DOCSLIB.ORG

Respiratory Failure, Cleft Palate and Epilepsy in the Mouse Model of Human Xq22.1 Deletion Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Respiratory Failure, Cleft Palate and Epilepsy in the Mouse Model of Human Xq22.1 Deletion Syndrome HMG Advance Access published March 5, 2014 Human Molecular Genetics, 2014 1–7 doi:10.1093/hmg/ddu095 Respiratory failure, cleft palate and epilepsy in the mouse model of human Xq22.1 deletion syndrome Jian Zhou1, Ethan M. Goldberg2, N. Adrian Leu1, Lei Zhou2, Douglas A. Coulter2 and P. Jeremy Wang1,∗ 1Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, 3800 Spruce Street, Philadelphia, PA 19104, USA and 2The Children’s Hospital of Philadelphia, Division of Neurology, Colket Translational Research Building, 3501 Civic Center Boulevard, Philadelphia, PA 19104-4399, USA Downloaded from Received December 30, 2013; Revised and Accepted February 20, 2014 Chromosomal segmental deletion is a frequent cause of human diseases. A familial 1.1 Mb deletion of human chromosome Xq22.1 associates with epilepsy, cleft palate and developmental defects in heterozygous female http://hmg.oxfordjournals.org/ patients. Here, we describe a mouse mutant with a targeted deletion of the syntenic segment of the mouse X chromosome that phenocopies the human syndrome. Male mice with a deletion of a 1.1 Mb Nxf2–Nxf3 X- chromosomal segment exhibit respiratory failure, neonatal lethality and cleft palate. In female mice, heterozy- gosity for the deletion manifests cleft palate, early postnatal lethality, postnatal growth delay and spontaneous seizures in surviving animals, apparently due to X-chromosome inactivation. Furthermore, loss of a 0.35 Mb sub- region containing Armcx5, Gprasp1, Gprasp2 and Bhlhb9 is sufficient to cause the Xq22.1 syndrome phenotype. Our results support that the 1.1 Mb deletion of human Xq22.1 is the genetic cause of the associated syndrome. at University of Pennsylvania Libraries on April 8, 2014 INTRODUCTION section of Xq22.1 affected by the deletion contains 13 annotated genes, including NXF5. Mutations of this gene have been previ- Medical cytogenetics and array comparative genomic hybridiza- ously associated with mental retardation (4–6). A causal rela- tion (array-CGH) have identified a number of microdeletions of tionship between loss of the Xq22.1 region and phenotypic human chromosomes as common causes of genetic diseases. manifestations in human patients remains to be established and These regions of segmental deletions, usually a few mega the potential role of each of the 13 candidate genes remains to bases, often harbor multiple genes such that their loss could be determined. Here, we report the generation of mice with a lead to haploinsufficiency syndromes. The 22q11 deletion syn- 1.1 Mb deletion syntenic to the human Xq22.1 deletion. Mice drome (DiGeorge/velocardiofacial syndrome), caused by a with this deletion exhibit respiratory failure, cleft palate and epi- 3 Mb deletion, is the most common human microdeletion syn- lepsy, phenocopying the human syndrome. Deletion of a drome, occurring in 1:4000 live births (1, 2). Complementing 0.35 Mb subregion containing Armcx5, Gprasp1, Gprasp2 and studies of human patients, the generation of corresponding Bhlhb9 causes the same phenotype, identifying these as critical animal models can greatly facilitate the understanding of the candidate genes. pathogenesis of these complex syndromes, elucidate gene-to- phenotype relationships and identify causative genes. Genetic engineering of large chromosomal segmental deletions remains RESULTS challenging but has become increasingly feasible. Loss of a 1.1 Mb region of chromosome Xq22.1 is associated Respiratory failure and neonatal lethality in DelA/Y males with epilepsy, mental retardation and various developmental A 1.1 Mb region (Nxf2–Nxf3) on the mouse X chromosome is defects including cleft palate in heterozygous female patients syntenic to the 1.1 Mb region deleted in human patients with (3). The severity of symptoms differed between females affected the Xq22.1 syndrome (Fig. 1A). We previously generated a tar- by the deletion, and a male offspring of a heterozygous female geted allele [Del(XNxf2–Nxf3)1Jw] in which the Nxf2–Nxf3 died 15 days after birth due to a breathing failure. The 1.1 Mb segment is flanked by loxP sites (Fig. 1A) (7). We crossed ∗To whom correspondence should be addressed at: Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, 3800 Spruce Street, Philadelphia, PA 19104, USA. Tel: +1 2157460160; Fax: +1 2155735188; Email: [email protected] # The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected] 2 Human Molecular Genetics, 2014 Downloaded from http://hmg.oxfordjournals.org/ at University of Pennsylvania Libraries on April 8, 2014 Figure 1. Deletion mapping analysis of the critical interval on the X chromosome. (A) Schematic representation of the human Xq22.1 segment, the syntenic region on mouse X chromosome after targeted insertion of loxP sites, and the floxed and deletion alleles generated in this study. Dashed lines connect orthologous genes between mouse and human. Deletions on the mouse X chromosome (DelA, DelB and DelC; designated by dashed lines) were obtained by crossing mice carrying the respective floxed allele with Actb-Cre mice that ubiquitously express Cre recombinase (8). All loxP sites are in the same orientation, and in each deletion allele (deletion size indicated in brackets), only one loxP site is left. (B) Western blot analysis of GPRASP1/2 in DelA mutant brain at E16.5. (C) Western blot analysis of GPRASP1/2 in DelC mutant brain at E18.5. ACTB serves as a loading control. Note that the antibody recognizes both GPRASP1 and GPRASP2 (15). these mice with ubiquitously expressing Actb-Cre mice (8)to DelA/Y male pups examined developed asphyxia and died im- delete the 1.1 Mb Nxf2–Nxf3 segment, here referred to as mediately after delivery, indicating acute respiratory failure DelA (Fig. 1A). The DelA allele caused neonatal lethality in (Fig. 2A). all (DelA/Y) male pups. The observation that DelA/Y males Alveolarization, the formation of the alveolar gas exchange develop to term suggests that none of the 20 genes in the DelA unit, is one of the most critical steps during lung development, region are essential for early embryogenesis (Fig. 1A). and begins at E16.5 in the mouse (9). Histological analysis of Western blot analysis demonstrated absence of GPRASP1 and fetal stage (E16.5–E18.5) lungs (Fig. 2B–D) revealed no mor- GPRASP2 proteins (encoded by this region) in DelA/Y male phological difference between the lungs of wild-type (XY) and brain and reduced levels in DelA/+ female brain, indicating mutant (DelA/Y) mice at E16.5. However, from E17.5 that the deletion was complete (Fig. 1B). To determine the onward, lung development was significantly delayed in mutant cause of neonatal lethality in male mutant mice, we examined compared with wild-type mice. Wild-type lungs exhibited embryonic Day 18.5 (E18.5) embryos delivered by cesarean normal progression in the development of sac-like structures section. All wild-type E18.5 pups except one (13 of 14) breathed and septae. In contrast, mutant lungs developed less septation normally after delivery and were viable. However, all 11 E18.5 with thicker interstitial mesenchymal walls. Severe pulmonary Human Molecular Genetics, 2014 3 Downloaded from http://hmg.oxfordjournals.org/ Figure 3. Cleft palate in DelA/Y male embryos. (A) View of the palate from E18.5 wild-type and DelA/Y male embryos. (B and C) Hematoxylin and eosin stained coronal sections through the palate and oral cavity. Genotypes: WT, + /Y; DelA/Y, 2/Y. Abbreviations: c, cranial base; m, Meckel’s cartilage; nc, at University of Pennsylvania Libraries on April 8, 2014 nasal cavity; pp, primary palate; ps, palatal shelf; t, tongue. Table 1. Comparison of developmental defects among three mouse mutants with deletions in the syntenic region to human Xq22.1 Figure 2. Lung dysplasia in DelA/Y male embryos. (A) Asphyxia in E18.5 DelA/ Y male pups. Wild-type pups breathed normally. Pups were delivered at E18.5 by Deletion Respiratory Cleft palate Cleft palate Epilepsy in cesareansection.(B–D) Histological analysisof lungfromembryosatE16.5 (B), allele failure in 2/Y in 2/Y in +/2 +/2 females E17.5 (C) and E18.5 (D). Lung sections were stained with hematoxylin and eosin. neonates males females (handling) Genotypes: WT, +/Y; DelA/Y, 2/Y. (E18.5) (E18.5) DelA 11/11a 20/20 3/21 30/35 DelB None None None None hypoplasia may therefore account for the acute respiratory DelC 8/8 37/37 1/56 9/12 failure at birth in DelA/Y male embryos. aNumber of mice with the defect over the total number of mice examined. Cleft palate in DelA/Y males and DelA/1 females The palate separates the oral cavity from the nasal cavity and consists of the primary palate (bony hard plate) and the second- Partial postnatal lethality in juvenile DelA/1 females ary palate (muscular soft palate) (10). The secondary palate is formed by fusion of two palatal shelves. In the mouse, palatogen- All DelA/Y males died immediately after birth, whereas het- esis is initiated at E11.5 and fusion of the palatal shelves normal- erozygous DelA/+ females were viable at birth. However, ly completed by E15.5. At E18.5, all 20 DelA/Y male pups the majority of DelA/+ heterozygous females died post- displayed complete cleft palate (Fig. 3A). Palatal shelves were natally prior to weaning (Fig. 4A). We determined the survival formed in DelA/Y embryos at E13.5 (Fig. 3B), similar to those rate of DelA/+ females and wild-type female littermates. present in wild type. At E15.5, the palatal shelves were fused None of 31 wild-type females died during a 4-week observa- in wild-type embryos but remained separate without any sign tion period. In contrast, 45% (22 of 49) of DelA/+ viable of fusion in DelA/Y fetuses (Fig.
Load more

Recommended publications
  • Escape from X Chromosome Inactivation Is an Intrinsic Property of the Jarid1c Locus
    Escape from X chromosome inactivation is an intrinsic property of the Jarid1c locus Nan Lia,b and Laura Carrela,1 aDepartment of Biochemistry and Molecular Biology and bIntercollege Graduate Program in Genetics, Pennsylvania State College of Medicine, Hershey, PA 17033 Edited by Stanley M. Gartler, University of Washington, Seattle, WA, and approved September 23, 2008 (received for review August 8, 2008) Although most genes on one X chromosome in mammalian fe- Sequences on the X are hypothesized to propagate XCI (12) and males are silenced by X inactivation, some ‘‘escape’’ X inactivation to be depleted at escape genes (8, 9). LINE-1 repeats fit such and are expressed from both active and inactive Xs. How these predictions, particularly on the human X (8–10). Distinct dis- escape genes are transcribed from a largely inactivated chromo- tributions of other repeats classify some mouse X genes (5). some is not fully understood, but underlying genomic sequences X-linked transgenes also test the role of genomic sequences in are likely involved. We developed a transgene approach to ask escape gene expression. Most transgenes are X-inactivated, whether an escape locus is autonomous or is instead influenced by although a number escape XCI (e.g., refs. 13 and 14). Such X chromosome location. Two BACs carrying the mouse Jarid1c gene transgene studies indicate that, in addition to CTCF (6), locus and adjacent X-inactivated transcripts were randomly integrated control regions and matrix attachment sites are also not suffi- into mouse XX embryonic stem cells. Four lines with single-copy, cient to escape XCI (15, 16).
    [Show full text]
  • Nuclear Organization and the Epigenetic Landscape of the Mus Musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-9-2019 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Liu, Alicia, "Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome" (2019). Doctoral Dissertations. 2273. https://opencommons.uconn.edu/dissertations/2273 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia J. Liu, Ph.D. University of Connecticut, 2019 ABSTRACT X-linked imprinted genes have been hypothesized to contribute parent-of-origin influences on social cognition. A cluster of imprinted genes Xlr3b, Xlr4b, and Xlr4c, implicated in cognitive defects, are maternally expressed and paternally silent in the murine brain. These genes defy classic mechanisms of autosomal imprinting, suggesting a novel method of imprinted gene regulation. Using Xlr3b and Xlr4c as bait, this study uses 4C-Seq on neonatal whole brain of a 39,XO mouse model, to provide the first in-depth analysis of chromatin dynamics surrounding an imprinted locus on the X-chromosome. Significant differences in long-range contacts exist be- tween XM and XP monosomic samples. In addition, XM interaction profiles contact a greater number of genes linked to cognitive impairment, abnormality of the nervous system, and abnormality of higher mental function. This is not a pattern that is unique to the imprinted Xlr3/4 locus. Additional Alicia J. Liu - University of Connecticut - 2019 4C-Seq experiments show that other genes on the X-chromosome, implicated in intellectual disability and/or ASD, also produce more maternal contacts to other X-linked genes linked to cognitive impairment.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Non-Synonymous Mutations Mapped to Chromosome X Associated With
    de Camargo et al. BMC Genomics (2015) 16:384 DOI 10.1186/s12864-015-1595-0 RESEARCH ARTICLE Open Access Non-synonymous mutations mapped to chromosome X associated with andrological and growth traits in beef cattle Gregório Miguel Ferreira de Camargo1,2,3, Laercio R Porto-Neto2, Matthew J Kelly3, Rowan J Bunch2, Sean M McWilliam2, Humberto Tonhati1, Sigrid A Lehnert2, Marina R S Fortes3* and Stephen S Moore4 Abstract Background: Previous genome-wide association analyses identified QTL regions in the X chromosome for percentage of normal sperm and scrotal circumference in Brahman and Tropical Composite cattle. These traits are important to be studied because they are indicators of male fertility and are correlated with female sexual precocity and reproductive longevity. The aim was to investigate candidate genes in these regions and to identify putative causative mutations that influence these traits. In addition, we tested the identified mutations for female fertility and growth traits. Results: Using a combination of bioinformatics and molecular assay technology, twelve non-synonymous SNPs in eleven genes were genotyped in a cattle population. Three and nine SNPs explained more than 1% of the additive genetic variance for percentage of normal sperm and scrotal circumference, respectively. The SNPs that had a major influence in percentage of normal sperm were mapped to LOC100138021 and TAF7L genes; and in TEX11 and AR genes for scrotal circumference. One SNP in TEX11 was explained ~13% of the additive genetic variance for scrotal circumference at 12 months. The tested SNP were also associated with weight measurements, but not with female fertility traits.
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Implication of PIWI Interacting Rnas Karine Casier, Antoine Boivin, Clément Carré, Laure Teysset
    Environmentally-Induced Transgenerational Epigenetic Inheritance: Implication of PIWI Interacting RNAs Karine Casier, Antoine Boivin, Clément Carré, Laure Teysset To cite this version: Karine Casier, Antoine Boivin, Clément Carré, Laure Teysset. Environmentally-Induced Transgen- erational Epigenetic Inheritance: Implication of PIWI Interacting RNAs. Cells, MDPI, 2019, 8 (9), pp.1108. 10.3390/cells8091108. hal-02344602 HAL Id: hal-02344602 https://hal.sorbonne-universite.fr/hal-02344602 Submitted on 4 Nov 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. cells Review Environmentally-Induced Transgenerational Epigenetic Inheritance: Implication of PIWI Interacting RNAs Karine Casier , Antoine Boivin , Clément Carré and Laure Teysset * Transgenerational Epigenetics & small RNA Biology, Sorbonne Université, CNRS, Laboratoire Biologie du Développement, Institut de Biologie Paris-Seine, UMR7622, 75005 Paris, France; [email protected] (K.C.); [email protected] (A.B.); [email protected] (C.C.) * Correspondence: [email protected] Received: 16 August 2019; Accepted: 17 September 2019; Published: 19 September 2019 Abstract: Environmentally-induced transgenerational epigenetic inheritance is an emerging field. The understanding of associated epigenetic mechanisms is currently in progress with open questions still remaining. In this review, we present an overview of the knowledge of environmentally-induced transgenerational inheritance and associated epigenetic mechanisms, mainly in animals.
    [Show full text]
  • Genetics and Extracellular Vesicles of Pediatrics Sleep Disordered Breathing and Epilepsy
    International Journal of Molecular Sciences Review Genetics and Extracellular Vesicles of Pediatrics Sleep Disordered Breathing and Epilepsy Abdelnaby Khalyfa 1,2,* and David Sanz-Rubio 2 1 Department of Pediatrics, Section of Sleep Medicine, The University of Chicago, Chicago, IL 60637, USA 2 Department of Child Health and the Child Health Research Institute, University of Missouri School of Medicine, Columbia, MO 65201, USA; [email protected] * Correspondence: [email protected] Received: 20 August 2019; Accepted: 28 October 2019; Published: 4 November 2019 Abstract: Sleep remains one of the least understood phenomena in biology, and sleep disturbances are one of the most common behavioral problems in childhood. The etiology of sleep disorders is complex and involves both genetic and environmental factors. Epilepsy is the most popular childhood neurological condition and is characterized by an enduring predisposition to generate epileptic seizures, and the neurobiological, cognitive, psychological, and social consequences of this condition. Sleep and epilepsy are interrelated, and the importance of sleep in epilepsy is less known. The state of sleep also influences whether a seizure will occur at a given time, and this differs considerably for various epilepsy syndromes. The development of epilepsy has been associated with single or multiple gene variants. The genetics of epilepsy is complex and disorders exhibit significant genetic heterogeneity and variability in the expressivity of seizures. Phenobarbital (PhB) is the most widely used antiepileptic drug. With its principal mechanism of action to prolong the opening time of the γ-aminobutyric acid (GABA)-A receptor-associated chloride channel, it enhances chloride anion influx into neurons, with subsequent hyperpolarization, thereby reducing excitability.
    [Show full text]
  • Biological Models of Colorectal Cancer Metastasis and Tumor Suppression
    BIOLOGICAL MODELS OF COLORECTAL CANCER METASTASIS AND TUMOR SUPPRESSION PROVIDE MECHANISTIC INSIGHTS TO GUIDE PERSONALIZED CARE OF THE COLORECTAL CANCER PATIENT By Jesse Joshua Smith Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University In partial fulfillment of the requirements For the degree of DOCTOR OF PHILOSOPHY In Cell and Developmental Biology May, 2010 Nashville, Tennessee Approved: Professor R. Daniel Beauchamp Professor Robert J. Coffey Professor Mark deCaestecker Professor Ethan Lee Professor Steven K. Hanks Copyright 2010 by Jesse Joshua Smith All Rights Reserved To my grandparents, Gladys and A.L. Lyth and Juanda Ruth and J.E. Smith, fully supportive and never in doubt. To my amazing and enduring parents, Rebecca Lyth and Jesse E. Smith, Jr., always there for me. .my sure foundation. To Jeannine, Bill and Reagan for encouragement, patience, love, trust and a solid backing. To Granny George and Shawn for loving support and care. And To my beautiful wife, Kelly, My heart, soul and great love, Infinitely supportive, patient and graceful. ii ACKNOWLEDGEMENTS This work would not have been possible without the financial support of the Vanderbilt Medical Scientist Training Program through the Clinical and Translational Science Award (Clinical Investigator Track), the Society of University Surgeons-Ethicon Scholarship Fund and the Surgical Oncology T32 grant and the Vanderbilt Medical Center Section of Surgical Sciences and the Department of Surgical Oncology. I am especially indebted to Drs. R. Daniel Beauchamp, Chairman of the Section of Surgical Sciences, Dr. James R. Goldenring, Vice Chairman of Research of the Department of Surgery, Dr. Naji N.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name thymosin beta 15a Gene Symbol TMSB15A Organism Human Gene Summary Description Not Available Gene Aliases TMSB15, TMSB15B, TMSL8, TMSNB, Tb15, TbNB RefSeq Accession No. NC_000023.10, NT_011651.17 UniGene ID Hs.56145 Ensembl Gene ID ENSG00000158164 Entrez Gene ID 11013 Assay Information Unique Assay ID qHsaCED0045803 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000289373, ENST00000601407 Amplicon Context Sequence TTAAAACAGGCTTATCCAGTATAGGATGCAAGAACTACATACACAAAGGTCATCA ATGGTGAGATTATTGACAGCATCTGCCATCTGGAACATATGCACCAATGGTAAGT TTAAAAATGAATT Amplicon Length (bp) 93 Chromosome Location X:101768728-101768850 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9994 cDNA Cq 21.97 cDNA Tm (Celsius) 79 gDNA Cq 25.12 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report TMSB15A, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • Region Based Gene Expression Via Reanalysis of Publicly Available Microarray Data Sets
    University of Louisville ThinkIR: The University of Louisville's Institutional Repository Electronic Theses and Dissertations 5-2018 Region based gene expression via reanalysis of publicly available microarray data sets. Ernur Saka University of Louisville Follow this and additional works at: https://ir.library.louisville.edu/etd Part of the Bioinformatics Commons, Computational Biology Commons, and the Other Computer Sciences Commons Recommended Citation Saka, Ernur, "Region based gene expression via reanalysis of publicly available microarray data sets." (2018). Electronic Theses and Dissertations. Paper 2902. https://doi.org/10.18297/etd/2902 This Doctoral Dissertation is brought to you for free and open access by ThinkIR: The University of Louisville's Institutional Repository. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of ThinkIR: The University of Louisville's Institutional Repository. This title appears here courtesy of the author, who has retained all other copyrights. For more information, please contact [email protected]. REGION BASED GENE EXPRESSION VIA REANALYSIS OF PUBLICLY AVAILABLE MICROARRAY DATA SETS By Ernur Saka B.S. (CEng), University of Dokuz Eylul, Turkey, 2008 M.S., University of Louisville, USA, 2011 A Dissertation Submitted To the J. B. Speed School of Engineering in Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Computer Science and Engineering Department of Computer Engineering and Computer Science University of Louisville Louisville, Kentucky May 2018 Copyright 2018 by Ernur Saka All rights reserved REGION BASED GENE EXPRESSION VIA REANALYSIS OF PUBLICLY AVAILABLE MICROARRAY DATA SETS By Ernur Saka B.S. (CEng), University of Dokuz Eylul, Turkey, 2008 M.S., University of Louisville, USA, 2011 A Dissertation Approved On April 20, 2018 by the following Committee __________________________________ Dissertation Director Dr.
    [Show full text]