DOCSLIB.ORG

Application of a Multiplex PCR Assay for Campylobacter Fetus Detection and Subspecies Differentiation in Uncultured Samples of Aborted Bovine Fetuses

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Application of a Multiplex PCR Assay for Campylobacter Fetus Detection and Subspecies Differentiation in Uncultured Samples of Aborted Bovine Fetuses pISSN 1229-845X, eISSN 1976-555X JOURNAL OF J. Vet. Sci. (2012), 13(4), 371-376 http://dx.doi.org/10.4142/jvs.2012.13.4.371 Veterinary Received: 11 Jul. 2011, Revised: 23 Oct. 2011, Accepted: 16 Mar. 2012 Science Original Article Application of a multiplex PCR assay for Campylobacter fetus detection and subspecies differentiation in uncultured samples of aborted bovine fetuses Gregorio Iraola1, Martín Hernández1, Lucía Calleros1, Fernando Paolicchi4, Silvia Silveyra3, Alejandra Velilla4, Luis Carretto1, Eliana Rodríguez2, Ruben Pérez1,* 1Evolutionary Genetics Section, Department of Animal Biology, Institute of Biology, and 2Practice Laboratories Unit, Faculty of Sciences, University of the Republic, 11400 Montevideo, Uruguay 3Division of Veterinary Laboratories (DILAVE), Montevideo, Uruguay 4Laboratory of Bacteriology, National Institute of Agricultural Technology (INTA), Balcarce, Argentina Campylobacter (C.) fetus (epsilonproteobacteria) is an in wildlife [3]. In particular, the species Campylobacter important veterinary pathogen. This species is currently (C.) fetus is an important veterinary pathogen that can also divided into C. fetus subspecies (subsp.) fetus (Cff) and C. fetus infect humans. This species is currently divided into C. subsp. venerealis (Cfv). Cfv is the causative agent of bovine fetus subspecies (subsp.) fetus (Cff) and C. fetus subsp. genital Campylobacteriosis, an infectious disease that leads to venerealis (Cfv). A phenotypic variant designated as C. severe reproductive problems in cattle worldwide. Cff is a fetus subsp. venerealis biovar intermedius (Cfvi) has also more general pathogen that causes reproductive problems been described [24]. mainly in sheep although cattle can also be affected. Here we Cff causes abortion mainly in sheep [6] and to a lesser describe a multiplex PCR method to detect C. fetus and extent in cattle. In humans, this is an opportunistic differentiate between subspecies in a single step. The assay microorganism that mainly infects immune-compromised was standardized using cultured strains and successfully used patients [12,21]. Cfv is the causative agent of bovine to analyze the abomasal liquid of aborted bovine fetuses genital campylobacteriosis (BGC), an infectious venereal without any pre-enrichment step. Results of our assay were disease which leads to reproductive problems such as completely consistent with those of traditional bacteriological infertility, lowered pregnancy rates, and abortion [4]. This diagnostic methods. Furthermore, the multiplex PCR subspecies is thought to be a cattle-specific pathogen and technique we developed may be easily adopted by any has been isolated from bull preputial cavities, cow vaginal molecular diagnostic laboratory as a complementary tool for mucus, and the organs of aborted fetuses [16,18]. Although detecting C. fetus subspecies and obtaining epidemiological Cfvi shows characteristics similar to those of Cfv, it is information about abortion events in cattle. unclear whether it can occur only in the genital tract or both Keywords: bovine aborted fetuses, Campylobacter fetus the genital and intestinal tracts [5,6]. Campylobacteriosis subspecies venerealis, multiplex PCR is a matter of concern for the cattle industry worldwide as this disease causes significant economic losses [2,15]. Infected animals are subjected to trade restrictions and it is therefore mandatory to report outbreaks to the World Introduction Organization for Animal Health (OIE). In order to collect epidemiological information and other Members of the genus Campylobacter are Gram-negative clinically relevant data about C. fetus infection, adequate epsilonproteobacteria highly adapted to vertebrate hosts. diagnostic methods are required. Bacteriological analyses, Most Campylobacter species are pathogens in a wide range such as culture isolation and biochemical tests, are useful of livestock species [18] and also have extensive reservoirs for evaluating different kinds of samples even with low *Corresponding author: Tel: +598-2-5258618; Fax: +598-2-5258617; E-mail: [email protected] ⓒ 2012 The Korean Society of Veterinary Science. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 372 Gregorio Iraola et al. bacterial counts (e.g., preputial washings from bulls). the cstA gene, which is a widely used genetic marker for C. Although these methods are well standardized and fetus [7]. The primer set nC1165g4F/nC1165g4R amplifies extensively used, they are laborious and time-consuming, a 233-bp amplicon of the virB11 gene that is present in Cfv thus making them disadvantageous when processing but not in Cff [13]. Multiplex PCR using these two primer large-scale samples or delivering a fast diagnosis. sets would accordingly produce only the 764-bp amplicon Molecular methods using polymerase chain reaction for Cff, and yield both the 764-bp and 233-bp amplicons in (PCR) have become a good alternative for obtaining rapid the case of Cfv. and highly specific bacterial diagnoses [8,11,27]. There are relatively few assays described for C. fetus [1,10,23,25]. Bacterial strains The most widely used is a multiplex PCR technique that Standardization of the multiplex PCR assay was detects C. fetus and differentiates between its subspecies performed with cultured Uruguayan, Australian, and [7]. This assay amplifies a 764-bp fragment that is specific Argentinian strains of Cff, Cfv, and Cfvi, provided from for C. fetus, and an additional 142-bp fragment that appears reference laboratories of Division of Veterinary in Cfv but not Cff [7]. However, the amplicon used as a Laboratories (DILAVE), Uruguay and National Institute of marker for Cfv has been reported to produce results that Agricultural Technology (INTA), Argentina, that are contradict those of other assays [7,19]. New markers for routinely used as controls for diagnostic procedures in Cfv have been suggested [1,23], but have not been Uruguay. Abomasal liquid from an Uruguayan aborted extensively applied. fetus that had been stored at −20oC since 1998 was In the present study, we developed a multiplex PCR assay included as an additional control. A bacterial strain to amplify a C. fetus-specific 764-bp sequence (C. fetus characterized as Cff had been previously isolated from this marker) and a 233-bp sequence that is only present in Cfv liquid in DILAVE. The multiplex-PCR assay was also (Cfv marker). The latter marker was recently identified by performed with 10 Uruguayan samples collected from the whole-sequence genome comparisons between both field during 2010. These samples were directly obtained subspecies [13]. This multiplex PCR assay allowed from the abomasal contents of bovine aborted fetuses straightforward detection of the species C. fetus and Cfv (Table 2). C. jejuni, C. sputorum subsp. bubulus (Csb), C. subspecies, and was standardized using cultured strains. coli, C. hyointestinalis, and Escherichia (E.) coli were used The assay was also successfully used to evaluate DNA as negative controls (INTA, Argentina) (Table 2); these are extracted directly from the abomasal liquid contents of Uruguayan and Argentinian strains that are routinely used aborted bovine fetuses without any pre-enrichment step. as negative controls for diagnostic laboratories. Materials and Methods Sample testing with standard bacteriological methods Control and field strains were previously typed using Multiplex PCR design standard bacteriological methods for Campylobacter fetus The multiplex PCR assay included two sets of commercial subespecies differentiation [9] in order to test the multiplex- primers synthesized by Integrated DNA Technologies PCR assay specificity. Bacterial samples were grown in heart (USA). These primer sets were previously described in the brain infusion agar (Sigma-Aldrich, USA) and Campylobacter literature but had never been used simultaneously (Table 1). selective supplement (Thermo Fisher Scientific, USA) as The primer set MG3F/MG4F amplifies a 764-bp region of selective medium under microaerophillic conditions for 48 h at 37oC. The presumptive Campylobacter colonies were grown in Brucella broth (Sigma-Aldrich, USA) with 1% glycine (Sigma-Aldrich, USA) and in Brucella broth with Table 1. Primers used for the multiplex PCR assay NaCl and cysteine (Sigma-Aldrich, USA) to detect H2S production with lead acetate paper (Sigma-Aldrich, USA). Amplicon Name Sequence Specificity size (bp) Typing samples by multiplex PCR MG3F* 5´ GGTAGCCGCAGCTGCTAAGAT 3´ 764 C. fetus DNA was extracted from 500 μL of control strain 8 MG4R* 5´ TAGCTACAATAACGACAACT 3´ colonies (1 × 10 CFU/mL) resuspended and diluted nC1165g4F† 5´ AGGACACAAATGGTAACTGG 3´ 233 Cfv 10-fold in PBS (pH 7.4) using a QIAamp DNA Mini Kit nC1165g4R† 5´ GATTGTATAGCGGACTTTGC 3´ (Qiagen, Germany) according to the manufacturer’s protocol. The DNA purification protocol was the same for *The MG3F and MG4R primer names and sequences were the ten field samples although 1,000 µL of liquid abomasal previously reported by Hum et al. [7]. †The nC1165g4F and nC1165g4R primer names and sequences were previously reported content from the aborted fetuses was used. Nanodrop 1000 by Moolhuijzen et al. [13]. C. fetus: Campylobacter fetus, Cfv: C. (Thermo Scientific, USA) was used to assess the extracted fetus subsp. venerealis. DNA purity,
Load more

Recommended publications
  • Abortion Outbreak Caused by Campylobacter Fetus Subspecies Venerealis and Neospora Caninum in a Bovine Dairy Herd
    https://doi.org/10.22319/rmcp.v10i4.5008 Technical note Abortion outbreak caused by Campylobacter fetus subspecies venerealis and Neospora caninum in a bovine dairy herd Melissa Macías-Rioseco a Rubén D. Caffarena a,b Martín Fraga a Caroline Silveira a Federico Giannitti a,c Germán Cantón d Yanina P. Hecker e Alejandra Suanes f Franklin Riet-Correa a* * Corresponding author: [email protected] a Instituto Nacional de Investigación Agropecuaria (INIA). Plataforma de Investigación en Salud Animal. Ruta 50 km 11, 70000, La Estanzuela, Uruguay. b Universidad de la República, Facultad de Veterinaria, Montevideo, Uruguay. c University of Minnesota, Veterinary Population Medicine Department, MN, USA. d Instituto Nacional de Tecnología Agropecuaria. Balcarce, Argentina. e Consejo Nacional de Investigaciones Científicas y Técnicas. Balcarce, Argentina. f Ministerio de Ganadería Agricultura y Pesca. Montevideo. Dirección de Laboratorios Veterinarios, Uruguay. 1054 Rev Mex Cienc Pecu 2019;10(4):1054-1063 Abstract: In November 2015, an abortion outbreak occurred in a commercial dairy herd of 650 Holstein cows in Florida department, Uruguay. Forty-five (45) cows aborted within 3 wk. Five fetuses were subjected to gross and microscopic pathologic examination, and microbiological testing. One fetus had fibrinous epicarditis and peritonitis, and neutrophilic bronchopneumonia. Campylobacter fetus subsp. venerealis was detected by direct immunofluorescence, isolated and identified by PCR and sequencing of the 16S rDNA in the abomasal fluid and/or lung. Histologic examination of two other fetuses revealed non- suppurative necrotizing encephalitis, lymphohistiocytic myositis and myocarditis, and lymphocytic interstitial nephritis. In these fetuses, N. caninum antigen was detected intralesionally by immunohistochemistry, and N. caninum DNA was amplified by PCR on formalin-fixed paraffin-embedded brain.
    [Show full text]
  • Arcobacter, Campylobacter, and Helicobacter in Reptiles
    fmicb-10-01086 May 28, 2019 Time: 15:12 # 1 REVIEW published: 15 May 2019 doi: 10.3389/fmicb.2019.01086 Living in Cold Blood: Arcobacter, Campylobacter, and Helicobacter in Reptiles Maarten J. Gilbert1,2*, Birgitta Duim1,3, Aldert L. Zomer1,3 and Jaap A. Wagenaar1,3,4 1 Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, Netherlands, 2 Reptile, Amphibian and Fish Conservation Netherlands, Nijmegen, Netherlands, 3 WHO Collaborating Center for Campylobacter/OIE Reference Laboratory for Campylobacteriosis, Utrecht, Netherlands, 4 Wageningen Bioveterinary Research, Lelystad, Netherlands Species of the Epsilonproteobacteria genera Arcobacter, Campylobacter, and Helicobacter are commonly associated with vertebrate hosts and some are considered significant pathogens. Vertebrate-associated Epsilonproteobacteria are often considered to be largely confined to endothermic mammals and birds. Recent studies have shown that ectothermic reptiles display a distinct and largely unique Epsilonproteobacteria community, including taxa which can cause disease in humans. Several Arcobacter taxa are widespread amongst reptiles and often show a broad host range. Reptiles carry a large diversity of unique and novel Helicobacter taxa, which Edited by: John R. Battista, apparently evolved in an ectothermic host. Some species, such as Campylobacter Louisiana State University, fetus, display a distinct intraspecies host dichotomy, with genetically divergent lineages United States occurring either in mammals or reptiles. These taxa can provide valuable insights in Reviewed by: Heriberto Fernandez, host adaptation and co-evolution between symbiont and host. Here, we present an Austral University of Chile, Chile overview of the biodiversity, ecology, epidemiology, and evolution of reptile-associated Zuowei Wu, Epsilonproteobacteria from a broader vertebrate host perspective.
    [Show full text]
  • Pregnancy Loss in Beef Cattle
    Pregnancy Loss in Beef Cattle Guide B-228 John C. Wenzel and Timothy J. Hanosh1 Cooperative Extension Service • College of Agricultural, Consumer and Environmental Sciences This publication is scheduled to be updated and reissued 6/16. Abortion and loss of pregnancy in beef cattle can movement of cattle; origin of new cattle and occur for a variety of reasons. Many times the rea- bulls brought into the herd; results of semen son for the loss is complex and difficult to diagnose. evaluations; and diagnostic test results on bulls. This guide will briefly outline and discuss some of the more common diseases and causes of loss of 5. Keep a reproductive history on your cow herd, pregnancy. If a loss of pregnancy is suspected, con- including conception rate, calving rate, weaning tact your local veterinarian for assistance and advice rate, and dates when bulls are exposed to cows. for diagnosis and control of the causative agent in the pregnancy loss. The following are some helpful steps to take when an abortion is identified. Bovine virus DiarrHea CAUTION: Many diseases that cause abortion Bovine virus diarrhea (BVD) is a viral disease in cattle are caused by pathogens that can cause caused by a pestivirus with many syndromes. For disease in people. Follow good biosecurity measures this guide, only the abortion syndrome will be dis- and use personal protective equipment such as latex cussed. The pregnancy loss associated with BVD is gloves and a mask when handling the aborted fetus dependent on when in gestation the dam is exposed and materials. Use disinfectant soap when washing to the virus.
    [Show full text]
  • Bovine Genital Campylobacteriosis: Main Features and Perspectives for Diagnosis and Control
    Ciência Rural, SantaBovine Maria, genital v.50:3, campylobacteriosis: e20190272, 2020main features and perspectives for http://dx.doi.org/10.1590/0103-8478cr20190272 diagnosis and control. 1 ISSNe 1678-4596 MICROBIOLOGY Bovine genital campylobacteriosis: main features and perspectives for diagnosis and control Cláudia Balzan1* Rosangela Estel Ziech2 Letícia Trevisan Gressler3 Agueda Palmira Castagna de Vargas1 1Programa de Pós-graduação em Medicina Veterinária (PPGMV), Departamento de Medicina Veterinária Preventiva, Centro de Ciências Rurais (CCR), Universidade Federal de Santa Maria (UFSM), 97105-900, Santa Maria, RS, Brasil. E-mail: [email protected]. *Corresponding author. 2Médica Veterinária, Prefeitura Dois Vizinhos, Dois Vizinhos, PR, Brasil. 3Laboratório de Microbiologia e Doenças Infecciosas, Instituto Federal de Educação, Ciência e Tecnologia Farroupilha (IFFar), Frederico Westphalen, RS, Brasil. ABSTRACT: Bovine genital campylobacteriosis (BGC) is a venereal disease caused by Campylobacter fetus subsp. venerealis. In countries with large cattle herds, such as Brazil, where the use of natural breeding as a reproductive strategy is a common practice, BGC is considered an important cause of reproductive failure and economic losses. In these cases, the bull is the asymptomatic carrier of the bacterium and the infected females can have infertility and even abortions. The techniques for the diagnosis of C. fetus are isolation in culture medium and identification by biochemical tests, immunofluorescence, immunoenzymatic assays and molecular techniques. Disease control is based on vaccination with bacterins. This review described the epidemiology, etiology, pathogenesis, and advances in the diagnosis and control of BGC. Key words: Campylobacter fetus subsp. venerealis, infertility, venereal disease, beef cattle. Campilobacteriose genital bovina: principais características e perspectivas para o diagnóstico e controle RESUMO: A campilobacteriose genital bovina (CGB) é uma importante enfermidade de caráter venéreo causada por Campylobacter fetus subsp.
    [Show full text]
  • A Review of Sexually Transmitted Bovine Trichomoniasis and Campylobacteriosis Affecting Cattle Reproductive Health
    Theriogenology 85 (2016) 781–791 Contents lists available at ScienceDirect Theriogenology journal homepage: www.theriojournal.com Review A review of sexually transmitted bovine trichomoniasis and campylobacteriosis affecting cattle reproductive health Aubrey N. Michi a, Pedro H. Favetto b, John Kastelic a, Eduardo R. Cobo a,* a Department of Production Animal Health, Faculty of Veterinary Medicine, University of Calgary, Calgary, Alberta, Canada b Private Veterinarian (Dairy Veterinary Services), Escalon, California, USA article info abstract Article history: The objective is to discuss sexually transmitted diseases caused by Tritrichomonas foetus Received 29 June 2015 (T foetus) and Campylobacter fetus (C fetus) subsp. venerealis, with a focus on prevalence, Accepted 28 October 2015 pathogenesis, and diagnosis in cows and bulls. Diagnosis and control are problematic because these diseases cause severe reproductive losses in cows, but in bulls are clinically Keywords: asymptomatic, which allows the disease to flourish, especially in the absence of legislated Sexually transmitted disease control programs. We review research regarding prophylactic systemic immunization of Tritrichomonas foetus bulls and cows with antigens of T foetus and C fetus venerealis and their efficacy in preventing Campylobacter fetus venerealis Cattle or clearing preexisting infections in the genital tract. Current diagnostic methods of C fetus Vaccine venerealis and T foetus (microbial culture and PCR) should be improved. Review of the latest advances in bovine trichomoniasis and campylobacteriosis should promote knowledge and provide an impetus to pursue further efforts to control bovine sexually transmitted diseases. Crown Copyright Ó 2016 Published by Elsevier Inc. All rights reserved. 1. Introduction artificial insemination (AI) [4,5]. In bulls, T foetus and C fetus venerealis are usually clinically asymptomatic.
    [Show full text]
  • Isolation of Campylobacter Fetus from Recent Cases of Human Vibriosis
    J. Hyg., Camb. (1977), 79, 381 381 With 1 plate Printed in Great Britain Isolation of Campylobacter fetus from recent cases of human vibriosis BY A. F. HALLETT* Department of Microbiology, University of Natal P. L. BOTHA Department of Bacteriology, University of Cape Town AND A. LOGAN Department of Thoracic Surgery, University of Natal (Received 2 May 1977) SUMMARY Campylobacter fetus was isolated from five recent cases of human vibriosis, of which two were adults and three were children. One adult presented with peri- carditis and the other with recurrent pyrexia. Campylobacterfetus subsp. intestinalis which resembled cattle strains serologically, was isolated under C02 or anaerobic conditions from blood cultures of these patients. Two of the three children had kwashiorkor and the third was only 8 days old. Isolates identified as Campylobacter fetus subsp. jejuni were cultured from blood of these patients, two of whom had diarrhoea. Three patients succumbed, despite adequate antibiotic therapy. The epidemiology of the disease is discussed and it is suggested that infection may have been from the patients' own flora. INTRODUCTION Microaerophilic vibrios infect several animal species including Man, and isolates from cattle have been from all parts of the world (Food and Agriculture Organi- zation, 1964; Neitz, 1965). In animals the organism has been cultured from various sites and infections may cause endometritis and placentitis, resulting in infertility, delayed conception and abortion (Gilman, 1960). Since the first authenticated report of a human infection due to Vibrio fetus in France (Vinzent, Dumas & Picard, 1947), cases have been reported from several other countries (Darrell, Farrell & Mulligan, 1967; White, 1967; Raahave, 1969; Bokkenheuser, 1970; Cornere, Robinson & Paykel, 1971; Dolev, Altmann & Padeh, 1971; Park, McDonald, Twohig & Cook, 1973).
    [Show full text]
  • Zoonotic and Public Health Implications of Campylobacter Species and Squamates (Lizards, Snakes and Amphisbaenians)
    pathogens Review Zoonotic and Public Health Implications of Campylobacter Species and Squamates (Lizards, Snakes and Amphisbaenians) Nicodemus M. Masila 1,2 , Kirstin E. Ross 1 , Michael G. Gardner 1,3 and Harriet Whiley 1,* 1 College of Science and Engineering, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia; [email protected] (N.M.M.); Kirstin.ross@flinders.edu.au (K.E.R.); michael.gardner@flinders.edu.au (M.G.G.) 2 Kenya Tsetse and Trypanosomiasis Eradication Council (KENTTEC), P.O. BOX 66290, Westlands, Nairobi 00800, Kenya 3 Evolutionary Biology Unit, South Australian Museum, North Terrace, Adelaide, SA 5000, Australia * Correspondence: harriet.whiley@flinders.edu.au; Tel.: +61-87-2218-580 Received: 26 August 2020; Accepted: 25 September 2020; Published: 28 September 2020 Abstract: Campylobacter spp. is one of the most widespread infectious diseases of veterinary and public health significance. Globally, the incidence of campylobacteriosis has increased over the last decade in both developing and developed countries. Squamates (lizards, snakes and amphisbaenians) are a potential reservoir and source of transmission of campylobacteriosis to humans. This systematic review examined studies from the last 20 years that have reported squamate-associated human campylobacteriosis. It was found that C. fetus subsp. testudinum and C. fetus subsp. fetus were the most common species responsible for human campylobacteriosis from a squamate host. The common squamate hosts identified included bearded dragons (Pogona vitticeps), green iguana (Iguana iguana), western beaked gecko (Rhynchoedura ornate) and blotched blue-tongued skink (Tiliqua nigrolutea). People with underlying chronic illnesses, the immunocompromised and the elderly were identified as the most vulnerable population.
    [Show full text]
  • Campylobacter Fetus Subsp. Fetus GREGORY E
    JOURNAL OF CLINICAL MICROBIOLOGY, June 1994, p. 1608-1609 Vol. 32, No. 6 0095-1137/94/$04.00+0 Copyright © 1994, American Society for Microbiology Septic Abortion with Intact Fetal Membranes Caused by Campylobacter fetus subsp. fetus GREGORY E. STEINKRAUS' AND BRENT D. WRIGHT2,3,4* Department of Pathology and Laboratory Medicine1 and Department of Obstetrics and Gynecology,2 New Hanover Regional Medical Center, and Department of Obstetrics and Gynecology, Coastal Area Health Education Center,3 Wilmington, and Department of Obstetrics and Gynecology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina4 Received 22 November 1993/Returned for modification 27 January 1994/Accepted 17 March 1994 We report a case of septic abortion with intact fetal membranes caused by Campylobacter fetus subsp.fetus in an 18-year-old woman who was 9 1/2 weeks pregnant. Septic abortion develops in approximately half of 1% of all The patient underwent suction curettage. Prior to surgery, 1 pregnant women. The leading cause of septic abortion in which g of cefoxitin and 100 mg of doxycycline were administered. the fetal membranes are intact is reported to be Listeria The cervical os easily admitted a no. 33 Pratt dilator. A polyp monocytogenes (9). The association of Campylobacter fetus forceps was used to open the internal os. A long spinal needle subsp. fetus with disease in humans has not been frequently was inserted through the intact membranes, and approximately documented. The most common type of infection encountered 2 ml of greenish fluid was obtained and immediately sent for is septicemia in a compromised host (11).
    [Show full text]
  • Redalyc.Campylobacter Fetus Subsp. Fetus Ovine Abortion Outbreak In
    REDVET. Revista Electrónica de Veterinaria E-ISSN: 1695-7504 [email protected] Veterinaria Organización España Fiorentino, María Andrea; Stazionati, Micaela; Hecker, Yanina; Morsella, Claudia; Cantón, Germán; Romero Harry, Hernán; Velilla, Alejandra V.; Gallo Vaulet, Lucía; Rodríguez Fermepin, Marcelo; Bedotti, Daniel O. Campylobacter fetus subsp. fetus ovine abortion outbreak in Argentina REDVET. Revista Electrónica de Veterinaria, vol. 18, núm. 11, noviembre, 2017, pp. 1-11 Veterinaria Organización Málaga, España Available in: http://www.redalyc.org/articulo.oa?id=63653574024 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative REDVET Rev. Electrón. vet. http://www.veterinaria.org/revistas/redvet 2017 Volumen 18 Nº 11 - http://www.veterinaria.org/revistas/redvet/n111117.html REDVET - Revista electrónica de Veterinaria - ISSN 1695-7504 Campylobacter fetus subsp. fetus ovine abortion outbreak in Argentina - Brote de abortos ovinos por Campylobacter fetus fetus en Argentina María Andrea Fiorentino 1*, Micaela Stazionati 2, Yanina Hecker 3, Claudia Morsella 1, Germán Cantón 1, Hernán Romero Harry 2, Alejandra V. Velilla 1, Lucía Gallo Vaulet 4, Marcelo Rodríguez Fermepin 4, Daniel O. Bedotti 2 1- INTA. Centro Regional Buenos Aires Sur. Estación Experimental Agropecuaria Balcarce. 7620 Balcarce. Argentina. 2- INTA. Centro Regional La Pampa-San Luis. Estación Experimental Agropecuaria Anguil. 6326 Anguil. Argentina 3- Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina 4- Universidad de Buenos Aires, Facultad de Farmacia y Bioquímica, Cátedra de Microbiología Clínica. 1113 Ciudad Autónoma de Buenos Aires.
    [Show full text]
  • Real Time PCR to Detect and Differentiate Campylobacter Fetus Subspecies Fetus and Campylobacter Fetus Subspecies Venerealis
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Journal of Microbiological Methods 94 (2013) 199–204 Contents lists available at ScienceDirect Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth Real Time PCR to detect and differentiate Campylobacter fetus subspecies fetus and Campylobacter fetus subspecies venerealis A. McGoldrick a,⁎, J. Chanter a, S. Gale b, J. Parr b, M. Toszeghy c, K. Line a a Animal Health and Veterinary Laboratories Agency Starcross, Exeter, United Kingdom b Animal Health and Veterinary Laboratories Agency Winchester, United Kingdom c Animal Health and Veterinary Laboratories Agency, Weybridge, United Kingdom article info abstract Article history: Bovine venereal campylobacter infection, caused by Campylobacter fetus venerealis, is of significant economic Received 8 January 2013 importance to the livestock industry. Unfortunately, the successful detection and discrimination of C. fetus Received in revised form 17 May 2013 venerealis from C. fetus fetus continue to be a limitation throughout the world. There are several publications Accepted 11 June 2013 warning of the problem with biotyping methods as well as with recent molecular based assays. In this study, Available online 25 June 2013 assessed on 1071 isolates, we report on the successful development of two Real Time SYBR® Green PCR assays that will allow for the detection and discrimination of C. fetus fetus and C. fetus venerealis. The sensitivity Keywords: fi Campylobacter reported here for the C. fetus (CampF4/R4) and the C. fetus venerealis (CampF7/R7) speci c PCR assays are 100% fetus fetus and 98.7% respectively.
    [Show full text]
  • Characterization of the Campylobacter Fetus Subsp. Venerealis Adhesion to Bovine Sperm Cells
    Int. J. Morphol., 34(4):1419-1423, 2016. Characterization of the Campylobacter fetus subsp. venerealis Adhesion to Bovine Sperm Cells Caracterización de la Adhesión de Campylobacter fetus subsp. venerealis a Espermatozoides Bovinos María L. Chiapparrone*; Pedro Soto* & María Catena* CHIAPPARRONE, M. L.; SOTO, P. & CATENA, M. Characterization of the Campylobacter fetus subsp. venerealis adhesion to bovine sperm cells. Int. J. Morphol., 34(4):1419-1423, 2016. SUMMARY: Campylobacter fetus is extracellular bacteria of the genital tract of cattle. They cause infertility and abortion, but there is no documented information on the susceptibility of bovine sperm cells to this bacteria. The aim of this present work was to study the effects provoked by Campylobacter fetus subsp. venerealis when in interaction with bovine sperm cells. The bovine spermatozoa were obtained frozen bovine semen pooled from uninfected bulls, and were exposed to living campylobacter over different periods of time. Light microscopy and scanning electron microscopy first revealed a tropism, then a close proximity followed by tight adhesion between these two different cells. A decrease in the spermatozoa motility was observed. Motile bacteria were observed during the next 3 h, this process began with a tight membrane–membrane adhesion. The adhesion between Campylobacter fetus to the sperm cell occurred either by the flagella or by sperm head. Results from this study demonstrated with light microscopy scanning electron microscopy allowed us to characterize some aspects of the interaction of Campylobacter fetus subsp. venerealis and bovine sperm while preserving the cellular and bacterial structure. This ex vivo model might be useful for studies on adhesion and cytopathogenicity of different field strains of Campylobacter fetus.
    [Show full text]
  • Occurrence, Virulence and Antimicrobial Resistance
    antibiotics Article Occurrence, Virulence and Antimicrobial Resistance-Associated Markers in Campylobacter Species Isolated from Retail Fresh Milk and Water Samples in Two District Municipalities in the Eastern Cape Province, South Africa Aboi Igwaran 1,2,* and Anthony Ifeanyi Okoh 1,2 1 SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice 5700, South Africa; [email protected] 2 Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare, Private Bag X1314, Alice 5700, South Africa * Correspondence: [email protected] Received: 21 December 2019; Accepted: 14 February 2020; Published: 21 July 2020 Abstract: Campylobacter species are among the major bacteria implicated in human gastrointestinal infections and are majorly found in faeces of domestic animals, sewage discharges and agricultural runoff. These pathogens have been implicated in diseases outbreaks through consumption of contaminated milk and water in some parts of the globe and reports on this is very scanty in the Eastern Cape Province. Hence, this study evaluated the occurrence as well as virulence and antimicrobial-associated makers of Campylobacter species recovered from milk and water samples. A total of 56 water samples and 72 raw milk samples were collected and the samples were processed for enrichment in Bolton broth and incubated for 48 h in 10% CO2 at 42 ◦C under microaerobic condition. Thereafter, the enriched cultures were further processed and purified. After which, presumptive Campylobacter colonies were isolated and later confirmed by PCR using specific primers for the detection of the genus Campylobacter, target species and virulence associated genes. Antimicrobial resistance profiles of the isolates were determined by disk diffusion method against a panel of 12 antibiotics and relevant genotypic resistance genes were assessed by PCR assay.
    [Show full text]