sign in sign up
<<
Home , Brook lamprey, Chestnut lamprey, Ichthyomyzon, Lethenteron appendix, Northern brook lamprey, Sea lamprey

Journal of Research 42 (2016) 649–659

Contents lists available at ScienceDirect

Journal of Great Lakes Research

journal homepage: www.elsevier.com/locate/jglr

Detection and identification of lampreys in Great Lakes streams using environmental DNA

Timothy D. Gingera a, Todd B. Steeves b, David A. Boguski a, Steven Whyard a, Weiming Li c, Margaret F. Docker a,⁎ a University of , Department of Biological, Sciences, 50 Sifton Road, Winnipeg, MB R3T 2N2, b Sea Control Centre, 1219 Queen Street East, Sault Ste. Marie, ON P6A 2E5, Canada c Michigan State University, Department of Fisheries and Wildlife, 13 Natural Resources Building, East Lansing, MI 48824, USA article info abstract

Article history: Control of Petromyzon marinus in the Great Lakes requires accurate assessment of the instream Received 16 July 2015 distribution of this pest and the ability to distinguish it from the four lamprey species that are native to Accepted 17 February 2016 the Great Lakes (American appendix, castaneus, Available online 19 March 2016 Ichthyomyzon fossor, and Ichthyomyzon unicuspis). We developed PCR- based environmental DNA (eDNA) assays to distinguish among the four “genetic species” of Great Lakes lampreys Communicated by Stephen Charles Riley (silver and northern brook lampreys were genetically indistinguishable), tested them under laboratory fi Keywords: conditions, and demonstrated in the eld that both spawning and larval sea lamprey can be detected using eDNA eDNA. In the laboratory, mean detection frequency decreased with increasing flow rate, but was not significantly related to larval density or temperature over the range of relatively high densities tested. Proof-of-concept Sea lamprey control was demonstrated in the field when sea lamprey eDNA was detected during the spawning season (when Native lampreys large-bodied adults, their gametes, and later their carcasses were present); sampling effort involved collection Cryptic organisms of three 1–2 L water samples at each of four transects (0.4–1.0 km apart). Mean detection frequency remained Spawning high (81–97%) until spawning ceased at the end of June, but decreased thereafter, falling to 6% by mid-August. We also demonstrated that eDNA of smaller, burrowing larvae (in water collected after mid-August) was detectable in two of four streams with medium to high larval density (1–2larvae/m2), but not at low densities (b0.1 larvae/m2), potentially due to the exacerbating effect of high flow rates. © 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved.

Introduction 3–7 years) in the sediment of rivers and streams (Dawson et al., 2015); the second stage, the parasitic juvenile, feeds on the blood and body The presence of an invasive species can have profound negative fluids of actinopterygian fishes for one growing season in the Great impacts on an ecosystem, including loss of native diversity, species Lakes (Bergstedt and Swink, 1995); and during the third stage, the sex- extinction, and shifts in community structure, as well as devastating ually maturing adult migrates upstream to a stream system with suit- socio-economic effects (Nienhuis et al., 2014; Pimentel et al., 2005; able larval habitat and spawns. Sea lamprey, like all lamprey species, Reaser et al., 2007; Simberloff, 1981). The sea lamprey Petromyzon are semelparous and die after spawning. marinus is an aquatic invasive species of jawless fish which was first The Sea Lamprey Control program, initiated over 50 years ago by the recorded in Lake in the mid-1800s and which subsequently Great Lakes Fishery Commission, represents one of the largest and most spread into the other Laurentian Great Lakes by the late 1930s intensive efforts to control a vertebrate pest (Siefkes et al., 2012). To (Eshenroder, 2014; Smith and Tibbles, 1980). Sea lamprey aggressively effectively reduce the impact of the parasitic stage on fish stocks, stream parasitize commercially-important fish species such as and river systems that contain filter-feeding sea lamprey larvae are Salvelinus namaycush,lakewhitefish Coregonus clupeaformis, and identified and treated with the selective lampricide 3-trifluoromethyl- . This has resulted in the decimation of commercial 4-nitrophenol (TFM) to kill sea lamprey before they metamorphose fisheries and severe population imbalances within the Great Lakes into the parasitic juvenile phase (Siefkes et al., 2012). Effective TFM (Smith and Tibbles, 1980). Sea lamprey have three distinct life stages: treatment therefore requires accurate assessment of larval distribution the first is a filter-feeding larval stage which resides (for approximately and the ability to distinguish this pest species from the four lamprey species that are native to the Great Lakes (American brook lamprey ⁎ Corresponding author. Tel.: +1 204 474 8831. ,chestnutlampreyIchthyomyzon castaneus,north- E-mail address: [email protected] (M.F. Docker). ern brook lamprey Ichthyomyzon fossor, and silver lamprey Ichthyomyzon

http://dx.doi.org/10.1016/j.jglr.2016.02.017 0380-1330/© 2016 International Association for Great Lakes Research. Published by Elsevier B.V. All rights reserved. 650 T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 unicuspis). Silver and northern brook lampreys, in particular, are of con- lakes Superior and Huron basins with a range of larval sea lamprey den- servation concern in some jurisdictions surrounding the Great Lakes sities to test the ability of the developed sea lamprey assay to detect the (Maitland et al., 2015). Because TFM is also lethal to other lampreys smaller, burrowing lamprey larvae under natural conditions. (Hubert, 2003), effects on non-target species can be achieved only through the targeted treatment of stream reaches containing sea lam- Methods prey and avoidance of those where the other lamprey species occur. Sea lamprey distribution and density is currently assessed using Marker design traditional sampling tools such as electrofishing (Slade et al., 2003). Traditional sampling methods, however, can be labor-intensive and Species-specific eDNA genetic markers were designed to diag- time-consuming, or are sometimes not feasible due to inaccessible nostically identify sea lamprey, American brook lamprey, chestnut terrain, dense vegetation, turbid water, or if the targeted species has a lamprey, and silver and northern brook lampreys (Table 1). The low population density or elusive life stages (Bayley and Peterson, silver and northern brook lampreys were treated as one species 2001; Darling and Mahon, 2011; MacKenzie et al., 2005). As an alterna- because they cannot be distinguished by any known genetic methods tive to these traditional surveillance methods, new highly-sensitive (Docker et al., 2012; Ren et al., 2014). The mitochondrial cytochrome molecular surveillance techniques are being developed in an attempt oxidase c subunit I gene (COI) was targeted because sequence data to collect more accurate species distribution data (e.g., Jerde et al., for the “DNA barcode” region of COI were available on GenBank for 2013; Laramie et al., 2015; Stewart and Baker, 2012; Xi et al., 2011). 13 sea lamprey (EU524270–273, JN028182–190), 24 American brook Currently, environmental DNA (eDNA) is the most common of these lamprey (EU524109–118, HQ579133–136, JN027063–072), 16 chest- molecular surveillance techniques (Jerde et al., 2011; Lodge et al., 2012). nut lamprey (EU524087–089, JN026863–875), 16 silver lamprey Mucus and feces excreted by the organism, the sloughing off of cells (EU524097–105, JN026903–909), and 12 northern brook lamprey from the gut lining, and of dead organisms introduce (EU524090–096, JN026876–880) specimens from across a broad geo- DNA into the environment (Klymus et al., 2015; Valentini et al., 2008). graphic range (April et al., 2011; Hubert et al., 2008). To increase sensi- Polymerase chain reaction (PCR) can then be used in combination tivity, primers were designed (using Primer3 software, bioinfo.ut.ee/ fi with species-speci c genetic markers to amplify, from water samples, primer3–0.4.0/) to amplify short fragments of the COI gene (119– fragments of DNA from the species of interest. This technique is 227 bp). BLAST (Basic Local Alignment Search Tool; GenBank, www. now being used for the detection of both endangered and invasive ncbi.nlm.nih.gov/blast) searches compared the primer sequences to all fi aquatic species, including freshwater shes (Jerde et al., 2011, 2013; available sequence data to test whether they were likely to result in Minamoto et al., 2012; Takahara et al., 2012, 2013; Thomsen et al., non-target amplification from other organisms. Each candidate marker 2012a), amphibians (Dejean et al., 2012; Ficetola et al., 2008; was tested against tissue-derived DNA from 44–60 specimens of Goldberg et al., 2011; Pilliod et al., 2013; Spear et al., 2015), and inver- the target species from across a broad geographic range (Table 2) tebrates (Deiner et al., 2015; Goldberg et al., 2013), as well as many and against each of the other (non-target) lamprey species (see PCR species of marine vertebrates (Foote et al., 2012; Thomsen et al., amplification and evaluation). PCR products were visualized on a 1.5% 2012b). Monitoring protocols which involve the use of eDNA tech- agarose gel stained with ethidium bromide, using a 100 bp ladder to fi niques have been identi ed and developed as a cost-effective detection verify that each amplicon was the correct size. PCR products from 2–3 tool that could potentially increase accuracy and the possible number of individuals per marker set were sequenced to confirm species identity fi sites sampled, provide information to re ne the known distribution of of the amplicons. Following purification using a standard isopropanol species, and serve as a method of early detection for invading species precipitation procedure, PCR products were sequenced using the that will not disturb native species within the monitored ecosystem sense primer and the BigDye Terminator Cycle Sequencing Kit v. 3.1, (Armstrong and Ball, 2005; Laramie et al., 2015; Sigsgaard et al., 2015; following standard procedures on an Applied Biosystems 3500 se- Taberlet et al., 2012). quencing platform (Life Technologies, Grand Island, NY, USA). The objective of the present study was to investigate whether eDNA The detection limit of each of the four assays was determined by monitoring techniques could serve as a means of assessing distribution performing PCRs for each assay with a series of standards with a of sea lamprey larvae prior to TFM treatment. Most aquatic organisms known concentration of target fragment copies per μL. Standards for monitored to date using eDNA techniques have been free-swimming each assay were produced by amplifying tissue-derived DNA of each organisms, which introduce cellular material directly into the water target species. The total PCR reaction volume was 25 μL with 1× PCR column. In contrast, larval lampreys are primarily found in stream sed- iments and are relatively sedentary; therefore, the extent to which their cellular material will be introduced into the water column is unknown. Table 1 To test the effectiveness of eDNA for detecting larval lampreys, we Summary of the eDNA markers (F = sense; R = antisense primers) developed in this developed, validated, and determined the detection limit of species- study for the Great Lakes lampreys (silver/northern brook, American brook, chestnut, specific genetic markers for sea lamprey and the native lamprey species and sea lampreys) using PCR and the cytochrome oxidase c subunit 1 (COI) mitochondrial gene; optimal annealing temperature (Tm), and amplicon size (bp) for each marker pair found in the Great Lakes basin. Then, to calibrate and understand the are given. Detection limit was 50 copies per PCR for each assay. Sequences (n = 81) used extent to which certain environmental factors may affect detection, to develop the primers are from Hubert et al. (2008) and April et al. (2011). we performed a series of controlled laboratory tank experiments to ′ ′ fl Lamprey species Marker Sequence (5 -3 ) Tm Size assess the effects of larval density, water temperature, and ow rate (°C) (bp) on eDNA detection frequency. These environmental variables have all Silver/northern F CTTCCACCATCATTACTTC 56 119 been demonstrated to have an effect on species' detection using eDNA brook lampreys (Dejean et al., 2011; Ficetola et al., 2008; Goldberg et al., 2011; Matsui R GTCAATAGATGCTCCTGTA et al., 2001; Thomsen et al., 2012b). Finally, we tested the sea lamprey American brook F CGGAAACTGACTTGTGCCTA 55 227 eDNA assay in the field: a) under a “best case scenario” in a stream lamprey with a high density of spawning sea lamprey, because large-bodied R CGGCTAGATGAAGGGAGAAA N Chestnut lamprey F GGCCTTCCCCCGTATAAAT 56 194 ( 250 g; Bergstedt and Swink, 1995), free-swimming adult lamprey, R ATGAGATTCCAGCGAGGTGT their gametes, and later their carcasses were expected to be more easily Sea lamprey F GGCAACTGACTTGTACCMCTAA 55 225 detected than burrowing lamprey larvae; b) in the 3 months following TACTTGGT spawning to assess the length of time required for an eDNA signal R GGCTAAGTGTAAGGAAAAGATTGT TAGGTCGAC from spawning lamprey to attenuate; and c) in seven streams in the T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 651

Table 2 as larvae, but there are no adult silver lamprey records from the Number of individuals for each Great Lakes lamprey species (silver/northern brook, Birch River (Stewart and Watkinson, 2004). However, because silver American brook, chestnut, and sea lampreys) used when testing eDNA markers against and northern brook lampreys are not distinguishable using COI gene tissue-derived DNA and the geographic location where individuals were collected; silver and northern brook lampreys were treated as one “genetic” species (see text). sequence, northern brook and silver lamprey larvae would be equally detectable with the silver/northern brook lamprey genetic marker. Silver/northern American Chestnut Sea Larvae were transported to the Holding Facility at the University brook brook of Manitoba and held in accordance with Animal Use Protocol F11–030. basin 12 19 11 All tank experiments were performed in 10 L tanks (0.2 m × basin 1 12 20 fi fi basin 12 12 5 17 0.27 m × 0.2 m) lled with 1.5 L of ne graded sand to replicate stream basin 11 sediment and 8.5 L dechlorinated City of Winnipeg water. Prior to basin 1 testing, all aquaria and filtration equipment were thoroughly cleaned Manitoba 7 33 with ELIMINase™ decontaminant (Decon™ Labs, King of Prussia, Newfoundland (anadromous) 12 PA, USA) and rinsed with distilled water. Sediment was discarded and Delaware 7 Maine 1 replaced between each test with fresh sediment to avoid cross- Arkansas 4 contamination between tank trials. Prior to collection of water samples, 1 controls were taken by filtering 2 L of distilled water through an unused 1 1.5 μm pore 47 mm diameter glass fiber filter (Whatman 1827–047, GE 4 Wisconsin 4 Healthcare Life Sciences, Piscataway, NJ, USA). Each larva was weighed Total 44 51 52 60 to ±0.1 g (mean weight 1.6 g) and subsequently placed in the tank for 1 h, after which six 0.5 L water samples were immediately collected from the tank and filtered. Detection frequency was evaluated at four

Gold Buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 0.2 μMofeachprimer, different densities: 1) high (4 larvae per tank, 0.86 g/L); 2) medium- 0.625 U of AmpliTaq Gold DNA polymerase (Life Technologies, Grand high (3 larvae per tank, 0.68 g/L); 3) medium-low (2 larvae per Island, NY, USA), and 5 μL of DNA extract (diluted 1:4 with nuclease- tank, 0.42–0.49 g/L); and 4) low (1 larva per tank, 0.14–0.22 g/L), all free water). The PCR program included an initial 5 min denaturation at 20 °C without any flow of water. To evaluate the effects of tempera- step at 95 °C; 35 cycles of denaturation at 95 °C for 30 s, annealing at ture on detection frequency, larvae were held at: 1) 10 °C; 2) 15 °C; or 55 or 56 °C (depending on the assay; see Table 1) for 30 s, elongation 3) 20 °C; density was always high (4 larvae per tank, 0.69–0.89 g/L) at 72 °C for 30 s; and a final elongation step at 72 °C for 5 min. Amplified and flow was 0. The effect of flow rate on detection frequency was eval- products were visualized using electrophoresis on a 1.5% agarose gel uated at: 1) 0 mL/s; 2) 10 mL/s; 3) 20 mL/s; and 4) 30 mL/s (0 m3/s, using ethidium bromide. For each assay, 20 μL from five PCR reactions 1×10−5 m3/s, 2 × 10−5 m3/s, and 3 × 10−5 m3/s, respectively); density were combined (for a total volume of 100 μL) and purified using the was always high (4 larvae per tank, 0.69–0.89 g/L) and temperature was QIAquick PCR Purification kit (Qiagen Inc., Valencia, CA, USA) following constant at 20 °C. Each tank trial was performed in duplicate. the manufacturer's protocols. The concentration (ng/μL) for each Water filtration was conducted as described in Goldberg et al. purified product was determined using a NanoDrop 8000 (Thermo (2011), using a peristaltic pump head (Masterflex model 7015–21; Fisher Scientific, Waltham, MA, USA). The number of DNA amplicons Cole-Parmer, Montreal, QC, Canada), in-line polycarbonate filter holder within each sample was determined using the Thermo Fisher Scientific (Pall product #1119; Pall Corp., Port Washington, NY, USA), and silicone DNA Copy Number and Dilution Calculator (www.thermofisher.com), tubing (Masterflex model OF-96,410-15); the pump was powered using assuming an average molar mass per base pair of 650 (g/mol)/bp. a cordless drill. Filters were placed in sterile Petri dishes and stored at Each purified product was diluted to 1010 copies/μL and a serial dilution −30 °C until extraction. Prior to extraction, the unused edge of each fil- was performed to achieve a concentration of 100 copies/μL. PCRs from ter (where the filter was secured by the filter holder) was removed 106 to 100 copies/μL were performed in triplicate for each assay follow- using a sterile razor blade in order to minimize the mass of filter ing the PCR protocols described above (with the exception that the paper in each extraction. DNA was extracted from each filter using the standard DNA was not diluted 1:4). At least one of three reactions for DNeasy Blood and Tissue kit (Qiagen Inc., Valencia, CA, USA), and eluted a particular standard concentration needed to be positive in order to in a volume of 200 μL. The filters were folded in half three times with confirm detection. sterile forceps to allow them to fit in a 1.5 mL tube and suspended in 360 μL ATL buffer and 40 μL proteinase K. Filters were incubated over- Laboratory sample collection, filtration, and extraction night at 56 °C and subsequently suspended in 400 μLofabsoluteethanol and 400 μL AL buffer. Extractions were then centrifuged for 5 min at Tank experiments were performed under controlled laboratory 13,000 rpm. All subsequent steps followed the manufacturer's protocol. conditions to assess the effects of larval density, water temperature, and flow rate on eDNA detection frequency. Because these experiments Field sample collection, filtration, and extraction were performed at the University of Manitoba (where sea lamprey are not locally available), native northern brook lamprey were used as a The ability of the sea lamprey assay to detect eDNA under natural proxy. Live northern brook lamprey larvae were collected using a back- field conditions was first tested during the spawning season in the Little pack electrofisher (Smith-Root LR-24, Vancouver, WA, USA) from the Thessalon River, a tributary to the Thessalon River in northern Lake Birch River in Manitoba, Canada (49.68003°N, 95.78956°W), between Huron (Table 3). This river—with both a high density of sea lamprey June and August of 2012 and 2013 in accordance with collection permits larvae (approx. 1.9 larvae/m2; Fisheries and Oceans Canada (DFO), Sea SCP 15–12/SCP 28–13 and SECT 73 SARA C&A 12–009/13–103. Larvae Lamprey Control Centre, unpublished data), which are present year- (90–110 mm) were tentatively identified as northern brook lamprey round, and one of the highest estimated spawning runs of sea lamprey from distributional records based on adult specimens (Stewart and each spring (DFO, unpublished data)—allowed us to test detectability Watkinson, 2004), and were subsequently distinguished from chestnut of DNA in the environment after spawning. We expected that eDNA lamprey based on both morphological characters (i.e., they lacked the from adults would be more readily detected than eDNA contributed dark lateral markings diagnostic of large chestnut lamprey larvae) and by resident larvae, but it is unknown how long adult eDNA will be de- genetic analysis (Neave et al., 2007; Spice and Docker, 2014). The only tected after the spawning run ends. Sea lamprey spawning migration other lamprey species present in Manitoba is the silver lamprey. Silver was inferred from water temperature to have begun late April to early and northern brook lampreys are morphologically indistinguishable May, and spawning was determined to have ceased after no sea lamprey 652 T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659

Table 3 chosen based on accessibility (e.g., at road crossings), except in the Coordinates of each of the four transects sampled along the Little Thessalon River, a tribu- Michipicoten and lower Batchawana rivers, where sampling was con- tary to the Thessalon River in northern Lake Huron, listed in order of furthest downstream ducted from a boat (thus permitting equally-spaced transects). Three (near the confluence with the Thessalon River) to furthest upstream (near a natural barrier preventing sea lamprey migration). Discharge during the sampling period (May water samples (see above) were taken at each transect; the only excep- 16–August 14, 2013), which was extrapolated from discharge measured at a recording tion was in Watson Creek where only two samples were taken at three staff gauge on the main Thessalon River (see text), ranged from 0.05 m3/s (on July 16) very narrow transects. Discharge (m3/s) was obtained from river- 3 to 0.93 m /s (May 28). specific Environment Canada recording staff gauges, or estimated Coordinates by multiplying the width (m) and mean depth (m) of the stream by fi Transect 1 (near confluence) 46.289081°N, 83.569413°W water velocity (m/s) (Table 4). All eld-collected water samples for Transect 2 46.296424°N, 83.561421°W this study were from public waters and did not require any specific Transect 3 46.299347°N, 83.552273°W permits. Transect 4 (below natural barrier) 46.302804°N, 83.551446°W At all field sites, water samples were collected and filtered stream- side using 1 L Nalgene bottles and the same peristaltic pump device described above. Filtration continued until the filters clogged; the adults were captured for 2 consecutive weeks (by June 25). Water sam- volume of water filtered ranged from 1 to 2 L. Prior to sampling, all fil- ples were collected (see below) between May 16 and July 22, 2013, at tration equipment and bottles were cleaned by being rinsed thoroughly 2–11 day intervals. Sampling frequency was opportunistic, based on with distilled water. Controls were taken at every site by filtering 1 L of availability of personnel and avoidance of high water from rain events, distilled water transported from the lab in a clean bottle. Surface water but samples were taken a minimum of 6 days apart in the month follow- was collected in the same bottle and filtered onto a 1.5 μm pore size ing cessation of spawning to ensure that relatively rapid changes in glass fiber filter as described above. Filters were placed in 15 mL conical eDNA detectability would be recorded. A final set of water samples tubes and suspended in absolute ethanol using sterile forceps. Between was collected on August 14, 2013, to compare with the samples taken each sampling site, tubing for the peristaltic pump was replaced to in July, and was timed to correspond with sampling for larval lamprey avoid cross-contamination between sites. Filters were shipped to the detection in other streams. Nursery and spawning habitats occur University of Manitoba on ice packs, where they were subsequently throughout the Little Thessalon River; consequently, adults may kept at −30 °C until extraction. DNA from each filter was extracted in anywhere throughout the system (i.e., they do not necessarily the same manner described above except the excess ethanol absorbed migrate upstream as far as possible before spawning) with larval depo- by each filter was left to dry on a sterile Petri dish inside a PCR worksta- sition occurring in association with spawning sites. To test whether tion (see quality control and assurance) prior to extraction. there was longitudinal variation in eDNA detectability, samples were collected from four transects 0.39–1.02 km apart. Transects were select- PCR amplification and evaluation ed based on accessibility, starting at the most downstream site (T1) 450 m upstream from the confluence with the Thessalon River and end- The detectability of larval northern brook lamprey eDNA in the ing (T4) 100 m downstream of a waterfall that forms a natural barrier laboratory used the developed silver/northern brook lamprey genetic preventing sea lamprey from migrating further upstream. On the first markers (Table 1). The conventional PCR method used here is unable sample date (May 16), T4 was located at a high-gradient, rocky site to quantify the amount of DNA within a sample (see Discussion). 40 m downstream of the waterfall, but it appeared too slippery to Instead, detectability of the species' presence was quantified adopting sample safely on subsequent visits; all remaining T4 samples were the multi-tube approach used by Ficetola et al. (2008). PCR was collected 100 m downstream of the waterfall. Transect 3, which was performed on each water sample (n = 6 per tank) in triplicate, and the most difficult site to access, was not sampled on May 16, May 20, the mean per water sample was used to calculate a global mean detect- and June 28 due to inclement weather. On all other days, three water ability (average amplification success) for each of the two tanks per samples were collected at each transect: one at the right bank, one at treatment (see below). In each PCR, the total reaction volume was center stream, and one at the left bank. Discharge was calculated each 25 μL with 1× PCR Gold Buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 0.2 μM day of sampling using a linear model that related discharge at an Envi- of each primer, 10 μg Bovine Serum Albumin (BSA), 0.625 U of AmpliTaq ronment Canada recording staff gauge on the main Thessalon River Gold DNA polymerase (Life Technologies, Grand Island, NY, USA), and to discharges measured during five separate lampricide applications 5 μL of DNA extract (diluted 1:4 with nuclease-free water). BSA was in the Little Thessalon River (y = 0.156× − 0.598, R2 = 0.973; DFO, used as an additive to relieve the PCR reaction of inhibition from sub- unpublished data). stances in the water such as humic acids (Kreader, 1996; Deiner et al., The ability to detect eDNA from larval sea lamprey was tested after 2015). Preliminary research (where known concentrations of lamprey the detection of an eDNA signal from spawners had attenuated (see DNA were added to 0.5 L river water prior to filtration and PCR) showed Results). Water samples were collected from seven streams in the that adding BSA (to a final concentration of 0.4 μg/μL) greatly reduced lakes Superior and Huron basins between August 11 and August 19, the incidence of false negatives (Gingera, 2013). Dilution of DNA has 2013. Using estimates of number of sea lamprey larvae collected during likewise been shown to be effective at reducing inhibition (McKee larval assessment surveys and area of suitable larval habitat (DFO, et al., 2015). The PCR program included an initial 5 min denaturation unpublished data; see Dawson et al., 2015, for information regarding step at 95 °C; 35 cycles of denaturation at 95 °C for 30 s, annealing at categorization of suitable larval habitat), two streams each were classi- 56 °C for 30 s, elongation at 72 °C for 30 s; and a final elongation step fied as high density (≥2 larvae/m2), medium density (approximately at 72 °C for 5 min. Amplified products were visualized using electropho- 1larva/m2), and low density (≤ 0.1 larva/m2), and one stream resis on a 1.5% agarose gel using ethidium bromide. (East Davignon Creek) was characterized as having no sea lamprey Sea lamprey detection from field-collected water samples was per- (Table 4). Furthermore, in the two low-density streams (Stokely Creek formed using the sea lamprey genetic markers (Table 1). As above, and Big Carp River), barriers which prevent sea lamprey migration fur- three PCR reactions were performed on each water sample. All reactions ther upstream provided additional “no sea lamprey” sites (i.e., density were conducted with a 15 μL total volume using the GoTaq PCR kit was low below the barrier and 0 above). These three “no sea lamprey” (Promega Corp., Madison, IW, USA) with 1× Go Flexi buffer, 2.5 mM sites enabled us to validate the species-specificity of the sea lamprey MgCl2, 0.2 mM dNTPs, 0.8 μMofeachprimer,10μg BSA, 0.08 U of assay in stream reaches where the ecosystem and biotic communities GoTaq Flexi DNA polymerase, and 0.6 μL of DNA template (undiluted). are otherwise typical of the region. In each stream, 3–6 transects were The PCR program included an initial 3 min denaturation step at 94 °C; sampled at 10–100 m intervals (Table 4); transect locations were 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 653

Table 4 Sample site coordinate, discharge, sea lamprey larval density, and mean detection frequency (±SE) of water samples taken from two streams in the Lake Huron basin (Watson Cr and Root R) and five streams in the Lake Superior basin. Stream discharges were obtained from river-specific Environment Canada recording staff gauges (RSG) or estimated (est) as described in the text. Discharge was neither calculated nor estimated for Watson Cr, but was qualitatively described as “quite low.” Densities are based on estimates of larval sea lamprey production and area of larval sea lamprey habitat within the river; high, medium, and low categories correspond approximately to ≥2, 1, ≤0.1 larvae/m2, respectively; no sea lamprey are present in East Davignon Creek or above the barriers in Big Carp River or Stokely Creek. Mean detection frequencies are based on three PCR reactions per water sample, with results from all transects pooled.

Stream name Sample site coordinates Discharge Sea lamprey density Mean detection (m3/s) (larvae/m2) frequency (±SE)

Watson Cr 46.150467°N, 83.892392°W N/A High (2.6) 0.3 (±0.09) 46.150065°N, 83.894404°W 46.15013°N, 83.895366°W 46.149468°N, 83.901236°W Michipicoten R 47.936627°N, 84.836996°W 102 (RSG) High (2.0) 0.00 47.933806°N, 84.832455°W 47.921768°N, 84.833453°W 47.916345°N, 84.816493°W 47.922376°N, 84.805784°W Batchawana R 46.150065°N, 83.894404°W 8.31 (RSG) Medium (1.1) 0.00 46.15013°N, 83.895366°W 46.149468°N, 83.901236°W 46.965215°N, 84.510861°W 46.970595°N, 84.50296°W Root R 46.555682°N, 84.269464°W 0.583 (RSG) Medium (0.9) 0.5 (±0.07) 46.563055°N, 84.281647°W 46.56365°N, 84.293804°W 46.566983°N, 84.306113°W 46.572077°N, 84.320673°W 46.582402°N, 84.325372°W Big Carp R Below barrier 46.505488°N, 84.451451°W 0.113 (RSG) Low (0.1) 0.00 46.506289°N, 84.45303°W Above barrier 46.506373°N, 84.453183°W 0 0.00 46.515856°N, 84.46519°W 46.52024°N, 84.472952°W Stokely Cr Below barrier 46.812881°N, 84.405982°W 0.25 (est) Low (0.07) 0.00 46.81294°N, 84.405835°W 46.80996°N, 84.40219°W 46.807271°N, 84.396762°W Above barrier 46.815839°N, 84.408658°W 0 0.00 46.814022°N, 84.407513°W East Davignon Cr 46.536191°N, 84.361187°W 0.15 (est) 0 0.00 46.54502°N, 84.365063°W 46.566581°N, 84.370035°W

and elongation at 72 °C for 30 s; and a final elongation step at 72 °C for The effective volume of stream water sampled in each PCR was cal- 5 min. Products were visualized on a 1.5% agarose gel, as above. Species culated to be 3–6mL(i.e.,1–2 L of stream water was filtered and subse- identity of eDNA amplicons was confirmed for northern brook lam- quently eluted into 200 μL, of which 0.6 μLwasaddedtoeachPCR). prey water samples (n = 5) by cloning the amplified fragment Therefore, in order to detect at least one COI fragment (copy) per PCR, using pJet vector (Life Technologies) and performing sequencing reac- at least 333 and 167 copies would need to be present per 1 L and 2 L tions with BigDye Terminator Cycle Sequencing Kit v. 3.1, using the water samples, respectively. Given that three water samples were fil- sense primer and following standard procedures on an Applied tered per transect, 3–6 transects were sampled per stream, and three Biosystems Prism 3130xl sequencing platform (Life Technologies). PCRs were performed per water sample, detection of at least one copy Species identity of the eDNA amplicons from sea lamprey water in at least one PCR per stream would require 6.2–12.3 or 3.1–6.2 copies samples (n = 20) was confirmed directly from PCR products (given per L stream water for 1 L and 2 L samples, respectively. their larger size, 225 versus 119 bp), following the same sequencing procedure as above. Mean detection frequency (average amplification success) for each Quality assurance and control of the two tanks per treatment was determined as follows: each PCR reaction was assigned a 0 (negative for eDNA) or 1 (positive), and Rigorous quality assurance and quality control protocols were used means for each tank (i.e., replicate) were determined based on three at every stage of this study. All filtration was either done in the field PCRs per water sample and six water samples per tank. In the field or in a separate room designated solely for water filtration where no study, mean detection frequency was likewise determined for each lamprey genetic work had been performed. All DNA extraction and transect (based on three PCRs per water sample and three water sam- PCR setup was done in a PCR workstation equipped with ultra-violet ples per transect). Standard deviations and standard errors were calcu- sterilization, HEPA (High Efficiency Particulate Air) filtration (Ultra- lated for each treatment using Microsoft Excel. Simple one-way ANOVA Violet Products Ltd., Upland, CA, USA) and aerosol filtered tips (ART, tests were performed to compare the detection frequencies among Molecular BioProducts, St. Louis, MO, USA). The workstation was laboratory treatments (larval density, temperature, and flow rate) and wiped down with ELIMINase™ and then exposed to UV light for differences between transects and sample locations within a transect 15 min before and after each use. Controls were collected during the for samples taken from Little Thessalon River. Post hoc Tukey HSD test filtration stage for every tank sampled and each field site to allow us analysis was used to compare differences between tanks, transects, to identify contamination of equipment. Separate controls were also and sample location. The significance level was set at p ≤ 0.05. incorporated with every PCR reaction to identify if contamination 654 T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 occurred during reaction setup. If contamination was suspected in any of the controls, results from that point forward were disregarded.

Results

Marker design

The four COI lamprey assays (Table 1)wereconfirmed to be species- specific when tested against tissue-derived DNA from 207 lampreys of the four genetic species. Assays using DNA from each target species did not result in any false negatives and non-target lamprey species did not produce any false positives, regardless of region of origin. BLAST searches did not return any highly homologous sequences be- longing to non-target species found in North America. All assays were able to detect target DNA concentration as low as 101 copies/μL of dilut- ed DNA extract (i.e., a total of 50 copies per reaction). All sequenced PCR fragments from tissue-derived DNA matched the target species.

Laboratory testing

Northern brook lamprey eDNA was successfully detected using PCR with the developed northern brook/silver lamprey markers after larvae were held in 10 L tanks (1.5 L sediment, 8.5 L water) for 1 h. In the den- sity trials, mean detection frequency (±SE) ranged from 0.75 (±0.20) for tanks with one larva to 1.00 (±0.00) for tanks with three and four larvae (Fig. 1a). Mean detection frequency did not vary significantly with larval density (ANOVA, F = 1.52, p = 0.35). In the temperature tri- als, mean detection frequency (±SE) ranged from 0.92 (±0.08) at 15 °C to 1.00 (±0.00) at 10 °C and 20 °C (Fig. 1b); eDNA detection frequency did not differ significantly with temperature (ANOVA, F = 1.00, p = 0.56). In the flow rate trials, mean detection frequency (±SE) ranged from 1.00 (±0.00) for tanks with no flow to 0.28 (±0.03) for tanks with a flow rate of 20 mL/s (Fig. 1c). Detection frequency was signifi- cantly related to flow rate (ANOVA, F = 774.54, p b 0.001); eDNA detec- Fig. 1. Mean detection frequency (±SE) of eDNA from northern brook lamprey held for 1 h tion frequency was significantly higher in tanks without flow compared in 10 L tanks (1.5 L sediment, 8.5 L water) at: (a) four different densities (1, 2, 3, and 4 to each of the other levels of flow (Tukey, HSD = 0.001, p b 0.001). Of larvae per tank) where the flow was 0 mL/s and temperature was 20 °C; (b) three temperatures (10 °C, 15 °C, and 20 °C) where density was 4 larvae per tank and flow the two tanks with 10 mL/s flow, one of the three equipment control rate was 0 mL/s; and (c) four flow rates (0, 10, 20, and 30 mL/s) where density was 4 PCRs tested positive for lamprey DNA, so all PCRs from this replicate larvae per tank and temperature was 20 °C. Each tank trial was performed in duplicate; were excluded. In all experimental trials, PCR products were the expect- mean detection frequency per tank was based on three PCRs from each of six water ed size for silver/northern brook lamprey (approximately 119 bp), and samples. species identity was confirmed in all five sequenced eDNA amplicons. None of the controls taken in the field tested positive, suggesting no Field testing during and after spawning contamination of the field equipment. All PCR products from positive samples were the expected size for sea lamprey (approximately Sea lamprey eDNA was successfully detected in water samples col- 225 bp), and those sequenced (n = 10) confirmed species identity. lected during and after the spawning season in the Little Thessalon River (Fig. 2). Mean detection frequencies (±SE) for samples collected Field testing in streams with different larval densities during the presumed spawning season (mid-May to late June) ranged from 0.81 (±0.18) to 0.97 (±0.03) when averaged across all transects Of the seven streams sampled between August 11 and August 19, and PCRs (Fig. 2a). Detection frequency began to drop gradually after 2013, sea lamprey eDNA was detected in only two: Watson Creek and June 25; by August 14, detection frequency was only 0.06 (±0.04). All Root River, which were characterized as having a high and medium 12 water samples collected per day tested positive for sea lamprey density of sea lamprey larvae, respectively (Table 4). Across all transects eDNA in at least one PCR until June 25; by July 22, only 2 of 12 water taken from each stream, the mean detection frequency (±SE) was 0.3 samples tested positive (Fig. 2b). (±0.09) for Watson Creek and 0.5 (±0.07) for the Root River. Mean Detection frequency varied significantly among transects (ANOVA, detection frequency in Little Thessalon River, also categorized as having F=9.91,p = 0.003). Mean detection frequency (±SE) for the four tran- a high sea lamprey larval density, was 0.06 (±0.04) on August 14, sects (from most downstream to most upstream) was 0.80 (±0.04), approximately 1.5 months after spawning ended (see field testing 0.73 (±0.04), 0.67 (±0.05), and 0.50 (±0.04) when averaged across during and after spawning). None of the controls taken in the field tested all sampling dates. eDNA detection at transect 4 (most upstream) was positive. All PCR products from positive samples were the expected size significantly lower than those of transects 1 and 2 (Tukey, HSD = for sea lamprey, and those sequenced (n = 10) confirmed species 7.36, p = 0.002 and HSD = 5.64, p = 0.03, respectively). Detection identity. at transect 4 was 0 by July 10; after July 22, sea lamprey eDNA was detected only at transect 1 (Fig. 3a, b). The mean detection frequency Discussion for sample locations within each transect (i.e., left bank, center stream, and right bank) were not significantly different (ANOVA, F = 1.71, This study demonstrates that environmental DNA is a highly prom- p = 0.45) and were pooled for each transect. ising tool for sea lamprey monitoring, and it may also have application T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 655

Fig. 2. Detection of sea lamprey eDNA in water samples collected between May 16 and August 14, 2013, from the Little Thessalon River: (a) mean detection frequency (±SE) based on three PCRs per water sample; and (b) number of water samples (out of 12) in which at least one PCR tested positive. Results from all four transects are pooled; (b) includes only those sampling dates in which all transects were sampled. Spawning sea lamprey were inferred to have moved into the river in late April to early May, and ceased to be captured in traps after June 25. towards the detection of native lamprey species which are of conserva- respectively. Mean detection frequency was 100% when three and tion concern. The genetic markers developed in the current study four larvae were held per tank. We expected that detection frequency specifically amplify DNA from each of sea lamprey, American brook would increase with density, as has been observed in some field studies lamprey, chestnut lamprey, and silver/northern brook lampreys. Only (e.g., Ficetola et al., 2008; Takahara et al., 2012), because it is likely silver and northern brook lampreys could not be distinguished by our that more cellular material is being released into the water at higher markers. This, however, does not represent a particular limitation of densities. However, we did not find a significant increase in detection the eDNA markers themselves. Silver and northern brook lampreys frequency with density, likely due to the small number of experimental cannot be distinguished by any known genetic methods (Docker et al., replicates (two) per density and because the detection frequency at our 2012; Ren et al., 2014), and researchers have recently questioned “low” density was already reasonably high. It is important to recognize the specific status of these species (April et al., 2011; Docker, 2009; that the conventional PCR method used here is unable to quantify the Hubert et al., 2008). Otherwise, all four markers were species-specific amount of DNA within a sample (see below). Although Ficetola et al. when tested with tissue-derived DNA, and were able to detect samples (2008) found a correlation between bullfrog Lithobates catesbeianus with a target sequence concentration as low as 50 copies per reaction. density (and, by inference, eDNA amounts) and average amplification The silver/northern brook lamprey and sea lamprey assays were further success using a multi-tube approach, detection frequency will not be a tested on water samples (in the laboratory and field, respectively), and reliable proxy for eDNA quantity if eDNA levels consistently exceed both were able to detect the presence of their respective lamprey spe- the threshold for detection. Conventional PCR will not be able to quan- cies under most conditions. Sea lamprey eDNA was readily detectable tify by how much the threshold is exceeded. Our experimental densities during and immediately following spawning, and—although further (corresponding to approximately 20–75 larvae/m2) were considerably work will need to be done to improve sensitivity (particularly under higher than most natural density estimates. Although maximum densi- conditions of high flow and/or low densities)—this study shows that ty (e.g., of young-of-the-year larvae, which typically measure b40 mm eDNA also holds promise as an effective monitoring tool for larval and b0.2 g; Ralph Lampman, Yakama Nation Fisheries Resource lampreys. Management Program, pers. comm., October 2015) in optimal lamprey In our laboratory tank experiments, single northern brook lamprey habitats may exceed 100 larvae/m2, mean densities over larger areas larvae (1.2 and 1.9 g in weight) held in 8.5 L standing water for 1 h (and presumably of larger larvae) will generally be one or two orders produced eDNA that was detectable in 55.7 and 94.5% of all PCRs, of magnitude lower (see Dawson et al., 2015). Moderate to high 656 T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659

Fig. 3. Detection of sea lamprey eDNA in water samples collected at four transects (T1 to T4, from downstream to upstream) in the Little Thessalon River betweenMay16andAugust14, 2013: (a) mean detection frequency (±SE) based on three PCRs per water sample; and (b) number of water samples (out of three) in which at least one PCR tested positive; (b) includes only those sampling dates in which all transects were sampled. densities of sea lamprey in Great Lakes tributaries are typically consid- water temperatures have been demonstrated to result in a less persis- ered to be N5 larvae/m2 (Steeves et al., 2003), and the highest densities tent eDNA signal, mostly due to increased microbial enzymatic activity sampled during the current study were 1–2 larvae/m2 (see below). In at higher temperatures (Dejean et al., 2011; Strickler et al., 2015; Zhu, future studies (particularly those exploring more sensitive assays; see 2006), suggesting that higher water temperature might result in lower below), a range of lower experimental densities (or biomass) should rates of detection. Although increased microbial degradation would be tested (i.e., using larger tanks and/or smaller larvae). not likely be apparent in the laboratory experiments after only 1 h, Follow-up studies should also use lower larval densities to test the this could significantly affect detectability in the field. effect of water temperature on eDNA detection frequency. Although Unlike density and temperature, water flow had a significant impact we found no significant effect of temperature (between 10 and 20 °C) on eDNA detection in the laboratory experiments; detectability was on detection frequency, these experiments were conducted only at 100% when northern brook lamprey larvae were held in standing the highest larval density when the detection rate appears to have water for 1 h but dropped to under 30% at 10–30 mL/s even at the been saturated. It would also be useful to test eDNA detection rates at highest larval density. Even at the lowest applied flow, cellular material temperatures below 10 °C. Growth and survival of larval lampreys was likely removed from the system almost as quickly as it was re- generally start to decrease at temperatures higher than 20 °C and the leased. These results suggest that stream flow may be one of the most average lethal temperature is around 28 °C (see Dawson et al., 2015), important factors affecting eDNA detection. In our field trials, larval but temperatures below 10 °C would be typical of those experienced sea lamprey were detectable in only two of six streams where they by larval lampreys in these basins prior to May 1 and after October 15 were present, potentially due to a combination of low larval density each year (DFO, unpublished data). Unlike the effect of density and and high flow rates (see below). Rates of flow in the field (on a volume flow rate (below) on eDNA detectability, the effect of temperature is per second basis) were orders of magnitude higher than in the labo- harder to predict. Although an increase in temperature might be expect- ratory (e.g., 50,000–1.31 × 106 mL/s in the Little Thessalon River), ed to increase the amount of cellular material released into the environ- but these cannot be directly compared given the much greater size ment (e.g., as a result of elevated activity levels or metabolic rates of the river systems. Nevertheless, high and variable rates of flow at higher temperatures), water temperature had no effect on eDNA may complicate the use of this methodology in lotic systems, although shedding rates in bighead Hypophthalmichthys nobilis and silver carp other studies (e.g., Goldberg et al., 2011) have successfully detected Hypophthalmichthys molitrix (Klymus et al., 2015). Furthermore, higher eDNA in flowing water. T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 657

Furthermore, in the field, flow will generally displace eDNA signals approximately 1 month before detection frequencies reached a level downstream from the source. In the present study, water samples (6–14%) more typical of a stream with only lamprey larvae, based taken 1–2 km downstream had higher detection frequencies (75–80%) on the detection frequencies observed in other streams with similar than those collected at the most upstream site (approximately 50%). densities (0–50%). This more gradual decrease in detection frequency This suggests that, for a general management application, the chance may have been caused by many different factors. For example, although of detecting an infestation should increase if sampling is performed no decomposing lamprey carcasses were found during visual surveys, it lower in the watershed, presumably because downstream sampling is possible that some carcasses may have still been present, releasing integrates the eDNA from a larger number of lampreys. It is possible, some—albeit a lower amount of—cellular material. Furthermore, other however, that the higher rate of detection at downstream sites was aquatic feed on the carcasses left by spawning lampreys (see the result of higher lamprey densities at these sites and, if eDNA Docker et al., 2015); and perhaps eDNA from the fecal matter of these degrades significantly as it drifts downstream, sampling lower in a scavengers was detected (Taberlet et al., 2012). There may also have watershed would not always be the best strategy. Longitudinal variation been an input of cellular material due to a relatively high mortality in eDNA detectability therefore should be further investigated. Al- rate for young-of-the-year lamprey larvae, which may have tapered though eDNA technologies generally cannot be used to precisely locate off in the month following spawning. By mid-August, detection fre- the source organisms themselves, one of the advantages of eDNA is that quency was only 6%; we suspect that this represents detection of pri- the precise location of the source organisms does not need to be identi- marily lamprey larvae. Although Little Thessalon River is characterized fied to detect their presence. A better understanding of the way in as having a high density of sea lamprey larvae, detection frequency which eDNA disperses and persists in a system will improve sampling was lower than in Watson Creek and Root River; this may again be design and maximize the likelihood of detection. DNA in the water evidence that greater stream size has a greater diluting effect on DNA appeared to be sufficiently homogenized at each transect, however, in the water. Nevertheless, measuring eDNA detectability during and that detection frequencies did not differ significantly between water after the spawning season in Little Thessalon River did allow us to samples taken at the center versus those taken at either bank. This sug- determine how long it would take for the eDNA signal from spawning gests that samples can be taken from the most easily accessible location. lamprey to diminish so that inferences could be made about larval For high-gradient streams or those that are otherwise hard to access, densities. More controlled field studies, however, would be required this flexibility in sampling location is very advantageous. to determine how much of the eDNA signal can be attributed to In our field study in the Great Lakes basin, water samples taken spawning and post-spawning activity versus resident larvae. Two re- from only one of two high-density (Watson Creek) and one of two cent studies have tested the ability of triple quadrupole mass spectrom- medium-density (Root River) streams yielded positive sea lamprey etry (MS/MS) or gas chromatography–mass spectrometry (GC/MS) for eDNA detections, and no eDNA was detected in the two low-density inferring the presence of larval (Stewart and Baker, 2012) and adult streams. As suggested above, this lack of detection even when sea lam- male (Xi et al., 2011) lampreys from minute environmental concentra- prey are present may be due to a combination of high flow rates and low tions of stage-specific pheromones. These pheromones, however, are density. The Michipicoten and Batchawana rivers, which tested nega- not species-specific(seereviewsbyMoser et al., 2015 and Johnson tive for sea lamprey eDNA despite being categorized as high- and et al., 2015, respectively) and would be unable to distinguish sea lam- medium-density streams, respectively, are much larger, deeper systems prey in the Great Lakes from the native lamprey species. than Watson Creek and Root River. Discharge in Batchawana River, Although the main focus of the present study was to test whether for example, was estimated to be more than 8 m3/s, whereas that in eDNA could be used for detecting the presence of larval sea lamprey the Root River was 0.5–0.6 m3/s. The lack of eDNA detection in the populations, this study also acts as a proof-of-concept that eDNA detec- Michipicoten and Batchawana rivers may be due to dilution; larval tion could be used in future monitoring programs to identify streams density estimates expressed as individuals per m2 does not account with reproducing lampreys. Although spawning lampreys can be quite for the number of individuals relative to the volume of water within visible in some stream systems—spawning during daylight hours in a system. Unless sensitivity can be increased (see below, including shallow riffle areas of clear headwater streams—they are far more diffi- increased confidence that inhibitors are not preventing detection in cult to detect in larger and more turbid river systems (Johnson et al., some streams), stream volume may be a major limiting factor for 2015). Because all lampreys die after spawning, eDNA assays used eDNA detection of larval lampreys in large river systems. However, during this high detection window could be very useful for detecting even at this stage of development, eDNA detection could be used as the presence of spawning lampreys of any species more efficiently a “red flag” warning system where positive detections would warrant than traditional methods. further investigation and potential consideration for treatment— However, although the PCR assays developed in the present study although lack of eDNA detection would not yet confidently suggest appeared capable of detecting eDNA from spawning lampreys and that sea lamprey larvae were absent. larvae when occurring at high density and, presumably, in lower flow In contrast, water samples taken during the sea lamprey spawning systems, greater sensitivity will be required for routine monitoring. season from the Little Thessalon River—where estimated discharge The next generation of eDNA surveillance methods are now adopting was on par with or higher than that of the Root River—consistently quantitative PCR (qPCR) assays using TaqMan® probes (e.g., Amberg yielded positive eDNA detections, generally mirroring spawning activi- et al., 2015; McKee et al., 2015; Takahara et al., 2012; Wilcox et al., ty. Water samples taken shortly after the beginning of the spawning 2013) or other techniques such as digital drop PCR (e.g., Doi et al., run already showed high detection frequencies; these increased to 2015; Nathan et al., 2014) to increase both sensitivity and species- 97% by late May and remained high until late June. During this period, specificity. Furthermore, unlike the conventional PCR method used in sea lamprey would have shown higher activity levels, been releasing the current study, qPCR and digital drop PCR are able to quantify the gametes into the environment, and dying soon after, causing a massive copy number of target sequences in a sample. These PCR methods also influx of cellular material into the water. By the end of June, no more decrease PCR inhibition by humic acids and other compounds found adult sea lamprey were being caught and visual surveys yielded no in natural bodies of water (Doi et al., 2015; Gibson et al., 2012), further decomposing adults. Correspondingly, detection frequencies began to reducing the likelihood of false negatives. Based on the sampling regime drop from late June to the end of July, falling from 86 to 14%. Although used in the present study, we estimated that detection of at least there were likely no more spawning lamprey remaining in the stream, one copy of the COI fragment per PCR would require a minimum of detection frequencies did not drop as rapidly as would be expected 167–333 copies per water sample and that, with multiple water sam- based on the dramatic drop in detection seen when flow was applied ples taken per stream and multiple PCRs per water sample, detection to larval tanks in the laboratory. In the Little Thessalon River, it took of at least one copy in at least one PCR per stream would require 658 T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659

3.1–12.3 copies per L stream water (see PCR amplification and evaluation Dawson, H.A., Quintella, B.R., Almeida, P.R., Treble, A.J., Jolley, J.C., 2015. The ecology of larval and metamorphosing lampreys. In: Docker, M.F. (Ed.), Lampreys: Biology. above). However, given that the detection limit of the sea lamprey assay Conservation and Control. Springer, Dordrecht, pp. 75–137. described here was 50 copies of template DNA per PCR, the detection Deiner, K., Walser, J.C., Mächler, E., Altermatt, F., 2015. Choice of capture and extraction rate of this assay will begin to approach 0% below 155–617 copies per methods affect detection of freshwater biodiversity from environmental DNA. Biol. Conserv. 183 (Spec. Issue), 53–63. L stream water. Quantitative and digital drop PCR, which do not rely Dejean, T., Valentini, A., Duparc, A., Pellier-Cuit, S., Pompanon, F., Taberlet, P., Miaud, C., on visually detecting amplicons on an agarose gel, are generally able 2011. Persistence of environmental DNA in freshwater ecosystems. PLoS One 6 (8), to come closer than conventional PCR to the theoretical PCR detection e23398. http://dx.doi.org/10.1371/journal.pone.0023398. limit of one copy of the target DNA sequence. Below this limit, however, Dejean, T., Valentini, A., Miquel, C., Taberlet, P., Bellemain, E., Miaud, C., 2012. Improved detection of an alien invasive species through environmental DNA barcoding: the ex- sensitivity can only be increased by increasing sampling effort (i.e., by ample of the American bullfrog Lithobates catesbeianus. J. Appl. Ecol. 49 (4), 953–959. increasing the volume of water collected per sample and the total num- Docker, M.F., 2009. A review of the evolution of nonparasitism in lampreys and an update of the paired species concept. Am. . Soc. Symp. 72, 71–114. ber of water samples). In the current study, the volume of stream water fl “ ” fi fi Docker, M.F., Mandrak, N.E., Heath, D.D., 2012. Contemporary gene ow between paired collected per sample was limited due to clogging of the lter after ltra- silver (Ichthyomyzon unicuspis) and northern brook (I. fossor) lampreys: implications tion of 1–2 L, but the total number of samples collected per stream could for conservation. Conserv. Genet. 13 (3), 823–835. be increased. False positives were already limited in the current study Docker, M.F., Hume, J.B., Clemens, B.J., 2015. Introduction: a surfeit of lampreys. In: fi Docker, M.F. (Ed.), Lampreys: Biology, Conservation and Control. Springer, Dordrecht, through speci city of the PCR assay and rigorous quality control and pp. 1–34. quality assurance methods to eliminate (or detect if present) contami- Doi, H., Takahara, T., Minamoto, T., Matsuhashi, S., Uchii, K., Yamanaka, H., 2015. Droplet nation during field testing and sample processing. digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species. Environ. Sci. Technol. 49 (9), In summary, we report that eDNA can be used for the detection and 5601–5608. identification of lampreys and is a promising monitoring tool for inva- Eshenroder, R.L., 2014. The role of the Champlain Canal and as putative corri- sive sea lamprey in the Great Lakes basin. Even conventional PCR assays dors for colonization of and Lake Ontario by sea lampreys. Trans. Am. Fish. Soc. 143 (3), 634–649. for eDNA appear to provide an excellent tool for identifying streams Ficetola, G.F., Miaud, C., Pompanon, F., Taberlet, P., 2008. Species detection using environ- with spawning sea lamprey, and should be applicable to all lamprey mental DNA from water samples. Biol. Letters 4 (4), 423–425. species (e.g., those of conservation concern) given the large amount of Foote, A.D., Thomsen, P.F., Sveegaard, S., Wahlberg, M., Kielgast, J., Kyhn, L.A., Salling, A.B., cellular material released into the environment by these semelparous Galatius, A., Orlando, L., Gilbert, M.T.P., 2012. Investigating the potential use of envi- ronmental DNA (eDNA) for genetic monitoring of marine mammals. PLoS One 7 fishes. Detection of sea lamprey larvae was possible in only two streams (8), e41781. http://dx.doi.org/10.1371/journal.pone.0041781. with a medium to high density of larvae, and suggested that success Gibson, K.E., Schwab, K.J., Spencer, S.K., Borchardt, M.A., 2012. Measuring and mitigating in eDNA monitoring for lamprey larvae is inversely correlated with inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46 (13), 4281–4291. the size and discharge of stream. Implementation of qPCR methods, Gingera, T.D., 2013. The Use of Environmental DNA (eDNA) for Detecting Larval Lampreys however, should increase sensitivity and allow for quantifying the within Stream Systems as a Tool for Conservation and Control Honours Undergraduate amount of target DNA in a sample, allowing us to further improve Thesis University of Manitoba. Goldberg, C.S., Pilliod, D.S., Arkle, R.S., Waits, L.P., 2011. Molecular detection of vertebrates upon the current eDNA assays. Sea lamprey eDNA detection methods in stream water: a demonstration using rocky mountain tailed frogs and Idaho giant could potentially reduce cost and increase efficiency of current manage- salamanders. PLoS One 6 (7), e22746. http://dx.doi.org/10.1371/journal.pone. ment strategies by serving as a “red flag” system, identifying streams 0022746. Goldberg, C.S., Sepulveda, A., Ray, A., Baumgardt, J., Waits, L.P., 2013. Environmental DNA with spawning adults as well as streams with large larval populations as a new method for early detection of New Zealand mudsnails (Potamopyrgus that require more thorough assessment. Due to the well-established antipodarum). Freshw. Sci. 32 (3), 792–800. monitoring systems being implemented by North American govern- Hubert, T.D., 2003. Environmental fate and effects of the lampricide TFM: a review. J. Great Lakes Res. 29 (1), 456–474. ments dedicated to identifying infested stream systems and controlling Hubert, N., Hanner, R., Holm, E., Mandrak, N.E., Taylor, E., Burridge, M., Watkinson, D., infesting populations, the tremendous amount of data available regard- Dumont, P., Curry, A., Bentzen, P., Zhang, J., April, J., Bernatchez, L., 2008. Identifying ing the distribution and density of sea lamprey populations provide an Canadian freshwater fishes through DNA barcodes. PLoS One 3 (6), e2490. http:// excellent opportunity for the study and calibration of eDNA methods. dx.doi.org http://dx.doi.org/10.1371/journal.pone.0002490. Jerde, C.L., Mahon, A.R., Chadderton, W.L., Lodge, D.M., 2011. “Sight-unseen” detection of rare aquatic species using environmental DNA. Conserv. Lett. 4 (2), 150–157. Jerde, C.L., Chadderton, W.L., Mahon, A.R., Renshaw, M.A., Corush, J., Budny, M.L., Acknowledgments Mysorekar, S., Lodge, D.M., 2013. Detection of Asian carp DNA as part of a Great Lakes basin-wide surveillance program. Can. J. Fish. Aquat. Sci. 70 (4), 522–526. Johnson, N.S., Buchinger, T.J., Li, W., 2015. Reproductive ecology of lampreys. In: Docker, This project was funded by the Great Lakes Fishery Commission. M.F. (Ed.), Lampreys: Biology, Conservation and Control. Springer, Dordrecht, The authors thank Lucy Johnson and Cassidy Erdelyan who provided pp. 265–303. fi assistance in the laboratory during the initial development of the Klymus, K.E., Richter, C.A., Chapman, D.C., Paukert, C., 2015. Quanti cation of eDNA fi shedding rates from invasive bighead carp Hypophthalmichthys nobilis and silver species-speci c PCR assays, Aditi Singh who helped with DNA extrac- carp Hypophthalmichthys molitrix. Biol. Conserv. 183 (Spec. Issue), 77–84. tions, and Erin Spice and Stacey Collerone who assisted in the lab and Kreader, C.A., 1996. Relief of amplification inhibition in PCR with bovine serum albumin the field. or T4 gene 32 protein. Appl. Environmental Microbiol. 62 (3), 1102–1106. Laramie, M.B., Pilloid, D.S., Goldberg, C.S., 2015. Characterizing the distribution of an endangered salmonid using environmental DNA analysis. Biol. Conserv. 183 (Spec. Issue), 29–37. References Lodge, D.M., Turner, C.R., Jerde, C.L., Barnes, M.A., Chadderton, L., Egan, S.P., Feder, J.L., Mahon, A.R., Pfrender, M.E., 2012. Conservation in a cup of water: estimating biodi- Amberg, J.J., McCalla, S.G., Monroe, E., Lance, R., Baerwaldt, K., Gaikowski, M.P., 2015. versity and population abundance from environmental DNA. Mol. Ecol. 21 (11), Improving efficiency and reliability of environmental DNA analysis for silver carp. 2555–2558. J. Great Lakes Res. 41 (2), 367–373. MacKenzie, D.I., Nichols, J.D., Sutton, N., Kawanishi, K., Bailey, L.L., 2005. Improving infer- April, J., Mayden, R.L., Hanner, R.H., Bernatchez, L., 2011. Genetic calibration of species ences in population studies of rare species that are detected imperfectly. Ecology 86 diversity among North America's freshwater fishes. Proc. Natl. Acad. Sci. U. S. A. 108 (5), 1101–1113. (26), 10602–10607. Maitland, P.S., Renaud, C.B., Quintella, B.R., Close, D.A., Docker, M.F., 2015. Conservation of Armstrong, K.F., Ball, S.L., 2005. DNA barcodes for biosecurity: invasive species identifica- native lampreys. In: Docker, M.F. (Ed.), Lampreys: Biology, Conservation and Control. tion. Philos. Trans. R. Soc. B 360 (1462), 1813–1823. Springer, Dordrecht, pp. 375–428. Bayley, P.B., Peterson, J.T., 2001. An approach to estimate probability of presence and rich- Matsui, K., Honjo, M., Kawabata, Z., 2001. Estimation of the fate of dissolved DNA in ness of fish species. Trans. Am. Fish. Soc. 130 (4), 620–633. thermally stratified lake water from the stability of exogenous plasmid DNA. Aquat. Bergstedt, R.A., Swink, W.D., 1995. Seasonal growth and duration of the parasitic life stage Microbiol. Ecol. 26 (1), 95–102. of the landlocked sea lamprey (Petromyzon marinus). Can. J. Fish. Aquat. Sci. 52 (6), McKee, A.M., Spear, S.F., Pierson, T.W., 2015. The effect of dilution and the use of a post- 1257–1264. extraction nucleic acid purification column on the accuracy, precision, and inhibition Darling, J.A., Mahon, A.R., 2011. From molecules to management: adopting DNA-based of environmental DNA samples. Biol. Conserv. 183 (Spec. Issue), 70–76. methods for monitoring biological invasions in aquatic environments. Environ. Res. Minamoto, T., Yamanaka, H., Takahara, T., Honjo, M.N., Kawabata, Z.I., 2012. Surveillance 111 (7), 978–988. of fish species composition using environmental DNA. Limnology 13 (2), 193–197. T.D. Gingera et al. / Journal of Great Lakes Research 42 (2016) 649–659 659

Moser, M.L., Almeida, P.R., Kemp, P.S., Sorensen, P.W., 2015. Lamprey spawning migration. Spear, S.F., Groves, J.D., Williams, L.A., Waits, L.P., 2015. Using environmental DNA In: Docker, M.F. (Ed.), Lampreys: Biology, Conservation and Control. Springer, methods to improve detectability in a hellbender (Cryptobranchus alleganiensis) Dordrecht, pp. 215–263. monitoring program. Biol. Conserv. 183 (Spec. Issue), 38–45. Nathan, L.R., Simmons, M.D., Wegleitner, B., Jerde, C.L., Mahon, A., 2014. Quantifying envi- Spice, E.K., Docker, M.F., 2014. Reduced fecundity in non-parasitic lampreys may not be ronmental DNA signals for aquatic invasive species across multiple detection plat- due to heterochronic shift in ovarian differentiation. J. Zool. 294 (1), 50–58. forms. Environ. Sci. Technol. 48 (21), 12800–12806. Steeves, T.B., Slade, J.W., Fodale, M.F., Cuddy, D.W., Jones, M.L., 2003. Effectiveness of Neave, F.B., Mandrak, N.E., Docker, M.F., Noakes, D.L., 2007. An attempt to differentiate using backpack electroshocking gear for collecting sea lamprey (Petromyzon marinus) sympatric Ichthyomyzon ammocoetes using meristic, morphological, pigmentation, larvae in Great Lakes tributaries. J. Great Lakes Res. 29 (Suppl. 1), 161–173. and gonad analyses. Can. J. Zool. 85 (4), 549–560. Stewart, M., Baker, C.F., 2012. A sensitive analytical method for quantifying petromyzonol Nienhuis, S., Haxon, T.J., Dunkley, T.C., 2014. An empirical analysis of the consequences of sulfate in water as a potential tool for population monitoring of the southern pouched zebra mussel invasions on fisheries in inland, freshwater lakes in Southern Ontario. lamprey, australis, in New Zealand streams. J. Chem. Ecol. 38, 135–144. Manag. Biol. Invasion. 5 (3), 287–302. Stewart, K.W., Watkinson, D.A., 2004. The Freshwater of Manitoba. University of Pilliod, D.S., Goldberg, C.S., Arkle, R.S., Waits, L.P., 2013. Estimating occupancy and abun- Manitoba Press, Manitoba. dance of stream amphibians using environmental DNA from filtered water samples. Strickler, K.M., Fremier, A.K., Goldberg, C.S., 2015. Quantifying effects of UV-B, tem- Can. J. Fish. Aquat. Sci. 70 (8), 1123–1130. perature, and pH on eDNA degradation in aquatic microcosms. Biol. Conserv. 183 Pimentel, D., Zuniga, R., Morrison, D., 2005. Update on the environmental and economic (Spec. Issue), 85–92. costs associated with alien-invasive species in the United States. Ecol. Econ. 52 (3), Taberlet, P., Coissac, E., Hajibabaei, M., Rieseberg, L.H., 2012. Environmental DNA. Mol. 273–288. Ecol. 21 (8), 1789–1793. Reaser, J.K., Meyerson, L.A., Cronk, Q., De Poorter, M., Eldrege, L.G., Green, E., Kairo, M., Takahara, T., Minamoto, T., Yamanaka, H., Doi, H., Kawabata, Z.I., 2012. Estimation of fish Latasi, P., Mack, R.N., Mauremootoo, J., O'Dowd, D., Orapa, W., Sastroutomo, S., biomass using environmental DNA. PLoS ONE 7 (4), e35868. http://dx.doi.org/10. Saunders, A., Shine, C., Thrainsson, S., Vaiuti, L., 2007. Ecological and socioeconomic 1371/journal.pone.0035868. impacts of invasive alien species in island ecosystems. Environ. Conserv. 34 (2), Takahara, T., Minamoto, T., Doi, H., 2013. Using environmental DNA to estimate the distri- 98–111. bution of an invasive fish species in ponds. PLoS One 8 (2), e56584. http://dx.doi.org Ren, J., Buchinger, T., Pu, J., Jia, L., Li, W., 2014. Complete mitochondrial of http://dx.doi.org/10.1371/journal.pone.0056584. paired species northern brook lamprey (Ichthyomyzon fossor) and silver lamprey Thomsen, P.F., Kielgast, J.O.S., Iversen, L.L., Wiuf, C., Rasmussen, M., Gilbert, M.T.P., (I. unicuspis). Mitochondrial DNA Oct 16, 1–2. http://www.ncbi.nlm.nih.gov/ Orlando, L., Willerslev, E., 2012a. Monitoring endangered freshwater biodiversity pubmed/25319286. using environmental DNA. Mol. Ecol. 21 (11), 2565–2573. Siefkes, M.J., Steeves, T.B., Sullivan, W.P., Twohey, M.B., Li, W., 2012. Sea lamprey control: Thomsen, P.F., Kielgast, J., Iversen, L.L., Møller, P.R., Rasmussen, M., Willerslev, E., 2012b. past, present, and future. In: Taylor, W.W., Lynch, A.J., Leonard, N.J. (Eds.), Great Lakes Detection of a diverse marine fish fauna using environmental DNA from seawater Fisheries Policy and Management: A Binational Perspective, second ed. Michigan samples. PLoS One 7 (8), e41732. http://dx.doi.org/10.1371/journal.pone.0041732. State University Press, East Lansing, pp. 651–704. Valentini, A., Pompanon, F., Taberlet, P., 2008. DNA barcoding for ecologists. Trends Ecol. Sigsgaard, E.E., Carl, H., Møller, P.R., Thomsen, P.F., 2015. Monitoring the near-extinct Evol. 24 (2), 110–117. European weather loach in Denmark based on environmental DNA from water Wilcox, T.M., McKelvey, K.S., Young, M.K., Jane, S.F., Lowe, W.H., Whiteley, A.R., Schwartz, samples. Biol. Conserv. 183 (Spec. Issue), 46–52. M.K., 2013. Robust detection of rare species using environmental DNA: the impor- Simberloff, D., 1981. Community Effects of Introduced Species. In: Nitecki, T.H. (Ed.), Biotic tance of primer specificity. PLoS One 8 (3), e59520. http://dx.doi.org/10.1371/ Crises in Ecological and Evolutionary Time. Academic Press, NewYork, pp. 53–81. journal.pone.0059520. Slade, J.W., Adams, J.V., Christie, G.C., Cuddy, D.W., Fodale, M.F., Heinrich, J.W., Quinlan, Xi, X., Johnson, N.S., Brant, C.O., Yun, S.S., Chambers, K.L., Jones, A.D., Li, W., 2011. Quanti- H.R., Weise, J.G., Weisser, J.W., Young, R.J., 2003. Techniques and methods for estimat- fication of a male sea lamprey pheromone in tributaries of Laurentian Great Lakes ing abundance of larval and metamorphosed sea lampreys in Great Lakes tributaries, by liquid chromatography tandem mass spectrometry. Environ. Health Tech. 45, 1995 to 2001. J. Great Lakes Res. 29 (Suppl. 1), 137–151. 6437–6443. Smith, B.R., Tibbles, J.J., 1980. Sea lamprey (Petromyzon marinus) in lakes Huron, Zhu, B., 2006. Degradation of plasmid and plant DNA in water microcosms monitored by Michigan, and Superior: history of invasion and control, 1936–78. Can. J. Fish. Aquat. natural transformation and real-time polymerase chain reaction (PCR). Water Res. 40 Sci. 37 (11), 1780–1808. (17), 3231–3238.