Supplementary Materials

Figure S1. SDS-PAGE analysis of the 2× purified HHPV4 particles with (A) Coomassie Brilliant Blue or (B) Sudan Black B staining. The peak fractions (nos. 4–6) of 20-60% sucrose gradient are shown (see Figure 3A). The major structural proteins, VP9 and VP11 are marked. Lipids are indicated with an arrow. Positions of the molecular mass standards are shown in kDa.

Figure S2. HHPV4 genome treated with nucleases or restriction enzymes, analysed in agarose gels stained with ethidium bromide. Molecular mass standards (kb) are shown on the left of each panel.

Figure S3. (A) Identified genes and predicted ORFs in the HHPV4 genome. ORFs are in the same colours as in Figure 5. GCCCA motifs identified on both strands are shown as green arrow heads. (B) HHPV4 genome sequences are represented as RY (the distribution of purine versus pyrimidine nucleotides), AT (adenine over thymine), GC (guanine over cytosine), and MK (amino bases (A and C) over keto bases (G and T)) disparity curves obtained using the Z-curve method (Ori- Finder 2 program (Luo et al., 2014)). Circles indicate the transition sites in the RY curve, which may correspond to the genome replication origin and terminus.

Figure S4. A putative HHPV4-like provirus in the genome of Haloarcula sp. K1. ORFs/genes are represented as arrows. ORFs/genes are numbered (gene numbers are in italics) and virion proteins (VPs) are marked for HHPV4. Similar ORFs/genes are in the same colour, and amino acid identities (%) of (putative) proteins are shown in between the sequences.

Table S1. HHPV4 virus purification statistics a. Titer In total (pfus) Recovery (%) (pfu/mL) Agar stock 1.7 × 1011 1.0 × 1014 100

PEG precipitated viruses 9.1 × 1012 9.6 × 1013 96

1 light scattering zone 1.1 × 1012 5.4 × 1013 54 (10-40 % sucrose gradient)

2 light scattering zone 5.6 × 1011 2.3 × 1013 23 (20 -60 % sucrose gradient)

13 13 Concentrated 2 purified 8.1 × 10 1.5 × 10 15 virus

a. purification of ~600 ml agar stock using HHPV4 buffer and a Sorvall AH629 rotor.

Table S2. Origin recognition box (ORB) sequences found with the Ori-Finder 2 program searching for patterns that are specific for Halobacteriaceae. Start-stop, nt p-valuea Matched sequence 2147–2128 4.3 × 10−4 CCTCCTTATTGTAAGAAGAA 3533–3514 6.7 × 10−5 CCCCTGCGTTTCTGGATGAA 4059–4040 2.1 × 10−4 CCACGGGGTTGCAGCTCGAA 4086–4067 3.7 × 10−5 GCTCTTGGTTTCATCTGAGG a. Statistical threshold (p-value) used for motifs search is 1E–03. The p- values are generated by FIMO pipeline, which is a tool in MEME suite (http://meme-suite.org/doc/fimo.html).

Table S3. HHPV4 predicted ORFs and identified genes. TMH/Cons. No of aa Aa Aa ORF/ ORF Domains/ Predicted Corresponding viral Directiona Start-Stop, nt GCb, % res./ MW, Calc. pId identityf similarity gene product signal pept./ function (putative) proteins kDac , % g, % coiled-coil(s)e putative SNJ2 ORF1 product ORF1 R 1038–1 58.7 345/39.6 5.64 -/yes/-/- Integrase 70.8 85.4 protein 1 (integrase) putative ORF2 F 1021–1386 56.6 121/13.5 9.98 -/-/-/- protein 2 putative PhiH1-like SNJ2 ORF4 product ORF3 F 1453–1779 52 108/12.1 4.56 -/yes/-/- 29.1 45.5 protein 3 repressor (phiH1-like repressor) SNJ2 ORF4 product putative PhiH1-like 30.6 41.8 ORF4 F 1797–2090 55.1 97/11.3 9.61 -/yes/-/- (phiH1-like repressor) protein 4 repressor BJ1 gp20 28 43 putative ORF5 F 2184–2300 41 38/4.4 4.14 -/-/-/- protein 5 putative Restriction HHPV3 putative protein ORF6 R 3431–2286 45.6 381/44.2 4.69 -/yes/-/yes 56.1 57.6 protein 6 endonuclease 15 putative HHPV3 putative protein ORF7h R 3853–3599 51.4 84/10.0 5.17 -/-/-/- 100 100 protein 7 16 putative HHPV3 putative protein ORF8 R 4418 –4089 38.8 109/12.6 4.06 -/-/-/- 100 100 protein 8 17 HHPV3 VP1 100 100 HRPV-3 VP1 27.1 41.6 HGPV-1 VP2 25 40.4 Internal HRPV-1 VP3 22.6 37.7 gene 9 F 4802–5260 60.6 VP9 152/15.6 4.06 4/ -/-/- membrane HHPV-1 VP3 18.8 31.8 protein HRPV-6 VP4 22.6 37.2 HRPV-2 VP4 20.9 35 HHPV-2 gp3 18.1 30.2 SNJ2 VP12 20.2 36.9 ORF10 F 5266–5496 66.2 VP10 76/7.7 4.76 1/-/-/- HHPV3 putative protein 2 100 100 HHPV3 VP3 100 100 HHPV-1 VP4 19.5 31 HRPV-6 VP5 20.1 32.2 gene 11 F 5493–7334 57.2 VP11 613/65.3 4.52 2/yes/yes/yes Spike protein HRPV-2 VP5 19.3 29.6 HRPV-1 VP4 23.7 37.9 HRPV-3 VP2 19.7 31.4

HGPV-1 VP4 22 35 His2 VP1 (gp29) 32.6 48.3 HHPV-2 gp4 22.4 37 SNJ2 VP13 21.7 34.2 HHPV3 putative protein 4 100 100 HHPV-1 ORF5 product 30.8 47.2 HRPV-6 ORF6 product 24.4 37.3 HRPV-2 ORF6 product 24.9 38.3 putative HRPV-1 ORF6 product 26.7 45.6 ORF12 F 7342–7893 63.4 183/19.2 4.46 1/yes/yes/- protein 12 HRPV-3 ORF3 product 25.8 41.9 HGPV-1 ORF5 product 21.4 31.6 His2 ORF30 product 19.1 32.2 HHPV-2 gp5 23.8 37.7 SNJ2 ORF14 product 24.1 40.2 HHPV3 putative protein 5 100 100 SNJ2 ORF15 product 36.2 53.2 HHPV-1 ORF6 product 20 33.8 HRPV-6 ORF7 product 22.7 38.6 putative HRPV-2 ORF7 product 23.9 39.8 ORF13 F 7890–8684 62.3 264/29.8 4.63 2/yes/-/- protein 13 HRPV-1 ORF7 product 24.4 37.8 HRPV-3 ORF4 product 36.3 51.4 HGPV-1 ORF6 product 18.4 30.4 His2 ORF31 product 19.9 34.6 HHPV2 gp6 19.3 34.5 HHPV3 putative protein 6 100 100 SNJ2 ORF17 product 40.3 56.8 HHPV-1 ORF7 product 20.5 33 HRPV-6 ORF8 product 23.9 37.2 putative HRPV-2 ORF8 product 22.4 35.2 ORF14 F 8677–9849 58.9 390/44.2 4.83 -/yes/-/- NTPase protein 14 HRPV-1 ORF8 product 19 31.9 HRPV-3 ORF5 product 47.9 65.2 HGPV-1 ORF7 product 22.8 38.4 His2 ORF33 product 30.7 47.3 HHPV2 gp7 20.4 33.8 putative ORF15 F 9846–10,013 61.9 55/6.1 6.03 -/-/-/- protein 15 10,010– putative HHPV3 pp7 78.3 90.7 ORF16 F 53.1 129/15.2 9.58 -/-/-/- 10,399 protein 16 SNJ2 ORF18 product 51.5 70 5

HRPV-3 ORF6 product 44.9 59.6 HGPV-1 ORF9 product 33.6 51.1 HHIV-2 putative protein 22.4 36.5 38 putative ORF17 F 10,500-11,465 38.6 321/36.3 4.62 2/-/-/- protein 17 putative ORF18 R 11,768-11,466 40.9 100/11.8 4.4 -/-/-/- protein 18 putative ORF19 R 12,171-11,752 44.8 139/15.6 6.27 -/-/-/- protein 19 HHPV3 putative protein 100 100 11 putative ORF20 R 14,209-12,446 61.6 587/67.6 5.04 -/-/-/yes SNJ2 ORF19 product 39.8 53.9 protein 20 HRPV-3 ORF9 product 25.4 41.5 HGPV-1 ORF14 product 27.3 41.8 putative HHPV3 putative protein ORF21 R 14,355-14,212 59 47/5.5 4.25 -/-/-/yes 100 100 protein 21 12 RNA polymerase putative sigma HHPV3 putative protein ORF22 R 14,549-14,352 63.1 65/7.2 6.18 -/yes/-/- 100 100 protein 22 factor, 13 sigma-70 family putative HHPV3 putative protein ORF23 R 14,734-14,546 61.4 62/7.1 4.67 -/-/-/- 100 100 protein 23 14 putative ORF24 R 15,008-14,769 55.8 79/8.8 11.5 -/-/-/- protein 24 a. F, forward; R, reverse. b. GC content. c. Number of amino acid residues and calculated molecular weight. d. Calculated isoelectric point. e. Predicted transmembrane helix(-ces)/conserved domain(s)/signal peptide(s)/coiled-coil region(s). f. Amino acid identity. g. Amino acid similarity. h. HHPV4 ORFs/genes that are 100% identical to the corresponding ORFs/genes of HHPV3 are highlighted with red.

Table S4. Putative conserved domains detected in the HHPV4 (putative) proteins. Protein Size, aaa Interval, aab Descriptionc Accessiond E-value 135–316 DNA breaking-rejoining enzymes, C-terminal catalytic domain cd00397 2.22E–07 24–97 Phage integrase, N-terminal SAM-like domain pfam02899 9.17E–07 127–319 Phage integrase family; pfam00589 5.99E–06 Putative protein 1 345 17–241 Tyrosine recombinase XerC TIGR02224 1.69E–08 17–178 Site-specific tyrosine recombinase XerC PRK00236 1.92E–06 25–177 Site-specific recombinase XerD COG4974 9.77E–06 15–56 MarR family (MarR proteins are involved in a non-specific resistance system) pfam12802 2.81E–05 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated 14–57 cd00090 2.99E–04 Putative protein 3 108 homodimeric repressors (helix-turn-helix bacterial transcription regulatory proteins) 14–94 Helix-turn-helix multiple antibiotic resistance protein smart00347 8.60E–08 14–85 DNA-binding transcriptional regulator, MarR family COG1846 5.95E–05 12–57 Winged helix-turn-helix DNA-binding proteins pfam13412 3.52E–03 Putative protein 4 97 12–72 Helix-turn-helix ASNC type smart00344 6.30E–03 12–51 DNA-binding transcriptional regulator, Lrp family COG1522 0.01 172–221 Dam-replacing family pfam06044 8.43E-18 276–329 HNH endonuclease pfam13391 2.08E-13 Putative protein 6 381 272–319 HNH nucleases smart00507 7.26E–05 273–319 HNH nucleases cd00085 8.35E–05 198–262 Domain of unknown function (DUF4404) pfam14357 0.05 VP11 613 202–267 Syntaxin N-terminal domain smart00503 2.70E–03

Putative protein 12 183 5–64 Domain of unknown function (DUF4366) pfam14283 7.66E–03 Putative protein 13 264 32–76 Putative ammonia monooxygenase pfam05145 0.01 Putative protein 14 390 134–262 AAA-ATPases associated with a variety of cellular activities smart00382 0.03 95–178 Protein of unknown function (DUF2393) pfam09624 0.01 Putative protein 17 321 71–112 Prolipoprotein diacylglyceryl transferase PRK12437 0.04 439–562 Exocyst complex component Sec10 pfam07393 0.03 Putative protein 20 587 425–566 Chromosome segregation protein PRK02224 0.03 13–64 DNA-binding transcriptional regulator, CsgD family COG2771 6.66E–06 14–64 Helix-turn-helix, Lux Regulon smart00421 1.21E–05 17–60 Sigma-70, region 4 pfam08281 3.99E–05 Putative protein 22 65 17–64 C-terminal DNA-binding domain of LuxR-like proteins cd06170 1.81E–03 14–60 RNA polymerase sigma factor, sigma-70 family TIGR02937 2.38E–05 14–59 DNA-directed RNA polymerase specialized sigma subunit, sigma24 family COG1595 2.99E–05 a. Total number of amino acid residues. b. Interval, amino acid residues. 7 c. All hits were found using BLASTp (Delta-BLAST), search dated 22.11.2016. E-value threshold is 0.05. d. Accession number in the NCBI’s conserved domain database.