DOCSLIB.ORG

Encodes a Mitochondrial Protein That.. Is Translated from an Mrna with a Long 5' Leader CHRISTINE A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Encodes a Mitochondrial Protein That.. Is Translated from an Mrna with a Long 5' Leader CHRISTINE A MOLECULAR AND CELLULAR BIOLOGY, Aug. 1987, p. 2728-2734 Vol. 7, No. 8 0270-7306/87/082728-07$02.00/0 Copyright C) 1987, American Society for Microbiology Saccharomyces cerevisiae Positive Regulatory Gene PET]]] Encodes a Mitochondrial Protein That.. Is Translated from an mRNA with a Long 5' Leader CHRISTINE A. STRICKl* AND THOMAS D. FOX2 Section ofBiochemistry, Molecular and Cell Biology,' and Section of Genetics and Development,2 Cornell University, Ithaca, New York 14853 Received 17 February 1987/Accepted 28 April 1987 The yeast nuclear gene PETI)I is required specifically for translation of the mitochondrion-coded mRNA for cytochrome c oxidase subunit II. We have determined the nucleotide sequence of a 3-kilobase segment of DNA that carries PET))). The sequence contains a single long open reading frame that predicts a basic protein of 718 amino acids. The PETIHl gene product is a mitochondrial protein, since a hybrid protein which includes the amino-terminal 154 amino acids of PETlll fused to 0-galactosidase is specifically associated with mitochondria. PETll is translated from a 2.9-kilobase mRNA which, interestingly, has an extended 5'-leader sequence containing four short open reading frames upstream of the long open reading frame. These open reading frames exhibit an interesting pattern of overlap with each other and with the PET))) reading frame. The yeast mitochondrial genetic system depends on a MATERIALS AND METHODS great number of nuclear gene products to express the few genes essential for respiration that are encoded in mitochon- Yeast strains and media. The wild-type Saccharomyces drial DNA (18). Many of these nuclear genes are required at cerevisiae strain was D273-1OB (ATCC 25657). PTE12 and posttranscriptional steps in the expression of specific mito- PTE14A strains both carry the pet)))-) mutation (19) and chondrial genes. These steps include 5'-end processing (14, have been described previously (50). YPEG medium con- 15, 17) and intron splicing (20, 41, 49) of mitochondrial tains 1% (wt/vol) yeast extract, 2% (wt/vol) peptone, 3% pre-mRNAs as well as mRNA translation (reviewed in (vol/vol) ethanol, and 3% (vol/vol) glycerol. SD is a minimal reference 22). For example, at least two proteins coded in medium containing glucose (60). the nucleus are required specifically to translate the mito- Plasmids and transformation procedures. DNA manipula- chondrial mRNA for cytochrome c oxidase subunit III (11, tions and transformation of Escherichia coli strains were 12, 47). Similarly, the translation of the mitochondrial performed as described elsewhere (39). Yeast were trans- mRNA for cytochrome b also depends on at least two formed by lithium acetate treatment of intact cells (32). nuclear gene products (16, 53-55). YpA35 is a yeast replicating vector carrying a 13.5-kilobase In this paper we describe the nuclear gene PETI)I (for- (kb) insert of yeast genomic DNA that complements pet))) merly PETE))), which is required for accumulation of mutations and has been described previously (50). pSP65-2.2 cytochrome c oxidase subunit II (coxII) (7, 19). CoxIl is and pSP64-XS were constructed by inserting a 2.2-kb BglII- encoded by the uninterrupted mitochondrial gene oxil (8, 10, HindIII fragment and a 1.8-kb SalI-XbaI fragment, respec- 21). Its mRNA is translated to yield a precursor protein that tively, from YpA35 into Riboprobe vectors (Promega is processed to coxIl by removal of the 15 amino-terminal Biotec; 43). YEp13-2.7L was constructed as follows. amino acid residues (51, 58). PETJ)) activity appears to be pMC1871 (9) was digested with BamHI and treated with required specifically for translation of coxll since pet))) Klenow fragment of DNA polymerase I to fill in recessed 3' mutants lack the protein but contain substantial amounts of ends. A 3-kb fragment carrying the lacZ gene was ligated its mRNA (50). Furthermore, pet))) mutations are sup- into pSP64-2.7 (a Riboprobe vector carrying a 2.76-kb pressed by mitochondrial gene rearrangements that fuse the HindIII fragment from YpA35 which contains the PET))) 5' portions of other mitochondrial genes to oxil (50). gene) which had been prepared by digestion with NdeI, Si In this paper we present the nucleotide sequence of nuclease digestion to remove 5' overhanging ends, and PETIJ) and the predicted amino acid sequence of its prod- dephosphorylation. The resulting plasmid (pSP64-2.7L) car- uct. We provide evidence that the PET) I) protein is located ried a 5.76-kb HindIll fragment containing a fusion of the in mitochondria and therefore probably acts directly to first 154 codons of PET))) in frame with codon 8 of lacZ. promote coxII translation. Interestingly, the PET I)I mRNA has an unusually long 5' leader that contains four short open YEp13-2.7L contains this Hindlll fragment ligated to reading frames. The results of recent studies on the expres- HindIII-cleaved YEp13 (6). sion of another yeast gene whose transcript also has a long 5' DNA sequence analysis. Sau3A, TaqI, AluI, and XbaI leader with short open reading frames (24, 27, 28, 46, 65) fragments of the 2.76-kb HindIII fragment that complements suggest that the expression of PET))) itself may be regu- pet))) (50) were subcloned into the M13 vectors mplO and lated at the level of translation. mpll (44). A 1.3-kb HindIII fragment from the 5' flank of the structural gene was cloned into M13 mpl8 and mpl9, and appropriate deletions were made by exonuclease III-Si * Corresponding author. digestion (26). These clones were used as templates for the 2728 VOL. 7, 1987 PETHII CODES FOR A MITOCHONDRIAL PROTEIN 2729 4 - . A S . H i .~~~~~~~. !. t X SA^ N 00 bp FIG. 1. Restriction map and sequencing strategy of PETJJJ. Restriction sites shown are as follows: A, AluI; B, BglII, H, Hindlll; N, NdeI; R, EcoRI; S, Sau3A; T, TaqI; V, EcoRV; and X, XbaI. , Position and orientation of N and C termini of the open reading frame. Arrows show the extent and direction of each sequence determined by the dideoxynucleotide chain termination method (55) (-k) or by chemical degradation of end-labeled fragments (40) (-*). All restriction sites were crossed; both strands were sequenced. bp, Base pairs. dideoxynucleotide chain termination sequencing reaction Fractions were assayed for ,-galactosidase activity by the (56). Some regions were also sequenced by chemical degra- method of Miller (45) and for fumarase by the method of dation of end-labeled fragments (40). Racker (52). Isolation of RNA. Total yeast nucleic acids (primarily RNA) were prepared from cells grown on YPEG medium to RESULTS early logarithmic stage by vortexing with glass beads in the presence of phenol as described elsewhere (63). Poly(A)- Primary sequence analysis of PET])). DNA that comple- containing RNA was selected by hybridization to oligo(dT)- ments petlll mutations is carried on a 2.76-kb HindIII cellulose (3) according to the procedure of the manufacturer fragment (50). The nucleotide sequence of this fragment and (Bethesda Research Laboratories, Inc., Gaithersburg, Md.). that of a portion of a flanking HindlIl fragment was deter- Northern hybridization (RNA blot) analysis. RNA was mined by subcloning restriction fragments into M13 vectors denatured with glyoxal, fractionated by electrophoresis in and using these as templates in dideoxynucleotide chain 1.1% agarose in 10 mM phosphate buffer (pH 7.0; 42), and termination reactions (56). Some restriction fragments were transferred to a nylon membrane (Biodyne A; 66). A uni- end labeled and subjected to chemical degradation (40). The formly radioactively labeled RNA probe was prepared by exact strategy used in described in the legend to Fig. 1. SP6 polymerase transcription (43) from pSP65-2.2, a The PETJIIJ sequence (Fig. 2) contains a single long open Riboprobe vector which contained a fragment from the reading frame which extends over 2.15 kb. If translation structural gene for PET]JJ in the antisense orientation. were to begin at the first ATG in this open reading frame, Hybridization was done at 65°C in a buffer containing 50% PETIII would encode a basic protein of 718 amino acids. formamide (62). Genetic evidence indicates that this open reading frame Si nuclease protection. A probe uniquely labeled at the codes for the PET] ]I product. A DNA fragment that carries BglIH site within PETJI] (Fig. 1) was generated as follows. just the long open reading frame and 57 upstream nucleotides YpA35 was restricted with BglII, and an 8-kb band was under the transcriptional direction of the ADCJ promoter (2) isolated from an agarose gel. This fragment was treated with complemented petlII mutations (data not shown). In addi- alkaline phosphatase and labeled by using T4 polynucleotide tion, the pet]I l-I mutation was mapped to a DNA fragment kinase as described elsewhere (39). The DNA was recut with which is delineated by two XbaI sites (Fig. 1) and includes Sall, and the appropriate 4-kb fragment was isolated from an primarily open reading frame (774 nucleotides of the open agarose gel. A probe uniquely labeled at the HindIII site reading frame and 219 upstream nucleotides). Also, insertion upstream of the PETJIJI coding region (Fig. 1) was generated of foreign DNA at the BglII site in the open reading frame as follows. pSP64-XS was digested with HindIII, and a destroyed the ability of the 2.76-kb HindIII fragment to 1.3-kb fragment was isolated from an agarose gel. This complement pet]ll mutations (50). fragment was labeled as described above and recut with The predicted amino acid sequence of PET] II was used in EcoRI, and the appropriate 500-base-pair fragment was a computer search of sequences contained in the National isolated from an agarose gel.
Load more

Recommended publications
  • A Chloroplast Gene Is Converted Into a Nucleargene
    Proc. Nati. Acad. Sci. USA Vol. 85, pp. 391-395, January 1988 Biochemistry Relocating a gene for herbicide tolerance: A chloroplast gene is converted into a nuclear gene (QB protein/atrazine tolerance/transit peptide) ALICE Y. CHEUNG*, LAWRENCE BOGORAD*, MARC VAN MONTAGUt, AND JEFF SCHELLt: *Department of Cellular and Developmental Biology, 16 Divinity Avenue, The Biological Laboratories, Harvard University, Cambridge, MA 02138; tLaboratorium voor Genetica, Rijksuniversiteit Ghent, B-9000 Ghent, Belgium; and TMax-Planck-Institut fur Zuchtungsforschung, D-500 Cologne 30, Federal Republic of Germany Contributed by Lawrence Bogorad, September 30, 1987 ABSTRACT The chloroplast gene psbA codes for the the gene for ribulose bisphosphate carboxylase/oxygenase photosynthetic quinone-binding membrane protein Q which can transport the protein product into chloroplasts (5). We is the target of the herbicide atrazine. This gene has been have spliced the coding region of the psbA gene isolated converted into a nuclear gene. The psbA gene from an from the chloroplast DNA of the atrazine-resistant biotype atrazine-resistant biotype of Amaranthus hybridus has been of Amaranthus to the transcriptional-control and transit- modified by fusing its coding region to transcription- peptide-encoding regions of a nuclear gene, ss3.6, for the regulation and transit-peptide-encoding sequences of a bona SSU of ribulose bisphosphate carboxylase/oxygenase of pea fide nuclear gene. The constructs were introduced into the (6). The fusion-gene constructions (designated SSU-ATR) nuclear genome of tobacco by using the Agrobacteium tumor- were introduced into tobacco plants via the Agrobacterium inducing (Ti) plasmid system, and the protein product of tumor-inducing (Ti) plasmid transformation system using the nuclear psbA has been identified in the photosynthetic mem- disarmed Ti plasmid vector pGV3850 (7).
    [Show full text]
  • The Molecular Basis of Cytoplasmic Male Sterility and Fertility Restoration Patrick S
    trends in plant science reviews 24 Grandmougin, A. et al. (1989) Cyclopropyl sterols and phospholipid 34 Gachotte, D., Meens, R. and Benveniste, P. (1995) An Arabodopsis mutant composition of membrane fractions from maize roots treated with deficient in sterol biosynthesis: heterologous complementation by ERG3 fenpropimorph, Plant Physiol. 90, 591–597 encoding a ⌬7-sterol-C5-desaturase from yeast, Plant J. 8, 407–416 25 Schuler, I. et al. (1990) Soybean phosphatidylcholine vesicles containing 35 Schaller, H. et al. (1995) Expression of the Hevea brasiliensis (H.B.K.) Müll. plant sterols: a fluorescence anisotropy study, Biochim. Biophys. Acta 1028, Arg. 3-hydroxy-3-methylglutaryl coenzyme A reductase 1 in tobacco results in 82–88 sterol overproduction, Plant Physiol. 109, 761–770 26 Schuler, I. et al. (1991) Differential effects of plant sterols on water 36 Marsan, M.P., Muller, I. and Milon, A. (1996) Ability of clionasterol and permeability and on acyl chain ordering of soybean phosphatidylcholine poriferasterol (24-epimers of sitosterol and stigmasterol) to regulate membrane bilayers, Proc. Natl. Acad. Sci. U. S. A. 88, 6926–6930 lipid dynamics, Chem. Phys. Lipids 84, 117–121 27 Krajewsky-Bertrand, M-A., Milon, A. and Hartmann, M-A. (1992) 37 Goad, L.J. (1990) Application of sterol synthesis inhibitors to investigate the Deuterium-NMR investigation of plant sterol effects on soybean sterol requirements of protozoa and plants, Biochem. Soc. Trans. 18, 63–65 phosphatidylcholine acyl chain ordering, Chem. Phys. Lipids 63, 235–241 38 Cerana, R. et al. (1984) Regulating effects of brassinosteroids and of sterols 28 Grandmougin-Ferjani, A., Schuler-Muller, I.
    [Show full text]
  • “Subfossil” Koala Lemur Megaladapis Edwardsi
    Evolutionary and phylogenetic insights from a nuclear genome sequence of the extinct, giant, “subfossil” koala lemur Megaladapis edwardsi Stephanie Marciniaka, Mehreen R. Mughalb, Laurie R. Godfreyc, Richard J. Bankoffa, Heritiana Randrianatoandroa,d, Brooke E. Crowleye,f, Christina M. Bergeya,g,h, Kathleen M. Muldooni, Jeannot Randrianasyd, Brigitte M. Raharivololonad, Stephan C. Schusterj, Ripan S. Malhik,l, Anne D. Yoderm,n, Edward E. Louis Jro,1, Logan Kistlerp,1, and George H. Perrya,b,g,q,1 aDepartment of Anthropology, Pennsylvania State University, University Park, PA 16802; bBioinformatics and Genomics Intercollege Graduate Program, Pennsylvania State University, University Park, PA 16082; cDepartment of Anthropology, University of Massachusetts, Amherst, MA 01003; dMention Anthropobiologie et Développement Durable, Faculté des Sciences, Université d’Antananarivo, Antananarivo 101, Madagascar; eDepartment of Geology, University of Cincinnati, Cincinnati, OH 45220; fDepartment of Anthropology, University of Cincinnati, Cincinnati, OH 45220; gDepartment of Biology, Pennsylvania State University, University Park, PA 16802; hDepartment of Genetics, Rutgers University, New Brunswick, NJ 08854; iDepartment of Anatomy, Midwestern University, Glendale, AZ 85308; jSingapore Centre for Environmental Life Sciences Engineering, Nanyang Technological University, Singapore 639798; kDepartment of Anthropology, University of Illinois Urbana–Champaign, Urbana, IL 61801; lDepartment of Ecology, Evolution and Behavior, Carl R. Woese Institute for
    [Show full text]
  • Evolution of Genomic Expression
    C H A P T E R 5 Evolution of Genomic Expression Bernardo Lemos, Christian R. Landry, Pierre Fontanillas, Susan P. Renn, Rob Kulathinal, Kyle M. Brown, and Daniel L. Hartl Introduction Genomic regulation is key to cellular differentiation, tissue morphogenesis, and development. Increasing evidence indicates that evolutionary diversity of phenotypes—from cellular to organismic—may also be, in large part, the result of variation in the regulation of genomic expression. In this chapter we explore the complexity of gene regulation from the perspective of single genes and whole genomes. The first part describes the major factors affecting gene expression levels, from rates of gene transcrip- tion—as mediated by promoter–enhancer interactions and chromatin mod- ifications—to rates of mRNA degradation. This description underscores the multiple levels at which genomic expression can be regulated as well as the complexity and variety of mechanisms used. We then briefly describe the major experimental and computational biology techniques for analyzing gene expression variation and its underlying causes. The final section reviews our understanding of the role of regulatory variation in evolution, including the molecular evolution and population genetics of noncoding DNA, as well as the inheritance and phenotypic evolution of levels of mRNA abundance. The Complex Regulation of Genomic Expression The regulation of gene expression is a complex and dynamic process. It is not a simple matter to turn a gene on and off, let alone precisely regulate its level of expression. Regulation can be accomplished through various mech- anisms at nearly every step of the process of gene expression. Furthermore, each mechanism may require a variety of elements, including DNA sequences, RNA molecules, and proteins, acting in combination to deter- 2 Chapter Five Evolution of Genomic Expression 3 mine the final amount, timing, and location of functional gene product.
    [Show full text]
  • INTRODUCTION Sirna and Rnai
    J Korean Med Sci 2003; 18: 309-18 Copyright The Korean Academy ISSN 1011-8934 of Medical Sciences RNA interference (RNAi) is the sequence-specific gene silencing induced by dou- ble-stranded RNA (dsRNA). Being a highly specific and efficient knockdown tech- nique, RNAi not only provides a powerful tool for functional genomics but also holds Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National a promise for gene therapy. The key player in RNAi is small RNA (~22-nt) termed University, Seoul, Korea siRNA. Small RNAs are involved not only in RNAi but also in basic cellular pro- cesses, such as developmental control and heterochromatin formation. The inter- Received : 19 May 2003 esting biology as well as the remarkable technical value has been drawing wide- Accepted : 23 May 2003 spread attention to this exciting new field. V. Narry Kim, D.Phil. Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National University, San 56-1, Shillim-dong, Gwanak-gu, Seoul 151-742, Korea Key Words : RNA Interference (RNAi); RNA, Small interfering (siRNA); MicroRNAs (miRNA); Small Tel : +82.2-887-8734, Fax : +82.2-875-0907 hairpin RNA (shRNA); mRNA degradation; Translation; Functional genomics; Gene therapy E-mail : [email protected] INTRODUCTION established yet, testing 3-4 candidates are usually sufficient to find effective molecules. Technical expertise accumulated The RNA interference (RNAi) pathway was originally re- in the field of antisense oligonucleotide and ribozyme is now cognized in Caenorhabditis elegans as a response to double- being quickly applied to RNAi, rapidly improving RNAi stranded RNA (dsRNA) leading to sequence-specific gene techniques.
    [Show full text]
  • DNA Interstrand Cross-Links Induced by Psoralen Are Not Repaired in Mammalian Mitochondria
    [CANCER RESEARCH 58. 1400-1404, April 1. 1998) Advances in Brief DNA Interstrand Cross-Links Induced by Psoralen Are Not Repaired in Mammalian Mitochondria Carleen Cullinane and Vilhelm A. Bohr1 Department of Biochemistry, Lit Trohe University, Bundoora, Victoria, 3083, Australia 1C. C./; and Laboratory of Molecular Genetics, National Institutes on Aging. Baltimore. Maryland 21224 ¡C.C., V.A. B.] Abstract evidence suggests that mitochondria are capable of repairing some types of DNA lesions. DNA damage induced by A'-methyl purines, Although it is generally known that mitochondria are defective in DNA including streptozotocin and /V-methyl-yV-nitrosourea, which, in nu damage processing, little is known about the DNA repair pathways and clear DNA, are substrates for the base excision repair pathway, are mechanisms that exist in these vital organdíes. Certain lesions that are repaired in mitochondria (3). The efficient in vivo removal of O6- removed by base excision repair are efficiently removed in mitochondria, ethyl-guanine lesions induced by ethyl nitrosourea in rat mitochondria whereas some bulky lesions that are removed by nucleotide excision repair are not repaired in these organelles. There has been much interest in has also been clearly demonstrated (4). Oxidative DNA lesions in whether mitochondria possess activities for recombination repair, and duced by alloxan (5) and bleomycin (6) are also efficiently repaired in some previous studies have reported such activities, whereas others have mitochondria. In contrast, bulky lesions induced by UVC, nitrogen not. We have taken the approach of studying the formation and removal mustard, and cisplatin are apparently not repaired by mitochondria of ¡nterstrand cross-links (ICLs) in DNA.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • Actin Gene Requires Myod1, Carg-Box Binding Factor, and Spl
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Muscle-specific expression of the cardiac -actin gene requires MyoD1, CArG-box binding factor, and Spl Vittorio Sartorelli, Keith A. Webster, 1 and Larry Kedes 2 Program in Molecular Biology and Genetics, Institute for Genetic Medicine, and Departments of Biochemistry and Medicine, University of Southern California School of Medicine, Los Angeles, California 90033 USA Expression of the human cardiac ~-actin gene (HCA) depends on the interactions of multiple transcriptional regulators with promoter elements. We report here that the tissue-specific expression of this promoter is determined by the simultaneous interaction of at least three specific protein-DNA complexes. The myogenic determinant gene MyoD1 activated the transcription of transfected HCA-CAT promoter constructs in nonmuscle cells, including CV-1 and HeLa cells. Gel mobility-shift and footprinting assays revealed that MyoD1 specifically interacted with a single consensus core sequence, CANNTG, at -50. Previously characterized sites interact with a protein identical with or related to the serum response factor (SRF) at - 100 and Spl at -70. All three elements must be intact to support transcription in muscle cells: site-specific mutation within any one of these three elements eliminated transcriptional expression by the promoter. Furthermore, expression of the promoter in embryonic Drosophila melanogaster cells that lack MyoD1 and Spl is strictly dependent on all three sites remaining intact and on the presence of exogenously supplied Spl and MyoD1. These experiments suggest that the presence of three sequence-specific binding proteins, including MyoD1, and their intact target DNA sequences are minimal requirements for muscle-specific expression of the HCA gene.
    [Show full text]
  • Chapter 12 Gene Expression and Regulation
    PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all growth conditions and are called house- keeping genes. These include the genes that encode such proteins as DNA poly- merase, RNA polymerase, and DNA gyrase. Many other gene products are required under specific growth conditions. These include enzymes that synthesize amino acids, break down specific sugars, or respond to a specific environmental condition such as DNA damage. Housekeeping genes must be expressed at some level all of the time. Frequently, as the cell grows faster, more of the housekeeping gene products are needed. Even under very slow growth, some of each housekeeping gene product is made. The gene prod- ucts required for specific growth conditions are not needed all of the time. These genes are frequently expressed at extremely low levels, or not expressed at all when they are not needed and yet made when they are needed. This chapter will examine gene regulation or how bacteria regulate the expression of their genes so that the genes that are being expressed meet the needs of the cell for a specific growth condition. Gene regulation can occur at three possible places in the production of an active gene product. First, the transcription of the gene can be regulated. This is known as transcriptional regulation. When the gene is transcribed and how much it is transcribed influences the amount of gene product that is made. Second, if the gene encodes a protein, it can be regulated at the translational level.
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • How the Techniques of Molecular Biology Are Developed from Natural Systems
    How the techniques of molecular biology are developed from natural systems Isobel Ronai [email protected] School of Life and Environmental Sciences, The University of Sydney, Sydney, NSW, Australia. Abstract A striking characteristic of the highly successful techniques in molecular biology is that they are derived from natural systems. RNA interference (RNAi), for example, utilises a mechanism that evolved in eukaryotes to destroy foreign nucleic acid. Other examples include restriction enzymes, the polymerase chain reaction, green fluorescent protein and CRISPR-Cas. I propose that biologists exploit natural molecular mechanisms for their effectors’ (protein or nucleic acid) activity and biological specificity (protein or nucleic acid can cause precise reactions). I also show that the developmental trajectory of novel techniques in molecular biology, such as RNAi, is four characteristic phases. The first phase is discovery of a biological phenomenon, typically as curiosity driven research. The second is identification of the mechanism’s trigger(s), the effector and biological specificity. The third is the application of the technique. The final phase is the maturation and refinement of the molecular biology technique. The development of new molecular biology techniques from nature is crucial for biological research. These techniques transform scientific knowledge and generate new knowledge. Keywords: mechanism; experiment; specificity; scientific practice; PCR; GFP. 1 Introduction Molecular biology is principally concerned with explaining the complex molecular phenomena underlying living processes by identifying the mechanisms that produce such processes (Tabery et al. 2015). In order to access the causal structure of molecular mechanisms it is generally necessary to manipulate the components of the mechanism and to observe the resulting effects with sophisticated molecular techniques.
    [Show full text]
  • Molecular Biology Eukaryotic Gene Additional Readings Prokaryotic Gene Bibliography
    Gene - AccessScience from McGraw-Hill Education http://accessscience.com/content/gene/284400 (http://accessscience.com/) Article by: Sturtevant, Alfred H. Formerly, Biology Division, California Institute of Technology, Pasadena, California. Winkler, Malcolm E. Department of Microbiology and Molecular Genetics, University of Texas, Houston, Texas. Marmur, Julius Department of Biochemistry, Albert Einstein College of Medicine of Yeshiva University, New York, New York. Publication year: 2014 DOI: http://dx.doi.org/10.1036/1097-8542.284400 (http://dx.doi.org/10.1036/1097-8542.284400) Content Molecular biology Eukaryotic gene Additional Readings Prokaryotic gene Bibliography The basic unit in inheritance. There is no general agreement as to the exact usage of the term “gene” since several criteria that have been used for its definition have been shown not to be equivalent. The nature of this difficulty will be indicated after a description of the earlier position. The facts of mendelian inheritance indicate the presence of discrete hereditary units that replicate at each cell division, producing remarkably exact copies of themselves, and that in some highly specific way determine the characteristics of the individuals that bear them. The evidence also shows that each of these units may at times mutate to give a new equally stable unit (called an allele), which has more or less similar but not identical effects on the characters of its bearers. See also: Allele (/content/allele/024000); Mendelism (/content/mendelism/414500) These hereditary units are the genes, and the criteria for the recognition that certain genes are alleles have been that they (1) arise from one another by a single mutation, (2) have similar effects on the characters of the organism, and (3) occupy the same locus in the chromosome.
    [Show full text]