Identification of Alkane Monoxygenase Genes in Acinetobacter Venetianus VE-C3 and Analysis of Mutants Impaired in Diesel Fuel Degradation

Annals of Microbiology, 56 (3) 207-214 (2006)

Identification of alkane monoxygenase genes in Acinetobacter venetianus VE-C3 and analysis of mutants impaired in diesel fuel degradation

Francesca DECOROSI2, Alessio MENGONI1, Franco BALDI3, Renato FANI1*

1Department of Animal Biology and Genetics, University of Florence, Via Romana 17-19, 50125 Firenze; 2Department of Agricultural Biotechnology, University of Florence, Piazzale delle Cascine 24, 50144 Firenze; 3Department of Environmental Sciences, Cà Foscari University, Calle Larga Santa Marta, Dorso-Duro 21-37, 30123 Venezia, Italy

Received 27 February 2006 / Accepted 18 May 2006

Abstract - Cells of Acinetobacter venetianus strain VE-C3 are able to degrade diesel fuel oil by a complex mechanism requiring the formation of cell aggregates and their further adhesion to fuel oil drops. In this work the biodegradation process in A. venetianus was studied by a combination of genetic, molecular and physiological methods. PCR amplification, sequencing and Southern blot analysis of alkM and rubA genes coding for the alkane hydroxylase and rubredoxin were carried out. Then, 22 Alk- mutants impaired in diesel fuel degradation were obtained by nitrosoguanidine mutagenesis and characterised by i) growth on alkanes as sole carbon and energy sources, ii) modification of cell electrophoretic properties, and iii) analysis of plasmid content. Data obtained revealed that the genetic determinants for alkane degradation are located on both the chromosome and the two plasmids harboured by VE-C3 strain (pAV1 and pAV2, 11 Kbp and 15 kbp, respectively). This organization of genes coding for alkane monoxygenase complex seems to be similar to the arrangement found in Acinetobacter sp. strains ADP1 and M1, where genes are scattered through the chromosome but, as a novelty, that some genes involved in hydrocarbon degradation are plasmid borne also.

Key words: Acinetobacter, biodegradation, alkanes, alkane hydroxylase, rubredoxin.

INTRODUCTION three different subunits: i) alkane hydroxylase, ii) rubredoxin, and iii) rubredoxin reductase. Extensive genetic and bio- The process of hydrocarbon degradation consists of two chemical studies conducted on alkane utilization in main steps: the former is handling hydrocarbons at the Pseudomonas oleovorans (van Beilen et al., 1994), revealed envelope, and the latter is the enzymatic degradation of that the alk genes, encoding proteins for the conversion of hydrocarbons to fatty acids. Hydrocarbon uptake is gener- alkanes to acyl coenzyme A (acyl-CoA), are located in two ally mediated by the synthesis of biosurfactants that avoid different regions of the OCT (octane utilization) plasmid. the direct contact between oil and membrane phospholipids. The alkBFGHJKL genes are cotranscribed from the alk pro- Biosurfactants can be secreted in the growth medium (Desai moter and code for the alkane hydroxylase, the rubredox- and Banat, 1997; Bach et al., 2003) as amphipathic mole- in, an aldehyde dehydrogenase, an alcohol dehydrogenase, cules able to decrease the interfacial tension between oil and an acyl-CoA synthetase and an outer membrane protein. The water, allowing hydrocarbon solubilisation. Alternatively, in other region contains alkS and alkR, which encode a LuxR- some Acinetobacter species (Navon-Venezia et al., 1995; UhpA-like regulator of alk operon expression and rubredox- Baldi et al., 2003), biosurfactant molecules can be embed- in reductase. AlkS is necessary for the activation of the ded in the cell outer membrane to control hydrocarbon expression of alkBFGHJKL operon. uptake without damaging phospholipid membrane. Once In Acinetobacter sp. strain ADP1 five genes essential for hydrocarbon molecules have bound the cell envelope, they n-alkane degradation have been found (Ratajczak et al., (may) undergo the degradation process. In aerobic condi- 1998): i) alkM, encoding the alkane hydroxylase; ii-iii) rubA tions only the terminal carbon oxidation pathway has been and rubB arranged in a bicistronic operon and coding for the identified so far, whereas other pathways have been eluci- rubredoxin and the rubredoxin reductase; iv) alkR, encod- dated in bacteria growing under anaerobic conditions (Yung ing a protein sharing a high degree of sequence similarity and Phelps, 2005). The aerobic process is usually catalysed with AraC-XylS-like transcriptional regulators, and v) xcpR, by the alkane monoxygenase complex that is formed by which is part of the general secretory pathway. In the n-alkane degrading Acinetobacter sp. M-1 genes coding the alkane hydroxylase complex were also found (Tani et al., 2001): * Corresponding author. Phone: +390552288244; the rubAB operon and two different alkane hydroxylase Fax: +390552288250; E-mail: [email protected], genes, alkMa and alkMb differentially induced in response to [email protected] the chain length of the n-alkane. In the regions upstream of 208 F. Decorosi et al.

alkMa and alkMb, two putative transcriptional regulator MATERIALS AND METHODS genes (alkRa and alkRb, respectively) were found. Thus, Acinetobacter sp. ADP1 and Acinetobacter sp. M-1 share a Bacterial strains and growth conditions. The Acineto- very similar overall organization of alk genes, which, in turn, bacter venetianus strains used in this work were the wild type is completely different from the arrangement found in P. VE-C3 (Di Cello et al., 1997) and twenty-two Alk- mutant oleovorans. In fact these genes are neither embedded in a strains, referred to as C3NG (this work), which were obtained large operon nor clustered or localized on a plasmid but they from strain VE-C3 by nitrosoguanidine mutagenesis as are scattered throughout the bacterial chromosome. described below. The bacterial strain VE-C3, belonging to the species Bacterial strains were grown either on Luria-Bertani (LB) Acinetobacter venetianus (Di Cello et al., 1997; Vanee- or minimal medium MMV (Mills et al., 1978) (1.0 g of choutte et al., 1999), was firstly isolated from surface water MgSO4◊7H2O, 0.7 g of KCl, 2.0 g of KH2PO4, 3.0 g of of Venice Lagoon. As shown previously (Baldi et al., 1997; Na2HPO4, 1.0 g of NH4NO3, and 24.0 g of NaCl per litre of Di Cello et al., 1997), this strain is able to grow efficiently in deionised water) containing 0.4% diesel fuel as the sole minimal medium with diesel-fuel as the sole energy and carbon and energy source (MMG). Diesel fuel (Esso Italiana) carbon source. The structure and organization of alk genes was previously filtered through a 0.2 mm-pore-size filter in A. venetianus VE-C3 is not known. However, hybridisation (Sartorius) for sterilization and particle removal. The agarised experiments using the P. oleovorans alkBFGH as a probe mineral medium (agar 16 g per litre) was supplemented with revealed that some of the genes involved in n-alkanes degra- one of the following different carbon and energy sources: dation were very likely located on both the bacterial chro- 0.5% (w/v) succinic acid (Sigma), 2% (v/v) diesel fuel, 2% mosome and on the largest of the two plasmids harboured (v/v) n-decane, 2% (v/v) n-decanol, 2% (v/v) n-decanal, by VE-C3 cells, i.e. pAV1 (11 Kb) and pAV2 (15 Kb) (Di Cello 0.5% (w/v) caprinic acid, 2% (v/v) n-tetradecane, 0.5% et al., 1997). It is also known (Baldi et al., 1999) that A. vene- (w/v) n-tetradecanol, 0.5% (w/v) n-tetradecanal, 0.5% tianus VE-C3 envelope is hydrophilic when grown in complex (w/v) miristic acid, 2% (v/v) n-eicosane, 0.5% (w/v) n- medium. Conversely, in mineral medium containing diesel- eicosanol, 0.5% (w/v) arachidic acid (Fluka). n-decan, n- fuel as the sole carbon and energy source, the envelope decanol,-n-decanal, and n-tetradecane are liquid at room becomes hydrophobic, changing the electrophoretic mobili- temperature and they were filtered through a 0.2 mm-pore- ty of cells due to the direct contact between cells and oil drops size filter (Sartorius) and spread onto MMV plates. Caprinic (Baldi et al., 1999). The n-alkanes induce glycolisation of acid, n-tetradecanol, n-tetradecanal, miristic acid, n- membrane proteins involved in oil uptake (Baldi et al., 2003) eicosane, n-eicosanol and arachidic acid are solid at room and in biofilm formation due to a cell-to-cell contact and to temperature. In order to spread these substrates on agarised the synthesis of a composite material constituted by medium they were solubilised in ether (Sigma) and the solu- exopolyshaccarydes (EPS) and n-alkanes (Baldi et al., 1999). tions were then spread on the medium. Ether was removed In the present work the investigation was focused on the from the medium by putting the plates under vacuum for two two major steps of alkane degradation process in A. vene- hours. All the cultures were incubated at 28 °C for 48 h. tianus VE-C3 cells: hydrocarbon uptake and oxidation. In par- ticular the presence and localization of alkM and rubA genes Amplification and sequencing of alkM and rubA genes. were investigated and Alk- mutants impaired in diesel fuel PCR primers employed to amplify alkane hydroxylase and degradation were obtained by random chemical mutagene- rubredoxin partial coding sequence from the VE-C3 genome sis and characterised by checking their ability to grow in min- are listed in Table 1. imal medium with different alkanes and their products as the PCR was carried out using a Perkin ElmerGeneAmp PCR sole carbon and energy source, by testing their adhesion to System 9600 in a 1X PCR buffer containing 2 mM MgCl2, 200 hydrocarbons (MATH test), and by the analysis of plasmid µM of each dNTPs, 1 µM of each primer, 0.025 U/µl of Taq content. DNA polymerase (Finnzyme), and 10 ng of genomic VE-C3 DNA in a final volume of 20 µl. The presence of the alkane hydroxylase gene in the A. venetianus VE-C3 genome was checked using the degenerate primers and the PCR program described by Smits et al.

TABLE 1 – Oligonucleotides used for PCR amplification

Primer Sequence Length G+C (%) Tm (°C) Reference

Ts2s 5’AAYAGAGCTCAYGARVTRGGTCAYAAG 3’ 27 45 63.7 Smits et al., 1999 Ts2smod 5’AAYAGAGCTCAYGAR5T5GG5CAYAAR 3’ 27 38.5 61.2 Smits et al., 1999 Ts2smod2 5’YAGAGCTCAYGAR5T5TC5CAYAA(GA) 3’ 27 35.2 59.7 Smits et al., 1999 Deg1re 5’GTGGAATTCGCRTGRTGRTC5GARTG 3’ 26 50 64.8 Smits et al., 1999 Deg1re2 5’GTGGAATTCGARTGRTGRTCRCTRTG 3’ 26 51.9 65.6 Smits et al., 1999 Alk1for 5’CGTGTAGAACATCCTTA 3’ 17 41.2 47.9 This study Alk2rev 5’CCATAGAATGCTTGTGT 3’ 17 41.2 47.9 This study Rubfor 5’TATCAATGTATCGTTTGTGGT3’ 21 33.3 52.0 This study Rubrev 5’TCAACTTTTGAAACGCCGC 3’ 19 47.4 54.4 This study Ann. Microbiol., 56 (3), 207-214 (2006) 209

(1999). When the two specific primers (Alk1for and Alk2rev) Cellular chain formation. Bacterial strains were grown on were used, the following program was used: 4 min at 95 °C; LB broth at 28 °C up to an OD600 = 0.6. A culture drop was 25 cycles of 45 s at 95 °C, 1 min at 48 °C, 1 min at 72 °C; observed under light microscopy and the shape and organ- and 5 min at 72 °C. Amplification of rubredoxin gene was ization of bacterial cells were recorded. obtained employing Rubfor and Rubrev primers using the following program: 4 min at 95 °C; 6 cycles of 45 s at 95 °C, MATH test. In order to screen and to observe changes in 1 min at 52 °C, 45 sec at 72 °C; 5 cycles of 45 s at 95 °C, envelops of A. venetianus VE-C3 Alk- mutants the microbial 1 min at 48 °C, 45 s at 72 °C; 20 cycles of 45 s at 95 °C, 1 adhesion to hydrocarbon test (MATH) was used. In a previ- min at 44 °C, 45 s at 72 °C; and 5 min at 72 °C. The Rub- ous work a comparison between this qualitative test and for and Rubrev primers were designed in this work on the measurements of cell electrophoretic mobility was made in basis of the sequence alignment of Acinetobacter sp. ADP1 two different strains of Acinetobacter (Bach et al., 2003). and Acinetobacter sp. M-1 rubredoxin genes. MATH test was carried out as previously described (Grossi Sequencing of DNA fragments was carried out in an et al., 2005). Strains were grown in flasks containing 50 ml

ABI310 automated sequencer (Perkin Elmer) using the Big of LB medium in a gyratory shaker until the OD600 was Dye-Terminator Kit v. 1.1 (Perkin Elmer). BLAST probing of approximately 0.8. Cells were then harvested by centrifu- the DNA and protein databases was performed with the gation at 3000 x g for 15 min, washed twice with deionised BLASTn and BLASTp options of the BLAST program, respec- water, and resuspended in phosphate-buffer saline (pH 7.2) tively (Altschul et al., 1997). The ClustalW program (Thomp- to obtain a final OD600 ranging from 0.4 to 0.6. Three-ml son et al., 1994) was used to align the alkM and rubA aliquots of each suspension were distributed in six vials to sequences obtained with the most similar ones retrieved from which 0.15 ml of n-hexadecane was added to extract the the databases. Each alignment was analysed using the hydrophobic cells. The OD600 of the aqueous phase (At) was Neighbour-Joining method (Saitou and Nei, 1987) according measured after vortexing, and cell concentration was to the model of Jukes-Cantor distances. Phylogenetic trees expressed with respect to the initial OD600 as log (A/A0 x were constructed using MEGA 3 (Molecular Evolutionary 100), where A is the absorbance after vortexing for t sec- Genetics Analysis) software (Kumar et al., 2004). The onds and A0 is the initial absorbance of the culture. nucleotide sequences obtained in this work were submitted to GenBank and were assigned the following accession num- bers: alkM (DQ241788), rubA (DQ251727). RESULTS AND DISCUSSION

Total and plasmid DNA extraction. Bacterial cultures PCR amplification of partial alkM and rubA genes from were grown at 28 °C in flasks containing 50 ml of LB medi- Acinetobacter venetianus VE-C3 um in an orbital shaker until the OD600 was approximately In order to check for the presence of the alkane hydroxylase 0.6. Total DNA was extracted as previously described by gene(s) in VE-C3 genome, PCR amplification of this gene was Bazzicalupo and Fani (1995). Plasmid DNA extraction was carried out according to Smits et al. (1999). Six different performed using the plasmid DNA extraction kit (Qiagen). degenerate primer combinations (TS2S-Deg1RE, TS2S- Deg1RE2, TS2Smod-Deg1-RE, TS2Smod-Deg1-RE2, Southern hybridisation. Approximately 3 µg of genomic TS2Smod2-Deg1-RE, TS2Smod2-Deg1-RE2) were used. DNA and 400 ng of plasmid DNA of strain VE-C3 were digest- Using the primers TS2S-Deg1RE an amplification product of ed to completion with the enzyme EcoRI, according to the the expected size (approximately 550 bp) was obtained. All instruction of the supplier (New England Biolabs). Restriction the other primer combinations failed to give an amplification digestion products were run on a 0.8% agarose gel in TAE product. In order to verify whether the amplification prod- buffer (Tris/acetate/EDTA). Southern blotting was performed uct actually corresponded to a fragment of a gene coding for onto nylon membrane (Hybond N, Amersham) as previous- an alkane hydroxylase, the nucleotide sequence of this PCR ly described (Grifoni et al., 1995). product was determined and compared to those available in Probes were prepared by direct PCR labelling with digox- databases by using both the BLASTn and BLASTp options of igenin-dUTP accordingly to the instructions of the DNA the BLAST programs (Altschul et al., 1997). Data obtained labelling kit (Roche). (not shown) revealed that the nucleotide sequence and the putative amino acid sequence it codes for retrieved at the Isolation of Acinetobacter venetianus Alk- mutants. A lowest E-value sequences corresponding to a fragment of 25 ml culture of strain VE-C3 was grown in LB medium at alkane hydroxylase, suggesting that the amplification prod-

28 °C in a gyratory shaker up to an OD600 = 0.6. uct actually codes for a segment of alkM gene. Nitrosoguanidine was added to the culture at a final con- We also checked for the presence of rubredoxin gene(s) centration of 0.1 mg/ml. The culture was incubated for 50 in the VE-C3 genome; to this purpose the rubredoxin gene min at room temperature in an orbital shaker. Cells were col- of Acinetobacter sp. M-1 and Acinetobacter sp. ADP1 were lected by centrifugation at 3000 x g for 15 min, washed twice aligned by the program ClustalW (Thompson et al., 1994) with fresh LB and then incubated overnight at 30 °C before and two primers, referred to as Rubfor and Rubrev, were plating onto LB plates. Colonies were transferred onto LB designed on conserved regions of the gene. These two master plates in arrays of 100 colonies. The master plates primers were employed in a PCR reaction with VE-C3 genome were replica plated onto MMV containing diesel fuel (MMG) and an amplification product of the expected size (approxi- or succinic acid. Twenty-two strains growing in MMV con- mately 130 pb) was obtained. The nucleotide sequence of taining succinic acid but not on MMG and, hence, unable to this amplification product was determined and it exhibited use diesel fuel as the sole energy and carbon source were a very high degree of sequence similarity with rubredoxin isolated and named C3NG. genes of other Acinetobacter strains (data not shown). The GC content of alkM and rubA genes was 35.8% and 51.4% 210 F. Decorosi et al.

respectively. The finding that the GC content of rubA gene 1997) search using the A. venetianus VE-C3 AlkM sequence is quite different from GC content (37.5%) of previously as a query, this sequence felt within a clearly distinct clus- obtained A. venetianus VE-C3 chromosomal fragments (R. ter containing only all Acinetobacter orthologous sequences Fani, personal communication), suggests that the rubA might (Fig. 1). Therefore, if a horizontal gene transfer (HGT) event have undergone a horizontal gene transfer event. On the con- involving the alkM gene occurred between Acinetobacter (or trary, the alkM gene appeared to be native of A. venetianus; its ancestor) and other prokaryotes, this event should be accordingly, in the phylogenetic tree constructed using the dated in far-off times, maybe before the appearance of the first 100 BLAST hits obtained in a BLASTp (Altschul et al., common ancestor of Acinetobacter.

A. venetianus VE-C3 AlkM

FIG. 1 – Phylogenetic tree constructed using the first 100 protein sequences retrieved from databases using the Acinetobacter venetianus VE-C3 AlkM as query. Ann. Microbiol., 56 (3), 207-214 (2006) 211

A B C

FIG. 2 – Southern blotting experiment. A - electrophoretic gel, B - hybridisation with alkMprobe and C - rubB probe. Lanes - 1: 1 Kb plus ladder, 2: VE-C3 genome, 3: EcoRI restricted VE-C3 genome, 4: VE-C3 plasmids, 5: EcoRI restricted VE-C3 plasmids, 6: Escherichia coli DH5α, 7: pUC18 cloning vector, 8: PCR product obtained from VE-C3 genome with Alk1for-Alk2 rev primer, 9: PCR product obtained from VE-C3 genome with Rubfor-Rubrev primer.

Genomic localization of alkM and rubA To establish the genomic localization of the alkM and rubA genes, the sets of primers specific for the A. venetianus alkM (alk1for and alk2rev) and rubA gene (Rubfor and Rubrev) were used in PCR experiments on the A. venetianus VE-C3 plasmid or total DNA. Data obtained (not shown) revealed that amplification fragments of the expected size were pAV2 obtained when the total DNA was used, whereas no amplification signal was found using the purified plasmid DNA. pAV1 These data strongly suggested that the two genes were located on the bacterial chromosome rather than on the plasmid molecule(s). This finding was confirmed by South- FIG. 3 – Electrophoretic plasmid profile of Acinetobacter venetianus VE-C3 and mutant strains. ern blotting experiments using the VE-C3 alkane hydroxylase and the rubredoxin coding genes as probes (Fig. 2). Data obtained revealed the presence of hybridisation signals with VE-C3 total DNA, whereas the plasmid DNA did not give any ed in figure 3 and revealed that three mutants, referred to hybridisation signal. These data supported the idea that the as C3NG2, C3NG21 and C3NG1, lacked pAV1, pAV2, or both alkM and rubA genes are localized on chromosomal DNA. of them, respectively. These data supported the idea that Moreover, the different hybridisation patterns obtained with some genes involved in hydrocarbon degradation might be the two probes, suggest that the two genes are apparently located on plasmid pAV2. Besides, the finding that cells of not clustered. mutant C3NG21 cells lack pAV1 suggests that also some These data are in agreement with previous results show- gene(s) located on this plasmid might be involved in hydro- ing that a P. oleovorans alkBFGH probe gave a hybridisation carbon oxidation/uptake. signal within A. venetianus VE-C3 chromosome (Di Cello et Thus, all these data witness the existence of genes al., 1997). However, in the same experiment, Di Cello and involved in some steps of hydrocarbon degradation on both co-workers found another hybridisation signal in plasmid plasmids pAV1 and pAV2. pAV2, suggesting that other genes homologous to the P. oleovorans alkBFGH probe and probably involved in hydro- Cell growth in n-alkanes and their oxidation products carbon degradation were located on the plasmid molecule. Useful hints on the function performed by plasmid-borne If this is so, one should expect that A. venetianus VE-C3 genes supposed to be involved in hydrocarbon degradation mutants lacking (at least) pAV2 exhibit an Alk- phenotype. may come from the analysis of the ability of mutant strains lacking pAV1, pAV2 or both of them to grow on n-alkanes Isolation of Acinetobacter venetianus Alk- mutants and their oxidation products. To this purpose the wild type and analysis of plasmid profile (w.t.) strain and all of the Alk- mutants were grown on solid To initiate a dissection of the mechanism of hydrocarbon MMV containing n-alkanes of different chain lengths (n- degradation a collection of mutants was set by nitrosoguani- decane, n-tetradecane, n-eicosane) or alkane monoterminal dine mutagenesis of A. venetianus VE-C3 cells. Twenty thou- oxidation products of n-tetradecane and n-eicosane (pri- sands single colonies of the mutagenised culture were mary alcohol, primary aldehyde and carboxylic acid) as the checked for their inability to grow on minimal medium con- sole carbon and energy source. Results are reported in Table taining diesel fuel as the sole carbon and energy source 2 and revealed that VE-C3 grew slightly on n-decane, where- (Alk- phenotype). In this way, 22 Alk- mutants were isolat- as it thrived on other alkanes (n-tetradecane, n-hexadecane). ed (with a frequency of about 10-3). Then, the presence of It was also able to grow on minimal medium supplemented plasmids pAV1 and/or pAV2 in all of the twenty-two A. vene- with the monoterminal oxidation products (alcohols, alde- tianus Alk- mutants was checked. Data obtained are report- hyds, and fatty acids) of medium chain length alkanes 212 F. Decorosi et al.

TABLE 2 – Phenotypic and molecular characterization (growth on MMV containing different carbon and energy sources, MATH test, cell chain formation and plasmid profile) of A. venetianus VE-C3 and twenty-two Alk- mutant strains

Growth on MMV Acinetobacter venetianus C3NG mutant VE-C3 supplemented with1 1 2 4 6 7 8 9 111314152021222326303233363741

Diesel fuel ------+ Decane ------+ Tetradecane ------+ 1-tetradecanol ------+ Tetradecanal ------+ Miristic acid ------+ ------+ Eicosane ------+ 1-eicosanol ------+ Arachidic acid ------+ MATH test2 +--+-- - --++- - -+------Cell chains3 -+-+-- -+-- -++- -+-++--+- Plasmid4 pAV1 - - + + + + + + + + + + + + + + + + + + + + + pAV2 - + + + + + + + + + + + - + + + + + + + + + +

1 Symbols: +, growth; -, no growth. 2 Symbols: +, hydrophobic cells; -, hydrophilic cells. 3 Symbols: +, cell chain formation; -, no cell chain formation. 4 Symbols: +, presence and - absence of plasmid molecules.

VE-C3 C3NG1 C3NG6 2 2 2 1,5 1,5 1,5 1 1 1 0,5 0,5 0,5 0 0 0 0102030405060 0 102030405060 0 102030405060

C3NG14 C3NG15 C3NG23 2 2 2 1,5 1,5 1,5 1 1 1 0,5 0,5 0,5 0 0 0 0102030405060 0 102030405060 0 102030405060

FIG. 4 – MATH test performed on Acinetobacter venetianus VE-C3 and mutant strains C3NG1, C3NG6, C3NG14, C3NG15, C3NG23. The log(A/A0 x100) and the vortexing time (s) are reported on y and x axis, respectively.

(n-tetradecanol, n-tetradecanal, mirystic acid, n-ecosanol, In order to check whether the Alk- mutants showed some arachidic acid) but it did not grow on n-decanol, n-decanal alterations in the cell surface, a MATH test was carried out or decanoic acid. Twenty-one mutants were not able to grow on each mutant strain grown on LB liquid medium. Data in any of the tested media; however, mutant C3NG21 showed obtained are reported in figure 4 and showed that five a faint growth on myristic acid, suggesting that it might be mutants, namely strains C3NG1, C3NG6, C3NG14, C3NG15, impaired in an aldehyde dehydrogenase activity converting and C3NG23 were highly hydrophobic in LB medium, reveal- n-tetradecanal into myristic acid. The fact that this mutant ing that some alteration(s) at the level of genes controlling lacks plasmid pAV2 speaks toward the possibility that such the cellular envelope occurred in these five mutants. a gene might be located on this plasmid. Cell chain formation MATH tests In principle, these alterations might affect the bacterial In principle, the Alk- phenotype might be due not only to a shape and/or organization during growth in LB medium. To defect in the oxidation process of hydrocarbon molecules, but test this hypothesis, the w.t. strain and each mutant strain also to mutations affecting the genes involved in other steps were grown in LB medium and observed by optical of the process, such as the adhesion and/or the introgres- microscopy during the exponential growth phase. Data sion of diesel fuel droplets in the cell. This represents a very obtained are shown in figure 5 and revealed that VE-C3 complex process involving modifications occurring at the cells grow as isolate or paired cells, whereas nine of the twen- VE-C3 cell envelope level, rendering it hydrophobic in the ty-two Alk- mutants produce long cellular chains, suggest- presence of diesel fuel, whereas it is hydrophilic in cells ing that those mutants could bear a mutation in gene(s) grown in complex medium. involved in the correct assembly of cellular envelope. Cells Ann. Microbiol., 56 (3), 207-214 (2006) 213

other activity responsible for alkane degradation is located on the plasmids. These data suggest a new genomic organization of genes coding for alkane monoxygenase complex in A. venetianus VE-C3 compared with that of Acinetobac- A ter sp. strain ADP1 and M-1 where all the genes for alkane monoxygenase complex are located on the chromosome.

REFERENCES

Altschul S.F., Madden T.L., Schaffer A.A., Zhalg J., Zhalg Z., Miller W., Lipman D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res., 25: 3389-3402. Bach H., Berdichevsky Y., Gutnick D. (2003) An exocellular protein from the oil-degrading microbe Acinetobacter venetianus RAG-1 enhances the emulsifying activity of the polymeric B bioemulsifier emulsan. Appl. Environ. Microbiol., 69: 2608- 2615. Baldi F., Pepi M., Fani R., Di Cello F., Da Ros L., Fossato V.U. (1997) Complementary degradation of n-paraffins by aerobic Gram- negative bacteria isolated from Venice Lagoon. Croatica Chem- ica Acta, 70: 333-346. Baldi F., Ivosevic N., Minacci A., Pepi M., Fani R., Svetlicic V., Zutic FIG. 5 – Light microscopy analysis of Acinetobacter venetianus V. (1999) Adhesion of Acinetobacter venetianus to diesel fuel VE-C3 and mutant strains grown LB. A - strains VE-C3, droplets studied with in situ electrochemical and molecular C3NG1, C3NG4, C3NG7, C3NG8, C3NG9, C3NG13,C3NG14, probes. Appl. Environ. Microbiol., 65: 2041-2048. C3NG15, C3NG22, C3NG23, C3NG30, C3NG36, C3NG37. B Baldi F., Pepi M., Capone A., Milanesi C., Fani R., Focarelli R. (2003) - C3NG2, C3NG6, C3NG11, C3NG20, C3NG21, C3NG26, Envelope glycosylation determined by lectins in microscopy C3NG32, C3NG33, C3NG41. sections of Acinetobacter venetianus induced by diesel fuel. Res. Microbiol., 154: 417-424. Bazzicalupo M., Fani R. (1995) The use of RAPD for generating specific DNA probes for microorganisms. In: Clapp J.P. Ed., Meth- of one of these nine mutants, strain C3NG6, were also ods In Molecular Biology, Vol 50: Species diagnostics proto- hydrophobic to MATH test (see above). cols: PCR and other nucleic acid Methods, Humana Press Inc. Totowa, NJ, pp. 155-175. Desai J.D., Banat I.M. (1997) Microbial production of surfactants CONCLUSION and their commercial potential. Microb. Mol. Biol. Rev., 61: 47-64. Data obtained in this work shed some light on the genes Di Cello F., Pepi M., Baldi F., Fani R. (1997) Molecular characterization of an n-alkane-degrading bacterial community and involved in n-alkane degradation in A. venetianus VE-C3 identification of a new species, Acinetobacter venetianus. Res. and on the uptake mechanism in this strain. Microbiol., 148: 237-249. Alkanes are highly hydrophobic molecules, and microbial Grifoni A., Bazzicalupo M., Di Serio C., Fancelli S., Fani R. (1995) cells, which are able to utilize these molecules as nutrient, Identification of Azospirillum strains by restriction length poly- show suitable uptake strategies. A widespread uptake strat- morphism of the 16S rDNA and of the histidine operon. FEMS egy is the secretion of biosurfactant molecules facilitating the Microbiol. Lett., 127: 85-91. solubilisation of hydrocarbons in water. Nevertheless, A. Grossi C., Nereo S., Brilli M., Michaud L., Lo Giudice A., Bruni V., venetianus VE-C3 cells and other Acinetobacter species, but Fani R. (2005) Isolation and phenotypic and molecular char- strain RAG1 (Rosenberg et al., 1998), are able to solubilise acterization of hydrocarbon-degrading bacteria isolated from Terra Nova Bay (Antarctica). Polarnet, 1: 157-165. hydrocarbons directly on the envelope (Hanson et al., 1994; Navon-Venezia et al., 1995; Toren et al., 2001, 2002). MATH- Hanson K.G., Kale V.C., Desai A.J. (1994) The possible involvement of cell surface and outer membrane proteins of Acinetobacter test, as a qualitative index to monitor electric envelope sp.A3 in crude oil degradation. FEMS Microbiol. Lett., 122: changes in many mutants, showed that, differently from the 275–280. wild type, five Alk- strains are hydrophobic when grown on Kumar S., Tamura K., Nei M. (2004) MEGA3: Integrated Software complete medium (LB). Furthermore, microscopic analysis for Molecular Evolutionary Genetics Analysis and Sequence revealed that nine of them form cellular chains in LB medi- Alignment. Briefings in Bioinformatics, 5: 150-163. um during exponential growth phase, and one mutant shows Mills A.L., Breuil C., Colwell R.R. (1978) Enumeration of petrole- both these phenotypes. These findings confirm that the um degrading marine and estuarine microorganisms by the grade of cell hydrophobicity might be a critical factor for cell- most probable number method. Can. J. Microbiol., 24: 552- to cell interaction and diesel-fuel uptake by VE-C3 (Baldi et 557. al., 1999, 2003). Navon-Venezia S., Zosim Z., Gottlieb A., Legmann R., Carmeli S., Molecular investigation of wild type and Alk- cells sug- Ron E.Z., Rosenberg E. (1995) Alasan, a new bioemulsifier from Acinetobacter radioresistens, Appl. Environ. Microbiol., gested that the gene(s) involved in alkane degradation are 61: 3240–3244. located on both the chromosome and the two plasmids. Ratajczak A., Geißdörfer W., Hillen W. (1998) Expression of alka- Actually, the two genes coding for alkane hydroxylase and ne hydroxylase from Acinetobacter sp. strain ADP1 is induced rubredoxin reductase are localized on the bacterial chromo- by a broad range of n-alkanes and require the transcription- some and they are apparently not clustered, while some al activator AlkR. J. Bacteriol., 180: 5822-5827. 214 F. Decorosi et al.

Rosenberg E., Rubinovitz C., Gottlieb A., Rossenhak S., Ron E.Z. Toren A., Navon-Venezia S., Ron E.Z., Rosenberg E. (2001) Emul- (1988) Production of biodispersan by Acinetobacter cal- sifying activities of purified Alasan proteins from Acinetobac- coaceticus A2. Appl. Environ. Microbiol., 54: 317-322. ter radioresistens KA53. Appl. Environ. Microbiol., 67: 1102–1106. Saitou M., Nei M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., Toren A., Orr E., Paitan Y., Ron E.Z., Rosenberg E. (2002) The active 4: 406-425. component of the bioemulsifier alasan from Acinetobacter radioresistens KA53 is an OmpA-like protein. J. Bacteriol., Smits T.H., Rothlisberger M., Witholt B., van Beilen J.B. (1999) Mol- 184: 165–170. ecular screening for alkane hydroxylase genes in Gram-neg- van Beilen J.B., Wubbolts M.G., Witholt B. (1994) Genetics of ative and Gram-positive strains. Environ. Microbiol., 1: 307- alkane oxidation in Pseudomonas oleovorans. Biodegrada- 317. tion, 5: 161-174. Tani A., Ishige T., Sakai Y., Kato N. (2001) Gene structures and reg- Vaneechoutte M., Tjernberg I., Baldi F., Pepi M., Fani R., Sullivan ulation of the alkane hydroxylase complex in Acinetobacter sp. E.R., van der Toorn J., Dijkshoorn L. (1999) Oil-degrading strain M-1. J. Bacteriol., 183: 1819-1823. Acinetobacter strain RAG-1 and strains described as ‘Acineto- Thompson J.D., Higgins D.G., Gibson T.J. (1994) CLUSTAL W: bacter venetianus sp. nov.’ belong to the same genomic improving the sensitivity of progressive multiple sequence species. Res. Microbiol., 150: 69-73. alignment through sequence weighting, position-specific gap Yung l.Y., Phelps C.D. (2005) Metabolic biomarkers for monitor- penalties and weight matrix choice. Nucl. Acids Res., 22: ing in situ anaerobic hydrocarbon degradation. Environ. Health 4673-4680. Perspective, 113: 62-67.