DOCSLIB.ORG

Supplemental Methods Proband and Control Lung Samples Lung Sections from Both the Proband and Age-Matched Controls Were Obtained

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Methods Proband and Control Lung Samples Lung Sections from Both the Proband and Age-Matched Controls Were Obtained Supplementary material J Med Genet Supplemental Methods Proband and Control Lung Samples Lung sections from both the proband and age-matched controls were obtained in the form of fixed formalin paraffin embedded (FFPE) samples. Control lung samples were obtained from the BRINDL biorepository at the University of Rochester(1). RNA expression analyses RNA was obtained for mRNA expression studies using the RNeasy FFPE kit (Qiagen) according to manufacturer’s instructions. cDNA was then generated using iScrpit kit (biorad), and quantitative PCR was done as previously published (2). Primers for qPCR are listed in supplemental table 1. Chromatin Immunoprecipitation of FFPE for Fixed Formalin Paraffin Embedded samples Chromatin immunoprecipitation was done on FFPE sections using a protocol modified from Fanelli and colleagues, Nature Methods, 2011(3) Samples were deparaffinized by incubating 10uM sections in 1ml of Xylene for 10 minutes at room temperature. The tissue was then pelleted at 17,000 x gravity for 3 min at room temperature. This process was repeated 3 times. Samples were then rehydrated by incubating with 1 ml of 100% Ethanol for 10 minutes at RT. Cells were pelleted and resuspended in progressively increasing percentage of water as follows: 95% ethanol, 70% ethanol, 50% ethanol, 20% ethanol. The sample was then resuspended in 1x PBS and the tissue dissociated by sonicating with a Bioruptor (Diagnode, NJ USA) for 30 seconds on the medium setting. Cells then resuspended in Collagenase digestion buffer and treated with collagenase A (Roche 11 088 785 103) to a final concentration of 2mg/ml and digested at 37 C for 45 minutes. Cells were then pelleted and resuspended in ice-cold cell lysis buffer (10 m Tris, pH 8.0, 10 mM NaCl, 0.2% NP40, 5 mM sodium butyrate) and lysed on ice for 20 minutes. Cells were pelleted at 5000x g for 5 min and washed several times with cold PBS. The pellet was then re-suspended in room temperature Nuclei Lysis buffer (50 mM Tris, pH 8.0, 10mM EDTA, 1% SDS) and the nucei lysed on ice x 20 minutes. The lysate was diluted with 1x ChIP dilution buffer (20 mM Tris, pH 8.0, 2 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.01% SDS) and sonicated on Hi for 35 cycles of 30 seconds on/30 seconds off in the Diagenode Bioruptor. Samples were spun at max speed and supernatant moved to clean tube. The remaining ChIP protocol was completed as published (4), using an antibody against H3K27Ac (Abcam). Array Comparative Genomic Hybridization Analysis Array Comparative Genomic Hybridization (aCGH) Analysis was done using DNA from peripheral blood, extracted using QIAamp® DNA Blood Mini Kit (Cat #51106). Nanodrop ND-2000 spectrometer (Thermo Scientific, DE, USA) was used for determination of DNA concentrations. Microarray experiments were performed on SurePrint G3 ISCA CGH+SNP Microarray Kit, 4x180K v2.0 platform (Agilent Technologies, Santa Clara, CA), featuring approximately 110,715 custom Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet oligonucleotides + 59,647 SNPs (60 mers) and covering 1282 OMIM target regions, resulting in a 25.3 Kb resolution. The patient DNA was referenced against Agilent Human Reference DNA male/female (5190-4370/4371) using Agilent’s SureTag Complete DNA labeling Kit (Cat # 5190- 4240) as per the manufacturer’s recommendations. Patient data was scanned (Agilent Model #G2505C) at 3µm resolution, and visualized (Cytogenomics Software) with log2 threshold ratios of -0.25 for losses and 0.25 for gains. Fluorescence in situ hybridization (FISH) Fluorescence in situ hybridization (FISH) analysis was performed using BAC probe (RP11- 625N4; 16q24.1) labeled and hybridized according to manufacturer’s instructions (Cat # 07J00- 001, Abbott Laboratories, IL, USA). Slides were analyzed using a Nikon (Eclipse 80i) fluorescence microscope with attached CCD camera; Applied Spectral Imaging (ASI) or Cytovision FISH software was used for image acquisition and analyses. Ten metaphase and 100 interphase cells were analyzed for confirmation of aCGH findings. Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental Figures Supplemental Fig 1. A deletion upstream of the FOXF1 gene is associated with an ACDMPV phenotype. (A) Lung histology demonstrating hematoxalin and eosin staining of lung samples from our patient (right panels) and control (left Panels). (B) aCGH results demonstrating a 340 bp deletion on chromosome 16q24.1. (C) FISH using BAC probe RP11-625N4 (green) and 16q subtel probe (red-control) confirmed the 16q24.1 loss. Red arrow indicates the deletion. Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental Fig 2. Cell-type and developmental stage specific expression of IRF8. Top panel. Expression of IRF8 in various cell-types. IRF8 is highly expressed in immune cells, and is expressed at low levels in fetal and adult lung. Data adapted from biogps.org (5) Bottom panel. Expression of IRF8 in sorted populations of cells from the lungs of term human infants. Data represent the average of three independent values. Error bars are standard error of the mean. Data adapted from (6). Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental Fig 3. FOXF1 expression is regulated in cell-type and developmental stage specific manner. (A) FOXF1 is highly expressed in lung and intestine (data adapted from biogps.org (3)). (B) FOXF1 expression in sorted populations of cells from normal lung tissue from term infants. Adapted from (6, 7). (C) UCSC genome browser view of the FOXF1 locus. The infant’s deletion is denoted by the striped blue box. The pink track shows occupancy of H3K27Ac, a mark of active enhancers, in normal human lung fibroblasts (NHLF). Below the H3K27Ac track are ChromHmm tracks for 9 different encode cell lines(8): NHLF, GM12878 (lymphoblastoid), H1-hESC (human embryonic stem cell), K562 (myeloid), HepG2 (liver), HUVEC (human umbilical vein endothelial cells), HMEC (human mammary epithelial cells), HSMM (human skeletal muscle myoblasts), and NHEK (normal human epidermal keratinocytes). Legend depicts the functional predictions of the ChromHmm tracks. The red box highlights the putative lung-specific enhancer. Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental Fig 4. Foxf1 is expressed at stable levels during human lung development. Data represent normalized Foxf1 expression in developing human lung tissue, from day 53 to day 140 of gestation. Data adapted from (9) Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental Figure 5. mRNA expression of lncRNA LINC01081 in lung samples taken from the patient and gestational-age matched controls. Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Human FoxF1 expression gcaccagaacagccacaac GTAGGTGACCTGCTGGTGGT Human GapDH expression AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA Human Linc01081 expression CGGAACCCTAGACACTGCTC CACTGGCTAGTCTGGCTTTG Human 18s reference gene expression TTGACGGAAGGGCACCACCAG GCACCACCACCCACGGAATCG Supplemental Table 1- qPCR Primers Enhancer 1 TGACCCCACTGGAGACAGAT TTGAACCAGGAAGCTGATCC Enhancer 2 CCCTGTGAAATTTCCTCCTG GCTTTTATCAGCCGTTTGGA Enhancer 3 AACGGCTGATAAAAGCACTGA CTTGGGAGGGAGAAATCACA Enhancer 4 GTTGCCCAAATGTCTCCAAG CGCCGAGGAATTTACTGGT Enhancer 5 CACCATTTCATTGTCCCTTCA GCCTGAGTGTGTGAGCATGT Enhancer6 TCCCAACCACAATGAGACAG GCAATGTGTGAGAGCACCAA Enhancer 7 GGTGCAGCCATTAGAAGTCA AGTGAGGCCCAGAGAGAACA Supplemental Table 2- ChIP Primers Steiner LA, et al. J Med Genet 2019; 0:1–5. doi: 10.1136/jmedgenet-2019-106095 Supplementary material J Med Genet Supplemental References 1. Bandyopadhyay G, Huyck HL, Misra RS, Bhattacharya S, Wang Q, Mereness J, Lillis J, Myers JR, Ashton J, Bushnell T, Cochran M, Holden-Wiltse J, Katzman P, Deutsch G, Whitsett JA, Xu Y, Mariani TJ, Pryhuber GS. Dissociation, cellular isolation, and initial molecular characterization of neonatal and pediatric human lung tissues. Am J Physiol Lung Cell Mol Physiol. 2018;315(4):L576-L83. Epub 2018/07/06. doi: 10.1152/ajplung.00041.2018. PubMed PMID: 29975103. 2. Malik J, Lillis JA, Couch T, Getman M, Steiner LA. The Methyltransferase Setd8 Is Essential for Erythroblast Survival and Maturation. Cell Rep. 2017;21(9):2376-83. Epub 2017/12/01. doi: 10.1016/j.celrep.2017.11.011. PubMed PMID: 29186677. 3. Fanelli M, Amatori S, Barozzi I, Minucci S. Chromatin immunoprecipitation and high- throughput sequencing from paraffin-embedded pathology tissue. Nat Protoc. 2011;6(12):1905-19. Epub 2011/11/16. doi: 10.1038/nprot.2011.406. PubMed PMID: 22082985. 4. Sollinger C, Lillis J, Malik J, Getman M, Proschel C, Steiner L. Erythropoietin Signaling Regulates Key Epigenetic and Transcription Networks in Fetal Neural Progenitor Cells. Sci Rep. 2017;7(1):14381. Epub 2017/11/01. doi: 10.1038/s41598-017-14366-0. PubMed PMID: 29084993; PMCID: PMC5662632. 5. Wu C, Jin X, Tsueng G, Afrasiabi C, Su AI. BioGPS: building your own mash-up of gene annotations and expression profiles. Nucleic Acids Res. 2016;44(D1):D313-6. Epub 2015/11/19. doi: 10.1093/nar/gkv1104. PubMed PMID: 26578587; PMCID: PMC4702805. 6. Bandyopadhyay G, Huyck HL, Misra RS, Bhattacharya S, Wang Q, Mereness J, Lillis JA, Myers JR, Ashton J, Bushnell T, Cochran M, Holden-Wiltse J, Katzman P, Deutsch GH, Whitsett JA, Xu Y, Mariani TJ, Pryhuber GS. Dissociation, Cellular Isolation and Initial Molecular Characterization of Neonatal and Pediatric Human Lung Tissues. Am J Physiol Lung Cell Mol Physiol. 2018. Epub 2018/07/06. doi: 10.1152/ajplung.00041.2018. PubMed PMID: 29975103. 7. Du Y, Kitzmiller JA, Sridharan A, Perl AK, Bridges JP, Misra RS, Pryhuber GS, Mariani TJ, Bhattacharya S, Guo M, Potter SS, Dexheimer P, Aronow B, Jobe AH, Whitsett JA, Xu Y.
Load more

Recommended publications
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Daneshshahab.Pdf (3.352Mb)
    BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY APPROVED BY SUPERVISORY COMMITTEE Ondine Cleaver, Ph.D. Melanie H. Cobb, Ph.D. Raymond J. MacDonald, Ph.D. Eric N. Olson, Ph.D. THIS DISSERTATION IS DEDICATED TO MY FAMILY, PAST, PRESENT AND FUTURE BMP SIGNALING THROUGH BMPR1A IS REQUIRED FOR ESTABLISHMENT OF PANCREATIC LATERALITY by SHAHAB SHAUN MALEKPOUR DANESH DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas May, 2009 Copyright by SHAHAB SHAUN MALEKPOUR DANESH, 2009 All Rights Reserved ACKNOWLEDGEMENTS I would like to thank my thesis advisor, Dr. Ondine Cleaver for her guidance and support. Ondine accepted me into her lab as a fifth year graduate student who had already been in three labs and had no background in developmental biology or mouse work. Her undying guidance, motivation and enthusiasm for science have allowed me to grow as a scientist and complete my thesis in two short years. I would like to thank my committee members Dr. Melanie Cobb, Dr. Eric Olson, and especially my thesis chair, Dr. Raymond MacDonald. They have provided invaluable suggestions and guidance that have facilitated my project that has allowed me to complete a substantial amount of work in a short time. I would like to thank the members of the Cleaver lab for providing a collaborative environment for science. Aly Villasenor was a great resource for exchange of valuable scientific ideas.
    [Show full text]
  • Gene Regulation Is Governed by a Core Network in Hepatocellular Carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang*
    Gu et al. BMC Systems Biology 2012, 6:32 http://www.biomedcentral.com/1752-0509/6/32 RESEARCH ARTICLE Open Access Gene regulation is governed by a core network in hepatocellular carcinoma Zuguang Gu, Chenyu Zhang* and Jin Wang* Abstract Background: Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide, and the mechanisms that lead to the disease are still relatively unclear. However, with the development of high-throughput technologies it is possible to gain a systematic view of biological systems to enhance the understanding of the roles of genes associated with HCC. Thus, analysis of the mechanism of molecule interactions in the context of gene regulatory networks can reveal specific sub-networks that lead to the development of HCC. Results: In this study, we aimed to identify the most important gene regulations that are dysfunctional in HCC generation. Our method for constructing gene regulatory network is based on predicted target interactions, experimentally-supported interactions, and co-expression model. Regulators in the network included both transcription factors and microRNAs to provide a complete view of gene regulation. Analysis of gene regulatory network revealed that gene regulation in HCC is highly modular, in which different sets of regulators take charge of specific biological processes. We found that microRNAs mainly control biological functions related to mitochondria and oxidative reduction, while transcription factors control immune responses, extracellular activity and the cell cycle. On the higher level of gene regulation, there exists a core network that organizes regulations between different modules and maintains the robustness of the whole network. There is direct experimental evidence for most of the regulators in the core gene regulatory network relating to HCC.
    [Show full text]
  • Prenatal Testing Requisition Form
    BAYLOR MIRACA GENETICS LABORATORIES SHIP TO: Baylor Miraca Genetics Laboratories 2450 Holcombe, Grand Blvd. -Receiving Dock PHONE: 800-411-GENE | FAX: 713-798-2787 | www.bmgl.com Houston, TX 77021-2024 Phone: 713-798-6555 PRENATAL COMPREHENSIVE REQUISITION FORM PATIENT INFORMATION NAME (LAST,FIRST, MI): DATE OF BIRTH (MM/DD/YY): HOSPITAL#: ACCESSION#: REPORTING INFORMATION ADDITIONAL PROFESSIONAL REPORT RECIPIENTS PHYSICIAN: NAME: INSTITUTION: PHONE: FAX: PHONE: FAX: NAME: EMAIL (INTERNATIONAL CLIENT REQUIREMENT): PHONE: FAX: SAMPLE INFORMATION CLINICAL INDICATION FETAL SPECIMEN TYPE Pregnancy at risk for specific genetic disorder DATE OF COLLECTION: (Complete FAMILIAL MUTATION information below) Amniotic Fluid: cc AMA PERFORMING PHYSICIAN: CVS: mg TA TC Abnormal Maternal Screen: Fetal Blood: cc GESTATIONAL AGE (GA) Calculation for AF-AFP* NTD TRI 21 TRI 18 Other: SELECT ONLY ONE: Abnormal NIPT (attach report): POC/Fetal Tissue, Type: TRI 21 TRI 13 TRI 18 Other: Cultured Amniocytes U/S DATE (MM/DD/YY): Abnormal U/S (SPECIFY): Cultured CVS GA ON U/S DATE: WKS DAYS PARENTAL BLOODS - REQUIRED FOR CMA -OR- Maternal Blood Date of Collection: Multiple Pregnancy Losses LMP DATE (MM/DD/YY): Parental Concern Paternal Blood Date of Collection: Other Indication (DETAIL AND ATTACH REPORT): *Important: U/S dating will be used if no selection is made. Name: Note: Results will differ depending on method checked. Last Name First Name U/S dating increases overall screening performance. Date of Birth: KNOWN FAMILIAL MUTATION/DISORDER SPECIFIC PRENATAL TESTING Notice: Prior to ordering testing for any of the disorders listed, you must call the lab and discuss the clinical history and sample requirements with a genetic counselor.
    [Show full text]
  • Clinical and Molecular Investigation of Rare
    CLINICAL AND MOLECULAR INVESTIGATION OF RARE CONGENITAL DEFECTS OF THE PALATE RIMANTE SESELGYTE A thesis submitted for the degree of Doctor of Philosophy to University College London August 2019 page Title 1 DECLARATION I, Rimante Seselgyte, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Signed……………………….. Declaration 3 ABSTRACT Cleft palate (CP) affects around 1/1500 live births and, along with cleft lip, is one of the most common forms of birth defect. The studies presented here focus on unusual defects of the palate, especially to understand better the rarely reported but surprisingly common condition called submucous cleft palate (SMCP). The frequency and consequences of SMCP from a surgical perspective were first investigated based on the caseload of the North Thames Cleft Service at Great Ormond Street Hospital and St Andrew's Centre, Broomfield Hospital, Mid Essex Hospitals Trust. It was previously reported that up to 80% of individuals with unrepaired SMCP experience speech difficulties as a consequence of velopharyngeal insufficiency (VPI). Attempted repair of the palatal defect can sometimes give poor results, so controversies still exist about the correct choice of surgical technique to use. Over 23 years, 222 patients at The North Thames Cleft Service underwent operations to manage SMCP. Nearly half of them (42.8%) were diagnosed with 22q11.2 deletion syndrome (22q11.2 DS). The first operation was palate repair, with an exception of one case, followed by a second surgical intervention required in approximately half of the patients.
    [Show full text]
  • Grimme, Acadia.Pdf
    MECHANISM OF ACTION OF HISTONE DEACETYLASE INHIBITORS ON SURVIVAL MOTOR NEURON 2 PROMOTER by Acadia L. Grimme A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Bachelors of Science in Biological Sciences with Distinction Spring 2018 © 2018 Acadia Grimme All Rights Reserved MECHANISM OF ACTION OF HISTONE DEACETYLASE INHIBITORS ON SURVIVAL MOTOR NEURON 2 PROMOTER by Acadia L. Grimme Approved: __________________________________________________________ Matthew E. R. Butchbach, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Deni S. Galileo, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Carlton R. Cooper, Ph.D. Committee member from the Department of Biological Sciences Approved: __________________________________________________________ Gary H. Laverty, Ph.D. Committee member from the Board of Senior Thesis Readers Approved: __________________________________________________________ Michael Chajes, Ph.D. Chair of the University Committee on Student and Faculty Honors ACKNOWLEDGMENTS I would like to acknowledge my thesis director Dr. Butchbach for his wonderful guidance and patience as I worked through my project. He has been an excellent research mentor over the last two years and I am forever thankful that he welcomed me into his lab. His dedication to his work inspires me as an aspiring research scientist. His lessons will carry on with me as I pursue future research in graduate school and beyond. I would like to thank both current and former members of the Motor Neuron Disease Laboratory: Sambee Kanda, Kyle Hinkle, and Andrew Connell. Sambee and Andrew patiently taught me many of the techniques I utilized in my project, and without them it would not be what it is today.
    [Show full text]
  • Hedgehog Signaling Patterns the Oral- Aboral Axis of the Mandibular Arch
    RESEARCH ARTICLE Hedgehog signaling patterns the oral- aboral axis of the mandibular arch Jingyue Xu1, Han Liu1, Yu Lan1,2,3,4, Mike Adam1, David E Clouthier5, Steven Potter1,3, Rulang Jiang1,2,3,4* 1Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, United States; 2Division of Plastic Surgery, Cincinnati Children’s Hospital Medical Center, Cincinnati, United States; 3Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, United States; 4Shriners Hospitals for Children – Cincinnati, Cincinnati, United States; 5Department of Craniofacial Biology, School of Dental Medicine, Anschutz Medical Campus, University of Colorado, Aurora, United States Abstract Development of vertebrate jaws involves patterning neural crest-derived mesenchyme cells into distinct subpopulations along the proximal-distal and oral-aboral axes. Although the molecular mechanisms patterning the proximal-distal axis have been well studied, little is known regarding the mechanisms patterning the oral-aboral axis. Using unbiased single-cell RNA-seq analysis followed by in situ analysis of gene expression profiles, we show that Shh and Bmp4 signaling pathways are activated in a complementary pattern along the oral-aboral axis in mouse embryonic mandibular arch. Tissue-specific inactivation of hedgehog signaling in neural crest- derived mandibular mesenchyme led to expansion of BMP signaling activity to throughout the oral- aboral axis of the distal mandibular arch and subsequently duplication of dentary bone in the oral side of the mandible at the expense of tongue formation. Further studies indicate that hedgehog signaling acts through the Foxf1/2 transcription factors to specify the oral fate and pattern the oral-aboral axis of the mandibular mesenchyme.
    [Show full text]
  • Gene- and Tissue-Level Interactions in Normal Gastrointestinal Development and Hirschsprung Disease
    Gene- and tissue-level interactions in normal gastrointestinal development and Hirschsprung disease Sumantra Chatterjeea,b,1, Priyanka Nandakumara,1, Dallas R. Auera,b, Stacey B. Gabrielc, and Aravinda Chakravartia,b,2 aCenter for Complex Disease Genomics, McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205; bCenter for Human Genetics and Genomics, New York University School of Medicine, New York, NY 10016; and cGenomics Platform, Broad Institute of MIT and Harvard, Cambridge, MA 02142 Contributed by Aravinda Chakravarti, November 1, 2019 (sent for review May 21, 2019; reviewed by William J. Pavan and Tatjana Sauka-Spengler) The development of the gut from endodermal tissue to an organ between the longitudinal and circular muscles, and the sub- with multiple distinct structures and functions occurs over a mucosal (Meissner’s) plexus, between the circular muscle and prolonged time during embryonic days E10.5–E14.5 in the mouse. the submucosal layer. The myenteric and submucoal plexuses During this process, one major event is innervation of the gut by provide motor innervation to both muscular layers of the gut, enteric neural crest cells (ENCCs) to establish the enteric nervous and secretomotor innervation of the mucosa nearest the lumen system (ENS). To understand the molecular processes underpinning of the gut, respectively (6). gut and ENS development, we generated RNA-sequencing profiles The many stages of gut development require numerous initiat- from wild-type mouse guts at E10.5, E12.5, and E14.5 from both ing signaling events activating transcription factors (TFs) targeting sexes. We also generated these profiles from homozygous Ret null diverse genes and pathways varying across development (7, 8).
    [Show full text]
  • The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear
    The Journal of Neuroscience, March 5, 2014 • 34(10):3523–3535 • 3523 Development/Plasticity/Repair The Transcriptome of Utricle Hair Cell Regeneration in the Avian Inner Ear Yuan-Chieh Ku,1 Nicole A. Renaud,1 Rose A. Veile,1 Cynthia Helms,1 Courtney C.J. Voelker,2 Mark E. Warchol,2 and Michael Lovett1 1Department of Genetics and 2Department of Otolaryngology, Washington University School of Medicine, St Louis, Missouri 63110 Sensory hair cell loss is the major cause of hearing and balance disorders. Mammals are incapable of sustained hair cell regeneration, but lower vertebrates can regenerate these mechano-electrical transducers. We present the first comprehensive transcriptome (by mRNA- Seq) of hair cell regeneration in the chick utricle. We provide pathway and pattern annotations and correlate these with the phenotypic events that occur during regeneration. These patterns are surprisingly synchronous and highly punctuated. We show how these patterns are a new resource for identifying components of the hair cell transcriptome and identify 494 new putative hair-cell-specific genes and validate three of these (of three tested) by immunohistochemical staining. We describe many surprising new components and dynamic expression patterns, particularly within NOTCH signaling. For example, we show that HES7 is specifically expressed during utricle hair cell regeneration and closely parallels the expression of HES5. Likewise, the expression of ATOH1 is closely correlated with HEYL and the HLH inhibitory transcription factors ID1, ID2, and ID4.
    [Show full text]
  • Selecting the Most Appropriate Time Points to Profile in High-Throughput Studies
    Selecting the most appropriate time points to profile in high-throughput studies Michael Kleyman*1, Emre Sefer*1, Teodora Nicola2, Celia Espinoza3, Divya Chhabra3, James S. Hagood3, Naftali Kaminski4, Namasivayam Ambalavanan2, Ziv-Bar Joseph1 *Equal contribution 1 Machine Learning and Computational Biology, School of Computer Science, Carnegie Mellon Univer- sity, Pittsburgh, PA, USA 2 Division of Neonatology, Dept of Pediatrics, University of Alabama at Birmingham, Birmingham, AL, USA 3 Division of Respiratory Medicine, Dept of Pediatrics, University of California San Diego, La Jolla, CARady Children's Hospital San Diego, San Diego, CA 4 Section of Pulmonary, Critical Care and Sleep Medicine, School of Medicine, Yale University, New Heaven, CT E-mail: [email protected] Abstract Biological systems are increasingly being studied by high throughput profiling of molecular data over time. Determining the set of time points to sample in studies that profile several different types of molecular data is still challenging. Here we present the Time Point Selection (TPS) method that solves this combinatorial problem in a principled and practical way. TPS utilizes expression data from a small set of genes sampled at a high rate. As we show by applying TPS to study mouse lung development, the points selected by TPS can be used to reconstruct an accurate representation for the expression values of the non selected points. Further, even though the selection is only based on gene expression, these points are also appropriate for representing a much larger set of protein, miRNA and DNA methylation changes over time. TPS can thus serve as a key design strategy for high throughput time series experiments.
    [Show full text]
  • Primary Cilia-Dependent Gli Processing in Neural Crest Cells Is Required for Early Tongue Development
    Primary cilia-dependent Gli processing in neural crest cells is required for early tongue development A thesis/Capstone Report submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Master of Science In the Department of Pediatrics Molecular and Developmental Biology Graduate program of the College of Medicine By Grethel Millington B.S. Oakwood University, May 2012 May 10, 2016 Committee Chair: Rashmi S. Hegde, PhD ABSTRACT Craniofacial dysmorphologies are common characteristics of the ciliopathy disease spectrum. Oral malformations, including those affecting the development of the tongue, are among the most common phenotypes of craniofacial ciliopathies. Tongue development requires contributions from cranial neural crest (CNC) cells and mesoderm-derived myoblast. The murine ciliopathic mutant, Kif3a f/f;Wnt1-Cre (Kif3a cKO), which is characterized by loss of primary cilia on CNC cells, exhibits aglossia (loss of a tongue). We found that loss of primary cilia on CNC cells rather than muscle cells results in aglossia. On a cellular level, our data revealed that aglossia in Kif3a cKO embryos is due to a loss of mesoderm-derived muscle precursors. We performed RNA-seq to elucidate the molecular mechanism for this phenotype. We found that Hedgehog (Hh) target genes, the Forkhead box genes, (Foxf1, Foxf2, Foxd1 and Foxd2), were transcriptionally downregulated in Kif3a cKO mandibles. The ratios of Hh effector transcription factors, Gli2 and Gli3 activator (GliA) to repressor (GliR) isoforms were disrupted in Kif3a cKO mutant embryos. Our data showed that the genetic removal of GliA in the CNC cells of wild- type mice recapitulated the aglossia phenotype and downregulated Fox gene expression.
    [Show full text]