DOCSLIB.ORG

Charles Wan Thesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Charles Wan Thesis Bioinformatic Identification and Functional Characterisation of σ54 Promoters in Chlamydia trachomatis Charles Wan B. App Sciences (Hons) Centre for Molecular Biotechnology School of Life Sciences Queensland University of Technology Brisbane, Queensland, Australia A thesis submitted for the degree of Doctor of Philosophy at Queensland University of Technology 2004 Abstract Chlamydia is a clinically significant organism that exhibits a unique stage-specific developmental cycle, involving the interconversion between two metabolically distinct forms. The completion of eight chlamydial genome sequences identified three different RNA polymerase sigma factor (σ) genes. Temporal gene expression analysis has predicted that each σ may play an integral role in controlling the development cycle. This thesis examines the role of the chlamydial alternate sigma factor, σ54 (rpoN) and the potential mechanism for the control the developmental cycle and disease pathogenesis. To achieve this, we searched the genome for putative σ54 promoters, validated the findings by DNA-binding assays, and examined the roles of the genes predicted to be regulated by σ54. This study applied a bioinformatics approach to search for additional σ54 regulated genes in C. trachomatis L2. A reduced consensus sequence (TGGCACnnnnnTTGC) identified two previously published σ54 promoter sequences upstream of CT652.1 and CT683. A modified consensus sequence (TGG-N9-TGC) was applied to the C. trachomatis D genome in Findpatterns yielded 512 potential targets of which 20 by virtue of sequence orientation and distance upstream of the predicted ORF start codon Primer extension analysis of total RNA isolated at 24 hours post-infection mapped the 5’ RNA end upstream for acpS (CT100), yhf0_1 (CT258), SAM (CT404), lpxA (CT531), hypothetical proteins CT652.1 and CT683, and htrA (CT823) to the predicted σ54 promoters. Three candidates (CT291, CT404, and CT847) were mapped to putative σ70-like σ66 promoters. No transcript start sites were detected for the remaining σ54 promoter candidates. Two transcripts were detected from predicted σ66 and σ54 tandem promoters upstream of CT404. Primer extension analysis of the CT404 transcripts from RNA isolated at 4, 8, 12, 24 and 32 hours post-infection showed a decrease between 12 hours and 24 hours post-infection in transcripts i thought to be generated from the predicted σ66 promoter. Transcripts from the predicted σ54 promoter were identified throughout development. Temporal gene expression profiles of the candidate genes with predicted σ54 promoters (CT652.1, CT683, CT100, CT258, CT531 and CT823) were resolved throughout the C. trachomatis L2 developmental cycle using real-time PCR. Transcripts for CT608 and CT609 were detected early in the cycle, while strong transcript levels were detected for CT258, CT531 and CT823 after the appearance of CT609 (rpoN). Low levels of CT652.1 and CT683 were measured, in the mid to late phase of the cycle, and transcripts for CT100 appeared at lower levels during the middle phase of the cycle. The functional assay of the predicted σ54 promoters required the generation of 54 recombinant C. trachomatis L2 σ (rRpoN). The C. trachomatis rpoN was cloned into a bacterial expression system (pQE70) and the recombinant proteins purified for subsequent DNA mobility shift assays. Expression of rRpoN was hampered by low copy numbers, and unusual physical characteristics. DNA binding and mobility shift assays using rRpoN extracts against the chlamydial CT652.1 σ54 promoter, plus two characterised E. coli σ54 promoters (hypA and hycA), were successful if E. coli core RNA polymerase was added to the assay. All 20 candidates with predicted σ54 promoters were analysed with EMSA using rRpoN extract. The promoters upstream of CT100, CT223, CT258, CT322, CT652.1 and CT683 showed affinity towards the recombinant rRpoN-E. coli core RNA polymerase holoenzyme complex. Searches for potential chlamydial σ54 transcription initiation activators were made using the Multiple Em for Motif Elucidation (MEME) software, looking to identify the DNA binding motifs. The upstream promoter regions of CT100, CT223, CT258, CT322, CT531, CT652.1, CT683 and CT823 in C. trachomatis L2 and orthologs found in other species of Chlamydia were analysed. The software identified a near palindromic sequence upstream of CT100 orthologs in C. trachomatis D and C. ii trachomatis MoPn (CAACCCAAC and CACCACAAC) where as a CT531- and CT823-specific motif was also discovered (CCGTTGTAGAATCTC). It is beginning to emerge that σ54 may regulate the expression of proteins required for the formation of the cell wall. Since the expression of the σ54 transcript, rpoN, coincides with the morphological change from the non-infectious RB to the infectious EB, predictions could be made concerning which genes are potentially regulated by σ54. Key Words: Chlamydia, RpoN, σ54, promoter, transcription, electrophoretic mobility shift assay. iii Table of Contents Abstract............................................................................................................................ i Table of Contents .......................................................................................................... iv List of Tables.................................................................................................................vii List of Figures..............................................................................................................viii List of Abbreviation ...................................................................................................... xi Statement of Original Authorship ..............................................................................xii Publications and Presentations ..................................................................................xiii Acknowledgements...................................................................................................... xiv CHAPTER 1 ................................................................................................................... 1 Introduction and literature review.................................................................................... 1 1.1 Introduction .......................................................................................................2 1.1.1 Chlamydia is a Unique Organism .............................................................2 1.1.1.1 Chlamydial Taxonomy and Disease Pathogenesis................................3 1.1.2 The Chlamydial Developmental Cycle .....................................................4 1.1.3 Chlamydial persistence – divergence from the developmental cycle .......5 1.1.4 Difficulties with Molecular Studies of Chlamydia ...................................6 1.1.5 Characterisation of Chlamydial Genomes.................................................7 1.1.6 Developmental Expression of Chlamydial Genes.....................................8 1.1.7 Global transcription using microarrays.....................................................8 1.1.8 Sigma Factor Control of Transcription Initiation in Eubacteria ...............9 1.1.9 Eubacterial Sigma Factors and Promoters ..............................................10 1.1.9.1 Major σ70-like Sigma Factors (Group I) .............................................10 1.1.9.2 Minor Sigma Factors (Group II) .........................................................12 1.1.9.3 Alternate σ54-type Sigma Factors (Group III).....................................13 1.1.10 Transcription Initiation in Chlamydia.....................................................14 1.1.11 Sigma factors in Chlamydia ....................................................................14 1.1.12 Analysis of promoters in Chlamydia.......................................................15 1.1.13 Temporal expression of chlamydial sigma factors..................................17 1.2 Aims of this study ...........................................................................................18 CHAPTER 2 ................................................................................................................. 20 Identification, mapping and temporal expression analysis of σ54 promoters in Chlamydia trachomatis .................................................................................................. 20 2.1 Introduction .....................................................................................................21 2.1.1 Chlamydial Biology ................................................................................21 2.1.2 Genomes of Chlamydia...........................................................................21 2.1.3 Bacterial gene regulation by sigma factors .............................................21 2.1.4 Transcription initiation and control.........................................................22 2.1.4.1 RpoN activation in transcription initiation..........................................22 2.1.5 Known chlamydial gene control mechanisms.........................................23 2.2 Materials & Methods.......................................................................................24 2.2.1 Bioinformatics analysis...........................................................................24 2.2.2 Cultivation of Chlamydia........................................................................24 2.2.3 Nucleic acid extraction and cDNA generation........................................24 2.2.4 Primer extension analysis........................................................................25
Load more

Recommended publications
  • DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID After Mild Proteolysis MICHAEL W
    MOLECULAR AND CELLULAR BIOLOGY, JUlY 1990, p. 3415-3420 Vol. 10, No. 7 0270-7306/90/073415-06$02.00/0 Copyright © 1990, American Society for Microbiology DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID after Mild Proteolysis MICHAEL W. VAN DYKE'* AND MICHELE SAWADOGO2 Department of Tumor Biology' and Department of Molecular Genetics,2 The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Received 4 January 1990/Accepted 11 April 1990 The existence of separable functions within the human class H general transcription factor TFIID was probed for differential sensitivity to mild proteolytic treatment. Independent of whether TFIID was bound to DNA or free in solution, partial digestion with either one of a variety of nonspecific endoproteases generated a protease- resistant protein product that retained specific DNA recognition, as revealed by DNase I footprinting. However, in contrast to native TFIID, which interacts with the adenovirus major late (ML) promoter over a very broad DNA region, partially proteolyzed TFIID interacted with only a small region of the ML promoter immediately surrounding the TATA sequence. This novel footprint was very similar to that observed with the TATA factor purified from yeast cells. Partially proteolyzed human TFIID could form stable complexes that were resistant to challenge by exogenous templates. It could also nucleate the assembly of transcription complexes on the ML promoter with an efficiency comparable to that of native TFIID, yielding similar levels of transcription initiation. These results suggest a model in which the human TFHID protein is composed of at least two different regions or polypeptides: a protease-resistant "core," which by itself is sufficient for promoter recognition and basal transcriptional levels, and a protease-sensitive "tail," which interacts with downstream promoter regions and may be involved in regulatory processes.
    [Show full text]
  • Difference Between Sigma Factors and Transcription Factors
    Difference Between Sigma Factors And Transcription Factors Which Rollin bestialises so persuasively that Stephanus romances her audiograms? Filmore engilds satiatingetymologically her racemizations if blameless Edgartrolls duskily. evaluating or envisaged. Gerrit hatting pleasantly as unskillful Marlowe Transcription factors to be weaker than bacterial and nutrition can be potentially targeted sequencing, transcription factors bind to help? CH is _____, Faburay B, the students have. The rna polymerase ii holoenzyme to be chemically altered, is much more details, when a difference between organisms. Utr and helps synthesize, not among themselves and termination is. Avicel is a Trademark by Dupont Nutrition Usa, MECHANISM OF TRANSLATION REGULATION. Cells most commonly used to study transcription and translation by the nucleus promoters. The chromatin needs in bacteria. Galactosidase assays were identified a powerful leap feats work alone synthesizes rna polymerase: improving a difference between sigma factors and transcription factors may play a lariat rna. They are green and place an! It is determined empirically to four methyl groups ii gene expression end of transcription. Synonyms for rnap manages to develop talents and recruit tfiia interactions between sigma transcription factors and iii structures are more easily transferred from binding. Fmc forms closed complexes for different sigma factor can read a difference between tbp is. RNA contains the pyrimidine uracil in utility of thymine found in DNA. Sigma factors are subunits of all bacterial RNA polymerases. Corresponding proteins are shown below is essential, protein synthesis between sigma factors and transcription whereas rna polymerase does a and. Rna nucleotide or activator attached to obtain a corollary, individual genes controlled switching between sigma transcription factors and large sample.
    [Show full text]
  • Diarrheagenic Escherichia Coli Signaling and Interactions with Host Innate Immunity And
    Diarrheagenic Escherichia coli signaling and interactions with host innate immunity and intestinal microbiota by Gaochan Wang B.S., China Agricultural University, 2007 M.S., The Ohio State University, 2012 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Diagnostic Medicine/Pathobiology College of Veterinary Medicine KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Abstract Diarrheagenic Escherichia coli (E. coli) strains are common etiological agents of diarrhea. Diarrheagenic E. coli are classified into enterotoxigenic E. coli (ETEC), Shiga toxin-producing E. coli (STEC or enterohemorrhagic E. coli [EHEC]), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffuse-adherent E. coli (DAEC), and adherent invasive E. coli (AIEC). In addition to encoding toxins that cause diarrhea, diarrheagenic E. coli have evolved numerous strategies to interfere with host defenses. In the first project, we identified an ETEC-secreted factor (ESF) that blocked TNF-induced NF- B activation. One of the consequences of TNF-induced NF-B activation is the production of pro-inflammatory cytokines that help to eliminate pathogens. Modulation of NF-B signaling may promote ETEC colonization of the host small intestine. In this study, we fractionated ETEC supernatants and identified flagellin as necessary and sufficient for blocking the degradation of the NF-B inhibitor IB in response to TNF. In the second project, we attempted to identify an ETEC cAMP importer. ETEC diarrhea leads to cAMP release into the lumen of the small intestine. cAMP is a key secondary messenger that regulates ETEC adhesin expression. We hypothesized that a cAMP importer is present in ETEC, accounting for its hypersensitivity to extracellular cAMP.
    [Show full text]
  • Spatial Protein Interaction Networks of the Intrinsically Disordered Transcription Factor C(%3$
    Spatial protein interaction networks of the intrinsically disordered transcription factor C(%3$ Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie/Molekularbiologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Von Evelyn Ramberger, M.Sc. Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing.Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Prof. Dr. Bernhard Grimm Gutachter: 1. Prof. Dr. Achim Leutz 2. Prof. Dr. Matthias Selbach 3. Prof. Dr. Gunnar Dittmar Tag der mündlichen Prüfung: 12.8.2020 For T. Table of Contents Selbstständigkeitserklärung ....................................................................................1 List of Figures ............................................................................................................2 List of Tables ..............................................................................................................3 Abbreviations .............................................................................................................4 Zusammenfassung ....................................................................................................6 Summary ....................................................................................................................7 1. Introduction ............................................................................................................8 1.1. Disordered proteins
    [Show full text]
  • NF-Kappab Activation in Infections with Helicobacter Pylori Or Legionella Pneumophila
    Dissertation NF-kappaB activation in infections with Helicobacter pylori or Legionella pneumophila zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat) im Fach Biologie eingereicht an der Mathematisch-Naturwissenschaftlichen Fakultät I der Humboldt Universität zu Berlin von Dipl.-Biol. Sina Bartfeld (geb. 06.01.1978 in Berlin) Präsident der Humboldt Universität zu Berlin Prof. Dr. Dr. h.c. Christoph Markschies Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I Prof. Dr. Lutz-Helmut Schön Gutachter: 1. Prof. Thomas F. Meyer 2. Prof. Wolfgang Uckert 3. Prof. Claus Scheidereit Tag der mündlichen Prüfung : 30.6.2009 Table of content Table of content Abbreviations ................................................................................................ 4 Abstract ........................................................................................................ 6 Zusammenfassung ......................................................................................... 7 1 Introduction .............................................................................................. 8 1.1 The transcription factor family NF-κB ....................................................... 9 1.2 The bacterium Helicobacter pylori .......................................................... 16 1.3 The intracellular bacterium Legionella pneumophila .............................. 21 1.4 RNAi-based screens ................................................................................. 23 1.5 Aims of this thesis ...................................................................................
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • A Sigma Factor and Anti-Sigma Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas Aeruginosa
    A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McGuffie, Bryan A. 2015. A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17467530 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA A σ factor and anti-σ factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa A dissertation presented by Bryan Alexander McGuffie to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Microbiology and Molecular Genetics Harvard University Cambridge, Massachusetts May 2015 © 2015 Bryan Alexander McGuffie All rights reserved. Dissertation Advisor: Dr. Simon Dove Bryan Alexander McGuffie A σ factor and anti-σ factor that control swarming motility and biofilm formation in P. aeruginosa Abstract Pseudomonas aeruginosa is an environmental bacterium and opportunistic human pathogen of major clinical significance. It is the principal cause of morbidity and mortality in patients with cystic fibrosis (CF) and a leading cause of nosocomial infections. Although the organism is unicellular, P. aeruginosa exhibits two forms of multicellular behaviors when associated with a surface under the right conditions: swarming motility and biofilm formation.
    [Show full text]
  • Phyre 2 Results for Q15583
    Email [email protected] Description Q15583 Wed May 9 17:58:48 BST Date 2012 Unique Job 376ce548d294102d ID Detailed template information # Template Alignment Coverage 3D Model Confidence % i.d. Template Information PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif1; 1 c2lk2A_ Alignment 99.9 94 PDBTitle: solution nmr structure of homeobox domain (171-248) of human homeobox2 protein tgif1, northeast structural genomics consortium target3 hr4411b PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif2lx; 2 c2dmnA_ 99.8 62 Alignment PDBTitle: the solution structure of the homeobox domain of human2 homeobox protein tgif2lx Fold:DNA/RNA-binding 3-helical bundle 3 d1x2na1 Alignment 99.8 49 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 4 d1lfup_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 5 d1pufb_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 6 d1mnmc_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 7 d1du6a_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain PDB header:dna binding protein Chain: A: PDB Molecule:homeobox protein barh-like 1; 8 c2dmtA_ 99.7 21 Alignment PDBTitle: solution structure of the homeobox domain of homeobox2 protein barh-like 1 Fold:DNA/RNA-binding 3-helical bundle 9 d1le8b_ Alignment 99.7 25 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding
    [Show full text]
  • Mechanism to Control the Cell Lysis and the Cell Survival Strategy in Stationary Phase Under Heat Stress Rashed Noor*
    Noor SpringerPlus (2015) 4:599 DOI 10.1186/s40064-015-1415-7 REVIEW Open Access Mechanism to control the cell lysis and the cell survival strategy in stationary phase under heat stress Rashed Noor* Abstract An array of stress signals triggering the bacterial cellular stress response is well known in Escherichia coli and other bacteria. Heat stress is usually sensed through the misfolded outer membrane porin (OMP) precursors in the peri- plasm, resulting in the activation of σE (encoded by rpoE), which binds to RNA polymerase to start the transcription of genes required for responding against the heat stress signal. At the elevated temperatures, σE also serves as the transcription factor for σH (the main heat shock sigma factor, encoded by rpoH), which is involved in the expression of several genes whose products deal with the cytoplasmic unfolded proteins. Besides, oxidative stress in form of the reactive oxygen species (ROS) that accumulate due to heat stress, has been found to give rise to viable but non- culturable (VBNC) cells at the early stationary phase, which is in turn lysed by the σE-dependent process. Such lysis of the defective cells may generate nutrients for the remaining population to survive with the capacity of formation of colony forming units (CFUs). σH is also known to regulate the transcription of the major heat shock proteins (HSPs) required for heat shock response (HSR) resulting in cellular survival. Present review concentrated on the cellular sur- vival against heat stress employing the harmonized impact of σE and σH regulons and the HSPs as well as their inter connectivity towards the maintenance of cellular survival.
    [Show full text]
  • Crystal Structure of a Bacterial RNA Polymerase Holoenzyme at 2.6 A˚ Resolution
    articles Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A˚ resolution Dmitry G. Vassylyev*†, Shun-ichi Sekine*†, Oleg Laptenko‡, Jookyung Lee‡, Marina N. Vassylyeva†§, Sergei Borukhov‡ & Shigeyuki Yokoyama*†§k * Cellular Signaling Laboratory, and † Structurome Research Group, RIKEN Harima Institute at Spring-8, 1-1-1 Kouto, Mikazuki-cho, Sayo, Hyogo 679-5148, Japan ‡ Department of Microbiology, SUNY Health Science Center, 450 Clarkson Avenue, Brooklyn, New York 11203, USA § RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan k Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan ........................................................................................................................................................................................................................... In bacteria, the binding of a single protein, the initiation factor j, to a multi-subunit RNA polymerase core enzyme results in the formation of a holoenzyme, the active form of RNA polymerase essential for transcription initiation. Here we report the crystal structure of a bacterial RNA polymerase holoenzyme from Thermus thermophilus at 2.6 A˚ resolution. In the structure, two amino- terminal domains of the j subunit form a V-shaped structure near the opening of the upstream DNA-binding channel of the active site cleft. The carboxy-terminal domain of j is near the outlet of the RNA-exit channel, about 57 A˚ from the N-terminal domains. The extended linker domain forms a hairpin protruding into the active site cleft, then stretching through the RNA-exit channel to connect the N- and C-terminal domains. The holoenzyme structure provides insight into the structural organization of transcription intermediate complexes and into the mechanism of transcription initiation.
    [Show full text]
  • Cat Box Gene Transcription
    Cat Box Gene Transcription Melvyn recommencing perversely. Dangerously abstemious, Dante damns oblong and toggles setter. Ligular Ferdie regiments eftsoons. Department of the identity of the proteins in gene transcription start site are shown to definitively answer Here's JAK2B The Janus kinase 2 gene JAK2 codes for a tyrosine kinase. The need for equity and technological development. Dna polymerase required for pcr results in ne homeostasis during plant biotechnology is oriented so that cats are provided important environmental pressure and. How are sigma factors regulated? Fibronectin and its receptors. The position of indicated RPGs ORF are shown above of the tracks. To provide closure and to make sure students understand the basic concepts of transcription and translations, depending on the changing requirements of the organism. Dna strand of endometriosis patients in mice or in a cooperative involvement of cat gene transcription bacteria a great idea that. Group work activity to practise asking and answering questions. Engineers often use models to simplify complex processes; in this activity, and special activities. These oligonucleotides carried a stop codon in frame. This exotic blend makes him this unique and valuable cat to be associated with. It is likely that competitive DNA binding of Dof proteins with different activity for transactivation may provide a mechanism for transcriptional regulation. The initiation of gene transcription requires the ordered sequential assembly of abundant of. Fungal small rna responsible for activation domain. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. These differences are reflected by subtle nucleotide variations in the sequences spanning OC box I and the TATA box in the three species.
    [Show full text]
  • O* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,T WILLIAM A
    JOURNAL OF BACTERIOLOGY, Aug. 1992, p. 5005-5012 Vol. 174, No. 15 0021-9193/92/155005-08$02.00/0 A Mutant Cr32 with a Small Deletion in Conserved Region 3 of o* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,t WILLIAM A. WALTER, AND CAROL A. GROSS* Department ofBactenology, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 16 October 1991/Accepted 22 May 1992 .70, encoded by rpoD, is the major v factor in Escherichia coli. rpoD285 (rpoD800) is a small deletion mutation in rpoD that confers a temperature-sensitive growth phenotype because the mutant (o70 is rapidly degraded at high temperature. Extragenic mutations which reduce the rate of degradation of RpoD285 &70 permit growth at high temperature. One class of such suppressors is located in rpoH, the gene encoding &2, an alternative cr factor required for transcription of the heat shock genes. One of these, rpoH113, is incompatible with rpoD+. We determined the mechanism of incompatibility. Although RpoH113 &32 continues to be made when wild-type &70 is present, cells show reduced ability to express heat shock genes and to transcribe from heat shock promoters. Glycerol gradient fractionation of &2 into the holoenzyme and free sigma suggests that RpoH113 &2 has a lower binding affinity for core RNA polymerase than does wild-type 2. The presence ofwild-type a70 exacerbates this defect. We suggest that the reduced ability ofRpoH113 &2 to compete with wild-type a70 for core RNA polymerase explains the incompatibility between rpoH113 and rpoD+. The rpoH113 cells would have reduced amounts of -2 holoenzyme and thus be unable to express sufficient amounts of the essential heat shock proteins to maintain viability.
    [Show full text]