DOCSLIB.ORG

Supplementary Materials

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Materials Supplementary Materials Figure S1. SDS-PAGE analysis of the 2× purified HHPV4 particles with (A) Coomassie Brilliant Blue or (B) Sudan Black B staining. The peak fractions (nos. 4–6) of 20-60% sucrose gradient are shown (see Figure 3A). The major structural proteins, VP9 and VP11 are marked. Lipids are indicated with an arrow. Positions of the molecular mass standards are shown in kDa. Figure S2. HHPV4 genome treated with nucleases or restriction enzymes, analysed in agarose gels stained with ethidium bromide. Molecular mass standards (kb) are shown on the left of each panel. 1 Figure S3. (A) Identified genes and predicted ORFs in the HHPV4 genome. ORFs are in the same colours as in Figure 5. GCCCA motifs identified on both strands are shown as green arrow heads. (B) HHPV4 genome sequences are represented as RY (the distribution of purine versus pyrimidine nucleotides), AT (adenine over thymine), GC (guanine over cytosine), and MK (amino bases (A and C) over keto bases (G and T)) disparity curves obtained using the Z-curve method (Ori- Finder 2 program (Luo et al., 2014)). Circles indicate the transition sites in the RY curve, which may correspond to the genome replication origin and terminus. Figure S4. A putative HHPV4-like provirus in the genome of Haloarcula sp. K1. ORFs/genes are represented as arrows. ORFs/genes are numbered (gene numbers are in italics) and virion proteins (VPs) are marked for HHPV4. Similar ORFs/genes are in the same colour, and amino acid identities (%) of (putative) proteins are shown in between the sequences. 2 Table S1. HHPV4 virus purification statistics a. Titer In total (pfus) Recovery (%) (pfu/mL) Agar stock 1.7 × 1011 1.0 × 1014 100 PEG precipitated viruses 9.1 × 1012 9.6 × 1013 96 1 light scattering zone 1.1 × 1012 5.4 × 1013 54 (10-40 % sucrose gradient) 2 light scattering zone 5.6 × 1011 2.3 × 1013 23 (20 -60 % sucrose gradient) 13 13 Concentrated 2 purified 8.1 × 10 1.5 × 10 15 virus a. purification of ~600 ml agar stock using HHPV4 buffer and a Sorvall AH629 rotor. Table S2. Origin recognition box (ORB) sequences found with the Ori-Finder 2 program searching for patterns that are specific for Halobacteriaceae. Start-stop, nt p-valuea Matched sequence 2147–2128 4.3 × 10−4 CCTCCTTATTGTAAGAAGAA 3533–3514 6.7 × 10−5 CCCCTGCGTTTCTGGATGAA 4059–4040 2.1 × 10−4 CCACGGGGTTGCAGCTCGAA 4086–4067 3.7 × 10−5 GCTCTTGGTTTCATCTGAGG a. Statistical threshold (p-value) used for motifs search is 1E–03. The p- values are generated by FIMO pipeline, which is a tool in MEME suite (http://meme-suite.org/doc/fimo.html). 3 Table S3. HHPV4 predicted ORFs and identified genes. TMH/Cons. No of aa Aa Aa ORF/ ORF Domains/ Predicted Corresponding viral Directiona Start-Stop, nt GCb, % res./ MW, Calc. pId identityf similarity gene product signal pept./ function (putative) proteins kDac , % g, % coiled-coil(s)e putative SNJ2 ORF1 product ORF1 R 1038–1 58.7 345/39.6 5.64 -/yes/-/- Integrase 70.8 85.4 protein 1 (integrase) putative ORF2 F 1021–1386 56.6 121/13.5 9.98 -/-/-/- protein 2 putative PhiH1-like SNJ2 ORF4 product ORF3 F 1453–1779 52 108/12.1 4.56 -/yes/-/- 29.1 45.5 protein 3 repressor (phiH1-like repressor) SNJ2 ORF4 product putative PhiH1-like 30.6 41.8 ORF4 F 1797–2090 55.1 97/11.3 9.61 -/yes/-/- (phiH1-like repressor) protein 4 repressor BJ1 gp20 28 43 putative ORF5 F 2184–2300 41 38/4.4 4.14 -/-/-/- protein 5 putative Restriction HHPV3 putative protein ORF6 R 3431–2286 45.6 381/44.2 4.69 -/yes/-/yes 56.1 57.6 protein 6 endonuclease 15 putative HHPV3 putative protein ORF7h R 3853–3599 51.4 84/10.0 5.17 -/-/-/- 100 100 protein 7 16 putative HHPV3 putative protein ORF8 R 4418 –4089 38.8 109/12.6 4.06 -/-/-/- 100 100 protein 8 17 HHPV3 VP1 100 100 HRPV-3 VP1 27.1 41.6 HGPV-1 VP2 25 40.4 Internal HRPV-1 VP3 22.6 37.7 gene 9 F 4802–5260 60.6 VP9 152/15.6 4.06 4/ -/-/- membrane HHPV-1 VP3 18.8 31.8 protein HRPV-6 VP4 22.6 37.2 HRPV-2 VP4 20.9 35 HHPV-2 gp3 18.1 30.2 SNJ2 VP12 20.2 36.9 ORF10 F 5266–5496 66.2 VP10 76/7.7 4.76 1/-/-/- HHPV3 putative protein 2 100 100 HHPV3 VP3 100 100 HHPV-1 VP4 19.5 31 HRPV-6 VP5 20.1 32.2 gene 11 F 5493–7334 57.2 VP11 613/65.3 4.52 2/yes/yes/yes Spike protein HRPV-2 VP5 19.3 29.6 HRPV-1 VP4 23.7 37.9 HRPV-3 VP2 19.7 31.4 4 HGPV-1 VP4 22 35 His2 VP1 (gp29) 32.6 48.3 HHPV-2 gp4 22.4 37 SNJ2 VP13 21.7 34.2 HHPV3 putative protein 4 100 100 HHPV-1 ORF5 product 30.8 47.2 HRPV-6 ORF6 product 24.4 37.3 HRPV-2 ORF6 product 24.9 38.3 putative HRPV-1 ORF6 product 26.7 45.6 ORF12 F 7342–7893 63.4 183/19.2 4.46 1/yes/yes/- protein 12 HRPV-3 ORF3 product 25.8 41.9 HGPV-1 ORF5 product 21.4 31.6 His2 ORF30 product 19.1 32.2 HHPV-2 gp5 23.8 37.7 SNJ2 ORF14 product 24.1 40.2 HHPV3 putative protein 5 100 100 SNJ2 ORF15 product 36.2 53.2 HHPV-1 ORF6 product 20 33.8 HRPV-6 ORF7 product 22.7 38.6 putative HRPV-2 ORF7 product 23.9 39.8 ORF13 F 7890–8684 62.3 264/29.8 4.63 2/yes/-/- protein 13 HRPV-1 ORF7 product 24.4 37.8 HRPV-3 ORF4 product 36.3 51.4 HGPV-1 ORF6 product 18.4 30.4 His2 ORF31 product 19.9 34.6 HHPV2 gp6 19.3 34.5 HHPV3 putative protein 6 100 100 SNJ2 ORF17 product 40.3 56.8 HHPV-1 ORF7 product 20.5 33 HRPV-6 ORF8 product 23.9 37.2 putative HRPV-2 ORF8 product 22.4 35.2 ORF14 F 8677–9849 58.9 390/44.2 4.83 -/yes/-/- NTPase protein 14 HRPV-1 ORF8 product 19 31.9 HRPV-3 ORF5 product 47.9 65.2 HGPV-1 ORF7 product 22.8 38.4 His2 ORF33 product 30.7 47.3 HHPV2 gp7 20.4 33.8 putative ORF15 F 9846–10,013 61.9 55/6.1 6.03 -/-/-/- protein 15 10,010– putative HHPV3 pp7 78.3 90.7 ORF16 F 53.1 129/15.2 9.58 -/-/-/- 10,399 protein 16 SNJ2 ORF18 product 51.5 70 5 HRPV-3 ORF6 product 44.9 59.6 HGPV-1 ORF9 product 33.6 51.1 HHIV-2 putative protein 22.4 36.5 38 putative ORF17 F 10,500-11,465 38.6 321/36.3 4.62 2/-/-/- protein 17 putative ORF18 R 11,768-11,466 40.9 100/11.8 4.4 -/-/-/- protein 18 putative ORF19 R 12,171-11,752 44.8 139/15.6 6.27 -/-/-/- protein 19 HHPV3 putative protein 100 100 11 putative ORF20 R 14,209-12,446 61.6 587/67.6 5.04 -/-/-/yes SNJ2 ORF19 product 39.8 53.9 protein 20 HRPV-3 ORF9 product 25.4 41.5 HGPV-1 ORF14 product 27.3 41.8 putative HHPV3 putative protein ORF21 R 14,355-14,212 59 47/5.5 4.25 -/-/-/yes 100 100 protein 21 12 RNA polymerase putative sigma HHPV3 putative protein ORF22 R 14,549-14,352 63.1 65/7.2 6.18 -/yes/-/- 100 100 protein 22 factor, 13 sigma-70 family putative HHPV3 putative protein ORF23 R 14,734-14,546 61.4 62/7.1 4.67 -/-/-/- 100 100 protein 23 14 putative ORF24 R 15,008-14,769 55.8 79/8.8 11.5 -/-/-/- protein 24 a. F, forward; R, reverse. b. GC content. c. Number of amino acid residues and calculated molecular weight. d. Calculated isoelectric point. e. Predicted transmembrane helix(-ces)/conserved domain(s)/signal peptide(s)/coiled-coil region(s). f. Amino acid identity. g. Amino acid similarity. h. HHPV4 ORFs/genes that are 100% identical to the corresponding ORFs/genes of HHPV3 are highlighted with red. 6 Table S4. Putative conserved domains detected in the HHPV4 (putative) proteins. Protein Size, aaa Interval, aab Descriptionc Accessiond E-value 135–316 DNA breaking-rejoining enzymes, C-terminal catalytic domain cd00397 2.22E–07 24–97 Phage integrase, N-terminal SAM-like domain pfam02899 9.17E–07 127–319 Phage integrase family; pfam00589 5.99E–06 Putative protein 1 345 17–241 Tyrosine recombinase XerC TIGR02224 1.69E–08 17–178 Site-specific tyrosine recombinase XerC PRK00236 1.92E–06 25–177 Site-specific recombinase XerD COG4974 9.77E–06 15–56 MarR family (MarR proteins are involved in a non-specific resistance system) pfam12802 2.81E–05 Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated 14–57 cd00090 2.99E–04 Putative protein 3 108 homodimeric repressors (helix-turn-helix bacterial transcription regulatory proteins) 14–94 Helix-turn-helix multiple antibiotic resistance protein smart00347 8.60E–08 14–85 DNA-binding transcriptional regulator, MarR family COG1846 5.95E–05 12–57 Winged helix-turn-helix DNA-binding proteins pfam13412 3.52E–03 Putative protein 4 97 12–72 Helix-turn-helix ASNC type smart00344 6.30E–03 12–51 DNA-binding transcriptional regulator, Lrp family COG1522 0.01 172–221 Dam-replacing family pfam06044 8.43E-18 276–329 HNH endonuclease pfam13391 2.08E-13 Putative protein 6 381 272–319 HNH nucleases smart00507 7.26E–05 273–319 HNH nucleases cd00085 8.35E–05 198–262 Domain of unknown function (DUF4404) pfam14357 0.05 VP11 613 202–267 Syntaxin N-terminal domain smart00503 2.70E–03 Putative protein 12 183 5–64 Domain of unknown function (DUF4366) pfam14283 7.66E–03 Putative protein 13 264 32–76 Putative ammonia monooxygenase pfam05145 0.01 Putative protein 14 390 134–262 AAA-ATPases associated with a variety of cellular activities smart00382 0.03 95–178 Protein of unknown function (DUF2393) pfam09624 0.01 Putative protein 17 321 71–112 Prolipoprotein diacylglyceryl transferase PRK12437 0.04 439–562 Exocyst complex component Sec10 pfam07393 0.03 Putative protein 20 587 425–566 Chromosome segregation protein PRK02224 0.03 13–64 DNA-binding transcriptional regulator, CsgD family COG2771 6.66E–06 14–64 Helix-turn-helix, Lux Regulon smart00421 1.21E–05 17–60 Sigma-70, region 4 pfam08281 3.99E–05 Putative protein 22 65 17–64 C-terminal DNA-binding domain of LuxR-like proteins cd06170 1.81E–03 14–60 RNA polymerase sigma factor, sigma-70 family TIGR02937 2.38E–05 14–59 DNA-directed RNA polymerase specialized sigma subunit, sigma24 family COG1595 2.99E–05 a.
Load more

Recommended publications
  • DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID After Mild Proteolysis MICHAEL W
    MOLECULAR AND CELLULAR BIOLOGY, JUlY 1990, p. 3415-3420 Vol. 10, No. 7 0270-7306/90/073415-06$02.00/0 Copyright © 1990, American Society for Microbiology DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID after Mild Proteolysis MICHAEL W. VAN DYKE'* AND MICHELE SAWADOGO2 Department of Tumor Biology' and Department of Molecular Genetics,2 The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Received 4 January 1990/Accepted 11 April 1990 The existence of separable functions within the human class H general transcription factor TFIID was probed for differential sensitivity to mild proteolytic treatment. Independent of whether TFIID was bound to DNA or free in solution, partial digestion with either one of a variety of nonspecific endoproteases generated a protease- resistant protein product that retained specific DNA recognition, as revealed by DNase I footprinting. However, in contrast to native TFIID, which interacts with the adenovirus major late (ML) promoter over a very broad DNA region, partially proteolyzed TFIID interacted with only a small region of the ML promoter immediately surrounding the TATA sequence. This novel footprint was very similar to that observed with the TATA factor purified from yeast cells. Partially proteolyzed human TFIID could form stable complexes that were resistant to challenge by exogenous templates. It could also nucleate the assembly of transcription complexes on the ML promoter with an efficiency comparable to that of native TFIID, yielding similar levels of transcription initiation. These results suggest a model in which the human TFHID protein is composed of at least two different regions or polypeptides: a protease-resistant "core," which by itself is sufficient for promoter recognition and basal transcriptional levels, and a protease-sensitive "tail," which interacts with downstream promoter regions and may be involved in regulatory processes.
    [Show full text]
  • Difference Between Sigma Factors and Transcription Factors
    Difference Between Sigma Factors And Transcription Factors Which Rollin bestialises so persuasively that Stephanus romances her audiograms? Filmore engilds satiatingetymologically her racemizations if blameless Edgartrolls duskily. evaluating or envisaged. Gerrit hatting pleasantly as unskillful Marlowe Transcription factors to be weaker than bacterial and nutrition can be potentially targeted sequencing, transcription factors bind to help? CH is _____, Faburay B, the students have. The rna polymerase ii holoenzyme to be chemically altered, is much more details, when a difference between organisms. Utr and helps synthesize, not among themselves and termination is. Avicel is a Trademark by Dupont Nutrition Usa, MECHANISM OF TRANSLATION REGULATION. Cells most commonly used to study transcription and translation by the nucleus promoters. The chromatin needs in bacteria. Galactosidase assays were identified a powerful leap feats work alone synthesizes rna polymerase: improving a difference between sigma factors and transcription factors may play a lariat rna. They are green and place an! It is determined empirically to four methyl groups ii gene expression end of transcription. Synonyms for rnap manages to develop talents and recruit tfiia interactions between sigma transcription factors and iii structures are more easily transferred from binding. Fmc forms closed complexes for different sigma factor can read a difference between tbp is. RNA contains the pyrimidine uracil in utility of thymine found in DNA. Sigma factors are subunits of all bacterial RNA polymerases. Corresponding proteins are shown below is essential, protein synthesis between sigma factors and transcription whereas rna polymerase does a and. Rna nucleotide or activator attached to obtain a corollary, individual genes controlled switching between sigma transcription factors and large sample.
    [Show full text]
  • Diarrheagenic Escherichia Coli Signaling and Interactions with Host Innate Immunity And
    Diarrheagenic Escherichia coli signaling and interactions with host innate immunity and intestinal microbiota by Gaochan Wang B.S., China Agricultural University, 2007 M.S., The Ohio State University, 2012 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Diagnostic Medicine/Pathobiology College of Veterinary Medicine KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Abstract Diarrheagenic Escherichia coli (E. coli) strains are common etiological agents of diarrhea. Diarrheagenic E. coli are classified into enterotoxigenic E. coli (ETEC), Shiga toxin-producing E. coli (STEC or enterohemorrhagic E. coli [EHEC]), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffuse-adherent E. coli (DAEC), and adherent invasive E. coli (AIEC). In addition to encoding toxins that cause diarrhea, diarrheagenic E. coli have evolved numerous strategies to interfere with host defenses. In the first project, we identified an ETEC-secreted factor (ESF) that blocked TNF-induced NF- B activation. One of the consequences of TNF-induced NF-B activation is the production of pro-inflammatory cytokines that help to eliminate pathogens. Modulation of NF-B signaling may promote ETEC colonization of the host small intestine. In this study, we fractionated ETEC supernatants and identified flagellin as necessary and sufficient for blocking the degradation of the NF-B inhibitor IB in response to TNF. In the second project, we attempted to identify an ETEC cAMP importer. ETEC diarrhea leads to cAMP release into the lumen of the small intestine. cAMP is a key secondary messenger that regulates ETEC adhesin expression. We hypothesized that a cAMP importer is present in ETEC, accounting for its hypersensitivity to extracellular cAMP.
    [Show full text]
  • Spatial Protein Interaction Networks of the Intrinsically Disordered Transcription Factor C(%3$
    Spatial protein interaction networks of the intrinsically disordered transcription factor C(%3$ Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie/Molekularbiologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Von Evelyn Ramberger, M.Sc. Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing.Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Prof. Dr. Bernhard Grimm Gutachter: 1. Prof. Dr. Achim Leutz 2. Prof. Dr. Matthias Selbach 3. Prof. Dr. Gunnar Dittmar Tag der mündlichen Prüfung: 12.8.2020 For T. Table of Contents Selbstständigkeitserklärung ....................................................................................1 List of Figures ............................................................................................................2 List of Tables ..............................................................................................................3 Abbreviations .............................................................................................................4 Zusammenfassung ....................................................................................................6 Summary ....................................................................................................................7 1. Introduction ............................................................................................................8 1.1. Disordered proteins
    [Show full text]
  • NF-Kappab Activation in Infections with Helicobacter Pylori Or Legionella Pneumophila
    Dissertation NF-kappaB activation in infections with Helicobacter pylori or Legionella pneumophila zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat) im Fach Biologie eingereicht an der Mathematisch-Naturwissenschaftlichen Fakultät I der Humboldt Universität zu Berlin von Dipl.-Biol. Sina Bartfeld (geb. 06.01.1978 in Berlin) Präsident der Humboldt Universität zu Berlin Prof. Dr. Dr. h.c. Christoph Markschies Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I Prof. Dr. Lutz-Helmut Schön Gutachter: 1. Prof. Thomas F. Meyer 2. Prof. Wolfgang Uckert 3. Prof. Claus Scheidereit Tag der mündlichen Prüfung : 30.6.2009 Table of content Table of content Abbreviations ................................................................................................ 4 Abstract ........................................................................................................ 6 Zusammenfassung ......................................................................................... 7 1 Introduction .............................................................................................. 8 1.1 The transcription factor family NF-κB ....................................................... 9 1.2 The bacterium Helicobacter pylori .......................................................... 16 1.3 The intracellular bacterium Legionella pneumophila .............................. 21 1.4 RNAi-based screens ................................................................................. 23 1.5 Aims of this thesis ...................................................................................
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • A Sigma Factor and Anti-Sigma Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas Aeruginosa
    A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McGuffie, Bryan A. 2015. A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17467530 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA A σ factor and anti-σ factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa A dissertation presented by Bryan Alexander McGuffie to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Microbiology and Molecular Genetics Harvard University Cambridge, Massachusetts May 2015 © 2015 Bryan Alexander McGuffie All rights reserved. Dissertation Advisor: Dr. Simon Dove Bryan Alexander McGuffie A σ factor and anti-σ factor that control swarming motility and biofilm formation in P. aeruginosa Abstract Pseudomonas aeruginosa is an environmental bacterium and opportunistic human pathogen of major clinical significance. It is the principal cause of morbidity and mortality in patients with cystic fibrosis (CF) and a leading cause of nosocomial infections. Although the organism is unicellular, P. aeruginosa exhibits two forms of multicellular behaviors when associated with a surface under the right conditions: swarming motility and biofilm formation.
    [Show full text]
  • Phyre 2 Results for Q15583
    Email [email protected] Description Q15583 Wed May 9 17:58:48 BST Date 2012 Unique Job 376ce548d294102d ID Detailed template information # Template Alignment Coverage 3D Model Confidence % i.d. Template Information PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif1; 1 c2lk2A_ Alignment 99.9 94 PDBTitle: solution nmr structure of homeobox domain (171-248) of human homeobox2 protein tgif1, northeast structural genomics consortium target3 hr4411b PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif2lx; 2 c2dmnA_ 99.8 62 Alignment PDBTitle: the solution structure of the homeobox domain of human2 homeobox protein tgif2lx Fold:DNA/RNA-binding 3-helical bundle 3 d1x2na1 Alignment 99.8 49 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 4 d1lfup_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 5 d1pufb_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 6 d1mnmc_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 7 d1du6a_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain PDB header:dna binding protein Chain: A: PDB Molecule:homeobox protein barh-like 1; 8 c2dmtA_ 99.7 21 Alignment PDBTitle: solution structure of the homeobox domain of homeobox2 protein barh-like 1 Fold:DNA/RNA-binding 3-helical bundle 9 d1le8b_ Alignment 99.7 25 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding
    [Show full text]
  • Mechanism to Control the Cell Lysis and the Cell Survival Strategy in Stationary Phase Under Heat Stress Rashed Noor*
    Noor SpringerPlus (2015) 4:599 DOI 10.1186/s40064-015-1415-7 REVIEW Open Access Mechanism to control the cell lysis and the cell survival strategy in stationary phase under heat stress Rashed Noor* Abstract An array of stress signals triggering the bacterial cellular stress response is well known in Escherichia coli and other bacteria. Heat stress is usually sensed through the misfolded outer membrane porin (OMP) precursors in the peri- plasm, resulting in the activation of σE (encoded by rpoE), which binds to RNA polymerase to start the transcription of genes required for responding against the heat stress signal. At the elevated temperatures, σE also serves as the transcription factor for σH (the main heat shock sigma factor, encoded by rpoH), which is involved in the expression of several genes whose products deal with the cytoplasmic unfolded proteins. Besides, oxidative stress in form of the reactive oxygen species (ROS) that accumulate due to heat stress, has been found to give rise to viable but non- culturable (VBNC) cells at the early stationary phase, which is in turn lysed by the σE-dependent process. Such lysis of the defective cells may generate nutrients for the remaining population to survive with the capacity of formation of colony forming units (CFUs). σH is also known to regulate the transcription of the major heat shock proteins (HSPs) required for heat shock response (HSR) resulting in cellular survival. Present review concentrated on the cellular sur- vival against heat stress employing the harmonized impact of σE and σH regulons and the HSPs as well as their inter connectivity towards the maintenance of cellular survival.
    [Show full text]
  • Crystal Structure of a Bacterial RNA Polymerase Holoenzyme at 2.6 A˚ Resolution
    articles Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A˚ resolution Dmitry G. Vassylyev*†, Shun-ichi Sekine*†, Oleg Laptenko‡, Jookyung Lee‡, Marina N. Vassylyeva†§, Sergei Borukhov‡ & Shigeyuki Yokoyama*†§k * Cellular Signaling Laboratory, and † Structurome Research Group, RIKEN Harima Institute at Spring-8, 1-1-1 Kouto, Mikazuki-cho, Sayo, Hyogo 679-5148, Japan ‡ Department of Microbiology, SUNY Health Science Center, 450 Clarkson Avenue, Brooklyn, New York 11203, USA § RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan k Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan ........................................................................................................................................................................................................................... In bacteria, the binding of a single protein, the initiation factor j, to a multi-subunit RNA polymerase core enzyme results in the formation of a holoenzyme, the active form of RNA polymerase essential for transcription initiation. Here we report the crystal structure of a bacterial RNA polymerase holoenzyme from Thermus thermophilus at 2.6 A˚ resolution. In the structure, two amino- terminal domains of the j subunit form a V-shaped structure near the opening of the upstream DNA-binding channel of the active site cleft. The carboxy-terminal domain of j is near the outlet of the RNA-exit channel, about 57 A˚ from the N-terminal domains. The extended linker domain forms a hairpin protruding into the active site cleft, then stretching through the RNA-exit channel to connect the N- and C-terminal domains. The holoenzyme structure provides insight into the structural organization of transcription intermediate complexes and into the mechanism of transcription initiation.
    [Show full text]
  • Cat Box Gene Transcription
    Cat Box Gene Transcription Melvyn recommencing perversely. Dangerously abstemious, Dante damns oblong and toggles setter. Ligular Ferdie regiments eftsoons. Department of the identity of the proteins in gene transcription start site are shown to definitively answer Here's JAK2B The Janus kinase 2 gene JAK2 codes for a tyrosine kinase. The need for equity and technological development. Dna polymerase required for pcr results in ne homeostasis during plant biotechnology is oriented so that cats are provided important environmental pressure and. How are sigma factors regulated? Fibronectin and its receptors. The position of indicated RPGs ORF are shown above of the tracks. To provide closure and to make sure students understand the basic concepts of transcription and translations, depending on the changing requirements of the organism. Dna strand of endometriosis patients in mice or in a cooperative involvement of cat gene transcription bacteria a great idea that. Group work activity to practise asking and answering questions. Engineers often use models to simplify complex processes; in this activity, and special activities. These oligonucleotides carried a stop codon in frame. This exotic blend makes him this unique and valuable cat to be associated with. It is likely that competitive DNA binding of Dof proteins with different activity for transactivation may provide a mechanism for transcriptional regulation. The initiation of gene transcription requires the ordered sequential assembly of abundant of. Fungal small rna responsible for activation domain. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. These differences are reflected by subtle nucleotide variations in the sequences spanning OC box I and the TATA box in the three species.
    [Show full text]
  • O* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,T WILLIAM A
    JOURNAL OF BACTERIOLOGY, Aug. 1992, p. 5005-5012 Vol. 174, No. 15 0021-9193/92/155005-08$02.00/0 A Mutant Cr32 with a Small Deletion in Conserved Region 3 of o* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,t WILLIAM A. WALTER, AND CAROL A. GROSS* Department ofBactenology, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 16 October 1991/Accepted 22 May 1992 .70, encoded by rpoD, is the major v factor in Escherichia coli. rpoD285 (rpoD800) is a small deletion mutation in rpoD that confers a temperature-sensitive growth phenotype because the mutant (o70 is rapidly degraded at high temperature. Extragenic mutations which reduce the rate of degradation of RpoD285 &70 permit growth at high temperature. One class of such suppressors is located in rpoH, the gene encoding &2, an alternative cr factor required for transcription of the heat shock genes. One of these, rpoH113, is incompatible with rpoD+. We determined the mechanism of incompatibility. Although RpoH113 &32 continues to be made when wild-type &70 is present, cells show reduced ability to express heat shock genes and to transcribe from heat shock promoters. Glycerol gradient fractionation of &2 into the holoenzyme and free sigma suggests that RpoH113 &2 has a lower binding affinity for core RNA polymerase than does wild-type 2. The presence ofwild-type a70 exacerbates this defect. We suggest that the reduced ability ofRpoH113 &2 to compete with wild-type a70 for core RNA polymerase explains the incompatibility between rpoH113 and rpoD+. The rpoH113 cells would have reduced amounts of -2 holoenzyme and thus be unable to express sufficient amounts of the essential heat shock proteins to maintain viability.
    [Show full text]