DOCSLIB.ORG

Molecular Cloning and Characterization of a Lipid Phosphohydrolase That Degrades Sphingosine-1- Phosphate and Induces Cell Death

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Cloning and Characterization of a Lipid Phosphohydrolase That Degrades Sphingosine-1- Phosphate and Induces Cell Death Molecular cloning and characterization of a lipid phosphohydrolase that degrades sphingosine-1- phosphate and induces cell death Suzanne M. Mandala*, Rosemary Thornton*, Ismael Galve-Roperh†, Samantha Poulton†, Courtney Peterson†, Ana Olivera†, James Bergstrom*, Myra B. Kurtz*, and Sarah Spiegel†‡ *Department of Infectious Disease, Merck Research Laboratories, Rahway, NJ 07065; and †Department of Biochemistry and Molecular Biology, Georgetown University Medical Center, Washington, DC 20007 Communicated by Edward M. Scolnick, Merck & Co., Inc., West Point, PA, April 3, 2000 (received for review December 17, 1999) Sphingosine and sphingosine-1-phosphate (SPP) are interconvert- SPP can be metabolized by two distinct pathways: catabolism ible sphingolipid metabolites with opposing effects on cell growth by a microsomal pyridoxal phosphate-dependent lyase to palmi- and apoptosis. Based on sequence homology with LBP1, a lipid taldehyde and phosphoethanolamine, which then can be used for phosphohydrolase that regulates the levels of phosphorylated the biosynthesis of glycerolipids, or dephosphorylation by spe- sphingoid bases in yeast, we report here the cloning, identification, cific phosphatases to sphingosine (27). Recently, the genes and characterization of a mammalian SPP phosphatase (mSPP1). encoding these enzymes were identified in Saccharomyces cer- This hydrophobic enzyme, which contains the type 2 lipid phos- evisiae (28–30), and genetic manipulation has demonstrated an phohydrolase conserved sequence motif, shows substrate speci- important role for long-chain phosphorylated sphingoid bases in ficity for SPP. Partially purified Myc-tagged mSPP1 was also highly growth and survival of yeast after nutrient deprivation and heat active at dephosphorylating SPP. When expressed in yeast, mSPP1 stress (29, 31–33) in a manner that is reminiscent of their effects can partially substitute for the function of LBP1. Membrane frac- on mammalian cells. Although the mammalian counterpart of tions from human embryonic kidney HEK293 cells transfected with the yeast SPP lyase recently has been identified (34), a specific mSPP1 markedly degraded SPP but not lysophosphatidic acid, mammalian SPP phosphatase has not been previously cloned. phosphatidic acid, or ceramide-1-phosphate. Enforced expression The yeast SPP phosphatases encoded by LBP1 and LBP2 are of mSPP1 in NIH 3T3 fibroblasts not only decreased SPP and members of type 2 lipid phosphate phosphohydrolases, a family enhanced ceramide levels, it also markedly diminished survival and of magnesium-independent, membrane-bound enzymes that induced the characteristic traits of apoptosis. Collectively, our share sequence conservation within three domains that are results suggest that SPP phosphohydrolase may regulate the dy- predicted to be involved in the coordination and hydrolysis of the namic balance between sphingolipid metabolite levels in mamma- phosphate moiety (35). A search of the yeast genome for lian cells and consequently influence cell fate. enzymes containing the three conserved domains revealed the presence of four genes encoding putative type 2 lipid phospha- phingosine-1-phosphate (SPP) is a bioactive sphingolipid tases. Two of these, DPP1 and LPP1, were shown to encode Smetabolite that regulates diverse biological processes (re- phosphatases with activity against phosphatidic acid (PA), lyso- viewed in refs. 1 and 2). Many of its pleiotropic actions appear phosphatidic acid (LPA), and diacylglycerol pyrophosphate (36, to be mediated by a family of specific cell surface G protein- 37). In contrast, LBP1 (also known as YSR2 or LCB3) and LBP2 coupled receptors (GPCR), known as EDG (endothelial differ- (YSR3) encode phosphatases with remarkable specificity for entiation genes) receptors. Binding of SPP to EDG-1 expressed phosphorylated sphingoid bases and without activity toward on endothelial cells enhances survival (3), chemotaxis, and in glycerolipid substrates (29, 30, 33). CELL BIOLOGY vitro angiogenesis (4), and adherens junction assembly leading to In crude rat liver and cerebellum extracts, high-affinity SPP morphogenetic differentiation (5), whereas binding of SPP to phosphatase activity has been previously described (38), with EDG-5 and EDG-3 induces neurite retraction and soma round- enzymatic properties similar to yeast SPP phosphatases. Al- ing (6, 7). SPP induces activation of Gi-gated inward rectifying ϩ though three isoforms of type 2 lipid phosphate phosphohydro- K -channels in atrial myocytes (8) and inhibits motility of lases, known as LPP1͞PAP2a, LPP3͞PAP2b, and LPP2͞PAP2c, melanoma cells (9) through as yet uncharacterized GPCRs. have been cloned from mammalian cells (reviewed in ref. 39), SPP also plays important roles inside cells. In response to these gene products appear to have broad substrate specificity diverse external stimuli, sphingosine kinase, the enzyme that with similar efficiencies against PA, LPA, SPP, ceramide-1-P, catalyzes the phosphorylation of sphingosine to SPP, is activated and diacylglycerol pyrophosphate, when assayed in vitro in (10–15). Intracellular SPP, in turn, mobilizes calcium from lipid͞detergent micelles. We now report the cloning and char- internal stores independently of inositol triphosphate (15, 16), as acterization of a mammalian homolog of yeast SPP phosphatase, well as eliciting diverse signaling pathways leading to prolifera- murine SPP phosphatase-1 (mSPP1). The mammalian enzyme tion (17, 18) and suppression of apoptosis (19–22). Because of its dual function as a ligand and second messenger and its pivotal role in cell growth and survival, the synthesis and Abbreviations: SPP, sphingosine-1-phosphate; PA, phosphatidic acid; LPA, lysophospha- degradation of SPP should be tightly regulated in a spatial- tidic acid; LPP, lipid phosphate phosphohydrolase; mSPP1, murine SPP phosphatase-1; RACE, rapid amplification of cDNA ends; GFP, green fluorescent protein; EST, expressed temporal manner. Until recently, however, little was known of sequence tag. the enzymes involved in SPP metabolism. We have purified Data deposition: The sequence reported in this paper has been deposited in the GenBank sphingosine kinase to apparent homogeneity from rat kidney database (accession no. AF247177). (23) and subsequently cloned and characterized a mammalian ‡To whom reprint requests should be addressed. E-mail: [email protected]. sphingosine kinase (24), which belongs to a highly conserved The publication costs of this article were defrayed in part by page charge payment. This gene family (24, 25). Enforced expression of sphingosine article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. kinase markedly enhanced proliferation and survival, substan- §1734 solely to indicate this fact. tiating the importance of intracellularly generated SPP in cell Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073͞pnas.120146897. fate decisions (26). Article and publication date are at www.pnas.org͞cgi͞doi͞10.1073͞pnas.120146897 PNAS ͉ July 5, 2000 ͉ vol. 97 ͉ no. 14 ͉ 7859–7864 Downloaded by guest on September 24, 2021 differs from lipid phosphatase phosphatases (LPP) in its se- according to the manufacturer’s instructions. In some experi- quence, properties, and in its high specificity for SPP. Our results ments, cells were transfected with plasmids plus pCEFL GFP suggest that mSPP1, which regulates the dynamic balance be- (5:1), which encodes green fluorescent protein. Transfection tween ceramide and SPP levels in mammalian cells, may play an efficiencies were typically 30% and 40% for NIH 3T3 and important role in regulating cell survival. HEK293 cells, respectively. Materials and Methods SPP Phosphatase Assay. Forty-eight hours after transfection, cells cDNA Cloning. BLAST searches using the LBP1 sequence identified were washed twice in PBS. Then, 200 ␮l of buffer A [100 mM expressed sequence tag (EST) clones: 1247076 (GenBank ac- Hepes (pH 7.5) containing 10 mM EDTA, 1 mM DTT, and 10 cession no. AA574626) had homology through the phosphatase- ␮g͞ml each leupeptin, aprotinin, and soybean trypsin inhibitor] conserved domains, and 1664615 (GenBank accession no. was added to each well, and cells were scraped on ice. Cells were AI098466) contained 5Ј sequences. PCR primers (5Ј- subsequently freeze-thawed seven times, then centrifuged at CGGAACTGGGCAACGAGCTCTTC and 5Ј-CTCG- 100,000 ϫ g for 1 h. Supernatants were removed, and the GAATACAGCATGCCCTCCACGC) were used in 3Ј rapid membrane fractions were resuspended in 200 ␮l of buffer A and amplification of cDNA ends (RACE) reactions using a Mara- homogenized. Protein concentrations were determined with the thon cDNA Amplification kit and mouse brain cDNA (CLON- Bradford assay. 32P-labeled SPP was prepared by phosphoryla- TECH). A 2.6-kb PCR product was cloned into pCR2.1 (In- tion of sphingosine with recombinant sphingosine kinase essen- vitrogen), and its sequence was found to match EST AA574626 tially as described (24). SPP phosphatase activity was measured with additional 3Ј sequence including the putative stop codon. by adding 32P-labeled SPP (2 nmol, 25,000 cpm, 0.3% BSA The full-length cDNA was constructed by ligating a 0.5-kb complex) to membrane or cytosol preparations (2 ␮g) in 200 ␮l HindIII͞BstYI fragment from AI098466 to a 1.0-kb BstYI͞ of buffer A and incubated for 30 min at 37°C. Remaining EcoRI fragment from the RACE PCR product into pcDNA3.1 32P-labeled SPP was extracted and analyzed by TLC as described (Invitrogen). NotI sites flanking
Load more

Recommended publications
  • Involvement of Sphingosine 1-Phosphate in Nerve Growth Factor-Mediated Neuronal Survival and Differentiation
    The Journal of Neuroscience, September 15, 1997, 17(18):6952–6960 Involvement of Sphingosine 1-Phosphate in Nerve Growth Factor-Mediated Neuronal Survival and Differentiation Lisa Cseh Edsall, Grisha G. Pirianov, and Sarah Spiegel Department of Biochemistry and Molecular Biology, Georgetown University Medical Center, Washington, DC 20007 Sphingolipid metabolites, such as ceramide and sphingosine- elicited by suboptimal doses of NGF. Moreover, SPP also pro- 1-phosphate (SPP), are emerging as a new class of second tected PC12 cells from apoptosis induced by serum with- messengers involved in cellular proliferation, differentiation, and drawal. To further substantiate a role for SPP in the cytopro- apoptosis. Nerve growth factor (NGF), a neurotrophic factor for tective actions of NGF, we found that N,N-dimethylsphingosine, pheochromocytoma PC12 cells, induced a biphasic increase in a competitive inhibitor of sphingosine kinase, also induced the activity of sphingosine kinase, the enzyme that catalyzes apoptosis and interfered with the survival effect of NGF. These the formation of SPP. This activation was blocked by K252a, an effects were counteracted by exogenous SPP. Moreover, other inhibitor of tyrosine kinase A (trkA). A rapid 1.7-fold increase structurally related compounds, such as dihydrosphingosine was followed by a marked prolonged increase reaching a max- 1-phosphate and lysophosphatidic acid, had no significant pro- imum of fourfold to fivefold stimulation with a concomitant tective effects. Our results suggest that activation of sphin- increase in SPP levels and a corresponding decrease in endog- gosine kinase and subsequent formation of SPP may play an enous sphingosine levels. Levels of ceramide, the precursor of important role in the differentiation and survival effects induced sphingosine, were only slightly decreased by NGF in serum- by NGF.
    [Show full text]
  • Sphingosine-1-Phosphate Links Persistent STAT3 Activation, Chronic Intestinal Inflammation, and Development of Colitis-Associate
    Cancer Cell Article Sphingosine-1-Phosphate Links Persistent STAT3 Activation, Chronic Intestinal Inflammation, and Development of Colitis-Associated Cancer Jie Liang,1,3,4 Masayuki Nagahashi,1,2,4 Eugene Y. Kim,1,4 Kuzhuvelil B. Harikumar,1 Akimitsu Yamada,1,2 Wei-Ching Huang,1 Nitai C. Hait,1 Jeremy C. Allegood,1 Megan M. Price,1 Dorit Avni,1 Kazuaki Takabe,1,2 Tomasz Kordula,1 Sheldon Milstien,1 and Sarah Spiegel1,* 1Department of Biochemistry and Molecular Biology and the Massey Cancer Center 2Division of Surgical Oncology, Department of Surgery Virginia Commonwealth University School of Medicine, Richmond, VA 23298, USA 3Present address: State Key Laboratory of Cancer Biology, Xi’an, Shannxi 710032, China 4These authors contributed equally to this work *Correspondence: [email protected] http://dx.doi.org/10.1016/j.ccr.2012.11.013 SUMMARY Inflammatory bowel disease is an important risk factor for colorectal cancer. We show that sphingosine-1- phosphate (S1P) produced by upregulation of sphingosine kinase 1 (SphK1) links chronic intestinal inflam- mation to colitis-associated cancer (CAC) and both are exacerbated by deletion of Sphk2. S1P is essential for production of the multifunctional NF-kB-regulated cytokine IL-6, persistent activation of the transcription factor STAT3, and consequent upregulation of the S1P receptor, S1PR1. The prodrug FTY720 decreased SphK1 and S1PR1 expression and eliminated the NF-kB/IL-6/STAT3 amplification cascade and development of CAC, even in Sphk2À/À mice, and may be useful in treating colon cancer in individuals with ulcerative colitis. Thus, the SphK1/S1P/S1PR1 axis is at the nexus between NF-kB and STAT3 and connects chronic inflammation and CAC.
    [Show full text]
  • Happy Holidays ASBMB Membersbayside Biomolecules
    SUBMIT YOUR LATE BREAKING MEETING ABSTRACTS BY FEB 25 January 2009 Happy Holidays ASBMB MembersBayside Biomolecules American Society for Biochemistry and Molecular Biology Edited by Ajit Varki, University of California, San Diego, Richard D. Cummings, Emory University School of Medicine, Atlanta, Jeffrey D. Esko, University of California, San Diego, Hudson H. Freeze, Burnham Institute for Medical Research, La Jolla, Pamela Stanley, Albert Einstein College of Medicine of Yeshiva University, New York, Carolyn R. Bertozzi, University of California, Berkeley, Gerald W. Hart, Johns Hopkins University of School of Medicine, Baltimore, and Marilynn E. Etzler, University of California, Davis he sugar chains of cells—known collectively as glycans—play a variety of impressive, critical, and often Tsurprising roles in biological systems. Glycobiology is the study of the roles of glycans in the growth and development, function, and survival of an organism. Glyco-related processes, described in vivid detail in the text, have become increasingly significant in many areas of basic research as well as biomedicine and biotechnology. This new edition of Essentials of Glycobiology covers the general principles and describes the structure and biosynthesis, diversity, and function of glycans and their relevance to both normal physiologic processes and human disease. Several new chapters present significant advances that have occurred since the publication of the first edition. Three sections of note describe organismal diversity, advances in our understanding of disease states and related therapeutic applications, and the genomic view of glycobiology. “Glycomics,” analogous to genomics and proteomics, is the systematic study of all glycan structures of a given cell type or organism and paves the way for a more thorough understanding of the functions of these ubiquitous molecules.
    [Show full text]
  • A History of the ASBMB Annual Meeting
    COMPETE FOR BEST POSTER AWARDS IN ANAHEIM September 2009 A History of the ASBMB Annual Meeting American Society for Biochemistry and Molecular Biology ASBMB Annual Meeting Get Ready to Meet in California! Anaheim Awaits April 24–28, 2010 www.asbmb.org/meeting2010 Travel Awards and Abstract Submission Deadline: November 4th, 2009 Registration Open September 2009 AnaheimAd FINAL.indd 1 6/15/09 1:00:42 PM contents SEPTEMBER 2009 On the Cover: A look at the history of the ASBMB Annual society news Meeting. 2 President’s Message 22 6 News from the Hill 9 Washington Update 10 Retrospective: Ephraim Katchalski Katzir (1916-2009) JBC minireview 13 JBC Highlights Computational series looks at computational Biochemistry biochemistry. 14 Member Spotlight 13 special interest 16 Lifting the Veil on Biological Research 18 Mildred Cohn: Isotopic and Spectroscopic Trailblazer 22 History of the ASBMB Annual Meeting 2010 annual meeting 26 The Chemistry of Life A profile of 28 New Frontiers in Genomics ASBMB’s first and Proteomics woman president, Mildred Cohn. 30 Hypertension: Molecular 18 Mechanisms, Treatment and Disparities departments 32 Minority Affairs 33 Lipid News 34 BioBits 36 Career Insights 38 Education and Training resources Scientific Meeting Calendar erratum online only The article on the 2009 ASBMB election results in the August issue of ASBMB Today mistakenly identified Charles Brenner as professor and head of the Biochemistry Department at Dartmouth Medical School. He is, in fact, head of biochemistry at University of Iowa’s Carver College of Medicine. September 2009 ASBMB Today 1 president’smessage A monthly publication of The American Society for Biochemistry and Molecular Biology Wimps? Officers Gregory A.
    [Show full text]
  • Sphingosine Kinase 1 Inhibitor, a Novel Inducer of Autophagy
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 Sphingosine Kinase 1 Inhibitor, A Novel Inducer of Autophagy Daniel Meza Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/1871 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. © Daniel Meza 2009 All Rights Reserved SPHINGOSINE KINASE 1 INHIBITOR, A NOVEL INDUCER OF AUTOPHAGY A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by DANIEL MEZA Director: SARAH SPIEGEL PROFESSOR AND CHAIR, BIOCHEMISTRY AND MOLECULAR BIOLOGY Virginia Commonwealth University Richmond, Virginia August 2009 Acknowledgement Many thanks to Dr. Spiegel who acted as my mentor and guide, Dr. Fang and Dr. Hylemon who were members of my committee, Dr. Lépine who took me under her scientific wing and supported me in all aspects of this project, Dr. Takabe and Dr. Hoon whose insights prepared me for the future, and Dr. Kapitonov whose love of research, technical advice and willingness to discuss even the most far-fetched of ideas, buoyed me along. Also, many thanks to my family (Mark, Paula and Benjamin) and friends (especially, Dan, Jochen, Mona and Dmitry) who gave this project its human element. We stand upon the shoulders of those who came before us.
    [Show full text]
  • Direct Visualization of Redistribution and Capping of Fluorescent Gangliosides on Lymphocytes
    Direct Visualization of Redistribution and Capping of Fluorescent Gangliosides on Lymphocytes SARAH SPIEGEL,** SHOUKI KASSIS,* MEIR WILCHEK,* and PETER H. FISHMAN* *Membrane Biochemistry Section, Developmental and Metabolic Neurology Branch, National Institute of Neurological and Communicative Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20205; and *Department of Biophysics, The Weizmann Institute of Science, Rehovot, Israel ABSTRACT Fluorescent derivatives of gangliosides were prepared by oxidizing the sialyl residues to aldehydes and reacting them with fluorescent hydrazides. When rhodaminyl Downloaded from gangliosides were incubated with lymphocytes, the cells incorporated them in a time- and temperature-dependent manner. Initially, the gangliosides were evenly distributed on the cell surface but were redistributed into patches and caps by antirhodamine antibodies. When the cells were then stained with a second antibody or protein A labeled with fluorescein, the fluorescein stain revealed the coincident movement of both the gangliosides and the anti- rhodamine antibodies. When the cells were treated with both rhodamine and Lucifer yellow jcb.rupress.org CH-labeled gangliosides, the antirhodamine antibodies induced patching and capping of both fluorescent gangliosides but had no effect on cells incubated only with Lucifer yellow CH- labeled gangliosides. In addition, capping was observed on cells exposed to cholera toxin, antitoxin antibodies, and rhodamine-labeled protein A, indirectly showing the redistribution of endogenous ganglioside GM1, the cholera toxin receptor. By incorporating Lucifer yellow on July 9, 2017 CH-labeled GM1 into the cells and inducing capping as above, we were able to demonstrate directly the coordinate redistribution of the fluorescent GM1 and the toxin. When the lymphocytes were stained first with Lucifer yellow CH-labeled exogenous ganglioside GM3, which is not a toxin receptor, there was co-capping of endogenous GM1 (rhodamine) and exogenous GM3 (Lucifer yellow CH).
    [Show full text]
  • Sphingosine-L-Phosphate, a Novel Lipid, Involved in Cellular Proliferation Hong Zhang, Naishadh N
    Sphingosine-l-Phosphate, a Novel Lipid, Involved in Cellular Proliferation Hong Zhang, Naishadh N. Desai, Ana Olivera, Takashi Seki, Gary Brooker, and Sarah Spiegel* Department of Biochemistry and Molecular Biology, Georgetown University Medical Center, Washington, DC 20007 Abstract. Sphingosine, a metabolite of membrane elicited similar increases in sphingosine-l-phosphate sphingolipids, regulates proliferation of quiescent Swiss levels in these cells. Although both sphingosine and 3T3 fibroblasts (Zhang, H ., N. E. Buckley, K. Gibson, sphingosine-l-phosphate acted synergistically with a and S. Spiegel . 1990. J. Biol. Chem. 265:76-81) . The wide variety of growth factors, there was no additive or present study provides new insights into the formation synergistic effect in response to a combination of sphin- and function of a unique phospholipid, a metabolite of gosine and sphingosine-l-phosphate . Using a digital sphingosine, which was unequivocally identified as imaging system for measurement of calcium changes, sphingosine-l-phosphate . The rapid increase in 32P-la- we observed that both sphingosine and sphingosine-l- beled sphingosine-l-phosphate levels induced by sphin- phosphate are potent calcium-mobilizing agonists in gosine was concentration dependent and correlated with viable 3T3 fibroblasts. The rapid rise in cytosolic free its effect on DNA synthesis. Similar to the mitogenic calcium was independent of the presence of calcium in effects of sphingosine, low concentrations ofsphingosine- the external medium, indicating that
    [Show full text]
  • VEGF Potentiates GD3-Mediated Immunosuppression by Human Ovarian Cancer Cells Irina V
    Published OnlineFirst April 13, 2016; DOI: 10.1158/1078-0432.CCR-15-2518 Biology of Human Tumors Clinical Cancer Research VEGF Potentiates GD3-Mediated Immunosuppression by Human Ovarian Cancer Cells Irina V. Tiper1, Sarah M. Temkin2,3, Sarah Spiegel1, Simeon E. Goldblum2, Robert L. Giuntoli II3, Mathias Oelke4, Jonathan P. Schneck4, and Tonya J. Webb1 Abstract Purpose: Natural killer T (NKT) cells are important mediators Results: Ovarian cancer tissue and ascites contain lym- of antitumor immune responses. We have previously shown that phocytic infiltrates, suggesting that immune cells trafficto ovarian cancers shed the ganglioside GD3, which inhibits NKT- tumors, but are then inhibited by immunosuppressive mole- cell activation. Ovarian cancers also secrete high levels of VEGF. In cules within the tumor microenvironment. OV-CAR-3 this study, we sought to test the hypothesis that VEGF production and SK-OV-3 cell lines produce high levels of VEGF and by ovarian cancers suppresses NKT-cell–mediated antitumor GD3. Pretreatment of APCs with ascites or conditioned responses. medium from OV-CAR-3 and SK-OV-3 blocked CD1d-medi- Experimental Design: To investigate the effects of VEGF on ated NKT-cell activation. Inhibition of VEGF resulted in a CD1d-mediated NKT-cell activation, a conditioned media model concomitant reduction in GD3 levels and restoration of was established, wherein the supernatants from ovarian cancer NKT-cell responses. cell lines (OV-CAR-3 and SK-OV-3) were used to treat CD1d- Conclusions: We found that VEGF inhibition restores NKT-cell expressing antigen-presenting cells (APC) and cocultured with function in an in vitro ovarian cancer model.
    [Show full text]
  • Sphingosine Kinase Type 1 Induces G12/13-Mediated Stress Fiber
    THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 47, Issue of November 21, pp. 46452–46460, 2003 Printed in U.S.A. Sphingosine Kinase Type 1 Induces G12/13-mediated Stress Fiber Formation, yet Promotes Growth and Survival Independent of G Protein-coupled Receptors* Received for publication, August 7, 2003, and in revised form, September 3, 2003 Published, JBC Papers in Press, September 8, 2003, DOI 10.1074/jbc.M308749200 Ana Olivera‡, Hans M. Rosenfeldt§, Meryem Bektas§¶, Fang Wang§, Isao Ishiiʈ, Jerold Chun**‡‡, Sheldon Milstien§§, and Sarah Spiegel§¶¶ From the ‡Molecular Immunology and Inflammation Branch, NIAMS, National Institutes of Health, and the §§Laboratory of Cellular and Molecular Regulation, National Institute of Mental Health, Bethesda, Maryland 20892, the §Department of Biochemistry, Virginia Commonwealth University School of Medicine, Richmond, Virginia 23298-0614, the ʈDepartment of Molecular Genetics, National Institute of Neuroscience, Tokyo 187-8502, Japan, and the **Department of Molecular Biology, Scripps Research Institute, La Jolla, California 92037 Sphingosine 1-phosphate (S1P) is the ligand for a family mammals, has been linked to a wide spectrum of biological pro- of specific G protein-coupled receptors (GPCRs) that reg- cesses, among which cell growth, survival, and motility are prom- ulate a wide variety of important cellular functions, in- inent (1, 2). S1P is formed by sphingosine kinase (SphK), a highly cluding growth, survival, cytoskeletal rearrangements, conserved enzyme that is activated by numerous stimuli (1, 3). and cell motility. However, whether it also has an intra- The most well known actions of S1P are mediated by binding cellular function is still a matter of great debate.
    [Show full text]
  • Personal Information Professional Summary
    Personal Information Full Name: L. Ashley Cowart, Ph.D. Title: Professor, Director, Lipidomics Core Facility, Research Health Scientist Business Name: Virginia Commonwealth University Business Address: 1101 E. Marshall St., Sanger Hall 2-016A, Richmond, VA 23219 Phone: 804-827--791 Email: [email protected] Languages Spoken: English Professional Summary Primary Departmental Specialization Area/Field Lipid metabolism, signaling, and biology in the context of diabetes and related metabolic disorders Areas of Expertise and Interest lipid signaling sphingolipids ceramide sphingosine-1-phosphate enzyme kinetics membranes protein structure diabetes obesity non-alcoholic fatty liver disease diabetic cardiomyopathy adipose tissue adipogenesis insulin resistance obesity lipidomics Cowart, Lauren A. 1 of 21 lipid metabolism Education Post Graduate Postdoctoral Fellowship, Medical University of South Carolina, Charleston, SC, Biochemistry and Molecular Biology 08/2001 - 05/2005 Graduate Vanderbilt University, Nashville, TN, NOVEL PATHWAYS OF CYTOCHROME P450- MEDIATED ARACHIDONIC ACID BIOACTIVATION, Jorge H. Capdevila. 08/1995 - 12/2001 Undergraduate Furman University, Greenville, SC, Biology, B.S., 1995, 08/1991 - 05/1995 Academic Appointment History Professor, tenure track, Virginia Commonwealth University College of Medicine 11/2017 - Present Associate Professor with tenure, Medical University of South Carolina College of Medicine 01/2017 - 10/2017 Associate Professor, tenure track, Medical University of South Carolina College of Medicine 07/2014 - 12/2016 Assistant Professor, tenure track, Medical University of South Carolina College of Medicine 06/2009 - 06/2014 Assistant Professor, research track, Medical University of South Carolina College of Medicine 07/2005 - 05/2009 Employment History Research Health Scientist, McGuire Veterans Affairs Medical Center 11/2017 - Present Director, Lipidomics Shared Resource Facility, Virginia Commonwealth University College of Medicine 02/2018 (in progress) Cowart, Lauren A.
    [Show full text]
  • Sphingolipid Biology & Disease
    S P H I N G O N E T S U M M E R S C H O O L & W O R K S H O P Sphingolipid Biology & Disease Merton College Oxford, July 10-13, 2013 Organizing committee Fran Platt – UOXF | Tim Levine – UCL | Howard Riezman – UNIGE | Matthijs Kol - UOS | Joost Holthuis – UOS Funding www.sphingonet-itn.eu VENUE & PRACTICALITIES Merton College Merton St, Oxford OX1 4JD United Kingdom Phone: +44 1865 276310 Travel directions Google Maps See: www.merton.ox.ac.uk/aboutmerton/visitorinfo.shtmlhttps://maps.google.de/maps?oe=utf-8&client=firefox-a&ie.... A bus service called The Airline (http://airline.oxfordbus.co.uk) runs every 20 min from London Heathrow Airport. You can buy tickets on the bus or order online. Get off at the High Street Stop/Queens Lane. Merton College is very close Klik op de link "Afdrukken" naast de kaart om by (see below). alle details op het scherm weer te geven. Site map Merton College Kaartgegevens ©2013 Google - Wi-Fi Access at Merton 2 1 van 1 7/2/13 7:46 PM PROGRAM WEDNESDAY 10 JULY (Arrival) noon: arrival fellows 13:00 – 18:00 Wikipedia Workshop Fellows afternoon/evening: arrival PIs & external speakers 18:30 – 19:30 WELCOME RECEPTION (sparkling wine, welcome by Fran & Joost) 19:30 – 21:30 Dinner (Merton College) THURSDAY 11 JULY (Summer School Day 1) 08:45 – 09:00 INTRODUCTION / Fran Platt & Joost Holthuis 09:00 – 10:00 Lecture 1 / Thomas Kirkegaard - Orphazyme, from basic biology to biotech. Starting a biotech company in the new era.
    [Show full text]
  • Introduction
    introduction An introduction to the Journal of Lipid Research Thematic Series on lysophospholipids Jerold Chun , Editorial Board 1 Molecular and Cellular Neuroscience Department, Dorris Neuroscience Center, The Scripps Research Institute, La Jolla, CA 92037 It is a pleasure to introduce the latest JLR Thematic Se- Global Health and Medicine entitled “ Diversity and func- ries that will review the fi eld of lysophospholipids through tion of membrane glycerophospholipids generated by the Downloaded from a set of six reviews written by authoritative members of this remodeling pathway in mammalian cells. ” This review cov- fi eld. These reviews will introduce key concepts and up- ers important aspects in the generation of bioactive lipids date selected areas within this growing fi eld, particularly like LPA from the cell membrane. In the next month, we in those areas that have had signifi cant scientifi c and/or will continue an examination of glycerophospholipid de- medical impact. While not all areas of lysophospholipid rivatives through a major biosynthetic enzyme for LPA called www.jlr.org biology are discussed in this thematic series, these areas autotaxin (ENPP2), a lysophopholipase D that can remove are at least tangentially touched upon within the six reviews. choline from lysophosphatidylcholine to produce LPA. This The interested reader may delve more deeply through the important enzyme is reviewed by Wouter Moolenaar ’ s group primary literature cited within the reviews in topics such from the Netherlands Cancer Institute, in “ Autotaxin: at Kresge Library, The Scripps Research Institute, on May 7, 2015 as the enzymology of degradative pathways, nonvertebrate structure-function and signaling.” The next topic to be metabolism and activities, and possible nonreceptor actions covered will be from my group (Jerold Chun, series coor- of lysophospholipids that have appeared in the literature dinator, The Scripps Research Institute) that updates stud- and await confi rmation.
    [Show full text]