Tg (V5+) **** <0.0001 PFN1 in Tg (V5 neg) vs. PFN1 in Tg (V5+) **** <0.0001

114

V5-PFN1C71G is expressed in motor neurons at embryonic ages

To confirm that V5-PFN1C71G was being expressed in developing motor neurons, sections from E12.5-14.5 embryos were stained for V5 (green) and ChAT (red, a marker of motor neurons). Images were taken on a Zeiss Axioskop 40 with a 20x objective.

Staining revealed ChAT-positive neurons in Wt embryos (Fig 4.2.2.1. A-I). V5 positive neurons in transgenic embryos were also positive for ChAT (Fig 4.2.2.1. J-R) (Brettle et al. 2019). The ChAT expression appeared to drop from E12.5 – E14.5, but this could be due to the division of other cells in the neural tube and/or the migration of the developing motor neurons. This expression pattern confirmed that the transgene expression was in the correct neuronal subtype, developing motor neurons.

115

Figure 4.2.2.1. V5-PFN1C71G is expressed in motor neurons at embryonic ages

116

4.2.2.1 Sections were stained for V5 (green) and ChAT (red). ChAT expression was detected

in Wt embryos (A-I). Sections from had V5 expression and in ChAT-positive areas of

the anterior protion of the neural tube (J - R). Scale bar = 50µm (Brettle et al. 2019).

No evidence of TDP-43 pathology in Hb9 V5-PFN1C71G mice

Cytoplasmic inclusions of TDP-43 are a cardinal feature of ALS, and mutant PFN1 has been shown to induce a TDP-43 pathology both in vitro and in vivo (Tanaka and

Hasegawa 2016, Fil et al. 2017). The next step was to investigate if V5-PFN1C71G motor neurons had any evidence of TDP-43 pathology. Wt and transgenic embryos were collected at the indicated age, fixed, processed, paraffin embedded and sectioned.

Sections were stained for V5 (green) and TDP-43 (red). Images taken on the Zeiss

Axioskop 40 with a 40x objective showed that TDP-43 maintained a nuclear localisation, and no clear cytoplasmic inclusions were observed (Fig 4.2.4.1. A-R). No

TDP-43 pathology was observed in transgenic E12.5-14.5 embryos, despite the confirmation of V5-PFN1C71G expression (Fig 4.2.4.1. J-R). We found no evidence of

TDP-43 cytoplasmic inclusions in embryos expressing V5-PFN1C71G.

117

Figure 4.2.3.1. Mutant PFN1 expression does not induce a TDP-43 pathology in the neural tubes of Hb9 V5-PFN1C71G mice

118

4.2.3.1 Sections were stained for V5 (green) and TDP-43 (red). Images showed that TDP-43

maintained a nuclear localisation, and no cytoplasmic inclusions were observed in Wt

or transgenic (Tg) embryos (A-R). No clear TDP-43 pathology was observed in Tg

E12.5-14.5 despite the confirmation of V5-PFN1C71G expression (J-R). Scale bars =

50µm.

Impact of mutant PFN1 expression on neurite outgrowth in vivo

Next, we addressed the effect of mutant PFN1 in axon growth, as it has been previously shown to be impacted in vitro (Wu et al. 2012). Sections from Wt and transgenic E14.5 embryos were stained with Tau1 to visualise developing axonal bundles (Fig 4.5.4.1. A,

B). Analysis revealed that transgenic animals had a reduction in the diameter of brachial nerves (Fig 4.5.4.1. C) (Brettle et al. 2019). The diameter was taken as opposed to area for accuracy, as some sections were slightly oblique. The formation of developing brachial nerves was found to be impacted in Hb9 V5-PFN1C71G transgenic embryos.

119

Figure 4.2.4.1. Mutant PFN1 expression impacts neurite outgrowth in vivo

4.2.4.1 Sections from Wt and transgenic (Tg) embryos were stained with Tau1 (A, B) and the

diameter of the brachial nerve bundles were analysed. Analysis revealed that Tg

animals had a reduction in the diameter of brachial nerves (C) (p=0.0003). N=4

animals for each genotype. Analysed with unpaired student t-test; ***p≤0.001;

graphed with SEM. Scale bars = 500µm (Brettle et al. 2019).

120

Mutant PFN1 expression impacts brain development

In the process of sectioning E14.5 Hb9 V5-PFN1C71G embryos and staining them with

H&E, some gross morphological abnormalities could be observed in the transgenic brains. Embryos were collected at E14.5, fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Sections from Wt and transgenic embryos were stained with V5-DAB and counterstained with hematoxylin.

Using Wt brains as a reference (Fig 4.2.5.1 A), abnormalities could be observed in a portion of brains from transgenic embryos. The image shows evidence of abnormal development in the primordial cerebellum of the transgenic embryo (Fig 4.2.5.1 B,

Arrow) when compared to Wt (Fig 4.2.5.1 A, Arrow). Gross abnormalities such as abnormal cerebellum development could be observed in 2/7 transgenic embryos (Fig

4.2.5.1 C), with slight abnormalities present in 1/7 transgenic embryos (Fig 4.2.5.1 C), and normal development in 4/7 transgenic embryos (Fig 4.2.5.1 C). No such abnormalities were observed in Wt embryos.

121

Figure 4.2.5.1. Some of the transgenic Hb9 V5- PFN1C71G embryos have abnormal brain development

4.2.5.1 Sections from Wt and transgenic (Tg) embryos were stained with V5-DAB and

counterstained with hematoxylin. Brains from Wt embryos showed no evidence of

abnormalities (A). The image shows evidence of abnormal development in the

primordial cerebellum of the Tg embryo (B Arrow) when compared to Wt (A, Arrow).

Gross abnormalities such as this could be observed in 2 Tg embryos (C), with slight

abnormalities present in 1 Tg embryos (C), and normal development in 4 Tg embryos

(C). N= 7. Scale bars = 500µm.

122

To investigate whether the described abnormalities were carried into adolescent mice,

MRI was completed on brains from 1m Wt and transgenic Hb9 V5-PFN1C71G mice.

Analysis revealed that the total brain volume of the transgenic animals was significantly less than Wt littermates (Fig 4.2.5.2. A). The cerebellum, hippocampus and ventricles were delineated to reveal that transgenic animals had a significantly smaller cerebellum

(Fig 4.2.5.2. D), hippocampus (Fig 4.2.5.2. E) and 4th ventricle (Fig 4.2.5.2. H) when compared with Wt. There was no significant difference in the lateral ventricles or 3rd ventricle (Fig 4.2.5.2. F, G).

To determine if the reduction in volume of these areas was responsible for the overall reduction in brain volume, these structures were analysed as a percentage of the total brain volume. When taken as a percentage, there was no significant difference in the volume of the cerebellum (Fig 4.2.5.2. I), hippocampus (Fig 4.2.5.2. J), or lateral ventricles (Fig 4.2.5.2. K). The 3rd ventricle was larger in transgenic mice when compared to Wt controls (Fig 4.2.5.2. L), while the 4th ventricle was smaller (Fig

4.2.5.2. M). Although slight changes were found in ventricle size, the cerebellum and hippocampus were not significantly reduced in size, when taken as a percentage.

Although there were significant changes detected by MRI, these were not consistent with the gross abnormalities present in transgenic E14.5 embryos. This indicates that although transgenic mice had significantly smaller brains, the reduction was not due to a reduction of cerebellar volume.

123

Figure 4.2.5.2. MRI analysis of the brains of adolescent Hb9 V5- PFN1C71G mice

124

4.2.5.2 Magnetic resonance imaging was completed on brains from 1m Wt and transgenic

(Tg) Hb9 V5-PFN1C71G mice. Representative images of the delineated structures are

shown (A, B). Analysis revealed that the total brain volume of the Tg animals was

significantly less than Wt littermates (C). Tg animals had a significantly smaller

cerebellum (D), hippocampus (E) and 4Th ventricle (H). There was no significant

difference in lateral ventricles (F) or 3rd ventricle (G). When taken as a percentage of

the total brain volume, there was no significant difference in the volume of the

cerebellum (I), hippocampus (J), or lateral ventricles (K). The 3rd ventricle was larger

in Tg mice when compared to Wt controls (L), while the 4th ventricle was smaller (M).

Analysed with unpaired t-test; *p≤0.05, **p≤0.01; graphed with SEM. N = 3 animals.

Expression of mutant PFN1 impacts Mendelian inheritance

To elucidate the potential impact of the gross morphological brain abnormalities, the inheritance patterns of the mice was analysed. Breeding of the line was done with

Wt/Tg Hb9 V5-PFN1C71G males and Wt/Wt C57Bl/6J females, which in line with

Mendelian inheritance, should result in a 50:50 ratio of Wt/Wt and Wt/Tg offspring.

Hb9 V5-PFN1C71G embryos were genotyped at the time of harvest by PCR and by visualisation of GFP in the neural tube. Mice were genotyped by PCR at 2 weeks old.

The genotype of Hb9 V5-PFN1C71G embryos fit the expected Mendelian inheritance pattern (Fig 4.2.6.1.). The majority of the mouse colony was genotyped at 2 weeks old, and no longer fit with a Mendelian inheritance pattern (Fig 4.2.6.1.) (Brettle et al.

2019). Despite having a classic Mendelian inheritance pattern at embryonic ages, the mice analysed at 2 weeks old shifted away from this pattern with the proportion of Wt animals significantly more than transgenic animals. Overall, the results indicate that there are several morphological and biochemical changes in the embryos of transgenic

Hb9 V5-PFN1C71G mice. 125

Figure 4.2.6.1. Loss of Mendelian inheritance in Hb9 V5-PFN1C71G mice

4.2.6.1 Hb9 V5-PFN1C71G mouse embryos were genotyped at the time of harvest by PCR and

visualisation of GFP in the neural tube. Postnatal mice were genotyped by PCR at 2

weeks old. Heterozygous Hb9 V5-PFN1C71G males were bred with C57Bl/6J females.

The genotype of Hb9 embryos fits the expected Mendelian inheritance pattern (A).

The mice in the mouse colony was genotyped at 2 weeks of age, and no longer fit with

a Mendelian inheritance pattern (B). ****p<0.0001 (Brettle et al. 2019).

126

Discussion

PFN1 is important during embryonic development for cell division, cell migration and neurite outgrowth (Wills et al. 1999, Witke et al. 2001, Ding et al. 2012). We have investigated the impact of expressing V5-PFN1C71G in motor neurons during development.

We generated a transgenic mouse line expressing V5-PFN1C71G driven by a Hb9 promoter with an IRES and EGFP sequence. We confirmed the expression of EGFP

(Fig 4.2.1.1.) and V5 (Fig 4.2.1.2.) in transgenic embryos. Expression was present in the anterior portion of the neural tube from E10.5-E14.5. By P0, expression was present, but was not as pronounced. Literature indicated that Hb9 will drive expression from

E9.5 – P10, and for the most part, our data showed this. We could not detect any V5 expression at E9.5, which is consistent with expression only just “turning on”. We did not extensively characterise expression in post-natal animals due to the observed reduction of expression at P0, when compared to embryonic expression. A limitation of our study was the lack of a Hb9 V5-PFN1WT mouse to be used as a control. This would have been ideal; however, it did not eventuate. The two other ALS-associated PFN1 mutant mice present in the literature had a PFN1WT overexpressing mouse line and showed no significant impact of overexpressing the protein.

Lightsheet imaging of E10.5 embryos showed that the spatial distribution of the transgene was largely restricted to the basal lateral plates of the developing neural tubes

(Fig 4.2.1.3.). This expression was confirmed to be in ChAT-positive neurons (Fig

4.2.2.1.). V5 expression extended into the developing axons extending from the neural tube whereas EGFP had a lower expression gradient in the axons. This shows that V5-

PFN1C71G localised to developing axons. PFN1 plays a role in the leading edge of

127

neuronal growth cones, where it regulates the actin cytoskeleton (Wills et al. 1999).

This indicates that the localisation patterns of PFN1 are not impacted by the C71G mutation. Transgene expression is present in the mid-hindbrain junction of the developing brain.

We characterised the level of PFN1 overexpression in areas of transgene expression

(Fig 4.2.1.4-5). At the peak of expression, V5-PFN1C71G was expressed 2.2-fold higher in motor neurons than endogenous PFN1 (Fig 4.2.1.6.). Yang and colleagues produced

V5-PFN1C71G mice with either the prion promoter (Prp) or the Thy1.2 promoter (Yang et al. 2016). In their study, Yang and colleagues crossed these mice and analysed a variety ofdifferent levels of mutant PFN1 expression. The most aggressive phenotype was present in a triple transgenic Thy1.2 PFN1C71G/C71G/Prp PFN1C71G mouse, with mutant PFN1 expressed 5-fold more than endogenous PFN1. The Prp PFN1C71G mouse had expression 2-fold higher than endogenous PFN1, a level comparable to the Hb9 V5-

PFN1C71G mice in our study. Interestingly, the triple transgenic mouse presented with muscle weakness at 140d and paralysis at 211d, whereas the Prp PFN1C71G line did not present with an ALS phenotype up to 700d (Yang et al. 2016). The level of PFN1 overexpression in our mouse model is comparable to the Prp PFN1C71G model, however, that model did not present with an ALS phenotype.

This novel Hb9 V5-PFN1C71G mouse model has transgene expression in developing motor neurons at embryonic ages, where PFN1C71G is expressed 2-fold higher than endogenous PFN1. At 1 month, the transient expression has turned off, indicating that any resulting phenotype is a result of transgene expression during development.

Cytoplasmic inclusions are a common pathological hallmark of ALS. There was no evidence of these inclusions in our in vitro studies (Chapter 3). Similarly, there were no

128

TDP-43 positive inclusions in the neural tubes of transgenic Hb9 V5-PFN1C71G mice

(Fig 4.2.3.1.). As previously discussed (section 3.3), this could be due to the level of

V5-PFN1C71G expression. No staining for TDP-43 were shown for the Thy1.2

PFN1C71G/C71G/Prp PFN1C71G mouse, and whether inclusions were present or not was not discussed by the authors (Yang et al. 2016). The second published mouse model with an

ALS-associated PFN1 mutation (G118V), showed a qualitative description of TDP-43 inclusions, however, the description is not conclusive without appropriate quantitative analysis (Fil et al. 2017). Future studies should have more quantitative analysis to determine whether a TDP-43 pathology is present. To date, our lab has not been able to show clear TDP-43-positive inclusions induced by the expression of V5-PFN1C71G. This indicates that the changes in Hb9 V5-PFN1C71G mice could be due to alterations in

PFN1 function, rather than an induction of TDP-43 pathology and the resulting stress on the cell.

Expression of V5-PFN1C71G has a neuronal subtype specific impact on axonal outgrowth in vitro (Wu et al. 2012, Brettle et al. 2015). We investigated if axonal outgrowth was reduced in motor neurons in vivo, by analysing the diameter of brachial nerves of Hb9 V5-PFN1C71G embryos. The observation that the brachial nerves of transgenic embryos are significantly smaller than Wt embryos, indicates that a reduction of axonal outgrowth in motor neurons may be conserved in vivo (Fig 4.2.4.1.). This may disrupt the circuitry of the developing mouse and NMJ formation.

Axonal outgrowth is a dynamic process, which in part involves PFN1 localising to the leading edge of the growth cone (Lee et al. 2013). PFN1 has a dual role in regulating the actin cytoskeleton and microtubule dynamics (Henty-Ridilla et al. 2017), processes that are crucial for axon extension and path-finding. We would suggest that the impact of

PFN1C71G expression in this case is indicative of a dominant negative loss of function, 129

rather than a gain of toxic function. PFN1C71G has an increased propensity for aggregation and is readily ubiquitinated, due to structural changes in protein folding

(Boopathy et al. 2015, Del Poggetto et al. 2015). Typically, PFN1C71G will be ubiquitinated faster than PFN1Wt. With a substantial increase in expression, the cell may not be able to keep up with the ubiquitination process, and due to the aggregation propensity of PFN1C71G, the more it is expressed, the more likely it will be to aggregate.

The hypothesis is strengthened by the results, showing that mice expressing higher levels of V5-PFN1C71G present with a more aggressive phenotype (Yang et al. 2016).

This could explain the different observations that we made, compared to other labs with regards to aggregation and pathology in cells expressing V5-PFN1C71G (Wu et al. 2012,

Tanaka and Hasegawa 2016, Fil et al. 2017).

We show that the axonal outgrowth of developing motor neurons is impacted in Hb9

V5-PFN1C71G embryos. This impact could be suggestive of a loss of function in mutant

PFN1. (Witke et al. 2001). It is possible that the C71G mutation reduces PFN1s ability to attract G-actin to the leading edge of growth cones or disrupts MT dynamics. Further studies to dissect how PFN1C71G changes growth cone dynamics would be beneficial to determine the molecular cause of altered axonal outgrowth. Another important consideration would be to assess if the molecular cause for the decreased brachial nerve thickness, also affected the formation and stability of neuromuscular junctions.

We characterised transgene expression in our transgenic Hb9 V5-PFN1C71G embryos and found expression in the mid-hindbrain junction (Fig 4.2.1.3.). Cell migration in the developing brain is essential for cortical and cerebellar organisation (Austin and Cepko

1990, Marzban et al. 2014). As PFN1 can impact cerebellar granule cell migration

(Kullmann et al. 2015), we analysed the brains of E14.5 animals to test for any gross abnormalities in brain development. Our results showed some gross abnormalities in 130

transgenic E14.5 brains, with a striking lack of tissue in the posterior primordial cerebellum compared to Wt control animals (Fig 4.2.5.1.). V5 positive (ChAT negative) expression was found adjacent to this area, suggesting that expression of V5-PFN1C71G may impact radial migration of cerebellar granule neurons, and/or other neurons in the developing brain.

The gross deficits were only observed in a portion of E14.5 embryos. The reason for the heterogeneity in brain development in transgenic embryos is unclear. Further studies will seek to ascertain which cell types and subclasses are impacted, and whether the abnormalities in specific areas correlate to the level of V5-PFN1C71G expression.

To establish if these abnormalities were carried through into postnatal mice, we completed MRIs of brains from 1m old Wt and transgenic Hb9 V5-PFN1C71G mice. The total brain volume of transgenic mice was significantly reduced when compared to brains from Wt mice (Fig 4.2.5.2.). We next analysed areas of the brain and found that the cerebellum, hippocampus, and 4th ventricle were all significantly reduced in the brains from transgenic mice (Fig 4.2.5.2.). If the cerebellar development was impacted, we would have expected a reduced cerebellar volume, an increased 4th ventricle volume and no change in the volume of the hippocampus.

To account for the significant reduction in overall brain volume, we looked at these structures as a percentage of brain volume to help elucidate which region this loss was present in. When considered as a percentage of overall brain volume, there was no significant difference in the cerebellum or hippocampus (Fig 4.2.5.2.). The 4th ventricle was significantly decreased in size and the 3rd ventricle was significantly increased. This shows that the cerebellum and hippocampus are in proportion of the size of the whole brain of the mouse. The reduction of brain volume may be a global effect and cannot be

131

attributed to the gross abnormalities in the cerebellum observed in brains from transgenic E14.5 mice. Even when considering the low penetrance of the gross cerebellar abnormalities in the embryo, the data collected from MRI analysis was grouped well and had small error bars. Further expression on tissue sections of brains from 1m old mice showed no gross abnormalities (Data not shown).

Hb9 V5-PFN1C71G mice show evidence of abnormalities in brain development in a portion of transgenic E14.5 mouse embryos, but this is not conserved in 1m old transgenic mice.

During the process of analysing the Hb9 V5-PFN1C71G mouse line, embryos were genotyped at the time of harvest and mice were genotyped at 2wk old. Breedings were set up between a heterozygous Hb9 V5-PFN1C71G male and a C57Bl6 female, which would yield a generation of mice that were 50% heterozygous transgenic and 50% homozygous Wt. Analysis of Mendelian inheritance in embryos showed a 45% transgenic to 55% Wt inheritance (transgenic n=27, Wt n=33), which was statistically considered to fit Mendelian pattern. However, 2w old mice showed an inheritance of

34.1% transgenic to 65.9% Wt (transgenic n=58, Wt n=112), a significant shift away from Mendelian inheritance (Fig 4.2.6.1.). These data are indicative of an early neonatal survival phenotype in Hb9 V5-PFN1C71G mice. This hypothesis is strengthened by the observations of gross abnormalities in Hb9 V5-PFN1C71G embryos, but there was no evidence of these abnormalities in 1m old transgenic mice.

Hb9 V5-PFN1C71G mice have Mendelian inheritance at embryonic stages, but not at

2wk. We hypothesise that this is due to neonatal mortality, but further studies would need to substantiate this. A significant limitation of the study is having only one Hb9

132

V5-PFN1C71G mouse line. As a result, we cannot rule out the possibility of a gene insertion artefact causing the changes observed both in chapter 4 and chapter 5.

The Hb9 V5-PFN1C71G mouse model presents with a developmental phenotype of reduced brachial nerve diameter, indicating that neurite outgrowth is likely reduced.

This emulates the impact of V5-PFN1C71G expression in motor neurons in vitro. The observation of gross abnormalities in the developing brains of Hb9 V5-PFN1C71G embryos, indicates that V5-PFN1C71G may impact cell migration. One advantage of the novel Hb9 V5-PFN1C71G mouse line is the expression of the transgene during embryonic ages. This feature, combined with the improved motor neuron culture described in Chapter 3, allow for both in vitro and in vivo studies to be completed on this mouse model. Although the phenotype described in these mice could be suggestive of a loss of function in mutant PFN1, another option is that it has a toxic effect without causing blatant aggregation. The expression of PFN1 can be globally reduced by 50% during development without having an adverse impact on brain development (Witke et al. 2001). There is also the possibility that the increased aggregation propensity of PFN1

(Boopathy et al. 2015), combined with and increased protein turnover, places pressure on the proteasome system within the cell, leading to a toxic effect. It is likely that the effects on the Hb9 V5-PFN1C71G mouse model are due to a combination of loss of function and gain of toxic function. Additional studies are necessary to dissect out the intricate molecular mechanisms at play in the Hb9 V5-PFN1C71G mice.

The next Chapter will characterise adult Hb9 V5-PFN1C71G mice.

133

Chapter 5:

Behavioural and

histological

characterisation of

Hb9 V5-PFN1C71G mice

134

5 Behavioural and histological characterisation of Hb9 V5-PFN1C71G

mice

Introduction

Transgenic Hb9 V5-PFN1C71G mice presented with a developmental phenotype with reduced brachial nerve diameter and some developmental brain abnormalities. These abnormalities did not seem to be present in 1m old mice (See Chapter 4). If the outgrowth of motor neurons is altered in Hb9 V5-PFN1C71G embryos, do adult mice have a long-lasting impact?

The recapitulation of ALS symptoms in mice creates models to study ALS pathogenesis. As discussed previously (section 1.2), SOD1 mouse models have been extensively studied and characterised (McGoldrick et al. 2013, Ittner et al. 2015). These models emulate ALS with a rapid decline in motor performance, followed by paralysis and death (Gurney 1994). The first PFN1/ALS mouse model presented with a similar phenotype to the classic SOD1 model (Yang et al. 2016). Mice by Yang and colleagues were generated with either a Thy1.2 or a prion promoter (Prp), driving the expression of

V5-PFN1C71G. The expression levels of these mice showed a dose dependent effect on symptom onset, with higher expression levels correlating with a faster presentation of symptoms (Yang et al. 2016). These changes in symptom onset could be due to higher expression, yielding an increase in protein aggregation in the mice. A study of mice with comparable expression levels of SOD1, but on different genetic backgrounds, had different timelines of disease progression (Marino et al. 2015). The Marino study showed that the profile of chaperone proteins in these mouse lines were altered and that the mouse line with decreased levels of chaperones had more aggressive disease

(Marino et al. 2015). Protein homeostasis appears to play a large role in ALS

135

pathogenesis. Given that Hb9 V5-PFN1C71G mice only express mutant PFN1 in developmental stages, we sought to characterise the impact on motor function.

As discussed in Chapter 1, TDP-43 positive cytoplasmic inclusions, gliosis and gradual motor neuron loss are all hallmarks of ALS. Novel mouse models try to recapitulate these features to study pathogenesis (Chapter 1). To date, two ALS-associated mouse models and one drosophila model have been published with ALS-associated PFN1 mutations (Yang et al. 2016, Fil et al. 2017, Wu et al. 2017). In addition to symptom onset at 140d (4-5m), with a rapid paralysis at 211d (7m), Thy1.2 PFN1C71G/C71G/Prp

PFN1C71G mice present with some histopathological hallmarks of ALS (Yang et al.

2016). Thy1.2 PFN1C71G/C71G/Prp PFN1C71G mice presented with deficits on RotaRod at

6m old and a gradual reduction in grip strength from 5m of age when compared to non- transgenic mice, and mice overexpressing V5-PFN1Wt (Yang et al. 2016). These mice presented with an increased number of astrocytes and microglia in the anterior horns of the spinal cord. Alpha motor neuron s were significantly reduced in animals expressing mutant PFN1 from 4m old, which correlated with an increase in the number of degenerating axons in the ventral and dorsal roots (Yang et al. 2016). No changes were observed in transgenic mice expressing V5-PFN1Wt, indicating that the observed changes in the Thy1.2 PFN1C71G/C71G/Prp PFN1C71G mice were specific to mutant PFN1 expression (Yang et al. 2016).

The second study on an ALS-associated PFN1 mutant, drove the expression of untagged

PFN1G118V with the Prp (Prp-PFN1G118V) (Fil et al. 2017). Mutant PFN1 was expressed

5-fold higher than endogenous PFN1. The Prp-PFN1G118V mice had a significant reduction in RotaRod performance from 153d (5cm), and a significantly shorter stride length at 160d (~5m). Animals presented with marked atrophy, significant denervation of NMJs and reduced survival, with females having a trend to worse survival than males 136

(Fil et al. 2017). The level of overexpression, progression of symptoms and survival are similar to the Thy1.2 PFN1C71G/C71G/Prp PFN1C71G mouse model (Yang et al. 2016, Fil et al. 2017). This is despite the indication from in vitro studies that the C71G mutant has the most significant impact on cell function and altered protein structure (Wu et al.

2012, Boopathy et al. 2015, Del Poggetto et al. 2015). The evidence of pathology was characterised in the Prp-PFN1G118V mice with evidence of TDP-43 positive cytoplasmic inclusions, reduction of alpha motor neurons in late stage disease, astrogliosis and microgliosis (Fil et al. 2017). Both mouse model studies showed that PFN1 aggregation occurred after the onset of symptoms (Yang et al. 2016, Fil et al. 2017), and drosophila models expressing PFN1C71G or PFN1M114T showed no protein aggregation (Wu et al.

2017). So, if the aggregation comes after degeneration and symptom onset, what is the cause of motor neuron toxicity?

PFN1 has a clear role in motor neuron function and ALS-associated PFN1 mutants impact this function, potentially in different ways. The fact that PFN1Wt overexpression can reduce the survival of drosophila shows that the balance of PFN1 expression is essential for motor neuron function. Taking this into account, what impact does developmental expression have on the Hb9 V5-PFN1C71G mice? Is the generation of an

ALS-phenotype dependent on the formation of protein aggregation and the disruption of protein homeostasis? What information can we extract from different mouse models of

PFN1 mutants?

The first aim of this Chapter is to characterise the motor phenotype of Hb9 V5-

PFN1C71G mice. The second is to investigate if these mice have any evidence of ALS pathology.

137

Results

Hb9 V5-PFN1 expression in adult mice across all ages

We characterised the expression of the transgene in Chapter 4 in animals up to 1m old.

To ensure that there was no transient expression, aged mice were analysed. Spinal cords and brains were collected from perfused Wt and transgenic animals at the indicated age.

All tissue was fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Wt and transgenic tissues were stained for V5-DAB and E12.5 tissue was used as a positive control. Sections were imaged on an Olympus

BX51 using a 10x objective. Staining revealed no positive staining for V5 in the spinal cords of 3, 6, 12 and 18m old Wt or transgenic animals (5.2.1.1 A-H). No positive staining was present in the brains of 3, 6, 12 and 18m old Wt or transgenic animals (data not shown). This confirmed that V5-PFN1C71G expression was only detectable in Hb9

V5-PFN1C71G transgenic mice during developmental stages and up to P0.

138

Figure 5.2.1.1. Adult transgenic mice do not express V5-PFN1C71G

5.2.1.1 Sections were stained for V5-DAB and no positive staining for V5 was detected in the

spinal cords of 3, 6, 12 and 18m old Wt or transgenic (Tg) animals (A-H) (Brettle et

al. 2019).

Weight Timeline of Hb9 V5-PFN1 C71G mice

Hb9 V5-PFN1C71G mice were weighed once a month. Data showed that transgenic mice aged 1-3m weighed significantly less than Wt littermates irrespective of sex (Fig

5.2.2.1. A-F) (Brettle et al. 2019). Data were analysed with unpaired student t-tests;

*p≤0.05; **p≤0.01; ***p≤0.001; graphed with SEM. Transgenic mice consistently weighed less than Wt littermates from 1-3m of age.

139

Figure 5.2.2.1. Transgenic V5-PFN1C71G mice weigh less than Wt littermates

5.2.2.1 Both male and female transgenic mice aged 1-3m weighed significantly less than Wt

littermates (A-F). Data were analysed with unpaired student t-tests; *p≤0.05;

**p≤0.01; ***p≤0.001; graphed with SEM. N = 6-21 (Brettle et al. 2019).

Although the first 3m of weight data fit a Gaussian distribution, as the mice got older the data did no longer fit a Gaussian distribution. Whilst some transgenic animals gained weight and caught up to Wt weight, a subgroup of transgenic animals plateaued

(Fig 5.2.2.2. A, B). This data showed a split weight phenotype with the defined presence of a low weight transgenic group and a normal weight transgenic group (Data summarised in Table 5.1).

At 6m, male transgenic low weight mice weighed significantly less than Wt controls littermates (Fig 5.2.2.2. A). From 8m to 16m, male transgenic low weight mice weighed

140

significantly less than Wt controls and transgenic normal weight mice (Fig 5.2.2.2. A).

From 8m to 12m there was no significant difference between Wt controls and transgenic normal weight mice. At 14m and 16m the transgenic normal weight mice had started to lose weight and were significantly different to Wt controls (Fig 5.2.2.2. A). Taken together, the low weight transgenic male mice plateaued in weight from 6m old, and consistently weighed less than both Wt controls and normal weight transgenic mice.

The normal weight transgenic male mice were comparable in weight to Wt controls until later stages, when they weighed significantly less (Fig 5.2.2.2. A) (Brettle et al.

2019).

Unlike the male low weight mice at 6m, female transgenic low weight mice trended towards a lower weight, however, this did not reach significance (Fig 5.2.2.2. B)

(Brettle et al. 2019). At 8m the low weight transgenic female mice weighed significantly less than Wt littermates (Fig 5.2.2.2. B). At 10m and 16m, the female transgenic low weight mice weighed significantly less than female Wt controls and transgenic normal weight mice (Fig 5.2.2.2. B). Female transgenic normal weight mice did not show any significant differences from Wt controls. Overall, after 6m of age, transgenic mice separated into two weight groups, low weight and normal weight. This is due to the low weight mice reaching a plateau in weight from 6m of age.

141

Figure 5.2.2.2. Transgenic V5-PFN1C71G mice yield two separate weight groups in older mice

5.2.2.2 In animals older than 6m, transgenic (Tg) mice separated into 2 groups; low weight

(LW) and normal weight (NW). * denotes a difference between Tg LW and Wt, #

denotes a difference between Tg LW and Tg NW, † denotes difference between Tg

NW and Wt. Data were analysed with two-way ANOVA; *p≤0.05; **p≤0.01;

***p≤0.001, ****p≤0.0001; graphed with SEM. N = 3-21 (Brettle et al. 2019).

142

Table 5.1: Body weight 6-16m old mice statistics

6m 8m Weight Significance Summary sig p-value ↑ or ↓ sig p-value ↑ or ↓ Wt vs Tg normal weight ns 0.7461 ns 0.9862 Male Wt vs Tg low weight * 0.0279 ↓ ** 0.0050 ↓ Tg normal weight vs Tg low 5.2.2.2. weight ns 0.5069 # 0.0313 ↓ Weight Wt vs Tg normal weight ns 0.9974 ns 0.9599 Female Wt vs Tg low weight ns 0.0531 ↓ ** 0.0021 ↓ Tg normal weight vs Tg low weight ns 0.3959 ns 0.0601

10m 12m Weight Significance Summary sig p-value ↑ or ↓ sig p-value ↑ or ↓ Wt vs Tg normal weight ns 0.9059 ns 0.9224 Male Wt vs Tg low weight *** 0.0003 ↓ **** <0.0001 ↓ Tg normal weight vs Tg low 5.2.2.2. weight ### 0.0004 ↓ #### <0.0001 ↓ Weight Wt vs Tg normal weight ns >0.9999 ns >0.9999 Female Wt vs Tg low weight **** <0.0001 ↓ * 0.0126 ↓ Tg normal weight vs Tg low weight ## 0.0015 ↓ ns 0.0924

14m 16m Weight Significance Summary sig p-value ↑ or ↓ sig p-value ↑ or ↓ Wt vs Tg normal weight † 0.0177 ↓ †† 0.0024 ↓ Male Wt vs Tg low weight **** <0.0001 ↓ **** <0.0001 ↓ Tg normal weight vs Tg low 5.2.2.2. weight ## 0.0035 ↓ # 0.0257 ↓ Weight Wt vs Tg normal weight ns >0.9999 ns 0.1026 Female Wt vs Tg low weight ns 0.136 **** <0.0001 ↓ Tg normal weight vs Tg low weight ns 0.2108 ## 0.0238 ↓

143

RotaRod performance of Hb9 V5-PFN1C71G mice

To assess motor ability and coordination, mice were challenged with an accelerating

RotaRod. Latency to fall was recorded in seconds. Male transgenic animals had a significant deficit on RotaRod with a decreased latency to fall, from 1-3m when compared with Wt controls (Fig 5.2.3.1. A-C). The performance of female transgenic mice was comparable to Wt controls at 1m old (Fig 5.2.3.1. D). However, at 2 and 3m, the female transgenic mice presented with significant deficits with a decreased latency to fall (Fig 5.2.3.1. E, F) (Brettle et al. 2019). Data were analysed with unpaired student t-tests and graphed with SEM (*p≤0.05; **p≤0.01). Transgenic Hb9 V5-PFN1C71G mice present with deficits on RotaRod from 1-3 months.

After establishing that the 1-3m old transgenic Hb9 V5-PFN1C71G mice presented with a significant motor phenotype, we analysed aged mice. As shown in section 5.2.2.2., from

6m old, the transgenic Hb9 V5-PFN1C71G mice present with two weight phenotypes.

Mice were split into these two phenotypes, normal weight and low weight, for analysis of their RotaRod performance at 6, 8, 14 and 16m old. At 6m old, transgenic male normal weight mice had a significant decrease in latency to fall when compared to Wt controls (Fig 5.2.3.2. A), while the performance of transgenic low weight mice was comparable to Wt controls.

At 8m and 14m, transgenic normal weight mice had no significant difference in latency to fall when compared to both Wt controls and transgenic low weight mice (Fig 5.2.3.2.

C, E). However, there was a trend towards transgenic normal weight not performing as well as Wt controls and transgenic low weight mice (Fig 5.2.3.2. C, E). At 16m old,

144

transgenic normal weight male mice had a significant decrease in latency to fall when compared to transgenic low weight mice (Fig 5.2.3.2. G).

Figure 5.2.3.1. Transgenic V5-PFN1C71G mice have early deficits on RotaRod

5.2.3.1 Hb9 V5-PFN1C71G mice were challenged with an accelerating RotaRod and male

transgenic (Tg) animals had a significant decrease in latency to fall on RotaRod from

1-3m (A-C). The performance of female Tg mice was comparable to Wt at 1m old (D)

but presented with a significant decrease in latency to fall at 2 and 3m old (E, F). Data

were analysed with unpaired student t-tests; *p≤0.05; **p≤0.01; graphed with SEM. N

= 8-26 (Brettle et al. 2019).

Unlike male mice, 6m old female transgenic mice had no significant deficits on

RotaRod (Fig 5.2.3.2. B). By 8m, female transgenic normal weight mice had a significant decrease in latency to fall on RotaRod compared with Wt controls (Fig

5.2.3.2. D). At 14m, transgenic normal weight mice had a significant decrease in latency to fall when compared with both Wt controls and transgenic low weight littermates (Fig

5.2.3.2. F). A similar trend is present for females at 16m old, but the latency to fall of 145

transgenic normal weight were only significant when compared with transgenic low weight littermates (Fig 5.2.3.2. H). Transgenic low weight performance was consistently comparable with Wt controls across all ages (Fig 5.2.3.2. B, D, F, H). In the figure, # denotes difference between transgenic low weight and transgenic normal weight, † denotes difference between transgenic normal weight and Wt controls. Data were analysed with one-way ANOVA and graphed with SEM (*p≤0.05; **p≤0.01;

****p≤0.0001).

Aged mice presented with similar trends in RotaRod performance. Generally, transgenic normal weight mice had a decreased latency to fall on RotaRod when compared to Wt controls and transgenic low weight mice (Fig 5.2.3.2. A-H) (Brettle et al. 2019).

Transgenic low weight mice typically had a similar performance to Wt controls (Table

5.2). Due to the split weight phenotype of the mice in section 5.2.2., the N number for

RotaRod was in some cases, less than optimal. However, the RotaRod performance indicates that transgenic normal weight mice have a motor deficit on RotaRod, whereas transgenic low weight mice did not.

146

Figure 5.2.3.2. Aged transgenic Hb9 V5-PFN1C71G mice have deficits on RotaRod

5.2.3.2 In animals aged 6m and older, transgenic (Tg) mice separated into 2 groups; low

weight (LW) and normal weight (NW). # denotes difference between Tg LW and Tg

NW, † denotes difference between Tg NW and Wt. Data analysed with one-way

ANOVA;*p≤0.05;**p≤0.01;****p≤0.0001; graphed with SEM. (Brettle et al. 2019).

147

Table 5.2: RotaRod statistics of 6-16m old mice

6m 8m ↑ or p- ↑ or RotaRod Significance Summary sig p-value ↓ sig value ↓ Wt vs Tg normal weight † 0.0209 ↓ ns 0.0739 Male Wt vs Tg low weight ns 0.9876 ns 0.9299 5.2.3.2. Tg normal weight vs Tg low weight ns 0.1233 ns 0.1083 RotaRod Wt vs Tg normal weight ns 0.2488 † 0.0381 ↓ Female Wt vs Tg low weight ns 0.4753 ns 0.9976 Tg normal weight vs Tg low weight ns 0.9777 ns 0.3292

14m 16m ↑ or p- ↑ or RotaRod Significance Summary sig p-value ↓ sig value ↓ Wt vs Tg normal weight ns 0.1167 ns 0.2391 Male Wt vs Tg low weight ns 0.8546 ns 0.1773 5.2.3.2. Tg normal weight vs Tg low weight ns 0.1157 # 0.0254 ↑ RotaRod Wt vs Tg normal weight † † † † <0.0001 ↓ ns 0.069 Female Wt vs Tg low weight ns 0.363 ns 0.1672 Tg normal weight vs Tg low weight #### <0.0001 ↑ ## 0.009 ↑

Fore limb grip strength timeline Hb9 V5-PFN1C71G mice

To characterise the strength of Hb9 V5-PFN1C71G mice, mice were challenged with a fore limb grip strength test. Results show that male transgenic mice, 1-3m old, did not have any deficit in fore limb grip strength (Fig 5.2.4.1. A-C). While female transgenic mice had a significant deficit at 1m old (Fig 5.2.4.1. D), no deficit was observed at 2 and 3m old (Fig 5.2.4.1. E, F). Data were analysed with unpaired student t-tests and graphed with SEM (*p≤0.05). Despite some evidence of fore limb grip weakness in 1m old female transgenic mice, overall, transgenic mice did not have deficits. Although transgenic mice have significant deficits on RotaRod, the lack if deficits when challenged with the fore limb grip strength suggest that deficits are primarily in the hind limbs.

148

Figure 5.2.4.1. Transgenic V5-PFN1C71G mice have limited deficits in forelimb grip strength

5.2.4.1 Wt controls and transgenic (Tg) mice were tested for forelimb grip strength, no deficit

in grip strength was found in 1-3m old male mice (A-C) or 2-3m old female mice (E,

F). Female Tg 1m old mice showed a significant decrease in fore limb grip strength

(D). Data were analysed with unpaired student t-tests; *p≤0.05; graphed with SEM. N

= 5-20.

149

Wire test performance of Hb9 V5-PFN1 C71G mice

The strength and endurance of Hb9 V5-PFN1C71G mice was tested on the hanging wire test. Latency to fall was measured and male 1m transgenic mice showed a significant deficit as they fell from the wire faster than Wt littermates (Fig 5.2.5.1. A). Male 2 and

3m transgenic mice did not have a significant deficit on the hanging wire test (Fig

5.2.5.1. B, C).

At 1m old, female transgenic mice did not have a significant deficit on the hanging wire test (Fig 5.2.5.1. D). Female 2m old mice had a significant deficit when compared to Wt littermates on the hanging wire test (Fig 5.2.5.1. E). By 3m old, the female transgenic mice also had no deficit (Fig 5.2.5.1. F). Data were analysed with Mann-Whitney test and graphed with SEM (*p≤0.05). Transgenic mice had some deficits when challenged with the hanging wire test, but not with the same consistency as when challenged with

RotaRod. This suggests that transgenic mice have endurance strength comparable with

Wt controls but have balance and strength deficits highlighted by the RotaRod results.

150

Figure 5.2.5.1. Transgenic V5-PFN1C71G mice have some deficits on wire test

5.2.5.1 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a hanging

wire test and latency to fall was measured. Male 1m Tg mice showed a significant

deficit as they fell from the wire faster than Wt littermates (A). Male 2 and 3m Tg

mice or female 1 and 3m Tg mice had no significant deficits (B-D, F). Female 2m old

mic had a significant deficit (E). Data were analysed with Mann-Whitney test;

*p≤0.05; graphed with SEM. N = 6-17.

151

Pole test performance of Hb9 V5-PFN1 C71G mice

To test balance and motor performance, Hb9 V5-PFN1C71G mice were challenged on the vertical pole test. At 3m old, male and female transgenic mice had a trend to take longer to descend the pole (Fig 5.2.6.1. A, C), however, this did not reach statistical significance. By 6m old, male transgenic mice took significantly longer to descend the pole as they could not complete the task and were given the maximum time (Fig 5.2.5.1.

B). Transgenic 6m female mice showed a trend to take longer to descend the pole but did not it did not reach significance (Fig 5.2.5.1. D). Data were analysed with unpaired students t-test and graphed with SEM (**p≤0.01). These trends support the previous motor data, highlighting deficits in balance and coordination. The act of completing a turn on a pole is dependent on strength, dexterity and balance. When mice were challenged with a strength task, for example fore limb grip strength, they did not present with consistent deficits. However, taken together, the pole and RotaRod data indicate that Hb9 V5-PFN1C71G transgenic mice have deficits in balance and coordination.

152

Figure 5.2.6.1. Male transgenic V5-PFN1C71G mice take longer to descend on pole test

5.2.6.1 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a pole test and

time to descend the vertical pole was measured. Both Male and Female Tg mice

showed a trend to take longer to descend the pole when compared to Wt (A-D), but it

was only significant in 6m old males (B). Data were analysed with Mann-Whitney

test; **p≤0.01; graphed with SEM. N = 5-14

153

Wt controls and transgenic Hb9 V5-PFN1C71G mice were tested on a pole test and the proportion of failures was recorded. Male 3m and 6m transgenic mice had an increased percentage of failing the task when compared to Wt (Fig 5.2.6.2. A, B). Similar trends were observed in female transgenic mice; however, these trends did not reach significance (Fig 5.2.6.2. C, D). Data were analysed with Pearson Chi-squared analysis with one degree of freedom (**p≤0.01, *** p≤0.001). Male transgenic mice showed deficits on pole test, with a significantly higher proportion of failure to complete the task and increased time to descend the pole at 6m old. While transgenic females presented with similar trends, no significance was reached. Male transgenic mice presented with deficits on pole test and were more likely to fail the task. The increased proportion of failures when challenged on the pole test indicate that transgenic mice have progressive motor deficits in balance and coordination, that is especially pronounced in male transgenic mice.

154

Figure 5.2.6.2. Male transgenic V5-PFN1C71G mice have a higher percentage of failing the pole test task

5.2.6.2 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a pole test and

the proportion of failures was recorded. Male 3m and 6m Tg mice had an increased

percentage of failing the task when compared to Wt (A, B). Similar trends were

observed in female Tg mice; however, these trends did not reach significance (C, D).

Data were analysed with Pearson Chi-squared analysis with one degree of freedom;

**p≤0.01, *** p≤0.001; graphed with SEM. N = 5-14

155

Beam test performance of Hb9 V5-PFN1 C71G mice

Horizontal beam test was used to analyse the balance and coordination of Hb9 V5-

PFN1 C71G mice. The time that the animals took to cross the beam was recorded as well as the number of adverse events. Although male 3m transgenic mice had a trend to take longer to cross, this did not reach significance (Fig 5.2.7.1. A). By 6m, male transgenic mice took significantly longer to cross (Fig 5.2.7.1. B). Female 3m transgenic mice took significantly longer to cross the beam than Wt (C), but the change was no longer significant in the 6m old cohort (D). Data were analysed with unpaired students t-test and graphed with SEM (**p≤0.01).

156

Figure 5.2.7.1. Transgenic V5-PFN1C71G mice take longer to cross on horizontal beam test

5.2.7.1 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a beam test

and time to cross the horizontal was measured. Male 3m Tg mice had a trend to take

longer to cross (A), but male 6m Tg mice had a significant increase in time to cross

(B). Female 3m Tg mice took significantly longer to cross the beam than Wt (C), but

this was not significant at 6m old (D). Data were analysed with Mann-Whitney test;

**p≤0.01; graphed with SEM. N = 5-14

157

Next, the number of adverse events during beam test was analysed. There was no significant difference in the number of events in male 3m or 6m old mice (Fig 5.2.7.2.

A, B). Female 3m old transgenic mice had significantly more events than Wt mice (Fig

5.2.7.2. C), and female 6m old transgenic mice showed no significant difference (Fig

5.2.7.2. D). Data were analysed with unpaired students t-test and graphed with SEM

(**p≤0.01).

The percentage of failures was recorded, there was no significant difference in the number of events in male or female 3m old animals (Data not shown) or female 6m old transgenic mice (Fig 5.2.7.3. A). Male 6m old transgenic mice failed the task significantly more often than Wt mice (Fig 5.2.7.3. A). Data were analysed with

Pearson Chi-squared analysis with one degree of freedom (*** p≤0.001). transgenic mice presented with some deficits when challenged with the horizontal beam test.

The deficits presented for the beam test support the results from RotaRod and pole tests.

In order to cross a thin wooden pole, mice need balance, coordination and dexterity.

Taken together, a clear understanding of the nature of the motor deficits of Hb9 V5-

PFN1C71G transgenic mice can be formed. When mice were challenged with tasks that only assessed strength, the mice did not present with consistent deficits. However, when the transgenic mice were challenged with more complex motor tasks that assess balance, coordination, dexterity and strength, the mice showed consistent trends or had significant deficits. A behavioural statistical summary is detailed below (Table 5.3).

158

Figure 5.2.7.2. Female transgenic V5-PFN1C71G mice have significantly more events when challenged with beam test

5.2.7.2 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a beam test

and the number of events were recorded. There was no significant difference in the

number of events in male 3m or 6m old mice (A, B). Female 3m old Tg mice had

significantly more events than Wt mice (C), and female 6m old Tg mice showed no

significant difference (D). Data were analysed with Mann-Whitney test; **p≤0.01;

graphed with SEM. N = 5-14

159

Figure 5.2.7.3. Male 6m old transgenic V5-PFN1C71G mice are more likely to fail the beam test

5.2.7.3 Wt controls and transgenic (Tg) Hb9 V5-PFN1C71G mice were tested on a beam test

and the percentage of failures was recorded. Male 6m old Tg mice failed the task

significantly more than Wt mice (C). Female 6m old Tg mice showed no significant

difference (D). Data were analysed with Chi squared analysis with one degree of

freedom; ****p≤0.0001. N = 5-14

Survival of Hb9 V5-PFN1C71G mice

The survival of V5-PFN1C71G mice was assessed. Overall, transgenic mice had a significantly decreased survival rate when compared with Wt littermates (Fig 5.2.8.1.

A) (Brettle et al. 2019). When the data is separated into male and female, the male survival curve is not significant (Fig 5.2.8.1. B). Female transgenic mice have significantly decreased survival over time (Fig 5.2.8.1. C). Data analysed with a Log-

Rank test (**p≤0.01).

160

Figure 5.2.8.1. Survival curves of Hb9 V5-PFN1C71G mice

5.2.8.1 The survival of transgenic (Tg) V5-PFN1C71G mice is significantly impacted when

compared with Wt controls (A). The survival of male Tg mice had no significant

difference (B). The survival of female Tg mice is significantly impacted (C). Data

were analysed with a Log-rank test; **p≤0.01 (Brettle et al. 2019).

161

Hb9 V5-PFN1C71G summary of motor performance

Table 5.3: Summary of Hb9 V5-PFN1C71G motor performance

Behavioural significance summary 1m 2m 3m 6m p-value 0.0003 0.0137 0.0072 Male sig *** * ** 5.2.2.1. ↑ or ↓ ↓ ↓ ↓ See Weight p-value 0.0219 0.0014 0.0035 Table 5.1 Female sig * ** ** ↑ or ↓ ↓ ↓ ↓ p-value 0.041 0.005 0.0037 Male sig * ** ** 5.2.3.1. ↑ or ↓ ↓ ↓ ↓ RotaRod Latency to fall p-value 0.9267 0.0273 0.0235 Female sig ns * * ↑ or ↓ ↓ ↓ p-value 0.5622 0.2422 0.6129 Male sig ns ns ns 5.2.4.1. ↑ or ↓ Forelimb grip Strength p-value 0.0378 0.1458 0.1188 Female sig * ns ns ↑ or ↓ ↓ p-value 0.037 0.1605 0.6026 Male sig * ns ns 5.2.5.1. ↑ or ↓ ↓ Wire test Latency to fall p-value 0.3275 0.026 0.5944 Female sig ns * ns ↑ or ↓ ↓ p-value 0.1186 0.0028 ns ** 5.2.6.1. Male sig Pole test ↑ or ↓ ↑

Time to p-value 0.4305 0.1984 descend Female sig ns ns ↑ or ↓ p-value 0.011 0.001 Male sig * *** 5.2.6.2. ↑ or ↓ ↑ ↑ Pole test % of Failures p-value 0.266 0.068 Female sig ns ns ↑ or ↓ Male p-value 0.2344 0.0028

162

sig ns ** 5.2.7.1. ↑ or ↓ ↑ Beam test p-value 0.0088 0.6429 Time to cross Female sig ** ns ↑ or ↓ ↑ p-value 0.5773 >0.999 ns ns 5.2.7.2. Male sig Beam test ↑ or ↓

Event p-value 0.0088 0.2698 Occurrence Female sig ** ns ↑ or ↓ ↑

163

Motor neuron counts of Hb9 V5-PFN1C71G mice

As transgenic Hb9 V5-PFN1C71G mice presented with motor deficits, we analysed motor neuron number in different regions of the spinal cords from these animals. Spinal cords were collected from perfused Wt and transgenic animals at the indicated age. All tissue was fixed in 4% PFA, processed through an ethanol gradient and xylene, cut into 2mm portions, paraffin embedded and sectioned. Wt and transgenic tissues were stained for

ChAT and imaged on a Zeiss Axioskop 40 with a 20x objective. ChAT-positive neurons were counted per ventral horn of the spinal cord. Analysis revealed that 1m old transgenic mice had significantly less ChAT-positive cells in cervical, thoracic, and lumbar regions when compared to Wt littermates (Fig 5.2.10.1. A-C) . We next analysed 18m old spinal cords and found that 18m old transgenic mice also have significantly less motor neurons in cervical, thoracic, and lumbar regions of spinal cords

(Fig 5.2.10.1. D-F) (Brettle et al. 2019). Data were analysed with unpaired students t- test and graphed with SEM (*p≤0.05, **p≤0.01, ****p≤0.0001). Transgenic animals universally have less motor neurons than Wt littermates.

164

Figure 5.2.10.1. Transgenic animals have less motor neurons than wild type littermates

5.2.10.1 Sections were stained for ChAT and positive cells were counted. Transgenic (Tg) Hb9

V5-PFN1C71G animals had significantly less motor neurons at 1 and 18m old

timepoints in cervical, thoracic, and lumbar regions pf the spinal cord (A-F). Data

were analysed with unpaired student t-test; *p≤0.05, **p≤0.01, ****p≤0.0001;

graphed with SEM. N = 3-5 mice, 11-41 sections (Brettle et al. 2019).

Table 5.4: Significance summary of motor neuron counts

Motor neuron counts Wt vs Tg Sig p-value Cervical * 0.0205 1m old Thoracic **** <0.0001 Lumbar **** <0.0001 Cervical ** 0.0031 18m old Thoracic **** <0.0001 Lumbar ** 0.0016

165

Aged transgenic mice presented with a split weight phenotype (section 5.2.2.) and different performances on RotaRod (section 5.2.3.). To analyse whether these mice had differences in motor neuron numbers in the spinal cord, we analysed thoracic motor neurons in the spinal cords of 16m old mice. Counts of ChAT-positive neurons showed that there was no significant difference between transgenic normal weight and transgenic low weight mice (Fig 5.2.10.2). Data were analysed with unpaired students t- test and graphed with SEM (p-value 0.7967). Despite aged transgenic mice presenting with different weight and motor phenotypes, there was no difference in motor neuron number in the spinal cords of these mice.

Figure 5.2.10.2. No difference in motor neuron counts between low weight and normal weight transgenic Hb9 V5-PFN1C71G mice

5.2.10.2 ChAT-positive motor neurons were analysed in 16 m old transgenic (Tg) normal

weight (NW) and Tg low weight (LW) Hb9 V5-PFN1C71G mice. There was no

significant different between the 2 groups (A). Data were analysed with unpaired

student t-test; graphed with SEM. N = 3 mice, 20-29 sections.

166

Evidence of pathology in Hb9 V5-PFN1C71G mice

To assess if Hb9 V5-PFN1C71G mice had evidence of pathology, we looked at ChAT and TDP-43 intensity, and for evidence of gliosis. Spinal cords and brains were collected from perfused Wt and transgenic animals at the indicated age. All tissue was fixed in 4% PFA, processed through an ethanol gradient and xylene, paraffin embedded and sectioned. Wt and transgenic tissues were stained for TDP-43 (green) and ChAT

(red). Exemplary images of spinal cords from 1 and 18m old mice show ChAT (red) positive neurons counterstained with TDP-43 (green) (Fig 5.2.11.1. A-F). Fluorescence intensity of cytoplasmic ChAT was measured in Image J. Motor neurons from transgenic 1m old mice had significantly lower expression levels of ChAT when compared to Wt littermates (Fig 5.2.11.2. A). This was conserved at the 18m timepoint, with transgenic motor neurons also expressing significantly less ChAT (Fig 5.2.11.2.

B). Data were analysed with unpaired students t-test and graphed with SEM

(****p≤0.0001).

Fluorescence intensity of nuclear and cytoplasmic TDP-43 was measured in Image J.

The nuclear to cytoplasmic ratio (NCR) was calculated by dividing nuclear TDP-43 by cytoplasmic TDP-43. At 1m old, transgenic mice had no significant differences in nuclear or cytoplasmic TDP-43 intensity or NCR (Fig 5.2.11.3. A-C). By 18m old, transgenic mice had significantly lower expression of nuclear and cytoplasmic TDP-43 when compared to Wt (5.2.11.3. D, E) (Brettle et al. 2019). However, the NCR in transgenic mice was comparable to Wt. Data were analysed with unpaired students t-test and graphed with SEM (**p≤0.01).

167

Figure 5.2.11.1. TDP-43 and ChAT images from 18m old Hb9 V5-PFN1C71G mice

5.2.11.1 Wt and transgenic (Tg) sections from 18m old Hb9 V5-PFN1C71G mice were stained

for ChAT (red) and TDP-43 (green) (A-F). Scale bars = 20µm (Brettle et al. 2019).

168

Figure 5.2.11.2. Motor neurons from transgenic Hb9 V5-PFN1C71G mice have lower ChAT expression

5.2.11.2 Transgenic (Tg) 1m and 18m old Hb9 V5-PFN1C71G mice had significantly lower

levels of ChAT signal intensity when compared with Wt littermates (A, B). Data were

analysed with unpaired student t-test; ****p≤0.0001; graphed with SEM. N = 3-5

mice, 81-97 cells (Brettle et al. 2019).

169

Figure 5.2.11.3. Motor neurons from aged transgenic animals have lower TDP-43 intensity

5.2.11.3 Transgenic 1m old Hb9 V5-PFN1C71G mice had no significant difference in nuclear or

cytoplasmic TDP-43 (TDP) intensity (A, B) or nuclear to cytoplasmic ratio (NCR)

when compared to Wt littermates (C). At 18m, Tg mice had significantly less nuclear

and cytoplasmic TDP in motor neurons (D, E). There was no significant difference in

NCR between Wt and Tg 18m old mice (F). Data were analysed with unpaired student

t-test; **p≤0.01; graphed with SEM. N = 3-5 mice, 81-97 cells (Brettle et al. 2019).

Table 5.5: Summary of statistics for ChAT and TDP-43 intensities

Sig p-value 1m ChAT Intensity **** <0.0001 18m ChAT Intensity **** <0.0001 1m TDP Nuclear Intensity ns 0.6701 18m TDP Nuclear Intensity ** 0.0014 1m TDP Cytoplamsic Intensity ns 0.5537 18m TDP Cytoplamsic Intensity ** 0.0011 1m Nuclear to Cytoplasmic Ratio ns 0.3354 18m Nuclear to Cytoplasmic Ratio ns 0.0979

170

To analyse if there was a correlation between low TDP-43 and low ChAT intensities, nuclear TDP-43 intensity was plotted against ChAT intensity. In Wt Hb9 V5-PFN1C71G mice, there was no significant correlation (Fig 5.2.11.4. A). In transgenic Hb9 V5-

PFN1C71G mice, a significant correlation between nuclear TDP-43 and ChAT levels was present (Fig 5.2.11.4. B) (p=0.001, ***).

Both young (1m) and aged (18m) transgenic mice showed reduced expression of ChAT in motor neurons. Young transgenic mice did not have significant changes in TDP-43 expression in motor neurons. However, aged mice had significant lower levels of TDP-

43 in both the nucleus and cytoplasm. In aged transgenic mice, the motor neurons that had lower ChAT intensity also had lower TDP-43 intensity.

Figure 5.2.11.4. Transgenic motor neurons with low ChAT intensity also tend to have lower TDP-43 intensity

5.2.11.4 TDP-43 and ChAT intensities were plotted to determine the correlation (A, B). There

was a significant correlation between TDP-43 and ChAT intensity in motor neurons in

transgenic (Tg) Hb9 V5-PFN1C71G mice (B). Data were analysed with Pearson

correlation coefficients; ***p≤0.001. N = 3 mice, 81-97 cells.

171

Next, we analysed spinal cords for another hallmark of ALS pathology, microgliosis and astrogliosis. Wt and transgenic sections from 18m old Hb9 V5-PFN1C71G mice were stained for GFAP (a marker of astrocytes) (green) and Iba1 (microglial marker) (red) and imaged on a Zeiss Axioskop 40 with a 20x objective. Exemplary images of Wt and transgenic spinal cords are shown (Fig 5.2.11.5. A-F). The number of GFAP and Iba1 positive cells per 0.1mm2 were analysed. There was no significant difference in the number of astrocytes between Wt and transgenic mice (Fig 5.2.11.5. G). By contrast, transgenic mice had significantly more microglia than Wt mice (Fig 5.2.11.5. H). Data were analysed with unpaired students t-test and graphed with SEM (***p≤0.001).

Furthermore, the microglia show an activated morphology, which suggests that there is some neuroinflammation in the spinal cords of aged Hb9 V5-PFN1C71G transgenic mice.

Hb9 V5-PFN1C71G transgenic mice present with microgliosis, but not astrogliosis.

172

Figure 5.2.11.5. Spinal cords from aged transgenic Hb9 V5-PFN1C71G animals have microgliosis

173

5.2.11.5 Wt and transgenic (Tg) sections from 18m old Hb9 V5-PFN1C71G mice were stained

for GFAP (green) and Iba1 (red) (A-F). The number of GFAP and Iba1 positive cells

were counted per 0.1mm2. The number of astrocytes was comparable in both Wt and

Tg mice (G). Tg mice had significantly more microglia when compared to Wt

littermates (H). Data were analysed with unpaired student t-test; ***p≤0.001; graphed

with SEM. N = 3 mice, 20-33 sections.

174

Discussion

What impact does expression of V5-PFN1C71G in motor neurons during mouse development have on adult mice? This is the question we sought to answer in this

Chapter. We characterised the expression timeline of V5-PFN1C71G in Chapter 4 and confirmed by 1m of age, V5-PFN1C71G Tg mice had no expression of the transgene. In this Chapter we confirmed that 3m, 6m, 12m and 18m old mice had no evidence of transgene expression (Fig 5.2.1.1.).

During the process of breeding the Hb9 V5-PFN1C71G mouse line, we observed that Tg animals were smaller than Wt littermates. To quantify this, we analysed the weights of

Tg and Wt mice. From 1-3m, both male and female Tg mice weighed significantly less than Wt littermates (Fig 5.2.2.1.). After 3m, Tg mice seemed to catch up in weight, but this was not consistent, and data showed two distinct weight phenotypes in mice that were 6m and older (Fig 5.2.2.2.). By the age of 6m, the weights of one group of Tg mice were comparable to Wt mice. These mice were classified as NW Tg. The other group of Tg mice appeared to plateau and did not gain much weight after the 6m timepoint, these mice were classified as LW Tg. These weight patterns were similar for male and female mice. Although, NW Tg male mice had a significant decrease in weight when compared to Wt mice at 14m and 16m old (Fig 5.2.2.2.). This decrease in weight could be similar to the decline in weight noted in other ALS mouse models

(Yang et al. 2016, Fil et al. 2017), however, these mice did not present with a clear paralysis.

The observed effects on weight were not specific to individual litters of mice, with litters yielding both NW and LW Tg mice. It is not clear what causes this heterogeneity in weight. At earlier ages, Tg mice consistently have a lower weight than Wt, and the

175

data is well grouped. If the weights of LW low weight transgenic mice are traced back to 1-3m old, the phenotypic outcome cannot be determined. There is no clear way to predict which transgenic mice plateau in weight and which will catch up to the weight of Wt controls. The factor that further confounds these findings is that there is no V5-

PFN1C71G expression in adult mice. In Chapter 4, we presented data showing a split phenotype in brain development in embryonic transgenic mice (Fig 4.2.5.1.), that did not appear to be carried into 1m old transgenic mice (Fig 4.2.5.2.). It is possible that there is an additional subtle phenotype in a subset of transgenic mice, and that this could contribute to the observed weight differences.

Monitoring the body weight of mouse models of ALS is common and can coincide with the development of motor deficits (Yang et al. 2016, Fil et al. 2017). In some models, transgenic mice do have a lower weight at young ages. A study by Henriques and colleagues reported that a small portion of their SOD1G93A mice had a reduced copy number of SOD1 and presented with a delayed weight loss phenotype (Henriques et al.

2010). This indicates that heterogeneity in weight may be present in mouse models of

ALS but could be rare or sparsely reported.

We assessed the motor performance of Hb9 V5-PFN1C71G mice with an array of motor tests. RotaRod revealed the most consistent results, with male mice showing deficits from 1-3m and females had deficits at 2 and 3m old (Fig 5.2.3.1.). Other tests, such as hanging wire test and fore limb grip strength, showed some indication of motor deficits, but lacked consistency in results.

Female transgenic 1m old mice had significantly lower fore limb grip strength than Wt controls, but this contrasted with the RotaRod performance of these mice, as they performed similar to Wt controls (Fig 5.2.4.1.). When mice were tested for strength and

176

endurance on Wire test, deficits were found in male 1m and female 2m old transgenic mice, while other timepoints showed no significant difference (Fig 5.2.5.1.).

Pole and beam tests were utilised to test balance, coordination and fine motor control.

The male Hb9 V5-PFN1C71G transgenic mice had some deficits on pole and beam, particularly at the 6m timepoint (Fig 5.2.6.1., 5.2.6.2., 5.2.7.1 and 5.2.7.2.).

Comparatively, female transgenic mice had less evidence of a motor phenotype when challenged with these tasks, indicating a sex different in motor phenotype.

When taken as a whole, it is clear that Hb9 V5-PFN1C71G mice have some motor deficits when compared to Wt controls (Table 5.3). These deficits are present despite no expression of V5-PFN1C71G in adult mice (Fig 5.2.1.1.). This indicates that expressing

V5-PFN1C71G during development is sufficient to alter the motor function of V5-

PFN1C71G transgenic mice. Due to the combination of motor deficits across the various motor functions tests, it appears that the balance and coordination of transgenic mice are impacted more than strength. As ALS is a neurodegenerative disease, the finding that alterations to the development of motor neurons in transgenic mice can result in motor deficits, is novel. Overall, the male mice appear to have a more pronounced weight and motor phenotype than female mice. In some cases, such as the split weight phenotype, male mice present with a change earlier than female, but over time both sexes show similar trends. There is a possibility that there is some hormonal protection in female mice. Although there is no overall difference in prognosis of male and female ALS patients (Gordon 2013), estrogen has been shown to have some neuroprotective properties and promote neurogenesis (Singer et al. 1996, Suzuki et al. 2007, Zhao and

Brinton 2007).

177

To further classify the long-term impact of the most consistent phenotype in Tg mice, we looked at RotaRod performance in aged Hb9 V5-PFN1C71G mice. For analysis, we separated our transgenic mice into low weight and normal weight groups to see if they presented with a similar motor phenotype. Mice were analysed at 6m, 8m, 14m and 16m old. With the exception of 6m old females, all time points showed a consistent trend, with transgenic normal weight mice presenting with a deficit when compared to Wt controls or low weight transgenic mice (Fig 5.2.3.2.). The initial study design did not account for a split weight and motor phenotype, as a result despite consistent trends, significance was only reached at certain timepoints (summarised in Table 5.2). The performance of the normal weight transgenic mice is similar to data from another study from our laboratory. Van Hummel and colleagues showed that iTDP-43A315T mice had an average latency to fall of 34.1±3.2sec (van Hummel et al. 2018). In comparison, Hb9

V5-PFN1C71G normal weight transgenic mice had an average latency to fall of 42.83 ±

2.9sec at 6m and 8m old, and 32.2 ± 2.8sec at 14m and 16m old. In general, the motor performance of low weight transgenic mice was comparable to Wt controls. Normal weight transgenic mice consistently performed worse than Wt controls and low weight transgenic mice.

When we analysed the survival of the Hb9 V5-PFN1C71G mouse line, we found that there was a significant reduction in survival of transgenic mice (Fig 5.2.8.1.). Despite seeing evidence of motor deficits, this did not progress to a full paralysis of the mice.

However, there were occasions that mice were found dead in cages or that had considerable weight loss, and subsequently had to be euthanised due to ethics. This reduction in survival was specific to female mice (Fig 5.2.8.1.). This finding was perplexing given that male mice showed a more pronounce weight and motor

178

phenotype. Prognostic studies of ALS have shown that bulbar onset ALS, a more aggressive form than limb onset, is more frequent in older women (Chio et al. 2009).

The impact of expressing V5-PFN1C71G in motor neurons during development is substantial, with transgenic mice presenting with significant motor deficits. These motor deficits appear in 1m old transgenic mice and continue throughout the life of the animals. This indicates that expression of V5-PFN1C71G may do irreparable damage during development which cannot be compensated for later in life. The effects of altered development are highlighted by the significant reduction in survival of female mice.

The exact reason for this decrease is unclear as neither male or female mice presented with quantifiable paralysis.

To elucidate the cause of the motor deficits in Hb9 V5-PFN1C71G mice, we analysed spinal cords to establish if transgenic mice had histopathological changes when compared with Wt littermates. Motor neuron counts in the cervical, thoracic and lumbar regions revealed the transgenic mice had significantly less motor neurons than Wt at 1m old (Fig 5.2.10.1.). Motor neurons in 1m old mice were reduced by 27.8%, 32.7% and

33.6%, in cervical, thoracic and lumbar regions respectively. At 18m, the number of motor neurons was also significantly reduced in all three regions in transgenic mice when compared to WT littermates (Fig 5.2.10.1.). The percentage in reduction of motor neurons was more substantial in the 18m old transgenic animals in the cervical and thoracic regions with a reduction of 40.1% and 44% respectively. The reduction in the lumbar region in 18m old transgenic mice was comparable with the 1m old transgenic mice, with a loss of 34.8%. Motor deficits start in Hb9 V5-PFN1C71G mice at 1m of age and persists throughout the life of the animal. The observed global reduction in the number of motor neurons in the spinal cords of transgenic mice appears to coincide with the presence of motor deficits. 179

While characterising the motor profile of the Hb9 V5-PFN1C71G mice, two distinct phenotypes were identified. Normal weight transgenic mice had motor deficits, while the RotaRod performance of low weight transgenic mice was comparable to Wt controls.

To address if the motor neuron counts of low weight and normal weight transgenic Hb9

V5-PFN1C71G mice differed, we analysed the motor neuron counts in spinal cords from these mice. We found that there was no significant difference in motor neuron number

(Fig 5.2.10.2.). Although low weight transgenic mice do not have motor deficits, they presented with a comparable number of motor neurons to normal weight transgenic mice. This indicates that the loss of motor neurons was not the sole cause of the motor deficit present in normal weight transgenic mice, unless the weight disparity was confounding the data. RotaRod performance has an inverse relationship with weight

(Mao et al. 2015). To test the true motor function of low weight transgenic mice, they would need to be paired with weight matched controls. However, to do this experimentally with genetic and age matched controls would be difficult. If the sample size was larger it would be possible to calculate the impact of body weights on RotaRod performance in the existing groups. Then the predicted performance of lighter Wt controls could be extrapolated and compared to low weight transgenic mice. The N numbers would need to be larger than we have for this study and the data would need to show a linear relationship. To further elaborate on the impact of the observed motor neuron loss, future studies could address NMJs and muscle fibres in the Hb9 V5-

PFN1C71G mice.

After confirming a reduction of motor neurons in transgenic spinal cords, they were analysed for the presence of pathology. Motor neurons from both 1m and 18m old Hb9

V5-PFN1C71G mice had reduced ChAT signal intensity when compared with Wt 180

littermates (Fig 5.2.11.2.). A reduction of ChAT expression is a hallmark of ALS and can be indicative of a loss of NMJs (Casas et al. 2013, Fil et al. 2017). To further characterise the feature of the ChAT-positive neurons, we analysed the levels of nuclear and cytoplasmic TDP-43. The levels of TDP-43 were unchanged in the nucleus and cytoplasm in ChAT-positive neurons in 1m old transgenic mice (Fig 5.2.11.3.).

However, ChAT-positive neurons from 18m old transgenic mice had a reduction of both nuclear and cytoplasmic TDP-43 (Fig 5.2.11.3.). Although no cytoplasmic inclusions were found in transgenic motor neurons, a global reduction could impact TDP-43 function. This reduction could be due to several reasons, such as an increased clearance of TDP-43, or a downregulation of TDP-43 translation (Ke et al. 2015). Homozygous

TDP-43 KO mice are embryonically lethal at E7.5 and heterozygous mice have motor deficits (Kraemer et al. 2010). In zebrafish, TDP-43 knockdown results in reduced motor neuron outgrowth (Schmid et al. 2013) and a downregulation of TDP-43 can induce neuronal death (Igaz et al. 2011).

When the correlation between ChAT and nuclear TDP-43 was analysed in 18m old Hb9

V5-PFN1C71G mice, it revealed that transgenic mice had a significant correlation between ChAT and TDP-43 expression levels (Fig 5.2.11.4.). Motor neurons that had lower ChAT expression also had lower expression of TDP-43. Our finding of a reduction of TDP-43 in the motor neurons of aged Hb9 V5-PFN1C71G mice is different to the TDP-43 pathology in the Prp-PFN1G118V mice (Fil et al. 2017). We had not previously observed a TDP-43 pathology in Hb9 V5-PFN1C71G mice. TDP-43 usually has a nuclear localisation, and in ALS, it localises to the cytoplasm, resulting in a decrease in the nuclear to cytoplasmic ratio of TDP-43 (Barmada et al. 2010). The study by Fil and colleagues reported that their mouse model was positive for TDP-43 pathology (Fil et al. 2017). However, the images show that the non-transgenic mice also

181

had a large presence of cytoplasmic TDP-43 in motor neurons. The only difference in the appearance of TDP-43 stains in transgenic and Wt Prp-PFN1G118V mice is that there may be some evidence of aggregation in the cytoplasm of motor neurons in transgenic mice, but this is subjective. Expression of mutant PFN1 has been associated with cytoplasmic TDP-43 inclusions in vitro (Tanaka and Hasegawa 2016), but to date there is no convincing data published on the presence of TDP-43 pathology in in vivo models of PFN1/ALS (Yang et al. 2016, Fil et al. 2017). To our knowledge, the present study is the first report detailing a global reduction of TDP-43 in motor neurons of a mouse model of ALS with a PFN1 mutant.

Next, we investigated whether Hb9 V5-PFN1C71G mice exhibited gliosis. Spinal cords from 18m old transgenic mice showed evidence of microgliosis, but not astrogliosis

(Fig 5.2.11.5.). Microgliosis and astrogliosis have been noted in multiple mouse models of ALS as well as in clinical samples (Alexianu et al. 2001, Neumann et al. 2006,

Philips and Rothstein 2014). The debate about the role of microglia in disease progression is heavily debated. Whether the role of microglia is detrimental or beneficial appears to depend on very specific circumstances (Apolloni et al. 2013,

Spiller et al. 2018). At this stage it is unclear why the Hb9 V5-PFN1C71G mice present with selectively microgliosis without astrogliosis. Future studies could focus on understanding why this pathology is present.

The novel Hb9 V5-PFN1C71G mouse model presented with evidence of motor deficits and some pathology. The motor deficits do not progress to paralysis, and although survival is impacted, the survival curve is not typical of an ALS phenotype. However,

ALS is a disease that presents with heterogeneity. The Hb9 V5-PFN1C71G mice do show evidence of heterogeneity in the developmental and adult mouse phenotypes. A lower penetrance of disease could explain the survival curve of the female mice. Another 182

explanation of the variability in the transgenic phenotype could be the differences in motor end plate expansion. A characterisation of SOD1G93A mice showed that a portion of mice had a preferential loss of motor units in large motor neurons (Hegedus et al.

2007). Other studies have noted that motor decline can be delayed due to compensatory motor unit expansion in another subset of neurons (Schaefer et al. 2005). A combination of preferential motor unit loss and/or expansion could contribute to the heterogeneity of the phenotype in the V5-PFN1C71G transgenic mice. This could be addressed in future studies. Comparing mouse models can give insight to disease progression. For instance, analysis of split phenotypes in mouse models generates novel insights into overall disease pathogenesis (Henriques et al. 2010). Studies identifying the points of divergence for each split phenotype presented in the Hb9 V5-PFN1C71G mouse line would aid the understanding of ALS pathogenesis.

183

Chapter 6:

Discussion

184

6 Discussion

Mutations in PFN1 cause fALS (Wu et al. 2012). This Thesis aimed to generate tools to study the impact of V5-PFN1C71G expression in vitro and in vivo. We aimed to generate and characterise a novel PFN1/ALS mouse model of disease in order to elucidate the impact of ALS-associated PFN1C71G expression in α-motor neurons.

The neuronal subtype specific effect of PFN1C71G

Comparison of V5-PFN1C71G expression in different neuronal subtypes has shown that it has a differential impact on cell morphology (Wu et al. 2012, Brettle et al. 2015). The function of PFN1 is complex and intricate. To better understand PFN1 function, a variety of factors need to be controlled and investigated. This includes expression levels, method of inducing expression, cell types studied, and stage of development of cells and/or animals. One rule does not fit all. The heterogeneity of both neurons and the disease progression of ALS presents an enigma that is difficult to decode. The improved motor neuron culture, plasmids, viruses and the mouse model, generated as part of this

Thesis, are tools that will be able to be used in future studies. For instance, the optimised protocol for cultures with enriched motor neurons, presented in Chapter 3, uses E13.5 embryos. As Hb9 V5-PFN1C71G transgenic mice express mutant PFN1 at

E13.5, cultures from these embryos provide the means to study V5-PFN1C71G expression in motor neurons in vitro. The findings from these in vitro studies can then be compared to the in vivo effects of the mutant PFN1 expression in the embryos and mice.

Expression of PFN1C71G has a cell subtype specific impact on neuronal outgrowth (Wu et al. 2012, Brettle et al. 2015). We have shown that PFN1C71G expression increases dendritic spine density in cultured hippocampal neurons (Fig 3.2.1.2.). This is despite 185

PFN2a being the most abundant profilin isoform, as opposed to PFN1 (Murk et al.

2012). This finding is important as ALS patients changes in extra-motor areas of the brain, and yet degeneration occurs in motor neurons (Gordon 2013, Abdulla et al.

2014). An increased dendritic density could be indicative of increased excitability. The

Hb9 V5-PFN1C71G mouse model, presented in Chapter 4 and 5, showed evidence of motor deficits that were likely caused by morphological changes in the developing mouse due to the expression of PFN1C71G in α-motor neurons. Future studies should focus on the morphological and electrophysiological impact of V5-PFN1C71G expression on different neuronal subtypes, including motor neurons, both in vitro and in vivo. The tools generated in this thesis, including the primary motor neuron culture and the Hb9

V5-PFN1C71G mouse model, will be beneficial for future studies.

Expression of V5-PFN1C71G causes a developmental phenotype

Expression of V5-PFN1C71G in motor neurons during development leads to morphological abnormalities. We showed that the brachial nerves had a reduced diameter as well as evidence of abnormalities in the formation of the posterior primordial cerebellum (Fig 6.1.1.1.). The brachial nerves were selected for this study as they could be reliably identified at identical branch points in the same plate of the embryos. Future studies should include lightsheet imaging of Wt and transgenic embryos and comparison of nerves throughout the embryo.

The reduced diameter of brachial nerves could be due to a decrease in neurite outgrowth. If there is a reduction of outgrowth, then one would expect that there would be a reduction in NMJ formation. Future studies should involve the embryonic dissection of muscles such as the gluteus maximus or the intercostal muscles, both of which are feasible to dissect at early developmental ages. What impact does the actin

186

cytoskeleton play in this developmental phenotype? The function of PFN1 is crucial for appropriate axonal pathfinding due to its role in recruiting G-actin to the leading edge of membranous structures (Lee et al. 2013). Identifying if V5-PFN1C71G can still alter G- actin localisation would help to answer why V5-PFN1C71G mice have a developmental phenotype.

There is indication that a reduction in brachial nerve thickness is actin dependent. A conditional KO of Rac1 in motor or sensory neurons resulted in thinner axonal bundles in the fore and hind limbs of E13.5 embryos (Hua et al. 2015). Rac1 is involved in actin dynamics and axonal outgrowth (Causeret et al. 2004). Rac1 and Cdc42 are both Rho

GTPases, and while they have some cross-over in function, they also have distinct differences (Chi et al. 2013, Schulz et al. 2016). Cdc42 enhances actin nucleation in a

PFN1 dependent manner (Yang et al. 2000). There is only one study that analyses the functional role of PFN1 on Rac1 and Cdc42-dependent actin organisation (Suetsugu et al. 1999). Suetsugu and colleagues showed that an actin deficient PFN1 mutant suppressed Cdc42-induced microspike formation and Rac1-dependent membrane ruffling (Suetsugu et al. 1999). Expression of V5-PFN1C71G and conditional KO of Rac1 have similar effects on developing axonal bundles in mouse embryos. Additional work needs to be done to classify the impact of V5-PFN1C71G expression on Rac1 and Cdc42 related actin filament populations.

187

Figure 6.2.1.1. Summary of developmental phenotype

6.2.1.1 Hb9 V5-PFN1C71G mice express the transgene from E10.5-E14.5 and P0. At E14.5,

transgenic embryos have a reduction in the diameter of brachial nerves and some

transgenic mice have brain abnormalities. These gross abnormalities are not apparent

at 1m old; however, a loss of Mendelian inheritance is observed.

The abnormalities in the cerebellum require a separate follow up. The number of mice in the study needs to be increased and the impact of V5-PFN1C71G expression on migration needs to be addressed. Embryos could be analysed to see if there is a correlation between expression levels of V5-PFN1C71G and the presence of abnormalities. To elucidate if these abnormalities lead to the shift away from Mendelian inheritance, future studies could utilise MRI for a longitudinal study (Nieman and

Turnbull 2010). Embryos should be imaged and monitored in utero to visualise the size of ventricles over time. The number of mice surviving after birth could also be analysed and compared to the number of embryos with changes to brain development detected in utero.

The presence of these brain abnormalities could indicate that V5-PFN1C71G expression impacts cell motility due to a loss of function of PFN1. PFN1 conditional KO mice have a reduction in the radial migration of cerebellar granule neurons (Kullmann et al. 2015). 188

This impact could be due to the role that PFN1 plays through actin binding, or through interactions with other proteins such as Cdc42 or Ena/VASP (Ding et al. 2012). This is despite the clear role that PFN1 plays in migration, as is evident from the plethora of studies of the impact of PFN1 on non-neuronal cell types and cancer metastasis (Ding et al. 2006, Ding et al. 2009, Ding et al. 2012, Choi et al. 2014, Ding et al. 2014). There is currently no literature on the impact of ALS-associated PFN1 mutants on cell migration.

The data in this Thesis is the first suggestion that ALS-associated PFN1 mutations may impact cell motility.

Phenotypes in Hb9 V5-PFN1C71G mice are only partially reversed when

transgene expression is switched off

Perhaps the most significant contribution of this study is that expressing V5-PFN1C71G during development, results in motor deficits throughout the life of the mouse. This shows that altering the development of the animal has consequences that cannot be resolved by simply turning off the expression of the transgene. This leads to the question, when does ALS pathogenesis begin? Familial cases present 10 years earlier than sporadic cases. ALS is proposed to be a multi-step process and having a familial form of disease reduced the number of steps needed for the onset of the disease (Chio et al. 2018). Although ALS is a neurodegenerative disease, in recent years ideas the field of neurodegeneration has been shifting this dogma. Subtle pre-symptomatic changes have changed what we know about Alzheimer’s disease. It is not clear when the disease begins, and some researchers posit that it begins early in life (Ohm 1997, De la Torre

2002, Lahiri et al. 2007, Fox 2012). It is possible that neurodevelopmental abnormalities play a role in ALS pathogenesis. Part of the reason that fALS requires

189

less steps to initiate disease could be due to the genetic impact during development, which is a tightly regulated process.

Figure 6.3.1.2. Summary of phenotype in adult mice

6.3.1.1 Adult Hb9 V5-PFN1C71G mice do not express the transgene. Despite this, they present

with a weight and motor phenotype from 1-3m old. At 1m old, they have less motor

neurons and lower ChAT intensity than Wt littermates. At 6m old, they display a split

weight phenotype. Low weight transgenic mice do not have a motor deficit, but

normal weight transgenic mice do. By 18m, the number of motor neurons is reduced

and the intensity of ChAT and TDP-43 is less than Wt littermates. Spinal cords of

these aged mice also have microgliosis.

The Hb9 V5-PFN1C71G mice in our study do not progress to the point of paralysis. They did however show evidence of pathology. Despite both young and aged mice presenting with reduced ChAT levels and motor neuron numbers, only aged mice had a reduction of nuclear and cytoplasmic TDP-43 in motor neurons. In addition to this reduction, aged mice had microgliosis in the ventral horns of spinal cords.

Transgenic mice had a global reduction of motor neurons at 1 and 18m of age when compared to Wt controls (Fig 5.2.10.1.). By 18m of age, the reduction was more 190

pronounced, indicating that the motor neurons are continuing to degenerate after transgene expression has ceased. The change in TDP-43 expression between 1m and

18m supports this notion. At this stage it is unclear what initiated this change in TDP-43 expression. A reduction in nuclear TDP-43 is toxic to neurons due to a dysregulation of mRNA in the cells (Igaz et al. 2011, Polymenidou et al. 2011, Highley et al. 2014). The microgliosis could be a result of the degenerating neurons initiating a microglial response. It would be beneficial to establish a timeline of ChAT and TDP-43 expression stretching from embryonic stages into young and aged mice. Laser microdissection could be used in combination with RT-qPCR to quantitatively characterise the expression levels in motor horn of neural tubes and spinal cords. This would provide important information about the exact timeline of the pathology in these mice.

Although the Hb9 V5-PFN1C71G mice presented with pathology, they did not always have an aggressive palliative disease reminiscent of classical ALS. To answer if the developmental expression of V5-PFN1C71G could predispose mice to ALS, Hb9 V5-

PFN1C71G mice could be crossed with other ALS mouse models and analysed for symptom onset, mortality rates, and disease progression. For instance, they could be crossed with iTDP-43A315T or SOD1G93A mice which show classical symptoms of ALS.

If crossing the Hb9 V5-PFN1C71G mice decreases the age of symptom onset or increases the aggressiveness of the phenotype, it would support the notion that developmental dysfunction contributes to ALS pathogenesis.

Classification of risk factors is a challenging process with many confounding factors. It is difficult to decipher if neurodevelopmental differences are risk factors for ALS.

Studies have shown that season of birth can impact the prevalence of ALS (Kondo and

Fujiki 1989, Ajdacic-Gross et al. 1998, Pamphlett and Fang 2012). The study by

191

Ajdacic-Gross and colleagues, posits that the prevalence of ALS is increased in people born in spring and early summer (Ajdacic-Gross et al. 1998). They also discuss the variable impacts that could cause these differences in prevalence. This includes the impact of infectious diseases, nutrition, availability of light and the subsequent impact on melatonin, and environmental considerations. Exposure to any of these additional features, either pre or post-natally, could be the cause for the difference in seasonal preference. They also claim that “Risk factors in ALS can be acquired very early in life, thus introducing a long latency period” (Ajdacic-Gross et al. 1998). Pamphlett and Fang suggested that their data show similar patterns as the studies from the Northern hemisphere (Pamphlett and Fang 2012). However, comparison of the Australian and

Swedish data doesn’t seem to show this (Ajdacic-Gross et al. 1998, Pamphlett and Fang

2012). Although the study by Pamphlett and Fang claims to have corrected for the northern hemisphere seasons, it shows the peaks of the Swedish data as being in autumn to early winter (Pamphlett and Fang 2012). Whereas the paper by Ajdacic-Gross and colleagues shows a peak in incidence in people born from spring to early summer

(Ajdacic-Gross et al. 1998).

Nonetheless, the study by Pamphlett and Fang shows a seasonal impact on the prevalence of ALS and attempts to correlate this with changes in weather and humidity

(Pamphlett and Fang 2012). This emphasises the complexity of classifying risk factor and highlights that we are a long way from having a full understanding of ALS pathogenesis.

ALS is a neurodegenerative disease, but are we overlooking the impact that neurodevelopment may have on the risk of developing ALS? Expression of V5-

PFN1C71G during development appears to do irreversible damage that results in split

192

weight and motor phenotypes in adult mice. Analysis of collaborative cross mice revealed potential genetic loci associated with reduced weight and poor RotaRod performance (Mao et al. 2015). Repulsive guidance molecule family member a (RGMa) was an identified gene that was associated with ALS via a GWAS or association study

(Mao et al. 2015). RGMa has been implicated in Parkinson’s disease and inhibition of

RGMa has been associated with increased regeneration after stroke and spinal cord injury (Hata et al. 2006, Mothe et al. 2017, Zhang et al. 2018). In addition to its role in outgrowth, RGMa is important in neurodevelopment (Brinks et al. 2004, Matsunaga and

Chédotal 2004, Wilson and Key 2006).

The Hb9 V5-PFN1C71G mice present with alteration in both weight and on RotaRod.

The split phenotype complicates the interpretation. However, it is clear that the performance of these mice has been altered by expression of V5-PFN1C71G early in development. The mice do not recover after expression has ceased. This model suggests that more investigation needs to be done into the developmental impact of ALS- associated mutations.

The cytoskeleton and ALS pathogenesis

The data presented in Chapter 4 showed a decrease in brachial nerve diameter, indicative of a decrease in the outgrowth of motor neurons. The formation of NMJs and circuitry could be altered. This notion is supported by the data in Chapter 5, showing that mice presented with motor deficits and a decreased ChAT expression in the motor neurons in transgenic mice compared to Wt controls. If the outgrowth of the nervous system is impacted, and subsequently, the circuitry of the mouse, could this predispose the animal to future degeneration? Perhaps in younger mice, compensatory mechanisms can counter this impact, so that the mice can survive, albeit weaker than the Wt

193

littermates. In the case of Hb9 V5-PFN1C71G mice, there is some evidence of late stage pathogenesis with a reduction of TDP-43 expression and presence of gliosis.

PFN1 is traditionally known as an ABP (Kwiatkowski and Bruns 1988). How ALS- associated PFN1 mutations cause fALS has not been established. It has been suggested that these PFN1 mutants cannot bind to actin (Wu et al. 2012). Subsequent papers have shown that the mutants can still bind to actin as they continue to have an inhibitory role on actin polymerisation in high concentrations (Boopathy et al. 2015). The growth cone of motor neurons expressing PFN1 mutants have decreased f-actin, which supports the notion that PFN1 mutants are deficient in their role of enhancing actin filament formation in combination with formin (Romero et al. 2004, Wu et al. 2012). However, in vivo data from Prp-PFN1G118V shows an abundance of F-actin in end stage paralysed mice. These confounding data make it difficult to determine how these mutations impact on actin dynamics. Further studies on with live-cell imaging of actin probes in neurons could help to elucidate the impact of PFN1 mutants on actin dynamics.

Neurite outgrowth and maintenance of NMJs require careful regulation of both actin and microtubules (Shi et al. 2012, Vitriol and Zheng 2012, Prokop 2013, Omotade et al.

2017). The regulation of actin and microtubule dynamics are not mutually exclusive.

Actin dynamics impact microtubules, and vice versa (for review see (Dogterom and

Koenderink 2018)). ALS-associated PFN1 mutations inhibit microtubule dynamics

(Henty-Ridilla et al. 2017). Given that PFN1 can impact the rate of microtubule turnover (Nejedla et al. 2016), this is not surprising. Furthermore, when PFN1 cannot properly regulate microtubule turnover, the dynamics of actin are altered (Nejedla et al.

2016). This highlights the importance of understanding the impact of PFN1 mutants in the context of both actin and microtubule dynamics.

194

Mutations in PFN1, TUBA4A and KIF5A all cause fALS. Abnormalities in the brachial nerve of transgenic Hb9 V5-PFN1C71G mice could be due to altered dynamics in actin, tubulin or molecular motors. Actin rich areas in neurons can inhibit the movement of molecular motor carrying axonal cargos (Sood et al. 2017). Future studies should focus on dissecting how PFN1 mutants impact each cytoskeletal system.

Of course, the potential impact of PFN1 mutants on axonal outgrowth and pathfinding has other implications when considering ALS and axonal degeneration. Although the

Hb9 V5-PFN1C71G transgenic mice do not present with an overt ALS phenotype, they do show evidence of motor deficits despite the restricted expression of the transgene.

So, what does this mean in the broader context of ALS?

Axonal degeneration is a feature present in ALS pathology. This is not surprising when the factors that impact axonal degeneration include altered proteostasis, inflammation, and alteration to stress (Yaron and Schuldiner 2016, Salvadores et al. 2017). Early markers of axonal degeneration have been observed in pre-symptomatic SOD1 transgenic mice (Jaarsma et al. 2000, Maglemose et al. 2017). This axonal degeneration can be driven by alterations to potassium channels, defective axonal transport, altered metabolism and increased inflammation (Fischer et al. 2004, Jiang et al. 2005, Yaron and Schuldiner 2016, Maglemose et al. 2017). Alterations to the morphology of motor neurons could also play a role in the pre-symptomatic changes that help to drive axonal degeneration. Dendritic morphology primes the potential of lower motor neurons to receive input from the brain. Alterations to dendritic morphology are also present in

ALS (Fogarty et al. 2016, Kanjhan et al. 2016, Fogarty et al. 2017). A classic regulator of dendritic morphology is the actin cytoskeleton. Actin regulation can impact both neurodevelopmental changes as well as changed during the remodelling of neurons that

195

can occur during axonal degeneration (Matus 2000). Multiple factors can impact actin- mediated changes to dendritic morphology including changes to actin associated proteins, glutamate receptors and calcineurin (Halpain et al. 1998, Fischer et al. 2000,

Kim et al. 2006). Glutamate receptors can impact both dendritic morphology and the initiation of axonal degeneration in ALS (Foran and Trotti 2009, Fogarty et al. 2016).

This highlights the cross-talk between axonal degeneration and actin-mediated dendritic morphology of α-motor neurons. Given that Hb9 V5- PFN1C71G transgenic mice present with some classical symptoms of ALS, it would be interesting to investigate evidence of axonal degeneration in aging mice. Additionally, investigations into the impact that other ALS associated mutations have on neurodevelopment could contribute a greater understanding to the pleiotropic impact that these mutations have.

Concluding remarks

Neurite outgrowth, synaptic connections, NMJ formation and maintenance are all dynamic processes. Even if normal axonal outgrowth is impacted in development, then why isn’t it corrected or strengthened after the transgene expression has been switched off? If ALS is a multistep condition, and genetic mutations reduce the number of steps that need to be taken before the disease manifests (Chio et al. 2018), then it is not unlikely that alterations in development, a strictly regulated period, could have irreversible effects.

This study has generated novel and interesting results, which provide new leads for potential future studies to examine the impact that the cytoskeleton and neuronal development play in ALS. Although some studies look at early impacts in SOD1 models, these models do not allow for the dissection of these phenotypes. Early alterations have been found, but the long-term impact is hard to establish due to

196

prolonged expression of transgenes. When and how does ALS pathogenesis begin? The

Hb9 V5-PFN1C71G mouse model suggests that it begins much earlier than previously anticipated.

197

7 References

Abdulla, S., J. Machts, J. Kaufmann, K. Patrick, K. Kollewe, R. Dengler, H. J. Heinze, S. Petri, S. Vielhaber and P. J. Nestor (2014). "Hippocampal degeneration in patients with amyotrophic lateral sclerosis." Neurobiol Aging 35(11): 2639-2645. Ackermann, M. and A. Matus (2003). "Activity-induced targeting of profilin and stabilization of dendritic spine morphology." Nat Neurosci 6(11): 1194-1200. Agosta, F., A. Al-Chalabi, M. Filippi, O. Hardiman, R. Kaji, V. Meininger, I. Nakano, P. Shaw, J. Shefner, L. H. van den Berg, A. Ludolph and W. F. N. R. G. o. ALS/MND (2015). "The El Escorial criteria: strengths and weaknesses." Amyotroph Lateral Scler Frontotemporal Degener 16(1-2): 1-7. Ajdacic-Gross, V., J. Wang and F. Gutzwiller (1998). "Season of birth in amyotrophic lateral sclerosis." Eur J Epidemiol 14(4): 359-361. Akin, O. and R. D. Mullins (2008). "Capping protein increases the rate of actin-based motility by promoting filament nucleation by the Arp2/3 complex." Cell 133(5): 841- 851. Al-Chalabi, A., P. M. Andersen, P. Nilsson, B. Chioza, J. L. Andersson, C. Russ, C. E. Shaw, J. F. Powell and P. N. Leigh (1999). "Deletions of the heavy neurofilament subunit tail in amyotrophic lateral sclerosis." Hum Mol Genet 8(2): 157-164. Alexianu, M. E., M. Kozovska and S. H. Appel (2001). "Immune reactivity in a mouse model of familial ALS correlates with disease progression." Neurology 57(7): 1282- 1289. Apolloni, S., C. Parisi, M. G. Pesaresi, S. Rossi, M. T. Carri, M. Cozzolino, C. Volonte and N. D'Ambrosi (2013). "The NADPH oxidase pathway is dysregulated by the P2X7 receptor in the SOD1-G93A microglia model of amyotrophic lateral sclerosis." J Immunol 190(10): 5187-5195. Arber, S., B. Han, M. Mendelsohn, M. Smith, T. M. Jessell and S. Sockanathan (1999). "Requirement for the homeobox gene Hb9 in the consolidation of motor neuron identity." Neuron 23(4): 659-674. Arthur, K. C., A. Calvo, T. R. Price, J. T. Geiger, A. Chio and B. J. Traynor (2016). "Projected increase in amyotrophic lateral sclerosis from 2015 to 2040." Nat Commun 7: 12408. Aschauer, D. F., S. Kreuz and S. Rumpel (2013). "Analysis of transduction efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain." PLoS One 8(9): e76310. Atkinson, R. A. K., C. M. Fernandez-Martos, J. D. Atkin, J. C. Vickers and A. E. King (2015). "C9ORF72 expression and cellular localization over mouse development." Acta Neuropathologica Communications 3(1): 59. Austin, C. P. and C. L. Cepko (1990). "Cellular migration patterns in the developing mouse cerebral cortex." Development 110(3): 713-732. Avossa, D., M. Grandolfo, F. Mazzarol, M. Zatta and L. Ballerini (2006). "Early signs of motoneuron vulnerability in a disease model system: Characterization of transverse slice cultures of spinal cord isolated from embryonic ALS mice." Neuroscience 138(4): 1179-1194. Ayers, J. I., S. Fromholt, O. Sinyavskaya, Z. Siemienski, A. M. Rosario, A. Li, K. W. Crosby, P. E. Cruz, N. M. DiNunno, C. Janus, C. Ceballos-Diaz, D. R. Borchelt, T. E. Golde, P. Chakrabarty and Y. Levites (2015). "Widespread and efficient transduction of spinal cord and brain following neonatal AAV injection and potential disease modifying effect in ALS mice." Mol Ther 23(1): 53-62.

198

Bae, Y. H., Z. Ding, L. Zou, A. Wells, F. Gertler and P. Roy (2009). "Loss of profilin-1 expression enhances breast cancer cell motility by Ena/VASP proteins." J Cell Physiol 219(2): 354-364. Balendra, R., A. Al Khleifat, T. Fang and A. Al-Chalabi (2019). "A standard operating procedure for King’s ALS clinical staging." Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration 20(3-4): 159-164. Bannwarth, S., S. Ait-El-Mkadem, A. Chaussenot, E. C. Genin, S. Lacas-Gervais, K. Fragaki, L. Berg-Alonso, Y. Kageyama, V. Serre, D. G. Moore, A. Verschueren, C. Rouzier, I. Le Ber, G. Augé, C. Cochaud, F. Lespinasse, K. N’Guyen, A. de Septenville, A. Brice, P. Yu-Wai-Man, H. Sesaki, J. Pouget and V. Paquis-Flucklinger (2014). "A mitochondrial origin for frontotemporal dementia and amyotrophic lateral sclerosis through CHCHD10 involvement." Brain 137(8): 2329-2345. Barmada, S. J., G. Skibinski, E. Korb, E. J. Rao, J. Y. Wu and S. Finkbeiner (2010). "Cytoplasmic Mislocalization of TDP-43 Is Toxic to Neurons and Enhanced by a Mutation Associated with Familial Amyotrophic Lateral Sclerosis." The Journal of Neuroscience 30(2): 639-649. Baron, D. M., L. J. Kaushansky, C. L. Ward, R. R. Sama, R. J. Chian, K. J. Boggio, A. J. Quaresma, J. A. Nickerson and D. A. Bosco (2013). "Amyotrophic lateral sclerosis- linked FUS/TLS alters stress granule assembly and dynamics." Mol Neurodegener 8: 30. Bartolome, F., H. C. Wu, V. S. Burchell, E. Preza, S. Wray, C. J. Mahoney, N. C. Fox, A. Calvo, A. Canosa, C. Moglia, J. Mandrioli, A. Chio, R. W. Orrell, H. Houlden, J. Hardy, A. Y. Abramov and H. Plun-Favreau (2013). "Pathogenic VCP mutations induce mitochondrial uncoupling and reduced ATP levels." Neuron 78(1): 57-64. Batra, R. and C. W. Lee (2017). "Mouse Models of C9orf72 Hexanucleotide Repeat Expansion in Amyotrophic Lateral Sclerosis/ Frontotemporal Dementia." Frontiers in Cellular Neuroscience 11(196). Beghi, E., C. Balzarini, G. Bogliun, G. Logroscino, L. Manfredi, L. Mazzini, A. Micheli, A. Millul, M. Poloni, R. Riva, F. Salmoiraghi, C. Tonini and E. Vitelli (2002). "Reliability of the El Escorial Diagnostic Criteria for Amyotrophic Lateral Sclerosis." Neuroepidemiology 21(6): 265-270. Bellingham, M. C. (2011). "A Review of the Neural Mechanisms of Action and Clinical Efficiency of Riluzole in Treating Amyotrophic Lateral Sclerosis: What have we Learned in the Last Decade?" CNS Neuroscience & Therapeutics 17(1): 4-31. Bensimon, G., L. Lacomblez, J. C. Delumeau, R. Bejuit, P. Truffinet, V. Meininger and A. L. S. S. G. Riluzole, II (2002). "A study of riluzole in the treatment of advanced stage or elderly patients with amyotrophic lateral sclerosis." J Neurol 249(5): 609-615. Bensimon, G., L. Lacomblez and V. Meininger (1994). "A controlled trial of riluzole in amyotrophic lateral sclerosis. ALS/Riluzole Study Group." N Engl J Med 330(9): 585- 591. Blanchoin, L., T. D. Pollard and R. D. Mullins (2000). "Interactions of ADF/cofilin, Arp2/3 complex, capping protein and profilin in remodeling of branched actin filament networks." Curr Biol 10(20): 1273-1282. Bodea, L.-G., H. T. Evans, A. Van der Jeugd, L. M. Ittner, F. Delerue, J. Kril, G. Halliday, J. Hodges, M. C. Kiernan and J. Götz (2017). "Accelerated aging exacerbates a pre-existing pathology in a tau transgenic mouse model." Aging Cell 16(2): 377-386. Bonafede, R. and R. Mariotti (2017). "ALS Pathogenesis and Therapeutic Approaches: The Role of Mesenchymal Stem Cells and Extracellular Vesicles." Frontiers in cellular neuroscience 11: 80-80.

199

Boopathy, S., T. V. Silvas, M. Tischbein, S. Jansen, S. M. Shandilya, J. A. Zitzewitz, J. E. Landers, B. L. Goode, C. A. Schiffer and D. A. Bosco (2015). "Structural basis for mutation-induced destabilization of profilin 1 in ALS." Proc Natl Acad Sci U S A 112(26): 7984-7989. Bosco, D. A., N. Lemay, H. K. Ko, H. Zhou, C. Burke, T. J. Kwiatkowski, Jr., P. Sapp, D. McKenna-Yasek, R. H. Brown, Jr. and L. J. Hayward (2010). "Mutant FUS proteins that cause amyotrophic lateral sclerosis incorporate into stress granules." Hum Mol Genet 19(21): 4160-4175. Brenner, D., K. Müller, T. Wieland, P. Weydt, S. Böhm, D. Lulé, A. Hübers, C. Neuwirth, M. Weber, G. Borck, M. Wahlqvist, K. M. Danzer, A. E. Volk, T. Meitinger, T. M. Strom, M. Otto, J. Kassubek, A. C. Ludolph, P. M. Andersen and J. H. Weishaupt (2016). "NEK1 mutations in familial amyotrophic lateral sclerosis." Brain 139(5): e28- e28. Brettle, M., S. Patel and T. Fath (2016). "Tropomyosins in the healthy and diseased nervous system." Brain Res Bull 126(Pt 3): 311-323. Brettle, M., H. Stefen, A. Djordjevic, S. Y. Y. Fok, J. W. Chan, A. van Hummel, J. van der Hoven, M. Przybyla, A. Volkerling, Y. D. Ke, F. Delerue, L. M. Ittner and T. Fath (2019). "Developmental Expression of Mutant PFN1 in Motor Neurons Impacts Neuronal Growth and Motor Performance of Young and Adult Mice." Front Mol Neurosci 12: 231. Brettle, M., A. K. Suchowerska, S. W. Chua, L. M. Ittner and T. Fath (2015). "Amyotrophic lateral sclerosis-associated mutant profilin 1 increases dendritic arborisation and spine formation in primary hippocampal neurons." Neurosci Lett 609: 223-228. Brinks, H., S. Conrad, J. Vogt, J. Oldekamp, A. Sierra, L. Deitinghoff, I. Bechmann, G. Alvarez-Bolado, B. Heimrich and P. P. Monnier (2004). "The repulsive guidance molecule RGMa is involved in the formation of afferent connections in the dentate gyrus." Journal of Neuroscience 24(15): 3862-3869. Brooks, B. R. (1994). "El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and the El Escorial "Clinical limits of amyotrophic lateral sclerosis" workshop contributors." J Neurol Sci 124 Suppl: 96-107. Brooks, B. R., R. G. Miller, M. Swash, T. L. Munsat and D. World Federation of Neurology Research Group on Motor Neuron (2000). "El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis." Amyotroph Lateral Scler Other Motor Neuron Disord 1(5): 293-299. Buchan, J. R., R. M. Kolaitis, J. P. Taylor and R. Parker (2013). "Eukaryotic stress granules are cleared by autophagy and Cdc48/VCP function." Cell 153(7): 1461-1474. Burrell, J. R., G. M. Halliday, J. J. Kril, L. M. Ittner, J. Gotz, M. C. Kiernan and J. R. Hodges (2016). "The frontotemporal dementia-motor neuron disease continuum." Lancet 388(10047): 919-931. Caroni, P. (1997). "Overexpression of growth-associated proteins in the neurons of adult transgenic mice." J Neurosci Methods 71(1): 3-9. Carvalho, M. D. and M. Swash (2009). "Awaji diagnostic algorithm increases sensitivity of El Escorial criteria for ALS diagnosis." Amyotroph Lateral Scler 10(1): 53-57. Casas, C., M. Herrando-Grabulosa, R. Manzano, R. Mancuso, R. Osta and X. Navarro (2013). "Early presymptomatic cholinergic dysfunction in a murine model of amyotrophic lateral sclerosis." Brain Behav 3(2): 145-158. 200

Castanedo-Vazquez, D., P. Bosque-Varela, A. Sainz-Pelayo and J. Riancho (2018). "Infectious agents and amyotrophic lateral sclerosis: another piece of the puzzle of motor neuron degeneration." J Neurol. Causeret, F., M. Hidalgo-Sanchez, P. Fort, S. Backer, M.-R. Popoff, C. Gauthier- Rouvière and E. Bloch-Gallego (2004). "Distinct roles of Rac1/Cdc42 and Rho/Rock for axon outgrowth and nucleokinesis of precerebellar neurons toward netrin 1." Development 131(12): 2841-2852. Ceballos-Diaz, C., A. M. Rosario, H. J. Park, P. Chakrabarty, A. Sacino, P. E. Cruz, Z. Siemienski, N. Lara, C. Moran, N. Ravelo, T. E. Golde and N. R. McFarland (2015). "Viral expression of ALS-linked ubiquilin-2 mutants causes inclusion pathology and behavioral deficits in mice." Mol Neurodegener 10: 25. Chakrabarty, P., A. Rosario, P. Cruz, Z. Siemienski, C. Ceballos-Diaz, K. Crosby, K. Jansen, D. R. Borchelt, J. Y. Kim, J. L. Jankowsky, T. E. Golde and Y. Levites (2013). "Capsid serotype and timing of injection determines AAV transduction in the neonatal mice brain." PLoS One 8(6): e67680. Chand, K. K., K. M. Lee, J. D. Lee, H. Qiu, E. F. Willis, N. A. Lavidis, M. A. Hilliard and P. G. Noakes (2018). "Defects in synaptic transmission at the neuromuscular junction precede motor deficits in a TDP-43(Q331K) transgenic mouse model of amyotrophic lateral sclerosis." FASEB J 32(5): 2676-2689. Charcot, J. M., G. Sigerson, G. Macdonald, New Sydenham Society, T. Gates Darton & Co., St. Thomas's Hospital. Medical School Library and London County Council (1881). Lectures on the diseases of the nervous system : delivered at la Salpêtrière. Second series. Chen, H., M. Richard, D. P. Sandler, D. M. Umbach and F. Kamel (2007). "Head injury and amyotrophic lateral sclerosis." Am J Epidemiol 166(7): 810-816. Chen, Y.-Z., C. L. Bennett, H. M. Huynh, I. P. Blair, I. Puls, J. Irobi, I. Dierick, A. Abel, M. L. Kennerson, B. A. Rabin, G. A. Nicholson, M. Auer-Grumbach, K. Wagner, P. De Jonghe, J. W. Griffin, K. H. Fischbeck, V. Timmerman, D. R. Cornblath and P. F. Chance (2004). "DNA/RNA Helicase Gene Mutations in a Form of Juvenile Amyotrophic Lateral Sclerosis (ALS4)." The American Journal of Human Genetics 74(6): 1128-1135. Chen, Y., Z. Z. Zheng, R. Huang, K. Chen, W. Song, B. Zhao, X. Chen, Y. Yang, L. Yuan and H. F. Shang (2013). "PFN1 mutations are rare in Han Chinese populations with amyotrophic lateral sclerosis." Neurobiol Aging 34(7): 1922 e1921-1925. Cheng, Y. J., Z. X. Zhu, J. S. Zhou, Z. Q. Hu, J. P. Zhang, Q. P. Cai and L. H. Wang (2015). "Silencing profilin-1 inhibits gastric cancer progression via integrin beta1/focal adhesion kinase pathway modulation." World J Gastroenterol 21(8): 2323-2335. Chevalier-Larsen, E. and E. L. Holzbaur (2006). "Axonal transport and neurodegenerative disease." Biochim Biophys Acta 1762(11-12): 1094-1108. Chew, J., T. F. Gendron, M. Prudencio, H. Sasaguri, Y. J. Zhang, M. Castanedes-Casey, C. W. Lee, K. Jansen-West, A. Kurti, M. E. Murray, K. F. Bieniek, P. O. Bauer, E. C. Whitelaw, L. Rousseau, J. N. Stankowski, C. Stetler, L. M. Daughrity, E. A. Perkerson, P. Desaro, A. Johnston, K. Overstreet, D. Edbauer, R. Rademakers, K. B. Boylan, D. W. Dickson, J. D. Fryer and L. Petrucelli (2015). "Neurodegeneration. C9ORF72 repeat expansions in mice cause TDP-43 pathology, neuronal loss, and behavioral deficits." Science 348(6239): 1151-1154. Chi, X., S. Wang, Y. Huang, M. Stamnes and J.-L. Chen (2013). "Roles of rho GTPases in intracellular transport and cellular transformation." International journal of molecular sciences 14(4): 7089-7108.

201

Chia, R., A. Chiò and B. J. Traynor (2018). "Novel genes associated with amyotrophic lateral sclerosis: diagnostic and clinical implications." The Lancet Neurology 17(1): 94- 102. Chio, A., A. Calvo, M. Dossena, P. Ghiglione, R. Mutani and G. Mora (2009). "ALS in Italian professional soccer players: the risk is still present and could be soccer-specific." Amyotroph Lateral Scler 10(4): 205-209. Chio, A., G. Logroscino, O. Hardiman, R. Swingler, D. Mitchell, E. Beghi, B. G. Traynor and C. Eurals (2009). "Prognostic factors in ALS: A critical review." Amyotroph Lateral Scler 10(5-6): 310-323. Chio, A., G. Logroscino, B. J. Traynor, J. Collins, J. C. Simeone, L. A. Goldstein and L. A. White (2013). "Global epidemiology of amyotrophic lateral sclerosis: a systematic review of the published literature." Neuroepidemiology 41(2): 118-130. Chio, A., L. Mazzini, S. D'Alfonso, L. Corrado, A. Canosa, C. Moglia, U. Manera, E. Bersano, M. Brunetti, M. Barberis, J. H. Veldink, L. H. van den Berg, N. Pearce, W. Sproviero, R. McLaughlin, A. Vajda, O. Hardiman, J. Rooney, G. Mora, A. Calvo and A. Al-Chalabi (2018). "The multistep hypothesis of ALS revisited: The role of genetic mutations." Neurology 91(7): e635-e642. Choi, Y. N., S. K. Lee, T. W. Seo, J. S. Lee and S. J. Yoo (2014). "C-Terminus of Hsc70-interacting protein regulates profilin1 and breast cancer cell migration." Biochemical and biophysical research communications 446(4): 1060-1066. Chow, C. Y., J. E. Landers, S. K. Bergren, P. C. Sapp, A. E. Grant, J. M. Jones, L. Everett, G. M. Lenk, D. M. McKenna-Yasek, L. S. Weisman, D. Figlewicz, R. H. Brown and M. H. Meisler (2009). "Deleterious Variants of FIG4, a Phosphoinositide Phosphatase, in Patients with ALS." The American Journal of Human Genetics 84(1): 85-88. Cirulli, E. T., B. N. Lasseigne, S. Petrovski, P. C. Sapp, P. A. Dion, C. S. Leblond, J. Couthouis, Y. F. Lu, Q. Wang, B. J. Krueger, Z. Ren, J. Keebler, Y. Han, S. E. Levy, B. E. Boone, J. R. Wimbish, L. L. Waite, A. L. Jones, J. P. Carulli, A. G. Day-Williams, J. F. Staropoli, W. W. Xin, A. Chesi, A. R. Raphael, D. McKenna-Yasek, J. Cady, J. M. Vianney de Jong, K. P. Kenna, B. N. Smith, S. Topp, J. Miller, A. Gkazi, F. S. Consortium, A. Al-Chalabi, L. H. van den Berg, J. Veldink, V. Silani, N. Ticozzi, C. E. Shaw, R. H. Baloh, S. Appel, E. Simpson, C. Lagier-Tourenne, S. M. Pulst, S. Gibson, J. Q. Trojanowski, L. Elman, L. McCluskey, M. Grossman, N. A. Shneider, W. K. Chung, J. M. Ravits, J. D. Glass, K. B. Sims, V. M. Van Deerlin, T. Maniatis, S. D. Hayes, A. Ordureau, S. Swarup, J. Landers, F. Baas, A. S. Allen, R. S. Bedlack, J. W. Harper, A. D. Gitler, G. A. Rouleau, R. Brown, M. B. Harms, G. M. Cooper, T. Harris, R. M. Myers and D. B. Goldstein (2015). "Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways." Science 347(6229): 1436-1441. Collard, J. F., F. Cote and J. P. Julien (1995). "Defective axonal transport in a transgenic mouse model of amyotrophic lateral sclerosis." Nature 375(6526): 61-64. Conrad, R., S. Jablonka, T. Sczepan, M. Sendtner, S. Wiese and A. Klausmeyer (2011). "Lectin-based isolation and culture of mouse embryonic motoneurons." J Vis Exp(55). Courtemanche, N. and T. D. Pollard (2013). "Interaction of Profilin with the Barbed End of Actin Filaments." Biochemistry 52(37): 6456-6466. Curthoys, N. M., H. Freittag, A. Connor, M. Desouza, M. Brettle, A. Poljak, A. Hall, E. Hardeman, G. Schevzov, P. W. Gunning and T. Fath (2014). "Tropomyosins induce neuritogenesis and determine neurite branching patterns in B35 neuroblastoma cells." Mol Cell Neurosci 58: 11-21.

202

Daoud, H., S. Dobrzeniecka, W. Camu, V. Meininger, N. Dupré, P. A. Dion and G. A. Rouleau (2013). "Mutation analysis of PFN1 in familial amyotrophic lateral sclerosis patients." Neurobiology of Aging 34(4): 1311.e1311-1311.e1312. de Carvalho, M., M. C. Kiernan and M. Swash (2017). "Fasciculation in amyotrophic lateral sclerosis: origin and pathophysiological relevance." J Neurol Neurosurg Psychiatry 88(9): 773-779. De la Torre, J. (2002). "Alzheimer's disease: how does it start?" Journal of Alzheimer's Disease 4(6): 497-512. Deepa, S. S., H. Van Remmen, S. V. Brooks, J. A. Faulkner, L. Larkin, A. McArdle, M. J. Jackson, A. Vasilaki and A. Richardson (2019). "Accelerated sarcopenia in Cu/Zn superoxide dismutase knockout mice." Free Radic Biol Med 132: 19-23. DeJesus-Hernandez, M., I. R. Mackenzie, B. F. Boeve, A. L. Boxer, M. Baker, N. J. Rutherford, A. M. Nicholson, N. A. Finch, H. Flynn, J. Adamson, N. Kouri, A. Wojtas, P. Sengdy, G. Y. Hsiung, A. Karydas, W. W. Seeley, K. A. Josephs, G. Coppola, D. H. Geschwind, Z. K. Wszolek, H. Feldman, D. S. Knopman, R. C. Petersen, B. L. Miller, D. W. Dickson, K. B. Boylan, N. R. Graff-Radford and R. Rademakers (2011). "Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS." Neuron 72(2): 245-256. DeKosky, S. T. and B. M. Asken (2017). "Injury cascades in TBI-related neurodegeneration." Brain Injury 31(9): 1177-1182. Del Poggetto, E., F. Bemporad, F. Tatini and F. Chiti (2015). "Mutations of Profilin-1 Associated with Amyotrophic Lateral Sclerosis Promote Aggregation Due to Structural Changes of Its Native State." ACS Chem Biol 10(11): 2553-2563. Deng, H. X., W. Chen, S. T. Hong, K. M. Boycott, G. H. Gorrie, N. Siddique, Y. Yang, F. Fecto, Y. Shi, H. Zhai, H. Jiang, M. Hirano, E. Rampersaud, G. H. Jansen, S. Donkervoort, E. H. Bigio, B. R. Brooks, K. Ajroud, R. L. Sufit, J. L. Haines, E. Mugnaini, M. A. Pericak-Vance and T. Siddique (2011). "Mutations in UBQLN2 cause dominant X-linked juvenile and adult-onset ALS and ALS/dementia." Nature 477(7363): 211-215. Dennis, J. S. and B. A. Citron (2009). "Wobbler mice modeling motor neuron disease display elevated transactive response DNA binding protein." Neuroscience 158(2): 745- 750. Devon, R. S., P. C. Orban, K. Gerrow, M. A. Barbieri, C. Schwab, L. P. Cao, J. R. Helm, N. Bissada, R. Cruz-Aguado, T.-L. Davidson, J. Witmer, M. Metzler, C. K. Lam, W. Tetzlaff, E. M. Simpson, J. M. McCaffery, A. E. El-Husseini, B. R. Leavitt and M. R. Hayden (2006). "Als2-deficient mice exhibit disturbances in endosome trafficking associated with motor behavioral abnormalities." Proceedings of the National Academy of Sciences 103(25): 9595-9600. Ding, Z., Y. H. Bae and P. Roy (2012). "Molecular insights on context-specific role of profilin-1 in cell migration." Cell Adh Migr 6(5): 442-449. Ding, Z., D. Gau, B. Deasy, A. Wells and P. Roy (2009). "Both actin and polyproline interactions of profilin-1 are required for migration, invasion and capillary morphogenesis of vascular endothelial cells." Exp Cell Res 315(17): 2963-2973. Ding, Z., M. Joy, R. Bhargava, M. Gunsaulus, N. Lakshman, M. Miron-Mendoza, M. Petroll, J. Condeelis, A. Wells and P. Roy (2014). "Profilin-1 downregulation has contrasting effects on early vs late steps of breast cancer metastasis." Oncogene 33(16): 2065-2074. Ding, Z., A. Lambrechts, M. Parepally and P. Roy (2006). "Silencing profilin-1 inhibits endothelial cell proliferation, migration and cord morphogenesis." J Cell Sci 119(Pt 19): 4127-4137. 203

Dirren, E., C. L. Towne, V. Setola, D. E. Redmond, Jr., B. L. Schneider and P. Aebischer (2014). "Intracerebroventricular injection of adeno-associated virus 6 and 9 vectors for cell type-specific transgene expression in the spinal cord." Hum Gene Ther 25(2): 109-120. Dogterom, M. and G. H. Koenderink (2018). "Actin–microtubule crosstalk in cell biology." Nature Reviews Molecular Cell Biology. Droppelmann, C. A., D. Campos-Melo, M. Ishtiaq, K. Volkening and M. J. Strong (2014). "RNA metabolism in ALS: When normal processes become pathological." Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration 15(5-6): 321-336. Edaravone Als 16 Study, G. (2017). "A post-hoc subgroup analysis of outcomes in the first phase III clinical study of edaravone (MCI-186) in amyotrophic lateral sclerosis." Amyotroph Lateral Scler Frontotemporal Degener 18(sup1): 11-19. Elden, A. C., H.-J. Kim, M. P. Hart, A. S. Chen-Plotkin, B. S. Johnson, X. Fang, M. Armakola, F. Geser, R. Greene, M. M. Lu, A. Padmanabhan, D. Clay-Falcone, L. McCluskey, L. Elman, D. Juhr, P. J. Gruber, U. Rüb, G. Auburger, J. Q. Trojanowski, V. M. Y. Lee, V. M. Van Deerlin, N. M. Bonini and A. D. Gitler (2010). "Ataxin-2 intermediate-length polyglutamine expansions are associated with increased risk for ALS." Nature 466: 1069. Eng, H., K. Lund and R. B. Campenot (1999). "Synthesis of beta-tubulin, actin, and other proteins in axons of sympathetic neurons in compartmented cultures." J Neurosci 19(1): 1-9. Erickson, H. P. (2007). "Evolution of the cytoskeleton." Bioessays 29(7): 668-677. Fang, F., U. Hallmarker, S. James, C. Ingre, K. Michaelsson, A. Ahlbom and M. Feychting (2016). "Amyotrophic lateral sclerosis among cross-country skiers in Sweden." Eur J Epidemiol 31(3): 247-253. Farrawell, N. E., I. A. Lambert-Smith, S. T. Warraich, I. P. Blair, D. N. Saunders, D. M. Hatters and J. J. Yerbury (2015). "Distinct partitioning of ALS associated TDP-43, FUS and SOD1 mutants into cellular inclusions." Scientific Reports 5: 13416. Fath, T., Y. D. Ke, P. Gunning, J. Gotz and L. M. Ittner (2009). "Primary support cultures of hippocampal and substantia nigra neurons." Nat Protoc 4(1): 78-85. Fecto, F., J. Yan, S. P. Vemula, E. Liu, Y. Yang, W. Chen, J. G. Zheng, Y. Shi, N. Siddique, H. Arrat, S. Donkervoort, S. Ajroud-Driss, R. L. Sufit, S. L. Heller, H. X. Deng and T. Siddique (2011). "SQSTM1 mutations in familial and sporadic amyotrophic lateral sclerosis." Arch Neurol 68(11): 1440-1446. Fedorov, A., R. Beichel, J. Kalpathy-Cramer, J. Finet, J.-C. Fillion-Robin, S. Pujol, C. Bauer, D. Jennings, F. Fennessy, M. Sonka, J. Buatti, S. Aylward, J. V. Miller, S. Pieper and R. Kikinis (2012). "3D Slicer as an image computing platform for the Quantitative Imaging Network." Magnetic resonance imaging 30(9): 1323-1341. Fidler, J. A., C. M. Treleaven, A. Frakes, T. J. Tamsett, M. McCrate, S. H. Cheng, L. S. Shihabuddin, B. K. Kaspar and J. C. Dodge (2011). "Disease progression in a mouse model of amyotrophic lateral sclerosis: the influence of chronic stress and corticosterone." FASEB journal : official publication of the Federation of American Societies for Experimental Biology 25(12): 4369-4377. Figlewicz, D. A., A. Krizus, M. G. Martinoli, V. Meininger, M. Dib, G. A. Rouleau and J.-P. Julien (1994). "Variants of the heavy neurofilament subunit are associated with the development of amyotrophic lateral sclerosis." Human Molecular Genetics 3(10): 1757- 1761. Figley, M. D., G. Bieri, R. M. Kolaitis, J. P. Taylor and A. D. Gitler (2014). "Profilin 1 associates with stress granules and ALS-linked mutations alter stress granule dynamics." J Neurosci 34(24): 8083-8097. 204

Fil, D., A. DeLoach, S. Yadav, D. Alkam, M. MacNicol, A. Singh, C. M. Compadre, J. J. Goellner, C. A. O'Brien, T. Fahmi, A. G. Basnakian, N. Y. Calingasan, J. L. Klessner, F. M. Beal, O. M. Peters, J. Metterville, R. H. Brown, Jr., K. K. Y. Ling, F. Rigo, P. H. Ozdinler and M. Kiaei (2017). "Mutant Profilin1 transgenic mice recapitulate cardinal features of motor neuron disease." Hum Mol Genet 26(4): 686-701. Fischer, L. R., D. G. Culver, P. Tennant, A. A. Davis, M. Wang, A. Castellano-Sanchez, J. Khan, M. A. Polak and J. D. Glass (2004). "Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man." Experimental neurology 185(2): 232-240. Fischer, M., S. Kaech, U. Wagner, H. Brinkhaus and A. Matus (2000). "Glutamate receptors regulate actin-based plasticity in dendritic spines." Nature neuroscience 3(9): 887. Flynn, K. C., C. W. Pak, A. E. Shaw, F. Bradke and J. R. Bamburg (2009). "Growth cone-like waves transport actin and promote axonogenesis and neurite branching." Dev Neurobiol 69(12): 761-779. Fogarty, M. J., R. Kanjhan, M. C. Bellingham and P. G. Noakes (2016). "Glycinergic Neurotransmission: A Potent Regulator of Embryonic Motor Neuron Dendritic Morphology and Synaptic Plasticity." J Neurosci 36(1): 80-87. Fogarty, M. J., P. M. Klenowski, J. D. Lee, J. R. Drieberg-Thompson, S. E. Bartlett, S. T. Ngo, M. A. Hilliard, M. C. Bellingham and P. G. Noakes (2016). "Cortical synaptic and dendritic spine abnormalities in a presymptomatic TDP-43 model of amyotrophic lateral sclerosis." Sci Rep 6: 37968. Fogarty, M. J., E. W. H. Mu, N. A. Lavidis, P. G. Noakes and M. C. Bellingham (2017). "Motor Areas Show Altered Dendritic Structure in an Amyotrophic Lateral Sclerosis Mouse Model." Front Neurosci 11: 609. Fogarty, M. J., P. G. Noakes and M. C. Bellingham (2015). "Motor cortex layer V pyramidal neurons exhibit dendritic regression, spine loss, and increased synaptic excitation in the presymptomatic hSOD1(G93A) mouse model of amyotrophic lateral sclerosis." J Neurosci 35(2): 643-647. Foran, E. and D. Trotti (2009). "Glutamate transporters and the excitotoxic path to motor neuron degeneration in amyotrophic lateral sclerosis." Antioxidants & redox signaling 11(7): 1587-1602. Fox, N. (2012). "When, where, and how does Alzheimer's disease start?" The Lancet Neurology 11(12): 1017-1018. Fratta, P., J. Charnock, T. Collins, A. Devoy, R. Howard, A. Malaspina, R. Orrell, K. Sidle, J. Clarke, M. Shoai, C. H. Lu, J. Hardy, V. Plagnol and E. M. Fisher (2014). "Profilin1 E117G is a moderate risk factor for amyotrophic lateral sclerosis." J Neurol Neurosurg Psychiatry 85(5): 506-508. Gajdusek, D. C. (1963). "Motor-neuron disease in natives of New Guinea." N Engl J Med 268: 474-476. Gallo, V., N. Vanacore, H. B. Bueno-de-Mesquita, R. Vermeulen, C. Brayne, N. Pearce, P. A. Wark, H. A. Ward, P. Ferrari, M. Jenab, P. M. Andersen, P. Wennberg, N. Wareham, V. Katzke, R. Kaaks, E. Weiderpass, P. H. Peeters, A. Mattiello, V. Pala, A. Barricante, M. D. Chirlaque, N. Travier, R. C. Travis, M. J. Sanchez, H. Pessah- Rasmussen, J. Petersson, A. Tjonneland, R. Tumino, J. R. Quiros, A. Trichopoulou, A. Kyrozis, D. Oikonomidou, G. Masala, C. Sacerdote, L. Arriola, H. Boeing, M. Vigl, F. Claver-Chapelon, L. Middleton, E. Riboli and P. Vineis (2016). "Physical activity and risk of Amyotrophic Lateral Sclerosis in a prospective cohort study." Eur J Epidemiol 31(3): 255-266. Garbuzova-Davis, S., A. E. Willing, M. Milliken, S. Saporta, B. Sowerby, D. W. Cahill and P. R. Sanberg (2001). "Intraspinal implantation of hNT neurons into SOD1 mice 205

with apparent motor deficit." Amyotroph Lateral Scler Other Motor Neuron Disord 2(4): 175-180. Gavett, B. E., R. A. Stern, R. C. Cantu, C. J. Nowinski and A. C. McKee (2010). "Mild traumatic brain injury: a risk factor for neurodegeneration." Alzheimer's Research & Therapy 2(3): 18-18. Geser, F., M. Martinez-Lage, J. Robinson, K. Uryu, M. Neumann, N. J. Brandmeir, S. X. Xie, L. K. Kwong, L. Elman and L. McCluskey (2009). "Clinical and pathological continuum of multisystem TDP-43 proteinopathies." Archives of neurology 66(2): 180- 189. Gordon, P. H. (2013). "Amyotrophic Lateral Sclerosis: An update for 2013 Clinical Features, Pathophysiology, Management and Therapeutic Trials." Aging Dis 4(5): 295- 310. Gordon, P. H., F. Salachas, L. Lacomblez, N. Le Forestier, P.-F. Pradat, G. Bruneteau, A. Elbaz and V. Meininger (2013). "Predicting survival of patients with amyotrophic lateral sclerosis at presentation: a 15-year experience." Neurodegenerative Diseases 12(2): 81-90. Greenway, M. J., P. M. Andersen, C. Russ, S. Ennis, S. Cashman, C. Donaghy, V. Patterson, R. Swingler, D. Kieran, J. Prehn, K. E. Morrison, A. Green, K. R. Acharya, R. H. Brown Jr and O. Hardiman (2006). "ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis." Nature Genetics 38: 411. Gunning, P. W., U. Ghoshdastider, S. Whitaker, D. Popp and R. C. Robinson (2015). "The evolution of compositionally and functionally distinct actin filaments." Journal of Cell Science 128(11): 2009-2019. Gurney, M. E. (1994). "Transgenic-mouse model of amyotrophic lateral sclerosis." N Engl J Med 331(25): 1721-1722. Hadano, S., C. K. Hand, H. Osuga, Y. Yanagisawa, A. Otomo, R. S. Devon, N. Miyamoto, J. Showguchi-Miyata, Y. Okada, R. Singaraja, D. A. Figlewicz, T. Kwiatkowski, B. A. Hosler, T. Sagie, J. Skaug, J. Nasir, R. H. Brown Jr, S. W. Scherer, G. A. Rouleau, M. R. Hayden and J.-E. Ikeda (2001). "A gene encoding a putative GTPase regulator is mutated in familial amyotrophic lateral sclerosis 2." Nature Genetics 29: 166. Hafezparast, M., R. Klocke, C. Ruhrberg, A. Marquardt, A. Ahmad-Annuar, S. Bowen, G. Lalli, A. S. Witherden, H. Hummerich, S. Nicholson, P. J. Morgan, R. Oozageer, J. V. Priestley, S. Averill, V. R. King, S. Ball, J. Peters, T. Toda, A. Yamamoto, Y. Hiraoka, M. Augustin, D. Korthaus, S. Wattler, P. Wabnitz, C. Dickneite, S. Lampel, F. Boehme, G. Peraus, A. Popp, M. Rudelius, J. Schlegel, H. Fuchs, M. Hrabe de Angelis, G. Schiavo, D. T. Shima, A. P. Russ, G. Stumm, J. E. Martin and E. M. Fisher (2003). "Mutations in dynein link motor neuron degeneration to defects in retrograde transport." Science 300(5620): 808-812. Halpain, S., A. Hipolito and L. Saffer (1998). "Regulation of F-actin stability in dendritic spines by glutamate receptors and calcineurin." Journal of Neuroscience 18(23): 9835-9844. Hanahan, D., J. Jessee and F. R. Bloom (1991). "Plasmid transformation of Escherichia coli and other bacteria." Methods Enzymol 204: 63-113. Harasta, A. E., J. M. Power, G. von Jonquieres, T. Karl, D. J. Drucker, G. D. Housley, M. Schneider and M. Klugmann (2015). "Septal Glucagon-Like Peptide 1 Receptor Expression Determines Suppression of Cocaine-Induced Behavior." Neuropsychopharmacology 40(8): 1969-1978.

206

Hart, M. P., J. Brettschneider, V. M. Y. Lee, J. Q. Trojanowski and A. D. Gitler (2012). "Distinct TDP-43 pathology in ALS patients with ataxin 2 intermediate-length polyQ expansions." Acta Neuropathologica 124(2): 221-230. Hata, K., M. Fujitani, Y. Yasuda, H. Doya, T. Saito, S. Yamagishi, B. K. Mueller and T. Yamashita (2006). "RGMa inhibition promotes axonal growth and recovery after spinal cord injury." The Journal of cell biology 173(1): 47-58. Hatzipetros, T., L. P. Bogdanik, V. R. Tassinari, J. D. Kidd, A. J. Moreno, C. Davis, M. Osborne, A. Austin, F. G. Vieira, C. Lutz and S. Perrin (2014). "C57BL/6J congenic Prp-TDP43A315T mice develop progressive neurodegeneration in the myenteric plexus of the colon without exhibiting key features of ALS." Brain Research 1584: 59-72. Hegedus, J., C. T. Putman and T. Gordon (2007). "Time course of preferential motor unit loss in the SOD1 G93A mouse model of amyotrophic lateral sclerosis." Neurobiol Dis 28(2): 154-164. Henriques, A., C. Pitzer and A. Schneider (2010). "Characterization of a novel SOD- 1(G93A) transgenic mouse line with very decelerated disease development." PLoS One 5(11): e15445. Hentati, A., K. Ouahchi, M. A. Pericak-Vance, D. Nijhawan, A. Ahmad, Y. Yang, J. Rimmler, W. Y. Hung, B. Schlotter, A. Ahmed, M. Ben Hamida, F. Hentati and T. Siddique (1998). "Linkage of a commoner form of recessive amyotrophic lateral sclerosis to chromosome 15q15-q22 markers." Neurogenetics 2(1): 55-60. Henty-Ridilla, J. L. and B. L. Goode (2015). "Global resource distribution: allocation of actin building blocks by profilin." Dev Cell 32(1): 5-6. Henty-Ridilla, J. L., M. A. Juanes and B. L. Goode (2017). "Profilin Directly Promotes Microtubule Growth through Residues Mutated in Amyotrophic Lateral Sclerosis." Curr Biol 27(22): 3535-3543 e3534. Highley, J. R., J. Kirby, J. A. Jansweijer, P. S. Webb, C. A. Hewamadduma, P. R. Heath, A. Higginbottom, R. Raman, L. Ferraiuolo, J. Cooper-Knock, C. J. McDermott, S. B. Wharton, P. J. Shaw and P. G. Ince (2014). "Loss of nuclear TDP-43 in amyotrophic lateral sclerosis (ALS) causes altered expression of splicing machinery and widespread dysregulation of RNA splicing in motor neurones." Neuropathology and Applied Neurobiology 40(6): 670-685. Howard, D. B., K. Powers, Y. Wang and B. K. Harvey (2008). "Tropism and toxicity of adeno-associated viral vector serotypes 1,2,5,6,7,8,9 in rat neurons and glia in vitro." Virology 372(1): 24-34. Hua, Z. L., F. E. Emiliani and J. Nathans (2015). "Rac1 plays an essential role in axon growth and guidance and in neuronal survival in the central and peripheral nervous systems." Neural development 10: 21-21. Igaz, L. M., L. K. Kwong, E. B. Lee, A. Chen-Plotkin, E. Swanson, T. Unger, J. Malunda, Y. Xu, M. J. Winton, J. Q. Trojanowski and V. M. Y. Lee (2011). "Dysregulation of the ALS-associated gene TDP-43 leads to neuronal death and degeneration in mice." The Journal of Clinical Investigation 121(2): 726-738. Ingre, C., J. E. Landers, N. Rizik, A. E. Volk, C. Akimoto, A. Birve, A. Hubers, P. J. Keagle, K. Piotrowska, R. Press, P. M. Andersen, A. C. Ludolph and J. H. Weishaupt (2013). "A novel phosphorylation site mutation in profilin 1 revealed in a large screen of US, Nordic, and German amyotrophic lateral sclerosis/frontotemporal dementia cohorts." Neurobiol Aging 34(6): 1708 e1701-1706. Ittner, A., S. W. Chua, J. Bertz, A. Volkerling, J. van der Hoven, A. Gladbach, M. Przybyla, M. Bi, A. van Hummel, C. H. Stevens, S. Ippati, L. S. Suh, A. Macmillan, G. Sutherland, J. J. Kril, A. P. G. Silva, J. P. Mackay, A. Poljak, F. Delerue, Y. D. Ke and

207

L. M. Ittner (2016). "Site-specific phosphorylation of tau inhibits amyloid-β toxicity in Alzheimer’s mice." Science 354(6314): 904-908. Ittner, L. M. and J. Gotz (2007). "Pronuclear injection for the production of transgenic mice." Nat Protoc 2(5): 1206-1215. Ittner, L. M., G. M. Halliday, J. J. Kril, J. Gotz, J. R. Hodges and M. C. Kiernan (2015). "FTD and ALS--translating mouse studies into clinical trials." Nat Rev Neurol 11(6): 360-366. Jaarsma, D., E. D. Haasdijk, J. Grashorn, R. Hawkins, W. van Duijn, H. W. Verspaget, J. London and J. C. Holstege (2000). "Human Cu/Zn superoxide dismutase (SOD1) overexpression in mice causes mitochondrial vacuolization, axonal degeneration, and premature motoneuron death and accelerates motoneuron disease in mice expressing a familial amyotrophic lateral sclerosis mutant SOD1." Neurobiology of disease 7(6): 623-643. Jablonka, S., S. Wiese and M. Sendtner (2004). "Axonal defects in mouse models of motoneuron disease." J Neurobiol 58(2): 272-286. Jean-Richard Dit Bressel, D. (2015). "The Effects of Profilin 1 Mutation on Neurite Outgrowth in Primary Motor Neurons " Honours Thesis, UNSW Sydney. Jiang, Y. M., M. Yamamoto, Y. Kobayashi, T. Yoshihara, Y. Liang, S. Terao, H. Takeuchi, S. Ishigaki, M. Katsuno and H. Adachi (2005). "Gene expression profile of spinal motor neurons in sporadic amyotrophic lateral sclerosis." Annals of neurology 57(2): 236-251. Johnson, J. O., J. Mandrioli, M. Benatar, Y. Abramzon, V. M. Van Deerlin, J. Q. Trojanowski, J. R. Gibbs, M. Brunetti, S. Gronka, J. Wuu, J. Ding, L. McCluskey, M. Martinez-Lage, D. Falcone, D. G. Hernandez, S. Arepalli, S. Chong, J. C. Schymick, J. Rothstein, F. Landi, Y. D. Wang, A. Calvo, G. Mora, M. Sabatelli, M. R. Monsurro, S. Battistini, F. Salvi, R. Spataro, P. Sola, G. Borghero, I. Consortium, G. Galassi, S. W. Scholz, J. P. Taylor, G. Restagno, A. Chio and B. J. Traynor (2010). "Exome sequencing reveals VCP mutations as a cause of familial ALS." Neuron 68(5): 857-864. Johnson, J. O., E. P. Pioro, A. Boehringer, R. Chia, H. Feit, A. E. Renton, H. A. Pliner, Y. Abramzon, G. Marangi, B. J. Winborn, J. R. Gibbs, M. A. Nalls, S. Morgan, M. Shoai, J. Hardy, A. Pittman, R. W. Orrell, A. Malaspina, K. C. Sidle, P. Fratta, M. B. Harms, R. H. Baloh, A. Pestronk, C. C. Weihl, E. Rogaeva, L. Zinman, V. E. Drory, G. Borghero, G. Mora, A. Calvo, J. D. Rothstein, Italsgen, C. Drepper, M. Sendtner, A. B. Singleton, J. P. Taylor, M. R. Cookson, G. Restagno, M. Sabatelli, R. Bowser, A. Chiò and B. J. Traynor (2014). "Mutations in the Matrin 3 gene cause familial amyotrophic lateral sclerosis." Nature Neuroscience 17: 664. Jung, C., C. M. J. Higgins and Z. Xu (2002). "Mitochondrial electron transport chain complex dysfunction in a transgenic mouse model for amyotrophic lateral sclerosis." Journal of Neurochemistry 83(3): 535-545. Kanjhan, R., P. G. Noakes and M. C. Bellingham (2016). "Emerging Roles of Filopodia and Dendritic Spines in Motoneuron Plasticity during Development and Disease." Neural Plast 2016: 3423267. Ke, Y. D., A. van Hummel, C. H. Stevens, A. Gladbach, S. Ippati, M. Bi, W. S. Lee, S. Kruger, J. van der Hoven, A. Volkerling, A. Bongers, G. Halliday, N. K. Haass, M. Kiernan, F. Delerue and L. M. Ittner (2015). "Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS." Acta Neuropathol 130(5): 661-678. Keen, J. H., M. C. Willingham and I. H. Pastan (1979). "Clathrin-coated vesicles: isolation, dissociation and factor-dependent reassociation of clathrin baskets." Cell 16(2): 303-312. 208

Kenna, K. P., P. T. C. van Doormaal, A. M. Dekker, N. Ticozzi, B. J. Kenna, F. P. Diekstra, W. van Rheenen, K. R. van Eijk, A. R. Jones, P. Keagle, A. Shatunov, W. Sproviero, B. N. Smith, M. A. van Es, S. D. Topp, A. Kenna, J. W. Miller, C. Fallini, C. Tiloca, R. L. McLaughlin, C. Vance, C. Troakes, C. Colombrita, G. Mora, A. Calvo, F. Verde, S. Al-Sarraj, A. King, D. Calini, J. de Belleroche, F. Baas, A. J. van der Kooi, M. de Visser, A. L. M. A. ten Asbroek, P. C. Sapp, D. McKenna-Yasek, M. Polak, S. Asress, J. L. Muñoz-Blanco, T. M. Strom, T. Meitinger, K. E. Morrison, S. Consortium, S. D'Alfonso, L. Mazzini, G. P. Comi, R. Del Bo, M. Ceroni, S. Gagliardi, G. Querin, C. Bertolin, V. Pensato, B. Castellotti, S. Corti, C. Cereda, L. Corrado, G. Sorarù, G. Lauria, K. L. Williams, P. N. Leigh, G. A. Nicholson, I. P. Blair, C. S. Leblond, P. A. Dion, G. A. Rouleau, H. Pall, P. J. Shaw, M. R. Turner, K. Talbot, F. Taroni, K. B. Boylan, M. Van Blitterswijk, R. Rademakers, J. Esteban-Pérez, A. García-Redondo, P. Van Damme, W. Robberecht, A. Chio, C. Gellera, C. Drepper, M. Sendtner, A. Ratti, J. D. Glass, J. S. Mora, N. A. Basak, O. Hardiman, A. C. Ludolph, P. M. Andersen, J. H. Weishaupt, R. H. Brown Jr, A. Al-Chalabi, V. Silani, C. E. Shaw, L. H. van den Berg, J. H. Veldink and J. E. Landers (2016). "NEK1 variants confer susceptibility to amyotrophic lateral sclerosis." Nature Genetics 48: 1037. Khamankar, N., G. Coan, B. Weaver and C. S. Mitchell (2018). "Associative Increases in Amyotrophic Lateral Sclerosis Survival Duration With Non-invasive Ventilation Initiation and Usage Protocols." Front Neurol 9: 578. Kiernan, M. C., S. Vucic, B. C. Cheah, M. R. Turner, A. Eisen, O. Hardiman, J. R. Burrell and M. C. Zoing (2011). "Amyotrophic lateral sclerosis." Lancet 377(9769): 942-955. Kim, H. J., N. C. Kim, Y.-D. Wang, E. A. Scarborough, J. Moore, Z. Diaz, K. S. MacLea, B. Freibaum, S. Li, A. Molliex, A. P. Kanagaraj, R. Carter, K. B. Boylan, A. M. Wojtas, R. Rademakers, J. L. Pinkus, S. A. Greenberg, J. Q. Trojanowski, B. J. Traynor, B. N. Smith, S. Topp, A.-S. Gkazi, J. Miller, C. E. Shaw, M. Kottlors, J. Kirschner, A. Pestronk, Y. R. Li, A. F. Ford, A. D. Gitler, M. Benatar, O. D. King, V. E. Kimonis, E. D. Ross, C. C. Weihl, J. Shorter and J. P. Taylor (2013). "Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS." Nature 495: 467. Kim, Y., J. Y. Sung, I. Ceglia, K.-W. Lee, J.-H. Ahn, J. M. Halford, A. M. Kim, S. P. Kwak, J. B. Park and S. H. Ryu (2006). "Phosphorylation of WAVE1 regulates actin polymerization and dendritic spine morphology." Nature 442(7104): 814. Koboldt, D. C., K. M. Steinberg, D. E. Larson, R. K. Wilson and E. R. Mardis (2013). "The next-generation sequencing revolution and its impact on genomics." Cell 155(1): 27-38. Kondo, K. and K. Fujiki (1989). "Is risk to motor neuron disease influenced by the season of birth?" Jinrui Idengaku Zasshi 34(3): 243-246. Korobova, F. and T. Svitkina (2010). "Molecular architecture of synaptic actin cytoskeleton in hippocampal neurons reveals a mechanism of dendritic spine morphogenesis." Mol Biol Cell 21(1): 165-176. Kovar, D. R., E. S. Harris, R. Mahaffy, H. N. Higgs and T. D. Pollard (2006). "Control of the assembly of ATP-and ADP-actin by formins and profilin." Cell 124(2): 423-435. Kraemer, B. C., T. Schuck, J. M. Wheeler, L. C. Robinson, J. Q. Trojanowski, V. M. Lee and G. D. Schellenberg (2010). "Loss of murine TDP-43 disrupts motor function and plays an essential role in embryogenesis." Acta Neuropathol 119(4): 409-419. Krishnan, K. and P. D. J. Moens (2009). "Structure and functions of profilins." Biophysical reviews 1(2): 71-81.

209

Kullmann, J. A., A. Neumeyer, I. Wickertsheim, R. T. Bottcher, M. Costell, J. W. Deitmer, W. Witke, E. Friauf and M. B. Rust (2012). "Purkinje cell loss and motor coordination defects in profilin1 mutant mice." Neuroscience 223: 355-364. Kullmann, J. A., I. Wickertsheim, L. Minnerup, M. Costell, E. Friauf and M. B. Rust (2015). "Profilin1 activity in cerebellar granule neurons is required for radial migration in vivo." Cell Adh Migr 9(3): 247-253. Kwiatkowski, D. J. and G. A. Bruns (1988). "Human profilin. Molecular cloning, sequence comparison, and chromosomal analysis." J Biol Chem 263(12): 5910-5915. Kwiatkowski, T. J., Jr., D. A. Bosco, A. L. Leclerc, E. Tamrazian, C. R. Vanderburg, C. Russ, A. Davis, J. Gilchrist, E. J. Kasarskis, T. Munsat, P. Valdmanis, G. A. Rouleau, B. A. Hosler, P. Cortelli, P. J. de Jong, Y. Yoshinaga, J. L. Haines, M. A. Pericak- Vance, J. Yan, N. Ticozzi, T. Siddique, D. McKenna-Yasek, P. C. Sapp, H. R. Horvitz, J. E. Landers and R. H. Brown, Jr. (2009). "Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis." Science 323(5918): 1205- 1208. Kwong, L. K., M. Neumann, D. M. Sampathu, V. M.-Y. Lee and J. Q. Trojanowski (2007). "TDP-43 proteinopathy: the neuropathology underlying major forms of sporadic and familial frontotemporal lobar degeneration and motor neuron disease." Acta Neuropathologica 114(1): 63-70. Lacomblez, L., G. Bensimon, P. N. Leigh, P. Guillet and V. Meininger (1996). "Dose- ranging study of riluzole in amyotrophic lateral sclerosis. Amyotrophic Lateral Sclerosis/Riluzole Study Group II." Lancet 347(9013): 1425-1431. Lacorte, E., L. Ferrigno, E. Leoncini, M. Corbo, S. Boccia and N. Vanacore (2016). "Physical activity, and physical activity related to sports, leisure and occupational activity as risk factors for ALS: A systematic review." Neurosci Biobehav Rev 66: 61- 79. Lahiri, D. K., B. Maloney, M. Riyaz Basha, Y. Wen Ge and N. H. Zawia (2007). "How and When Environmental Agents and Dietary Factors Affect the Course of Alzheimer's Disease: The “LEARn” Model (Latent Early-Life Associated Regulation) May Explain the Triggering of AD." Current Alzheimer Research 4(2): 219-228. Lambrechts, A., A. Braun, V. Jonckheere, A. Aszodi, L. M. Lanier, J. Robbens, I. Van Colen, J. Vandekerckhove, R. Fassler and C. Ampe (2000). "Profilin II is alternatively spliced, resulting in profilin isoforms that are differentially expressed and have distinct biochemical properties." Mol Cell Biol 20(21): 8209-8219. Lattante, S., I. Le Ber, A. Camuzat, A. Brice and E. Kabashi (2013). "Mutations in the PFN1 gene are not a common cause in patients with amyotrophic lateral sclerosis and frontotemporal lobar degeneration in France." Neurobiology of Aging 34(6): 1709.e1701-1709.e1702. Leblond, C. S., Z. Gan-Or, D. Spiegelman, S. B. Laurent, A. Szuto, A. Hodgkinson, A. Dionne-Laporte, P. Provencher, M. de Carvalho, S. Orrù, D. Brunet, J.-P. Bouchard, P. Awadalla, N. Dupré, P. A. Dion and G. A. Rouleau (2016). "Replication study of MATR3 in familial and sporadic amyotrophic lateral sclerosis." Neurobiology of Aging 37: 209.e217-209.e221. Leblond, C. S., H. M. Kaneb, P. A. Dion and G. A. Rouleau (2014). "Dissection of genetic factors associated with amyotrophic lateral sclerosis." Experimental Neurology 262: 91-101. Lee, C. W., E. A. Vitriol, S. Shim, A. L. Wise, R. P. Velayutham and J. Q. Zheng (2013). "Dynamic localization of G-actin during membrane protrusion in neuronal motility." Curr Biol 23(12): 1046-1056. 210

Lee, S. K. and P. J. Hollenbeck (2003). "Organization and translation of mRNA in sympathetic axons." J Cell Sci 116(Pt 21): 4467-4478. Lewis, T. L., Jr., T. Mao and D. B. Arnold (2011). "A role for myosin VI in the localization of axonal proteins." PLoS Biol 9(3): e1001021. Li, Z., K. Okamoto, Y. Hayashi and M. Sheng (2004). "The importance of dendritic mitochondria in the morphogenesis and plasticity of spines and synapses." Cell 119(6): 873-887. Ligon, L. A. and O. Steward (2000). "Movement of mitochondria in the axons and dendrites of cultured hippocampal neurons." J Comp Neurol 427(3): 340-350. Lin, M. T. and M. F. Beal (2006). "Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases." Nature 443: 787. Ling, S. C., M. Polymenidou and D. W. Cleveland (2013). "Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis." Neuron 79(3): 416-438. Liu-Yesucevitz, L., A. Bilgutay, Y. J. Zhang, T. Vanderweyde, A. Citro, T. Mehta, N. Zaarur, A. McKee, R. Bowser, M. Sherman, L. Petrucelli and B. Wolozin (2010). "Tar DNA binding protein-43 (TDP-43) associates with stress granules: analysis of cultured cells and pathological brain tissue." PLoS One 5(10): e13250. Liu, Y., A. Pattamatta, T. Zu, T. Reid, O. Bardhi, D. R. Borchelt, A. T. Yachnis and L. P. Ranum (2016). "C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS/FTD." Neuron 90(3): 521-534. Logroscino, G., B. Traynor, O. Hardiman, P. Couratier, J. Mitchell, R. Swingler and E. Beghi (2008). "Descriptive epidemiology of amyotrophic lateral sclerosis: new evidence and unsolved issues." Journal of Neurology, Neurosurgery & Psychiatry 79(1): 6-11. Logroscino, G., B. J. Traynor, O. Hardiman, A. Chio, D. Mitchell, R. J. Swingler, A. Millul, E. Benn, E. Beghi and Eurals (2010). "Incidence of amyotrophic lateral sclerosis in Europe." J Neurol Neurosurg Psychiatry 81(4): 385-390. Ludolph, A., V. Drory, O. Hardiman, I. Nakano, J. Ravits, W. Robberecht, J. Shefner and W. F. N. R. G. O. ALS/MND (2015). "A revision of the El Escorial criteria - 2015." Amyotroph Lateral Scler Frontotemporal Degener 16(5-6): 291-292. Luna, J., G. Logroscino, P. Couratier and B. Marin (2017). "Current issues in ALS epidemiology: Variation of ALS occurrence between populations and physical activity as a risk factor." Rev Neurol (Paris) 173(5): 244-253. Machts, J., S. Vielhaber, K. Kollewe, S. Petri, J. Kaufmann and M. A. Schoenfeld (2018). "Global Hippocampal Volume Reductions and Local CA1 Shape Deformations in Amyotrophic Lateral Sclerosis." Front Neurol 9: 565. Maglemose, R., A. Hedegaard, J. Lehnhoff, K. P. Dimintiyanova, M. Moldovan, L. Grøndahl and C. F. Meehan (2017). "Potassium channel abnormalities are consistent with early axon degeneration of motor axons in the G127X SOD1 mouse model of amyotrophic lateral sclerosis." Experimental neurology 292: 154-167. Magrane, J., M. A. Sahawneh, S. Przedborski, A. G. Estevez and G. Manfredi (2012). "Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons." J Neurosci 32(1): 229-242. Malek, A. M., A. Barchowsky, R. Bowser, T. Heiman-Patterson, D. Lacomis, S. Rana, A. Youk, D. Stickler, D. T. Lackland and E. O. Talbott (2014). "Environmental and occupational risk factors for amyotrophic lateral sclerosis: a case-control study." Neurodegener Dis 14(1): 31-38. Mammoto, A., T. Sasaki, T. Asakura, I. Hotta, H. Imamura, K. Takahashi, Y. Matsuura, T. Shirao and Y. Takai (1998). "Interactions of drebrin and gephyrin with profilin." Biochem Biophys Res Commun 243(1): 86-89.

211

Mancuso, R., S. Olivan, R. Osta and X. Navarro (2011). "Evolution of gait abnormalities in SOD1(G93A) transgenic mice." Brain Res 1406: 65-73. Mao, J.-H., S. A. Langley, Y. Huang, M. Hang, K. E. Bouchard, S. E. Celniker, J. B. Brown, J. K. Jansson, G. H. Karpen and A. M. Snijders (2015). "Identification of genetic factors that modify motor performance and body weight using Collaborative Cross mice." Scientific Reports 5: 16247. Marino, M., S. Papa, V. Crippa, G. Nardo, M. Peviani, C. Cheroni, M. C. Trolese, E. Lauranzano, V. Bonetto, A. Poletti, S. DeBiasi, L. Ferraiuolo, P. J. Shaw and C. Bendotti (2015). "Differences in protein quality control correlate with phenotype variability in 2 mouse models of familial amyotrophic lateral sclerosis." Neurobiol Aging 36(1): 492-504. Martin, E., W. Cazenave, D. Cattaert and P. Branchereau (2013). "Embryonic alteration of motoneuronal morphology induces hyperexcitability in the mouse model of amyotrophic lateral sclerosis." Neurobiol Dis 54: 116-126. Martin, L. J., B. Gertz, Y. Pan, A. C. Price, J. D. Molkentin and Q. Chang (2009). "The mitochondrial permeability transition pore in motor neurons: Involvement in the pathobiology of ALS mice." Experimental Neurology 218(2): 333-346. Maruyama, H., H. Morino, H. Ito, Y. Izumi, H. Kato, Y. Watanabe, Y. Kinoshita, M. Kamada, H. Nodera, H. Suzuki, O. Komure, S. Matsuura, K. Kobatake, N. Morimoto, K. Abe, N. Suzuki, M. Aoki, A. Kawata, T. Hirai, T. Kato, K. Ogasawara, A. Hirano, T. Takumi, H. Kusaka, K. Hagiwara, R. Kaji and H. Kawakami (2010). "Mutations of optineurin in amyotrophic lateral sclerosis." Nature 465(7295): 223-226. Marzban, H., M. R. Del Bigio, J. Alizadeh, S. Ghavami, R. M. Zachariah and M. Rastegar (2014). "Cellular commitment in the developing cerebellum." Front Cell Neurosci 8: 450. Matsunaga, E. and A. Chédotal (2004). "Repulsive guidance molecule/neogenin: a novel ligand‐receptor system playing multiple roles in neural development." Development, growth & differentiation 46(6): 481-486. Matus, A. (2000). "Actin-based plasticity in dendritic spines." Science 290(5492): 754- 758. McEwen, B. S. and B. Grafstein (1968). "Fast and slow components in axonal transport of protein." J Cell Biol 38(3): 494-508. McGoldrick, P., P. I. Joyce, E. M. Fisher and L. Greensmith (2013). "Rodent models of amyotrophic lateral sclerosis." Biochim Biophys Acta 1832(9): 1421-1436. Menon, P., M. C. Kiernan and S. Vucic (2015). "Cortical hyperexcitability precedes lower motor neuron dysfunction in ALS." Clin Neurophysiol 126(4): 803-809. Menon, P., M. C. Kiernan and S. Vucic (2018). "Cortical excitability varies across different motor regions." J Neurophysiol. Metzler, W. J., A. J. Bell, E. Ernst, T. B. Lavoie and L. Mueller (1994). "Identification of the poly-L-proline-binding site on human profilin." Journal of Biological Chemistry 269(6): 4620-4625. Michaelsen-Preusse, K., S. Zessin, G. Grigoryan, F. Scharkowski, J. Feuge, A. Remus and M. Korte (2016). "Neuronal profilins in health and disease: Relevance for spine plasticity and Fragile X syndrome." Proc Natl Acad Sci U S A 113(12): 3365-3370. Michaelsen, K., K. Murk, M. Zagrebelsky, A. Dreznjak, B. M. Jockusch, M. Rothkegel and M. Korte (2010). "Fine-tuning of neuronal architecture requires two profilin isoforms." Proc Natl Acad Sci U S A 107(36): 15780-15785. Michelot, A., M. Costanzo, A. Sarkeshik, C. Boone, J. R. Yates, 3rd and D. G. Drubin (2010). "Reconstitution and protein composition analysis of endocytic actin patches." Curr Biol 20(21): 1890-1899. 212

Miki, H., M. Setou, K. Kaneshiro and N. Hirokawa (2001). "All kinesin superfamily protein, KIF, genes in mouse and human." Proceedings of the National Academy of Sciences 98(13): 7004-7011. Miki, H., S. Suetsugu and T. Takenawa (1998). "WAVE, a novel WASP‐family protein involved in actin reorganization induced by Rac." The EMBO Journal 17(23): 6932- 6941. Miller, R. G., J. D. Mitchell and D. H. Moore (2012). "Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND)." Cochrane Database Syst Rev(3): CD001447. Mills, R. G., L. S. Minamide, A. Yuan, J. R. Bamburg and J. J. Bray (1996). "Slow axonal transport of soluble actin with actin depolymerizing factor, cofilin, and profilin suggests actin moves in an unassembled form." J Neurochem 67(3): 1225-1234. Mockrin, S. C. and E. D. Korn (1980). "Acanthamoeba profilin interacts with G-actin to increase the rate of exchange of actin-bound adenosine 5'-triphosphate." Biochemistry 19(23): 5359-5362. Morgan, S. and R. W. Orrell (2016). "Pathogenesis of amyotrophic lateral sclerosis." British Medical Bulletin 119(1): 87-98. Morris, R. L. and P. J. Hollenbeck (1993). "The regulation of bidirectional mitochondrial transport is coordinated with axonal outgrowth." J Cell Sci 104 ( Pt 3): 917-927. Moser, J. M., P. Bigini and T. Schmitt-John (2013). "The wobbler mouse, an ALS animal model." Mol Genet Genomics 288(5-6): 207-229. Mothe, A. J., N. G. Tassew, A. P. Shabanzadeh, R. Penheiro, R. J. Vigouroux, L. Huang, C. Grinnell, Y.-F. Cui, E. Fung, P. P. Monnier, B. K. Mueller and C. H. Tator (2017). "RGMa inhibition with human monoclonal antibodies promotes regeneration, plasticity and repair, and attenuates neuropathic pain after spinal cord injury." Scientific Reports 7(1): 10529. Münch, C., R. Sedlmeier, T. Meyer, V. Homberg, A. D. Sperfeld, A. Kurt, J. Prudlo, G. Peraus, C. O. Hanemann, G. Stumm and A. C. Ludolph (2004). "Point mutations of the p150 subunit of dynactin (DCTN1) gene in ALS." Neurology 63(4): 724-726. Murk, K., N. Wittenmayer, K. Michaelsen-Preusse, T. Dresbach, C. A. Schoenenberger, M. Korte, B. M. Jockusch and M. Rothkegel (2012). "Neuronal profilin isoforms are addressed by different signalling pathways." PLoS One 7(3): e34167. Nejedla, M., S. Sadi, V. Sulimenko, F. N. de Almeida, H. Blom, P. Draber, P. Aspenstrom and R. Karlsson (2016). "Profilin connects actin assembly with microtubule dynamics." Mol Biol Cell 27(15): 2381-2393. Neuhoff, H., M. Sassoe-Pognetto, P. Panzanelli, C. Maas, W. Witke and M. Kneussel (2005). "The actin-binding protein profilin I is localized at synaptic sites in an activity- regulated manner." Eur J Neurosci 21(1): 15-25. Neumann, M., D. M. Sampathu, L. K. Kwong, A. C. Truax, M. C. Micsenyi, T. T. Chou, J. Bruce, T. Schuck, M. Grossman, C. M. Clark, L. F. McCluskey, B. L. Miller, E. Masliah, I. R. Mackenzie, H. Feldman, W. Feiden, H. A. Kretzschmar, J. Q. Trojanowski and V. M. Lee (2006). "Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis." Science 314(5796): 130-133. Nicolas, A., K. P. Kenna, A. E. Renton, N. Ticozzi, F. Faghri, R. Chia, J. A. Dominov, B. J. Kenna, M. A. Nalls, P. Keagle, A. M. Rivera, W. van Rheenen, N. A. Murphy, J. J. F. A. van Vugt, J. T. Geiger, R. A. Van der Spek, H. A. Pliner, Shankaracharya, B. N. Smith, G. Marangi, S. D. Topp, Y. Abramzon, A. S. Gkazi, J. D. Eicher, A. Kenna, F. O. Logullo, I. Simone, G. Logroscino, F. Salvi, I. Bartolomei, G. Borghero, M. R. 213

Murru, E. Costantino, C. Pani, R. Puddu, C. Caredda, V. Piras, S. Tranquilli, S. Cuccu, D. Corongiu, M. Melis, A. Milia, F. Marrosu, M. G. Marrosu, G. Floris, A. Cannas, S. Tranquilli, M. Capasso, C. Caponnetto, G. Mancardi, P. Origone, P. Mandich, F. L. Conforti, S. Cavallaro, G. Mora, K. Marinou, R. Sideri, S. Penco, L. Mosca, C. Lunetta, G. L. Pinter, M. Corbo, N. Riva, P. Carrera, P. Volanti, J. Mandrioli, N. Fini, A. Fasano, L. Tremolizzo, A. Arosio, C. Ferrarese, F. Trojsi, G. Tedeschi, M. R. Monsurrò, G. Piccirillo, C. Femiano, A. Ticca, E. Ortu, V. La Bella, R. Spataro, T. Colletti, M. Sabatelli, M. Zollino, A. Conte, M. Luigetti, S. Lattante, G. Marangi, M. Santarelli, A. Petrucci, M. Pugliatti, A. Pirisi, L. D. Parish, P. Occhineri, F. Giannini, S. Battistini, C. Ricci, M. Benigni, T. B. Cau, D. Loi, A. Calvo, C. Moglia, M. Brunetti, M. Barberis, G. Restagno, F. Casale, G. Marrali, G. Fuda, I. Ossola, S. Cammarosano, A. Canosa, A. Ilardi, U. Manera, M. Grassano, R. Tanel, F. Pisano, G. Mora, A. Calvo, L. Mazzini, N. Riva, J. Mandrioli, C. Caponnetto, S. Battistini, P. Volanti, V. La Bella, F. L. Conforti, G. Borghero, S. Messina, I. L. Simone, F. Trojsi, F. Salvi, F. O. Logullo, S. D’Alfonso, L. Corrado, M. Capasso, L. Ferrucci, M. B. Harms, D. B. Goldstein, N. A. Shneider, S. Goutman, Z. Simmons, T. M. Miller, S. Chandran, S. Pal, G. Manousakis, S. H. Appel, E. Simpson, L. Wang, R. H. Baloh, S. Gibson, R. Bedlack, D. Lacomis, D. Sareen, A. Sherman, L. Bruijn, M. Penny, C. d. A. M. Moreno, S. Kamalakaran, D. B. Goldstein, A. S. Allen, S. Appel, R. H. Baloh, R. S. Bedlack, B. E. Boone, R. Brown, J. P. Carulli, A. Chesi, W. K. Chung, E. T. Cirulli, G. M. Cooper, J. Couthouis, A. G. Day-Williams, P. A. Dion, S. Gibson, A. D. Gitler, J. D. Glass, D. B. Goldstein, Y. Han, M. B. Harms, T. Harris, S. D. Hayes, A. L. Jones, J. Keebler, B. J. Krueger, B. N. Lasseigne, S. E. Levy, Y.-F. Lu, T. Maniatis, D. McKenna-Yasek, T. M. Miller, R. M. Myers, S. Petrovski, S. M. Pulst, A. R. Raphael, J. M. Ravits, Z. Ren, G. A. Rouleau, P. C. Sapp, N. A. Shneider, E. Simpson, K. B. Sims, J. F. Staropoli, L. L. Waite, Q. Wang, J. R. Wimbish, W. W. Xin, A. D. Gitler, T. Harris, R. M. Myers, H. Phatnani, J. Kwan, D. Sareen, J. R. Broach, Z. Simmons, X. Arcila-Londono, E. B. Lee, V. M. Van Deerlin, N. A. Shneider, E. Fraenkel, L. W. Ostrow, F. Baas, N. Zaitlen, J. D. Berry, A. Malaspina, P. Fratta, G. A. Cox, L. M. Thompson, S. Finkbeiner, E. Dardiotis, T. M. Miller, S. Chandran, S. Pal, E. Hornstein, D. J. MacGowan, T. Heiman-Patterson, M. G. Hammell, N. A. Patsopoulos, J. Dubnau, A. Nath, H. Phatnani, R. L. Musunuri, U. S. Evani, A. Abhyankar, M. C. Zody, J. Kaye, S. Finkbeiner, S. Wyman, A. LeNail, L. Lima, E. Fraenkel, J. D. Rothstein, C. N. Svendsen, L. M. Thompson, J. Van Eyk, N. J. Maragakis, J. D. Berry, J. D. Glass, T. M. Miller, S. J. Kolb, R. H. Baloh, M. Cudkowicz, E. Baxi, J. Kaye, S. Finkbeiner, S. K. Wyman, A. LeNail, L. Lima, E. Fraenkel, C. N. Svendsen, L. M. Thompson, J. E. Van Eyk, J. D. Berry, T. M. Miller, S. J. Kolb, M. Cudkowicz, E. Baxi, M. Benatar, J. P. Taylor, G. Wu, E. Rampersaud, J. Wuu, R. Rademakers, S. Züchner, R. Schule, J. McCauley, S. Hussain, A. Cooley, M. Wallace, C. Clayman, R. Barohn, J. Statland, J. Ravits, A. Swenson, C. Jackson, J. Trivedi, S. Khan, J. Katz, L. Jenkins, T. Burns, K. Gwathmey, J. Caress, C. McMillan, L. Elman, E. Pioro, J. Heckmann, Y. So, D. Walk, S. Maiser, J. Zhang, M. Benatar, J. P. Taylor, E. Rampersaud, G. Wu, J. Wuu, V. Silani, N. Ticozzi, C. Gellera, A. Ratti, F. Taroni, G. Lauria, F. Verde, I. Fogh, C. Tiloca, G. P. Comi, G. Sorarù, C. Cereda, S. D’Alfonso, L. Corrado, F. De Marchi, S. Corti, M. Ceroni, L. Mazzini, G. Siciliano, M. Filosto, M. Inghilleri, S. Peverelli, C. Colombrita, B. Poletti, L. Maderna, R. Del Bo, S. Gagliardi, G. Querin, C. Bertolin, V. Pensato, B. Castellotti, G. Lauria, F. Verde, I. Fogh, C. Tiloca, G. P. Comi, G. Sorarù, C. Cereda, W. Camu, K. Mouzat, S. Lumbroso, P. Corcia, V. Meininger, G. Besson, E. Lagrange, P. Clavelou, N. Guy, P. Couratier, P. Vourch, V. Danel, E. Bernard, G. Lemasson, P. Corcia, H. Laaksovirta, L. Myllykangas, L. Jansson, M. Valori, J. Ealing, H. Hamdalla, S. Rollinson, S. Pickering- 214

Brown, R. W. Orrell, K. C. Sidle, A. Malaspina, J. Hardy, A. B. Singleton, J. O. Johnson, S. Arepalli, P. C. Sapp, D. McKenna-Yasek, M. Polak, S. Asress, S. Al-Sarraj, A. King, C. Troakes, C. Vance, J. de Belleroche, F. Baas, A. L. M. A. ten Asbroek, J. L. Muñoz-Blanco, D. G. Hernandez, J. Ding, J. R. Gibbs, S. W. Scholz, M. K. Floeter, R. H. Campbell, F. Landi, R. Bowser, S. M. Pulst, J. M. Ravits, D. J. L. MacGowan, J. Kirby, E. P. Pioro, R. Pamphlett, J. Broach, G. Gerhard, T. L. Dunckley, C. B. Brady, N. W. Kowall, J. C. Troncoso, I. Le Ber, K. Mouzat, S. Lumbroso, T. D. Heiman- Patterson, F. Kamel, L. Van Den Bosch, R. H. Baloh, T. M. Strom, T. Meitinger, A. Shatunov, K. R. Van Eijk, M. de Carvalho, M. Kooyman, B. Middelkoop, M. Moisse, R. L. McLaughlin, M. A. Van Es, M. Weber, K. B. Boylan, M. Van Blitterswijk, R. Rademakers, K. E. Morrison, A. N. Basak, J. S. Mora, V. E. Drory, P. J. Shaw, M. R. Turner, K. Talbot, O. Hardiman, K. L. Williams, J. A. Fifita, G. A. Nicholson, I. P. Blair, G. A. Rouleau, J. Esteban-Pérez, A. García-Redondo, A. Al-Chalabi, A. Al Kheifat, A. Al-Chalabi, P. Andersen, A. N. Basak, I. P. Blair, A. Chio, J. Cooper- Knock, P. Corcia, P. Couratier, M. de Carvalho, A. Dekker, V. Drory, A. G. Redondo, M. Gotkine, O. Hardiman, W. Hide, A. Iacoangeli, J. Glass, K. Kenna, M. Kiernan, M. Kooyman, J. Landers, R. McLaughlin, B. Middelkoop, J. Mill, M. M. Neto, M. Moisse, J. M. Pardina, K. Morrison, S. Newhouse, S. Pinto, S. Pulit, W. Robberecht, A. Shatunov, P. Shaw, C. Shaw, V. Silani, W. Sproviero, G. Tazelaar, N. Ticozzi, P. van Damme, L. van den Berg, R. van der Spek, K. van Eijk, M. van Es, W. van Rheenen, J. van Vugt, J. Veldink, M. Weber, K. L. Williams, M. Zatz, D. C. Bauer, N. A. Twine, E. Rogaeva, L. Zinman, L. W. Ostrow, N. J. Maragakis, J. D. Rothstein, Z. Simmons, J. Cooper-Knock, A. Brice, S. A. Goutman, E. L. Feldman, S. B. Gibson, F. Taroni, A. Ratti, C. Gellera, P. Van Damme, W. Robberecht, P. Fratta, M. Sabatelli, C. Lunetta, A. C. Ludolph, P. M. Andersen, J. H. Weishaupt, W. Camu, J. Q. Trojanowski, V. M. Van Deerlin, R. H. Brown, Jr., L. H. van den Berg, J. H. Veldink, M. B. Harms, J. D. Glass, D. J. Stone, P. Tienari, V. Silani, A. Chiò, C. E. Shaw, B. J. Traynor and J. E. Landers (2018). "Genome-wide Analyses Identify KIF5A as a Novel ALS Gene." Neuron 97(6): 1268-1283.e1266. Niedermeyer, S., M. Murn and P. J. Choi (2018). "Respiratory Failure in Amyotrophic Lateral Sclerosis." Chest. Nieman, B. J. and D. H. Turnbull (2010). "Ultrasound and magnetic resonance microimaging of mouse development." Methods in enzymology 476: 379-400. Nishimura, A. L., M. Mitne-Neto, H. C. A. Silva, J. R. M. Oliveira, M. Vainzof and M. Zatz (2004). "A novel locus for late onset amyotrophic lateral sclerosis/motor neurone disease variant at 20q13." Journal of Medical Genetics 41(4): 315-320. Nishimura, A. L., M. Mitne-Neto, H. C. A. Silva, A. Richieri-Costa, S. Middleton, D. Cascio, F. Kok, J. R. M. Oliveira, T. Gillingwater, J. Webb, P. Skehel and M. Zatz (2004). "A Mutation in the Vesicle-Trafficking Protein VAPB Causes Late-Onset Spinal Muscular Atrophy and Amyotrophic Lateral Sclerosis." The American Journal of Human Genetics 75(5): 822-831. Nonhoff, U., M. Ralser, F. Welzel, I. Piccini, D. Balzereit, M. L. Yaspo, H. Lehrach and S. Krobitsch (2007). "Ataxin-2 interacts with the DEAD/H-box RNA helicase DDX6 and interferes with P-bodies and stress granules." Mol Biol Cell 18(4): 1385-1396. Nunn, P. B. (2017). "50 years of research on alpha-amino-beta-methylaminopropionic acid (beta-methylaminoalanine)." Phytochemistry 144: 271-281. Ohm, T. G. (1997). "Does Alzheimer's disease start early in life?" Molecular Psychiatry 2: 21. Omotade, O. F., S. L. Pollitt and J. Q. Zheng (2017). "Actin-based growth cone motility and guidance." Molecular and Cellular Neuroscience. 215

Orlacchio, A., C. Babalini, A. Borreca, C. Patrono, R. Massa, S. Basaran, R. P. Munhoz, E. A. Rogaeva, P. H. St George-Hyslop, G. Bernardi and T. Kawarai (2010). "SPATACSIN mutations cause autosomal recessive juvenile amyotrophic lateral sclerosis." Brain 133(2): 591-598. Pamphlett, R. and F. Fang (2012). "Season and weather patterns at time of birth in amyotrophic lateral sclerosis." Amyotroph Lateral Scler 13(5): 459-464. Parkinson, N., P. G. Ince, M. O. Smith, R. Highley, G. Skibinski, P. M. Andersen, K. E. Morrison, H. S. Pall, O. Hardiman, J. Collinge, P. J. Shaw and E. C. Fisher (2006). "ALS phenotypes with mutations in CHMP2B (charged multivesicular body protein 2B)." Neurology 67(6): 1074-1077. Peters, T. L., F. Fang, C. E. Weibull, D. P. Sandler, F. Kamel and W. Ye (2013). "Severe head injury and amyotrophic lateral sclerosis." Amyotroph Lateral Scler Frontotemporal Degener 14(4): 267-272. Petrov, D., C. Mansfield, A. Moussy and O. Hermine (2017). "ALS Clinical Trials Review: 20 Years of Failure. Are We Any Closer to Registering a New Treatment?" Front Aging Neurosci 9: 68. Philippidou, P. and Jeremy S. Dasen (2013). "Hox Genes: Choreographers in Neural Development, Architects of Circuit Organization." Neuron 80(1): 12-34. Philips, T. and J. D. Rothstein (2014). "Glial cells in amyotrophic lateral sclerosis." Exp Neurol 262 Pt B: 111-120. Phukan, J., M. Elamin, P. Bede, N. Jordan, L. Gallagher, S. Byrne, C. Lynch, N. Pender and O. Hardiman (2012). "The syndrome of cognitive impairment in amyotrophic lateral sclerosis: a population-based study." J Neurol Neurosurg Psychiatry 83(1): 102- 108. Pieri, M., I. Carunchio, L. Curcio, N. B. Mercuri and C. Zona (2009). "Increased persistent sodium current determines cortical hyperexcitability in a genetic model of amyotrophic lateral sclerosis." Experimental Neurology 215(2): 368-379. Pleasure, I. T., M. M. Black and J. H. Keen (1993). "Valosin-containing protein, VCP, is a ubiquitous clathrin-binding protein." Nature 365(6445): 459-462. Polymenidou, M., C. Lagier-Tourenne, K. R. Hutt, S. C. Huelga, J. Moran, T. Y. Liang, S.-C. Ling, E. Sun, E. Wancewicz, C. Mazur, H. Kordasiewicz, Y. Sedaghat, J. P. Donohue, L. Shiue, C. F. Bennett, G. W. Yeo and D. W. Cleveland (2011). "Long pre- mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43." Nature Neuroscience 14: 459. Prokop, A. (2013). "The intricate relationship between microtubules and their associated motor proteins during axon growth and maintenance." Neural development 8(1): 17. Quarta, E., R. Bravi, I. Scambi, R. Mariotti and D. Minciacchi (2015). "Increased anxiety-like behavior and selective learning impairments are concomitant to loss of hippocampal interneurons in the presymptomatic SOD1(G93A) ALS mouse model." J Comp Neurol 523(11): 1622-1638. Qureshi, M. M., D. Hayden, L. Urbinelli, K. Ferrante, K. Newhall, D. Myers, S. Hilgenberg, R. Smart, R. H. Brown and M. E. Cudkowicz (2006). "Analysis of factors that modify susceptibility and rate of progression in amyotrophic lateral sclerosis (ALS)." Amyotroph Lateral Scler 7(3): 173-182. Ratti, E., N. Atassi, E. Macklin, A. Murphy, A. C. Groberio, B. Dickerson and J. Berry (2016). Evaluation of the Association Between Pattern of Symptoms Onset and Survival within the ALS-FTD Continuum (P1. 138), AAN Enterprises. Reinhard, M., K. Giehl, K. Abel, C. Haffner, T. Jarchau, V. Hoppe, B. M. Jockusch and U. Walter (1995). "The proline-rich focal adhesion and microfilament protein VASP is a ligand for profilins." EMBO J 14(8): 1583-1589. 216

Renton, A. E., A. Chio and B. J. Traynor (2014). "State of play in amyotrophic lateral sclerosis genetics." Nat Neurosci 17(1): 17-23. Renton, A. E., E. Majounie, A. Waite, J. Simon-Sanchez, S. Rollinson, J. R. Gibbs, J. C. Schymick, H. Laaksovirta, J. C. van Swieten, L. Myllykangas, H. Kalimo, A. Paetau, Y. Abramzon, A. M. Remes, A. Kaganovich, S. W. Scholz, J. Duckworth, J. Ding, D. W. Harmer, D. G. Hernandez, J. O. Johnson, K. Mok, M. Ryten, D. Trabzuni, R. J. Guerreiro, R. W. Orrell, J. Neal, A. Murray, J. Pearson, I. E. Jansen, D. Sondervan, H. Seelaar, D. Blake, K. Young, N. Halliwell, J. B. Callister, G. Toulson, A. Richardson, A. Gerhard, J. Snowden, D. Mann, D. Neary, M. A. Nalls, T. Peuralinna, L. Jansson, V. M. Isoviita, A. L. Kaivorinne, M. Holtta-Vuori, E. Ikonen, R. Sulkava, M. Benatar, J. Wuu, A. Chio, G. Restagno, G. Borghero, M. Sabatelli, I. Consortium, D. Heckerman, E. Rogaeva, L. Zinman, J. D. Rothstein, M. Sendtner, C. Drepper, E. E. Eichler, C. Alkan, Z. Abdullaev, S. D. Pack, A. Dutra, E. Pak, J. Hardy, A. Singleton, N. M. Williams, P. Heutink, S. Pickering-Brown, H. R. Morris, P. J. Tienari and B. J. Traynor (2011). "A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD." Neuron 72(2): 257-268. Riancho, J., P. Bosque-Varela, S. Perez-Pereda, M. Povedano, A. L. de Munain and A. Santurtun (2018). "The increasing importance of environmental conditions in amyotrophic lateral sclerosis." Int J Biometeorol 62(8): 1361-1374. Rocha, M. C., P. A. Pousinha, A. M. Correia, A. M. Sebastiao and J. A. Ribeiro (2013). "Early changes of neuromuscular transmission in the SOD1(G93A) mice model of ALS start long before motor symptoms onset." PLoS One 8(9): e73846. Romero, S., C. Le Clainche, D. Didry, C. Egile, D. Pantaloni and M.-F. Carlier (2004). "Formin is a processive motor that requires profilin to accelerate actin assembly and associated ATP hydrolysis." Cell 119(3): 419-429. Rosen, D. R., T. Siddique, D. Patterson, D. A. Figlewicz, P. Sapp, A. Hentati, D. Donaldson, J. Goto, J. P. O'Regan, H. X. Deng and et al. (1993). "Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis." Nature 362(6415): 59-62. Rothstein, J. D. (1996). "Therapeutic horizons for amyotrophic lateral sclerosis." Curr Opin Neurobiol 6(5): 679-687. Rotty, J. D., C. Wu, E. M. Haynes, C. Suarez, J. D. Winkelman, H. E. Johnson, J. M. Haugh, D. R. Kovar and J. E. Bear (2015). "Profilin-1 serves as a gatekeeper for actin assembly by Arp2/3-dependent and -independent pathways." Dev Cell 32(1): 54-67. Rowland, L. P. (2001). "How amyotrophic lateral sclerosis got its name: the clinical- pathologic genius of Jean-Martin Charcot." Arch Neurol 58(3): 512-515. Rowland, L. P. and N. A. Shneider (2001). "Amyotrophic lateral sclerosis." N Engl J Med 344(22): 1688-1700. Rubenstein, J. L. R. (2011). "Annual Research Review: Development of the cerebral cortex: implications for neurodevelopmental disorders." Journal of Child Psychology and Psychiatry 52(4): 339-355. Saba, L., M. T. Viscomi, S. Caioli, A. Pignataro, E. Bisicchia, M. Pieri, M. Molinari, M. Ammassari-Teule and C. Zona (2016). "Altered Functionality, Morphology, and Vesicular Glutamate Transporter Expression of Cortical Motor Neurons from a Presymptomatic Mouse Model of Amyotrophic Lateral Sclerosis." Cerebral Cortex 26(4): 1512-1528. Salvadores, N., M. Sanhueza, P. Manque and F. A. Court (2017). "Axonal Degeneration during Aging and Its Functional Role in Neurodegenerative Disorders." Front Neurosci 11: 451.

217

Schaefer, A. M., J. R. Sanes and J. W. Lichtman (2005). "A compensatory subpopulation of motor neurons in a mouse model of amyotrophic lateral sclerosis." Journal of Comparative Neurology 490(3): 209-219. Schindelin, J., I. Arganda-Carreras, E. Frise, V. Kaynig, M. Longair, T. Pietzsch, S. Preibisch, C. Rueden, S. Saalfeld, B. Schmid, J.-Y. Tinevez, D. J. White, V. Hartenstein, K. Eliceiri, P. Tomancak and A. Cardona (2012). "Fiji: an open-source platform for biological-image analysis." Nature Methods 9: 676. Schmid, B., A. Hruscha, S. Hogl, J. Banzhaf-Strathmann, K. Strecker, J. van der Zee, M. Teucke, S. Eimer, J. Hegermann, M. Kittelmann, E. Kremmer, M. Cruts, B. Solchenberger, L. Hasenkamp, F. van Bebber, C. Van Broeckhoven, D. Edbauer, S. F. Lichtenthaler and C. Haass (2013). "Loss of ALS-associated TDP-43 in zebrafish causes muscle degeneration, vascular dysfunction, and reduced motor neuron axon outgrowth." Proc Natl Acad Sci U S A 110(13): 4986-4991. Schulz, J., K. Franke, M. Frick and S. Schumacher (2016). "Different roles of the small GTPases Rac1, Cdc42, and RhoG in CALEB/NGC-induced dendritic tree complexity." Journal of Neurochemistry 139(1): 26-39. Shi, L., A. K. Fu and N. Y. Ip (2012). "Molecular mechanisms underlying maturation and maintenance of the vertebrate neuromuscular junction." Trends in neurosciences 35(7): 441-453. Simpson, C. L., R. Lemmens, K. Miskiewicz, W. J. Broom, V. K. Hansen, P. W. J. van Vught, J. E. Landers, P. Sapp, L. Van Den Bosch, J. Knight, B. M. Neale, M. R. Turner, J. H. Veldink, R. A. Ophoff, V. B. Tripathi, A. Beleza, M. N. Shah, P. Proitsi, A. Van Hoecke, P. Carmeliet, H. R. Horvitz, P. N. Leigh, C. E. Shaw, L. H. van den Berg, P. C. Sham, J. F. Powell, P. Verstreken, J. R. H. Brown, W. Robberecht and A. Al-Chalabi (2009). "Variants of the elongator protein 3 ( ELP3 ) gene are associated with motor neuron degeneration." Human Molecular Genetics 18(3): 472-481. Singer, C. A., K. L. Rogers, T. M. Strickland and D. M. Dorsa (1996). "Estrogen protects primary cortical neurons from glutamate toxicity." Neuroscience Letters 212(1): 13-16. Skruber, K., T.-A. Read and E. A. Vitriol (2018). "Reconsidering an active role for G- actin in cytoskeletal regulation." Journal of Cell Science 131(1). Smith, B. N., N. Ticozzi, C. Fallini, A. S. Gkazi, S. Topp, K. P. Kenna, E. L. Scotter, J. Kost, P. Keagle, J. W. Miller, D. Calini, C. Vance, E. W. Danielson, C. Troakes, C. Tiloca, S. Al-Sarraj, E. A. Lewis, A. King, C. Colombrita, V. Pensato, B. Castellotti, J. de Belleroche, F. Baas, A. L. ten Asbroek, P. C. Sapp, D. McKenna-Yasek, R. L. McLaughlin, M. Polak, S. Asress, J. Esteban-Perez, J. L. Munoz-Blanco, M. Simpson, S. Consortium, W. van Rheenen, F. P. Diekstra, G. Lauria, S. Duga, S. Corti, C. Cereda, L. Corrado, G. Soraru, K. E. Morrison, K. L. Williams, G. A. Nicholson, I. P. Blair, P. A. Dion, C. S. Leblond, G. A. Rouleau, O. Hardiman, J. H. Veldink, L. H. van den Berg, A. Al-Chalabi, H. Pall, P. J. Shaw, M. R. Turner, K. Talbot, F. Taroni, A. Garcia- Redondo, Z. Wu, J. D. Glass, C. Gellera, A. Ratti, R. H. Brown, Jr., V. Silani, C. E. Shaw and J. E. Landers (2014). "Exome-wide rare variant analysis identifies TUBA4A mutations associated with familial ALS." Neuron 84(2): 324-331. Smith, B. N., C. Vance, E. L. Scotter, C. Troakes, C. H. Wong, S. Topp, S. Maekawa, A. King, J. C. Mitchell, K. Lund, A. Al-Chalabi, N. Ticozzi, V. Silani, P. Sapp, R. H. Brown, Jr., J. E. Landers, S. Al-Sarraj and C. E. Shaw (2015). "Novel mutations support a role for Profilin 1 in the pathogenesis of ALS." Neurobiol Aging 36(3): 1602 e1617- 1627.

218

Sood, P., K. Murthy, T. V. Kumar, M. L. Nonet, G. I. Menon and S. P. Koushika (2017). "Cargo crowding at actin-rich regions along axons causes local traffic jams in neurons." bioRxiv: 151761. Southam, K. A., A. E. King, C. A. Blizzard, G. H. McCormack and T. C. Dickson (2013). "Microfluidic primary culture model of the lower motor neuron-neuromuscular junction circuit." J Neurosci Methods 218(2): 164-169. Spiller, K. J., C. R. Restrepo, T. Khan, M. A. Dominique, T. C. Fang, R. G. Canter, C. J. Roberts, K. R. Miller, R. M. Ransohoff, J. Q. Trojanowski and V. M. Lee (2018). "Microglia-mediated recovery from ALS-relevant motor neuron degeneration in a mouse model of TDP-43 proteinopathy." Nat Neurosci 21(3): 329-340. Sreedharan, J., I. P. Blair, V. B. Tripathi, X. Hu, C. Vance, B. Rogelj, S. Ackerley, J. C. Durnall, K. L. Williams, E. Buratti, F. Baralle, J. de Belleroche, J. D. Mitchell, P. N. Leigh, A. Al-Chalabi, C. C. Miller, G. Nicholson and C. E. Shaw (2008). "TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis." Science 319(5870): 1668-1672. Stefen, H., C. Chaichim, J. Power and T. Fath (2016). "Regulation of the Postsynaptic Compartment of Excitatory Synapses by the Actin Cytoskeleton in Health and Its Disruption in Disease." Neural Plasticity 2016: 19. Stoppel, C. M., S. Vielhaber, C. Eckart, J. Machts, J. Kaufmann, H. J. Heinze, K. Kollewe, S. Petri, R. Dengler, J. M. Hopf and M. A. Schoenfeld (2014). "Structural and functional hallmarks of amyotrophic lateral sclerosis progression in motor- and memory-related brain regions." Neuroimage Clin 5: 277-290. Suetsugu, S., H. Miki and T. Takenawa (1998). "The essential role of profilin in the assembly of actin for microspike formation." The EMBO Journal 17(22): 6516-6526. Suetsugu, S., H. Miki and T. Takenawa (1999). "Distinct roles of profilin in cell morphological changes: microspikes, membrane ruffles, stress fibers, and cytokinesis." FEBS Letters 457(3): 470-474. Suzuki, S., L. M. Gerhold, M. Böttner, S. W. Rau, C. Dela Cruz, E. Yang, H. Zhu, J. Yu, A. B. Cashion, M. S. Kindy, I. Merchenthaler, F. H. Gage and P. M. Wise (2007). "Estradiol enhances neurogenesis following ischemic stroke through estrogen receptors α and β." Journal of Comparative Neurology 500(6): 1064-1075. Swarup, V. and J. P. Julien (2011). "ALS pathogenesis: recent insights from genetics and mouse models." Prog Neuropsychopharmacol Biol Psychiatry 35(2): 363-369. Swarup, V., D. Phaneuf, N. Dupre, S. Petri, M. Strong, J. Kriz and J. P. Julien (2011). "Deregulation of TDP-43 in amyotrophic lateral sclerosis triggers nuclear factor kappaB-mediated pathogenic pathways." J Exp Med 208(12): 2429-2447. Takahashi, F., K. Takei, K. Tsuda and J. Palumbo (2017). "Post-hoc analysis of MCI186-17, the extension study to MCI186-16, the confirmatory double-blind, parallel- group, placebo-controlled study of edaravone in amyotrophic lateral sclerosis." Amyotroph Lateral Scler Frontotemporal Degener 18(sup1): 32-39. Takei, K., F. Takahashi, S. Liu, K. Tsuda and J. Palumbo (2017). "Post-hoc analysis of randomised, placebo-controlled, double-blind study (MCI186-19) of edaravone (MCI- 186) in amyotrophic lateral sclerosis." Amyotroph Lateral Scler Frontotemporal Degener 18(sup1): 49-54. Tanaka, Y. and M. Hasegawa (2016). "Profilin 1 mutants form aggregates that induce accumulation of prion-like TDP-43." Prion 10(4): 283-289. Thielsen, K. D., J. M. Moser, T. Schmitt-John, M. S. Jensen, K. Jensen and M. M. Holm (2013). "The Wobbler mouse model of amyotrophic lateral sclerosis (ALS) displays hippocampal hyperexcitability, and reduced number of interneurons, but no presynaptic vesicle release impairments." PLoS One 8(12): e82767. 219

Tiloca, C., N. Ticozzi, V. Pensato, L. Corrado, R. Del Bo, C. Bertolin, C. Fenoglio, S. Gagliardi, D. Calini, G. Lauria, B. Castellotti, A. Bagarotti, S. Corti, D. Galimberti, A. Cagnin, C. Gabelli, M. Ranieri, M. Ceroni, G. Siciliano, L. Mazzini, C. Cereda, E. Scarpini, G. Sorarù, G. P. Comi, S. D'Alfonso, C. Gellera, A. Ratti, J. E. Landers and V. Silani (2013). "Screening of the PFN1 gene in sporadic amyotrophic lateral sclerosis and in frontotemporal dementia." Neurobiology of Aging 34(5): 1517.e1519- 1517.e1510. Tremblay, E., E. Martineau and R. Robitaille (2017). "Opposite Synaptic Alterations at the Neuromuscular Junction in an ALS Mouse Model: When Motor Units Matter." J Neurosci 37(37): 8901-8918. Van Deerlin, V. M., J. B. Leverenz, L. M. Bekris, T. D. Bird, W. Yuan, L. B. Elman, D. Clay, E. M. Wood, A. S. Chen-Plotkin, M. Martinez-Lage, E. Steinbart, L. McCluskey, M. Grossman, M. Neumann, I. L. Wu, W. S. Yang, R. Kalb, D. R. Galasko, T. J. Montine, J. Q. Trojanowski, V. M. Lee, G. D. Schellenberg and C. E. Yu (2008). "TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis." Lancet Neurol 7(5): 409-416. van Es, M. A., H. J. Schelhaas, P. W. J. van Vught, N. Ticozzi, P. M. Andersen, E. J. N. Groen, C. Schulte, H. M. Blauw, M. Koppers, F. P. Diekstra, K. Fumoto, A. L. LeClerc, P. Keagle, B. R. Bloem, H. Scheffer, B. F. L. van Nuenen, M. van Blitterswijk, W. van Rheenen, A.-M. Wills, P. P. Lowe, G.-f. Hu, W. Yu, H. Kishikawa, D. Wu, R. D. Folkerth, C. Mariani, S. Goldwurm, G. Pezzoli, P. Van Damme, R. Lemmens, C. Dahlberg, A. Birve, R. Fernández-Santiago, S. Waibel, C. Klein, M. Weber, A. J. van der Kooi, M. de Visser, D. Verbaan, J. J. van Hilten, P. Heutink, E. A. M. Hennekam, E. Cuppen, D. Berg, R. H. Brown, V. Silani, T. Gasser, A. C. Ludolph, W. Robberecht, R. A. Ophoff, J. H. Veldink, R. J. Pasterkamp, P. I. W. de Bakker, J. E. Landers, B. P. van de Warrenburg and L. H. van den Berg (2011). "Angiogenin variants in Parkinson disease and amyotrophic lateral sclerosis." Annals of Neurology 70(6): 964-973. van Hummel, A., G. Chan, J. van der Hoven, M. Morsch, S. Ippati, L. Suh, M. Bi, P. R. Asih, W. S. Lee, T. A. Butler, M. Przybyla, G. M. Halliday, O. Piguet, M. C. Kiernan, R. S. Chung, L. M. Ittner and Y. D. Ke (2018). "Selective Spatiotemporal Vulnerability of Central Nervous System Neurons to Pathologic TAR DNA-Binding Protein 43 in Aged Transgenic Mice." Am J Pathol 188(6): 1447-1456. Van Mossevelde, S., J. van der Zee, M. Cruts and C. Van Broeckhoven (2017). "Relationship between C9orf72 repeat size and clinical phenotype." Current Opinion in Genetics & Development 44: 117-124. Vance, C., B. Rogelj, T. Hortobágyi, K. J. De Vos, A. L. Nishimura, J. Sreedharan, X. Hu, B. Smith, D. Ruddy, P. Wright, J. Ganesalingam, K. L. Williams, V. Tripathi, S. Al-Saraj, A. Al-Chalabi, P. N. Leigh, I. P. Blair, G. Nicholson, J. de Belleroche, J.-M. Gallo, C. C. Miller and C. E. Shaw (2009). "Mutations in FUS, an RNA Processing Protein, Cause Familial Amyotrophic Lateral Sclerosis Type 6." Science 323(5918): 1208-1211. Verhey, K. J., D. L. Lizotte, T. Abramson, L. Barenboim, B. J. Schnapp and T. A. Rapoport (1998). "Light chain-dependent regulation of Kinesin's interaction with microtubules." J Cell Biol 143(4): 1053-1066. Vinsant, S., C. Mansfield, R. Jimenez-Moreno, V. Del Gaizo Moore, M. Yoshikawa, T. G. Hampton, D. Prevette, J. Caress, R. W. Oppenheim and C. Milligan (2013). "Characterization of early pathogenesis in the SOD1(G93A) mouse model of ALS: part I, background and methods." Brain Behav 3(4): 335-350. Vinsant, S., C. Mansfield, R. Jimenez-Moreno, V. Del Gaizo Moore, M. Yoshikawa, T. G. Hampton, D. Prevette, J. Caress, R. W. Oppenheim and C. Milligan (2013). 220

"Characterization of early pathogenesis in the SOD1(G93A) mouse model of ALS: part II, results and discussion." Brain Behav 3(4): 431-457. Vitriol, Eric A. and James Q. Zheng (2012). "Growth Cone Travel in Space and Time: the Cellular Ensemble of Cytoskeleton, Adhesion, and Membrane." Neuron 73(6): 1068-1081. Wegner, A. M., C. A. Nebhan, L. Hu, D. Majumdar, K. M. Meier, A. M. Weaver and D. J. Webb (2008). "N-wasp and the arp2/3 complex are critical regulators of actin in the development of dendritic spines and synapses." J Biol Chem 283(23): 15912-15920. Wegorzewska, I., S. Bell, N. J. Cairns, T. M. Miller and R. H. Baloh (2009). "TDP-43 mutant transgenic mice develop features of ALS and frontotemporal lobar degeneration." Proceedings of the National Academy of Sciences 106(44): 18809- 18814. Wen, K.-K., M. McKane, J. C. Houtman and P. A. Rubenstein (2008). "Control of profilin's ability to bind and facilitate nucleotide exchange from G-actin." Journal of Biological Chemistry. Weydt, P., S. Y. Hong, M. Kliot and T. Moller (2003). "Assessing disease onset and progression in the SOD1 mouse model of ALS." Neuroreport 14(7): 1051-1054. Wheway, G., M. Schmidts, D. A. Mans, K. Szymanska, T.-M. T. Nguyen, H. Racher, I. G. Phelps, G. Toedt, J. Kennedy, K. A. Wunderlich, N. Sorusch, Z. A. Abdelhamed, S. Natarajan, W. Herridge, J. van Reeuwijk, N. Horn, K. Boldt, D. A. Parry, S. J. F. Letteboer, S. Roosing, M. Adams, S. M. Bell, J. Bond, J. Higgins, E. E. Morrison, D. C. Tomlinson, G. G. Slaats, T. J. P. van Dam, L. Huang, K. Kessler, A. Giessl, C. V. Logan, E. A. Boyle, J. Shendure, S. Anazi, M. Aldahmesh, S. Al Hazzaa, R. A. Hegele, C. Ober, P. Frosk, A. A. Mhanni, B. N. Chodirker, A. E. Chudley, R. Lamont, F. P. Bernier, C. L. Beaulieu, P. Gordon, R. T. Pon, C. Donahue, A. J. Barkovich, L. Wolf, C. Toomes, C. T. Thiel, K. M. Boycott, M. McKibbin, C. F. Inglehearn, U. K. Consortium, G. University of Washington Center for Mendelian, F. Stewart, H. Omran, M. A. Huynen, P. I. Sergouniotis, F. S. Alkuraya, J. S. Parboosingh, A. M. Innes, C. E. Willoughby, R. H. Giles, A. R. Webster, M. Ueffing, O. Blacque, J. G. Gleeson, U. Wolfrum, P. L. Beales, T. Gibson, D. Doherty, H. M. Mitchison, R. Roepman and C. A. Johnson (2015). "An siRNA-based functional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes." Nature Cell Biology 17: 1074. Wiese, S., T. Herrmann, C. Drepper, S. Jablonka, N. Funk, A. Klausmeyer, M. L. Rogers, R. Rush and M. Sendtner (2010). "Isolation and enrichment of embryonic mouse motoneurons from the lumbar spinal cord of individual mouse embryos." Nat Protoc 5(1): 31-38. Williams, K. L., S. Topp, S. Yang, B. Smith, J. A. Fifita, S. T. Warraich, K. Y. Zhang, N. Farrawell, C. Vance, X. Hu, A. Chesi, C. S. Leblond, A. Lee, S. L. Rayner, V. Sundaramoorthy, C. Dobson-Stone, M. P. Molloy, M. van Blitterswijk, D. W. Dickson, R. C. Petersen, N. R. Graff-Radford, B. F. Boeve, M. E. Murray, C. Pottier, E. Don, C. Winnick, E. P. McCann, A. Hogan, H. Daoud, A. Levert, P. A. Dion, J. Mitsui, H. Ishiura, Y. Takahashi, J. Goto, J. Kost, C. Gellera, A. S. Gkazi, J. Miller, J. Stockton, W. S. Brooks, K. Boundy, M. Polak, J. L. Muñoz-Blanco, J. Esteban-Pérez, A. Rábano, O. Hardiman, K. E. Morrison, N. Ticozzi, V. Silani, J. de Belleroche, J. D. Glass, J. B. J. Kwok, G. J. Guillemin, R. S. Chung, S. Tsuji, R. H. Brown Jr, A. García-Redondo, R. Rademakers, J. E. Landers, A. D. Gitler, G. A. Rouleau, N. J. Cole, J. J. Yerbury, J. D. Atkin, C. E. Shaw, G. A. Nicholson and I. P. Blair (2016). "CCNF mutations in amyotrophic lateral sclerosis and frontotemporal dementia." Nature Communications 7: 11253.

221

Williamson, T. L. and D. W. Cleveland (1999). "Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons." Nat Neurosci 2(1): 50-56. Wills, Z., L. Marr, K. Zinn, C. S. Goodman and D. Van Vactor (1999). "Profilin and the Abl tyrosine kinase are required for motor axon outgrowth in the Drosophila embryo." Neuron 22(2): 291-299. Wilson, J. M., R. Hartley, D. J. Maxwell, A. J. Todd, I. Lieberam, J. A. Kaltschmidt, Y. Yoshida, T. M. Jessell and R. M. Brownstone (2005). "Conditional rhythmicity of ventral spinal interneurons defined by expression of the Hb9 homeodomain protein." J Neurosci 25(24): 5710-5719. Wilson, N. H. and B. Key (2006). "Neogenin interacts with RGMa and netrin-1 to guide axons within the embryonic vertebrate forebrain." Developmental biology 296(2): 485- 498. Witke, W. (2004). "The role of profilin complexes in cell motility and other cellular processes." Trends Cell Biol 14(8): 461-469. Witke, W., A. V. Podtelejnikov, A. Di Nardo, J. D. Sutherland, C. B. Gurniak, C. Dotti and M. Mann (1998). "In mouse brain profilin I and profilin II associate with regulators of the endocytic pathway and actin assembly." EMBO J 17(4): 967-976. Witke, W., J. D. Sutherland, A. Sharpe, M. Arai and D. J. Kwiatkowski (2001). "Profilin I is essential for cell survival and cell division in early mouse development." Proc Natl Acad Sci U S A 98(7): 3832-3836. Writing, G. and A. L. S. S. G. Edaravone (2017). "Safety and efficacy of edaravone in well defined patients with amyotrophic lateral sclerosis: a randomised, double-blind, placebo-controlled trial." Lancet Neurol 16(7): 505-512. Writing Group On Behalf Of The Edaravone Als 17 Study, G. (2017). "Exploratory double-blind, parallel-group, placebo-controlled extension study of edaravone (MCI- 186) in amyotrophic lateral sclerosis." Amyotroph Lateral Scler Frontotemporal Degener 18(sup1): 20-31. Wu, C. H., C. Fallini, N. Ticozzi, P. J. Keagle, P. C. Sapp, K. Piotrowska, P. Lowe, M. Koppers, D. McKenna-Yasek, D. M. Baron, J. E. Kost, P. Gonzalez-Perez, A. D. Fox, J. Adams, F. Taroni, C. Tiloca, A. L. Leclerc, S. C. Chafe, D. Mangroo, M. J. Moore, J. A. Zitzewitz, Z. S. Xu, L. H. van den Berg, J. D. Glass, G. Siciliano, E. T. Cirulli, D. B. Goldstein, F. Salachas, V. Meininger, W. Rossoll, A. Ratti, C. Gellera, D. A. Bosco, G. J. Bassell, V. Silani, V. E. Drory, R. H. Brown, Jr. and J. E. Landers (2012). "Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis." Nature 488(7412): 499-503. Wu, C. H., A. Giampetruzzi, H. Tran, C. Fallini, F. B. Gao and J. E. Landers (2017). "A Drosophila model of ALS reveals a partial loss of function of causative human PFN1 mutants." Hum Mol Genet 26(11): 2146-2155. Xiao, Y., C. Karam, J. Yi, L. Zhang, X. Li, D. Yoon, H. Wang, K. Dhakal, P. Ramlow, T. Yu, Z. Mo, J. Ma and J. Zhou (2018). "ROS-related mitochondrial dysfunction in skeletal muscle of an ALS mouse model during the disease progression." Pharmacological Research. Xue, B. and R. C. Robinson (2013). "Guardians of the actin monomer." Eur J Cell Biol 92(10-11): 316-332. Yang, C., E. W. Danielson, T. Qiao, J. Metterville, R. H. Brown, Jr., J. E. Landers and Z. Xu (2016). "Mutant PFN1 causes ALS phenotypes and progressive motor neuron degeneration in mice by a gain of toxicity." Proc Natl Acad Sci U S A 113(41): E6209- E6218.

222

Yang, C., M. Huang, J. DeBiasio, M. Pring, M. Joyce, H. Miki, T. Takenawa and S. H. Zigmond (2000). "Profilin enhances Cdc42-induced nucleation of actin polymerization." J Cell Biol 150(5): 1001-1012. Yang, S., J. A. Fifita, K. L. Williams, S. T. Warraich, R. Pamphlett, G. A. Nicholson and I. P. Blair (2013). "Mutation analysis and immunopathological studies of PFN1 in familial and sporadic amyotrophic lateral sclerosis." Neurobiology of Aging 34(9): 2235.e2237-2235.e2210. Yang, Y., A. Hentati, H.-X. Deng, O. Dabbagh, T. Sasaki, M. Hirano, W.-Y. Hung, K. Ouahchi, J. Yan, A. C. Azim, N. Cole, G. Gascon, A. Yagmour, M. Ben-Hamida, M. Pericak-Vance, F. Hentati and T. Siddique (2001). "The gene encoding alsin, a protein with three guanine-nucleotide exchange factor domains, is mutated in a form of recessive amyotrophic lateral sclerosis." Nature Genetics 29: 160. Yao, P. J., R. S. Petralia, C. Ott, Y. X. Wang, J. Lippincott-Schwartz and M. P. Mattson (2015). "Dendrosomatic Sonic Hedgehog Signaling in Hippocampal Neurons Regulates Axon Elongation." J Neurosci 35(49): 16126-16141. Yaron, A. and O. Schuldiner (2016). "Common and Divergent Mechanisms in Developmental Neuronal Remodeling and Dying Back Neurodegeneration." Curr Biol 26(13): R628-r639. Yu, Y., F. C. Su, B. C. Callaghan, S. A. Goutman, S. A. Batterman and E. L. Feldman (2014). "Environmental risk factors and amyotrophic lateral sclerosis (ALS): a case- control study of ALS in Michigan." PLoS One 9(6): e101186. Zhang, R., Y. Wu, F. Xie, Y. Zhong, Y. Wang, M. Xu, J. Feng, J. Charish, P. P. Monnier and X. Qin (2018). "RGMa mediates reactive astrogliosis and glial scar formation through TGFβ1/Smad2/3 signaling after stroke." Cell Death & Differentiation 25(8): 1503-1516. Zhao, L. and R. D. Brinton (2007). "Estrogen receptor α and β differentially regulate intracellular Ca2+ dynamics leading to ERK phosphorylation and estrogen neuroprotection in hippocampal neurons." Brain Research 1172: 48-59. Zou, Z. Y., Q. Sun, M. S. Liu, X. G. Li and L. Y. Cui (2013). "Mutations in the profilin 1 gene are not common in amyotrophic lateral sclerosis of Chinese origin." Neurobiol Aging 34(6): 1713 e1715-1716.

223