Expression and Transcriptional Regulation of the PD-Ialautotaxin Gene in Neuroblastoma1 Hiroyuki Kawagoe, Mary L

(CANCER RESEARCH57. 2516-2521. June 15. 19971 Expression and Transcriptional Regulation of the PD-IalAutotaxin Gene in Neuroblastoma1 Hiroyuki Kawagoe, Mary L. Stracke, Hajime Nakamura, and Kimihiko Sano2 Department of Pediatrics, Kobe University School of Medicine, 7-5-1 Kusunoki-cho. Chuo-ku, Kobe 650, Japan [H. K.. H. N.. K. S.]. and Laborators of Pathology, National Cancer institute, NIH. Bethesda, Maryland 20892 [M. L S.]

ABSTRACT cDNA and designated it PD-Ia (9, 10). The nucleotide sequence of human PD-Ia is identical with ATX except that PD-Ia lacks 156 Autotaxin (ATX) is a newly found autocrine tumor cell motility-stim. nucleotides of ATX; therefore, human PD-Ia and ATX are likely to be ulating factor. ATX is a member of the ecto-phosphodiesterase I (PD-I)/ both alternative splicing products from one gene, which is located at nucleotide pyrophosphatase family. PD-Ia was found as a brain-type ecto-phosphodiesterase 1/nucleotide pyrophosphatase. ATX and PD-Ia 8q24.l (9). The deduced amino acid sequence of human PD-Ia was are alternative splicing products from one gene. ATX stimulates motility 89% identical to that of rat PD-Ia (10), and the overall structure of of A2058 melanoma cells in vitro; however, it has not been known if human PD-Ia/ATX was closely related to those of rat PD-Ia and PD-Ia/ATX is expressed in naturally occurred human tumors. In this human and mouse PC-l. Both human PD-Ia/ATX and rat PD-Ia have study, we examined the expression of the human PD-JaJATX gene in a domain that reveals homology with the somatomedin B-like domain human neuroblastoma tumor tissues and the motility stimulating activity of vitronectin, a putative plasminogen activator inhibitor binding site of recombinant ATX on neuroblastoma cells and investigated its tran scriptional regulatory mechanism in a human neuroblastoma cell line. The (11, 12), and the RGD (arginine-glycine-asparticacid)tripeptide PD-Ia/ATX gene was expressed in the primary tumor tissues from neu motifs, which are possibly recognized by a@j3integrins (13, 14). The roblastoma patients to varying degrees. This gene is also expressed in the amino acid sequence of the putative catalytic site is well conserved SMS-KAN neuroblastoma cell line. We identified both isoforms, PD-Ia among the family proteins PC-i, rat PD-Ia, human PD-Ia/ATX, and and ATX, in these tumor tissues and SMS-KAN cells. The recombinant rat PD-1f3, which we cloned from the rat intestine.4 Although human ATX stimulated the motility of SMS-KAN cells at low nanomolar concen PD-Ia/ATX is suspected to play a role in the migration of tumor cells tration. We situated the promoter region, which is essential for its tran in de novo tumors, the expression of this gene in human tumor tissues scription in SMS-KAN cells, at â€”287toâ€”254nucleotidesby the promoter activity assay. The gel-shift assay revealed that there exists a nuclear has not been demonstrated. We first analyzed the expression of the protein in SMS-KAN cells that binds this region. These new insights about PD-Ia/ATX gene in a variety of cell lines derived from human tumors autocnne tumor cell motility-stimulating protein will help us to under of childhood including neuroblastoma, glioma, myeboid leukemia, stand the metastatic mechanism of human neuroblastoma. lymphoid leukemia, rhabdomyosarcoma, Wilms' tumor, and Ewing's sarcoma. We found that neuroblastoma cell lines express this gene, INTRODUCTION but other cell lines tested did not express this gene to a detectable extent (data not shown). Cell migration is an important process not only for embryonab In this report, we have examined the expression of the human development but also for tumor metastasis (1). The exact mechanism PD-kiJATX gene in the primary tumor tissues from neuroblastoma of this cellular event is not clear; however, several factors including patients. We identified the transcripts of the human PD-IeJATX gene some cytokines are thought to be involved in the migration of tumor in tumor tissues from neuroblastoma patients. The recombinant ATX cells (2, 3). Some tumor cell lines respond in a motile fashion to an stimulated the cell motility of SMS-KAN neuroblastoma cells in vitro. autocrine tumor motility-stimulating factor (2). We have found that a These results suggest that human PD-Ia/ATX might play a role in the Mr 125,000 glycoprotein, which was identified in the conditioned migration of human neuroblastoma as an autocrine motility-stimulat medium from A2058 human melanoma cells, stimulates both random ing factor. The rat PD-Ia gene is expressed in the brain and up and directed migration of the same melanoma cells and designated it ATX3 (4). ATX is a member of autocrine motility-stimulating factor regulated according to development (10). Rat PD-Ia mRNA is local and is thought to act through its receptor on the cell surface (4). The ized in the choroid plexus epithebiab cells, retinal pigment epithelial amino acid sequence of ATX reveals 45% identity with plasma cell cells, and some glial cells in brain parenchyma (10). The regulatory surface antigen PC-l (5, 6), which has phosphodiesterase I (EC mechanisms of its gene expression is not known at present. We have 3. 1.4. 1)/nucleotide pyrophosphatase (EC 3.6. 1.9) activities (7). reported the DNA sequence of the putative promoter region of the Phosphodiesterase 1/nucleotide pyrophosphatase is a widely cx human PD-IiJATX gene (9). This region has no typical TATA box or pressed ectoenzyme. Phosphodiesterase L'nucleotide pyrophosphatase CAAT box, and there are several putative transcription factor binding cleaves phosphosulfate, PP1. and phosphodiester bonds, and its activ sites in this region. To gain further understanding of the transcrip ity was found in most human organs and body fluids (8). However, the tionab regulatory mechanism of the PD-Ia/AiX gene, we have ana physiological function of this enzyme has not been known. We have lyzed this promoter region for its activity using SMS-KAN human cloned brain-type phosphodiesterase 1/nucleotide pyrophosphatase neuroblastoma cells. Promoter activity assay demonstrated that the essential region for the cell type-specific transcription of this gene is Received 12/30/96; accepted 4/22/97. located at â€”287to â€”254nucleotides (the A of initiation codon ATG The costs of publication of this article were defrayed in part by the payment of page is defined as + 1 bp). Nuclear extract from SMS-KAN cells retarded charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. the ebectrophoretic mobility of synthetic oligonucleotide containing @ This work was supported in part by a Grant-in-Aid for Scientific Research and this sequence. We surmise the existence of a cell type-specific tran Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture (1996) and a grant from The Ryoichi Naito Foundation for scriptional regulatory protein for the PD-Ia/ATX gene in SMS-KAN Medical Research (1996). cells. 2 To whom requests for reprints should be addressed. Phone: 81-78-341-7451, exten sion 5722; Fax: 81-78-371-6239; E-mail: [email protected]. 3Theabbreviationsusedare:ATX, autotaxin; @-gaI,@3-galactosidase;CMV,cytomeg 4 K. Terashima and K. Sano, Molecular cloning and localization of rat intestinal alovirus; RT-PCR, reverse transcription-PCR; PVP, polyvinylpyrrolidone. phosphodiesterase 1/nucleotide pyrophosphatase (PD-I@3),submitted for publication. 2516

MATERIALS AND METHODS 0.3% Tween 20, the blot was incubated with 1:400 dilution of disodium 3-(4-methoxyspiro{l,2-dioxethane-3,2'-(S'-chloro) tricyclo[3.3.3.13,7] de Reagents. Restriction endonucleases were obtained from New England can )-4-yl) phenyl phosphate solution for S mm at room temperature. The blot Biolabs (Beverly, MA). Taq DNA polymerase was from Perkin-Elmer (Nor was exposed to a KOdak X-Omat AR film for 20 mm. walk, CT). pGL2 basic plasmids, pGL2 control plasmids, luciferase assay Analysis of Human PD-Ia/ATX Isoforms. cDNA was synthesized from @ reagent, and T4 polynucleotide kinase were from Promega Corp. (Madison, each 1 oftotal RNA extracted from tumor tissues and SMS-KAN cells (15) WI). [a-32PJdCTP, [a-32P]UTP, [y-32P]ATP,Multiprime DNA-labeling sys as described above. The resulted cDNAs and genomic DNA from human tern, and positive-charged nylon membrane (Hybond-N+) were from Amer placenta were subjected to PCR reactions. The oligonucleotide primers for sham International (Buckinghamshire, United Kingdom). T31T7in vitro tran PCR were as follows: sense, AGATGGTGGGGAGGTCAACC (position: scription system, pBluescript II KS(+) plasmid, pBK-CMV plasmid, +757/+776 ofboth human PD-Ia and AIX cDNA): antisense-l, CACCGAT ExpressHyb hybridization solution, and human @-actincDNAprobe were from GCAG1TI1'AGTFG (position: + 1052/+ 1033 of human PD-Ia cDNA Clontech (Palo Alto, CA). Digoxigenin DNA labeling kit, anti-digoxigenin and + l208/+ I 187 of ATX cDNA); and antisense-2, AGTAAAAGGTGAG alkaline phosphatase conjugate Fab fragments, disodium 3-(4-methoxy GCATAAC (position: +999/+980 of ATX cDNA, specific to ATX). PCR spiro{ l,2-dioxethane-3,2'-(5'-chloro) tricyclo[3.3.3.13,71decan}-4-yl) phenyl reactions were performed using the primer pairs of sense and antisense-1 or phosphate solution, and digoxigenin-labeled DNA molecular weight marker sense and antisense-2 under the following conditions: 94Â°Cfor5 mm followed were from Boehringer-Mannheim (Mannheim, Germany). Escherichia coli by 94Â°Cfor1 mm; 55Â°Cfor1 mm; 72Â°Cfor2 mm; and 30 cycles terminated rRNA was from Sigma Chemical Co. (St. Louis, MO). Random hexamers, by incubation at 72Â°Cfor5 mm. Detection of the sequence-specific amplified Moloney murine leukemia virus reverse transcriptase, DMEM, and Cellfectin products was carried out as described above. were from Life Technologies, Inc. (Gaithersburg, MI). Sequenase version 2.0 Preparation of Recombinant ATX. ATX cDNA, which included the DNA sequencing kit, M13 primer, and single-strand Ml3 DNA were from full-length open reading frame, was subcloned into the plasmid transfer vector United States Biochemical (Cleaveland, OH). mRNA purification kit was from pMJ6O1(16) and then transfected into vaccinia virus (17). BS-C-I cells were Pharmacia Biotech, Inc. (Uppsala, Sweden). Forty-eight-well microchemotaxis infected with the recombinant virus, and then culture lysate was collected and chambers and PVP-free polycarbonate membranes with 12-pm pores were filtered through an Easy Flow Filter, molecular weight cutoff of Mr 300,000, from NeuroProbe (Cabin John, MD). Duff-Quick was from American Scien to remove virus particles. The lysate was concentrated in an Amicon ultrafil tific Products (McGaw Park, IL). @3-gal-CMVplasmidwas a gift from Dr. tration device, Diaflo YM3O membrane, and then sequentially fractionated Yasuhiko Okimura (Third Department of Internal Medicine, Kobe University through agarose-bound conA and Zorbax Bioseries wax columns as described School of Medicine). Other chemicals used were of analytical grade. previously (4). Fractions were tested for motility in chemotaxis assays using Northern Blot Analysis. Each 10 @tgoftotal RNA, which were extracted A2058 cells and purity by silver stain of a SDS-polyacrylamide gel. The pure from tumor tissues and cell lines, was denatured and electrophoresed on a 1% active fractions were dialyzed into 50 mist Tris/HCI (pH 7.5) and 20% ethylene agarose gel containing 3% formaldehyde and 0.5 @xWmbof ethidium bromide. glycol and stored at 5Â°C. This preparation is more than 95% pure when Each gel was photographed under UV illumination, and no rRNA degradation estimated by silver staining of the gel. was confIrmed. Total RNA was transferred by a capillary blot method in lox Cell Motility Assay. Cell motilityassay was performedin triplicateusing SSC (1x SSC: 15mMNaCI and 15mr@isodiumcitrate) to a Hybond-N+ nylon a 48-well microchemotaxis chamber. PVP-free polycarbonate membranes with membrane. The blots were prehybridized at 42Â°Cfor16 h in a buffer contain 12-xm pores were coated with type IV collagen. Recombinant ATX was ing 5x SSC, 45% formamide, 0.5% SDS, 3x Denhardt's solution (1x diluted in DMEM containing 0. 1% BSA to appropriate concentration and then Denhardt's solution: 0.02% BSA, 0.02% Ficoll, and 0.02% PVP), and 0.1 placed in the lower wells of the chambers. SMS-KAN cells were added to the mg/mI yeast tRNA. Then the blots were hybridized with a probe at 2 x 106 upper wells, and the chambers were incubated for 6 h at 37Â°C. After incuba cpm/ml. The probe was labeled with [a-32P] dCTP using the Multiprime DNA tion, the membranes were removed from the chambers, fixed, and stained by labeling system. The probe was the 0.9-kb fragment of human PD-Ia cDNA Diff-Quick. Chemotaxis was quantitated by counting randomly chosen me encoding the 5' part of the coding region. After a 24-h hybridization, the blots dium power fields under the light microscopy (x 200) for each replicate. were washed in 2x SSC at room temperature for S mm twice and in 2x SSC Random motility was assayed by adding DMEM-0.l% BSA alone to the lower containing 0.1% SDS at 65Â°Cfor30 rain twice. The blots were exposed to a wells and was subtracted out for each data point. KOdak X-Omat AR film at â€”70Â°Cwithintensifying screens. As a further RNase Protection Assay. The 542-bp human PD-Ia/ATX genomic DNA control to demonstrate the presence of the hybridized mRNA, all blots were fragment that was positioned at â€”525 to + 17 nucleotides was subcloned into rehybridized with a probe for a ubiquitous mRNA, human (3-actin. pBK-CMV plasmid. The radiolabeled antisense RNA probe was made using I RT-PCR for PD-IaIATX in Primary Neuroblastoma Tissues. Each 1 ,xg of this plasmid as a template with T7 RNA polymerase in the presence of ,.tg of total RNA extracted from tumor tissues was denatured at 65Â°Cfor10 50 pCi of [a-32PIUTP (800 mCi/mmol). The radiolabeled probe was analyzed mm in the presence of 2.5 msi random hexamers and then chilled on ice. cDNA by PAGE and checked for full-length extension. The full-length band was synthesis was carried out in a solution containing 100 units of Moloney murine excised and then extracted in 0.5 M ammonium acetate containing I mM EDTA leukemia virus reverse transcriptase and deoxynucleotide triphosphates at 1 and 0.1% SDS for 2 h at 37Â°C.The poly(A)@ RNA was extracted from mM each for 40 mm at 42Â°Cin a final volume of 20 p1. The resulted cDNA SMS-KAN cells using mRNA purification kit (Pharmacia). Approximately was subjected to PCR reactions. The oligonucleotide primers for PCR were as 1 x l0@cpm of the antisense RNA probe was hybridized with 5 @xgof follows: sense, 5'-ATGGCAAGGAGGAGCTCGTTC (+ 1/+21 of PD-Ia po1y(Ai@RNA from SMS-KAN cells and 10 @xgofcontrol E. coli rRNA at cDNA, the A of initiation codon ATO of human PD-Ict/ATX cDNA was 42Â°C for 16 h in hybridization buffer consisting of 0.4 M NaCI, 2 msi EDTA, defined as + 1); and antisense, 5'-GGTAACTfCCTCTGCICATGGT (+ 1648/ 40 m@i 1,4-piperazinediethanesulfonic acid (pH 6.4), and 80% formamide. + 1627 of PD-Ia cDNA). PCR reactions were performed with Taq DNA Following hybridization, the samples were digested in a solution containing 20 polymerase under the following conditions: 94Â°C for 5 mm followed by 94Â°C @g/mlRNase A and 350 units/mI RNase Tl at 37Â°Cfor 30 mm. After for 1 mm; 60Â°Cfor1 mm; and 72Â°Cfor2 mm; and 20 cycles terminated by digestion, the samples were precipitated with ethanol, resuspended in loading incubation at 72Â°CforS mm. The PCR products and a digoxigenin-labeled buffer (80% formamide, 0.1% xylene cyanol, 0.1% bromphenol blue, and 10 DNA molecular weight marker were electrophoresed on a 1% agarose gel, mM EDTA), and run on a 6% polyacrylamide DNA sequencing gel containing denatured, and then transferred to a nylon membrane. The blot was hybridized 7 M urea. The gel was exposed to a Fuji X-ray film with an intensifying screen in the ExpressHyb hybridization solution at 60Â°Cwith50 ng of a digoxigenin at â€”80Â°C.The same experiments were repeated several times. labeled probe. The probe was the same as used for the Northern blot. After 1-h Promoter Activity Assay. The 5' region of human PD-Ia/ATX genomic hybridization, the blot was washed in 2x SSC containing 0.1% SDS at room DNA was subcloned into pBluescript KS(+) plasmid. The inserts were deleted temperature for 15 mm twice and in 0.1x SSC containing 0.1% SDS at 60Â°C using Exonuclease III and S 1 nuclease and sequenced. A part of deleted inserts for 15 mm twice. The blot was incubated in the solution containing 1% were subcloned into the pGL2 basic plasmids, upstream of the luciferase gene. blocking reagent and then incubated with the 1:10,000 diluted anti-digoxige These constructed reporter plasmids were designated PD-Ia R1 (position: nm-alkaline phosphatase conjugate Fab fragments for 30 mm at room temper â€” 1 l97/+ 17 nucleotides), R2 (position: â€”833/+ 17 nucleotides), R3 (position: ature. After washing in 0.1 Mmaleic acid at pH 7.5 containing 0.15 MNaCI and â€”287/+ 17 nucleotides), and R4 (position: â€”254/+ 17 nucleotides). Each 2 pg 2517

of these reporter plasmids and a pGL2 control plasmid, possessing SV4O promoter linked to the luciferase gene, were transfected to SMS-KAN cells and A HeLa cells using cationic liposome, Cellfectin, according to the manufacturer's directions. To normalize the transfection efficiency, these cells were cotrans human PD-I OIATX fected with f3-gal-CMVplasmids containing @3-galgenelinked to the CMV promoter and assayed for p3-gal activity. After a 72-h incubation, these cells 1 2 3 4 5 6 7 8 91011121314 Kb were harvested and subjected to the luciferase assay. In brief, the cells were -.10-- 4.4

@ lysed in 25 mM Tris-phosphate (pH 7.8) containing 2 msi DTT, 2 mist . *1@ l,2-diaminocycbohexane-N,N,N',N'-tetraacetic acid, 10% glycerol, and 1% Triton X- 100, and the lysates were mixed with the luciferase assay reagent at @â€”2.4 room temperature. Within each series of transfection assays, the amounts of these lysates were adjusted on the @3-galactivity.Their produced light inten sities were measured for 20 s by the lumiphotometer (model TD-4000; NDS, Tokyo, Japan), and transactivations were expressed as the fold increase over the activity of the pGL2 control plasmid. All measurements were made with dishes in triplicate, and the averages are reported. @-actin Preparation of the Nuclear Extract. The nuclear extract was prepared from SMS-KAN cells. Approximately 1 x l0@cells were washed with the 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Kb @ @L @@â€”2.4 washing buffer (10 mM Tris/HC1 at pH 7.5 containing 150 miss NaCI, S miss KC1,and 8 mMMgC12)and then suspended in the hypotonic buffer (20 miss

Hepes/KOH at pH 7.9 containing 5 mM KCI, 0.5 mM MgCI2, 0.5 miss DTT, and .@ ,. I miss phenylmethylsulfonyb fluoride). This solution was incubated at 4Â°C for 10 mm, homogenized with a Dounce homogenizer, and centrifuged at 1000 x g for 10 mm at 4Â°C.Thepellet was suspended in the extraction buffer (20 mist HepesIKOH at pH 7.9 containing 500 mist NaC1, 1.5 mist MgCl2, 0.2 mM EDTA, 25% glycerol, 0.5 mM Dli', 1 mist phenylmethylsulfonyl fluoride, and 0.7 @g/mlpepstatinA), incubated at 4Â°Cfor1 h, and then centrifuged at B 100,000 x g for 30 mm at 4Â°C.Thissupernatant was used for further analysis. 1 2 3 4 5 6 7 Gel-Shift Assay. The oligodeoxynucleotides (sense, AACAAACCCTC CTGTfGCCAGAGGATACCACATGAAAGTGTCTGTGOGU; antisense, RT - +- + - + - +- + - +- + AACCCACAGACACTTfCATGTGGTATCCTCTGGCAACAGGAGGGT - TFGTT) were synthesized and annealed in STE buffer (10 mM TriS/HCI at pH 7.5 containing 1 mM EDTA and 100 missNaCl) under the following ,, â€”â€¢â€¢. conditions: 90Â°C for 5 mm, 65Â°C for 30 mm, and 25Â°C for I h. The resulting double-stranded DNA was designated PD-Ia GS (position: â€”286/â€”237 nu 8 9 10 11 12 13 14 cleotides) and end-labeled using T4 polynucleotide kinase with [y-32P]ATP. Gel shift assay was carried out with this radiolabeled probe. In brief, approx RT - +- + - + - +- + - +- + imately 1 x l0@ cpm of the radiolabeled probe was incubated with 10 @xgof nuclear extracts from SMS-KAN cells in the binding buffer consisting of 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DU, 50 mist NaC1, 10 mM Tris-HC1(pH 7.5), and 50 @g/mlpoly(dI@dC)at25Â°Cfor30 mm. The nuclear ., 0 extracts were dialyzed against the binding buffer in advance. To confirm the Fig. 1. A, Northern blot analysis of PD-Ia/ATX transcripts in primary tumor tissues specificity of binding to the probe, the competition procedures were carried out from neuroblastoma patients. Total RNA (10 jzg/lane) from neuroblastoma tissues was with cold PD-Ia GS probe and cold Oct 1 probe, which was a 20-bp oligo hybridized with the PD-Ia/ATX cDNA probe as described under â€œMaterialsand Meth DNA containing octamer binding sequence. The samples were run on 4% mis.â€•Upper panel, mRNA hybridized with a radiolabeled 0.9-kb fragment of human polyacrylamide gel buffered with Tris-glycine-EDTA containing 2.5% glyc PD-Ia cDNA. In a control experiment, the same RNA samples were probed with (3-actin crime.The gel was dried and exposed to a Fuji X-ray film with an intensifying cDNA, and the result is shown in the lower panel. The lane number is identical with the patient number in Table 1. Right, the size of markers. B, RT-PCR analysis for the screen at â€”80Â°C. PD-Ia/ATX transcripts. Each one @sgoftotal RNA used in the Northern blot analysis was subjectedto RT-PCRas describedunderâ€œMaterialsandMethods.â€•Eachsamplewas incubated in the cDNA synthesis solution in the absence of reverse transcriptase, and this RESULTS was used as a negative control (RT â€”).The signal was detected with digoxigenin-based Southern blot analysis. The lane number is identical with the patient number in Table I. Expression of the Human PD-Ia/ATX Gene in the Primary Tumor Tissues from Neuroblastoma Patients. We first carriedout Northern blot analysis of total RNA prepared from 14 neuroblastoma patients' tumor tissues to investigate the expression of human PD-Ia! patients were older than 1 year of age, and they had aggressive neurobbastomas in the clinical stage IV with multiple metastasis AiX gene in this tumor. The blot was probed with a 0.9-kb fragment of humanPD-Ia cDNA encoding the 5' partof the coding region.The (Table 1). We further performed more sensitive RT-PCR to detect a clinical characteristics of these patients are shown in Table I . As low bevel of expression of this gene. As shown in Fig. 1B, the signal shown in Figure 1A, we found the relatively higher expression of this could be detected in 13 of 14 cases at a variable extent. None of the gene in two patients (patient nos. 13 and 14). Both of these two patients analyzed had the amplification of the N-myc gene. The

patientsPatient Table ICharacteristics of

no. 1 Age 7M'@ lOM 8M 8M 4Y 8M 9M 7M 4Y 19D 9M 8M 5Y 3Y Stage I III III lVs IVa I II II III IVs I H IVb P/b NBâ€˜,Pathological type1 NB2 NB3 NB4 NB5 NB6 NB7 NB8 NB9 GN10 NB1 NB12 NB13 NB14 M, months; Y, years; D, days; NB. neuroblastoma; GN. gangrioneuroma. 2518

bind bigand, or decreased cellular activation by the bound receptor. bp i 2 3 4 This phenomenon is also observed for A2058 cells. 489â€” Identification of Transcription Initiation Sites of Human PD-Ia Transcripts. Toward a understanding of the transcriptional regula tory mechanism of the PD-Ia/ATX gene in neuroblastoma cells, we analyzed the promoter region of this gene. We carried out RNase protection assay using poly(A@@RNA from SMS-KAN cells to locate the exact transcription initiation sites. We used the pBK-CMV plas mid carrying the 542-bp fragment of human PD-Ia/ATX genomic DNA as a template to make a radiobabeled antisense RNA probe for RNaseprotectionassay.As shownin Fig.4, the protectedfragments were observed as two bands at 8 1 and 78 bases. Therefore, the bp transcription initiation sites of the PD-1aJATX gene are likely to be 1 2 3 4 located at position â€”64and â€”61nucleotides. These two bands were 489 â€” not observed with E. coli rRNA. Promoter Activity Analysis of the 5' Flanking Region. To iden tify the region contributing to the cell type-specific transcription of the human PD-IaJATX gene, a number of DNA fragments with different sizes were prepared from their 5' flanking regions and subcboned into S â€¢ pGL2 basic vectors. This reporter vector contains luciferase gene as a Fig. 2. Analysis of human PD-Ia/ATX isoforms. Total RNA extracted from two tumor reporter gene and lacks its promoter and enhancer. These constructed tissues (patient nos. 13 and 14) and SMS-KAN cells was subjected to RT-PCR and run on a 1% agarose gel. Southern blot analysis of PCR products was carried out using a plasmids were transfected into SMS-KAN cells. HeLa cells do not digoxigenin-labeled 0.9-kb fragment of human PD-Ia eDNA. This eDNA probe can bind express PD-Ia gene (Fig. 5A) and were used as a negative control. to both PD-Ia and ATh isoforms. Upper panel, the result using sense (position: +757/ The transactivation of each reporter plasmid was expressed as fold +776 of human PD-Ia and ATX cDNA) and antisense-l (position: + 1052/+ 1033 of human PD-Ia eDNA, + 1208/+ 1187 of ATX cDNA) printers. Lawer panel, the result increase over the activity of the pGL2 control plasmid carrying SV4O using the sense and antisense-2 primers (position: +999/+980 of ATX cDNA, specific to promoter in Fig. SB. PD-Ia/ATX Rl, R2, and R3 showed the pro ATX).ThesourcesoftotalRNAare:Lane1,SMS-KANcells;Lane2,tumortissuefrom moter activity in SMS-KAN cells. On the other hand, PD-Ia/ATX R4 patient 13; and Lane 3, tumor tissue from patient 14. Lane 4, result of the control experiment with human placenta genomic DNA. Left. size of the markers. showed no promoter activities in the same cells. All of these reporter pbasmids did not show promoter activities in HeLa cells except pGL2 control plasmid; therefore, the promoter region positioned at â€”287to analysis of control normal tissues was not carried out because it was â€”254nucleotides might be essential for the cell type-specific expres difficult to distinguish normal tissues from tumor tissues. sion of human PD-1aJATX gene in neuroblastoma cells. There are four Analysis of Human PD-IaIATX Isoforms. To examine which putative Spl binding sites in the 5' flanking region of the human isoform of the human PD-IaJATX gene transcripts is expressed in the PD-IaJATX gene (9); however, none of them is located in this region. tumor tissues from two patients (patient nos. 13 and 14) and SMS Analysis of DNA-binding Protein. We next performed gel-shift KAN neuroblastoma cells, we performed PCR-mediated Southern assay to demonstrate the presence of nuclear proteins that could bind blot analysis. At first, the cDNAs made from tumor tissues and the transcription regulatory region of the human PD-IaJATX gene in SMS-KAN cells were subjected to PCR using a sense primer and an SMS-KAN cells. The oligo-DNA probe, positioned at â€”286to â€”237 antisense-i primer. As shown in Fig. 2 (upper panel), we identified nucleotides, was synthesized on the basis of the data from the pro two positive bands at approximately 450 and 300 bp in SMS-KAN moter activity analysis and designated PD-Ia/ATX GS. The radiola cells (Lane 1) and the tumor tissue from patient 13 (Lane 2) and beled PD-Ia/ATX GS probe was mixed with the nuclear extract from patient 14 (Lane 3). Human genomic DNA from placenta did not SMA-KAN and then electrophoresed. As shown in Fig. 6, the ebec produce any signal (Lane 4). The sizes of positive DNA fragments trophoretic mobility of the probe was retarded when incubated with were well matched to the deduced sizes of PCR products from ATX (451 bp) and PD-Ia (295 bp) isoforms. Therefore, it was surmised that both isoforms are expressed in these two patients' tumors and SMS KAN cells. Furthermore, this was confirmed by using the ATX U- specific primer (antisense pnmer-2). We identified a single positive a. band at approximately 240 bp (Fig. 2, lower panel). This was well matched to the expected size of ATX mRNA (242 bp). U Cell Motility-stimulating ACtivityof the Recombinant ATX on Neuroblastoma Cells. In the next set of experiments, we carried out a cell motility assay using the recombinant ATX protein and SMS 0 KAN cells to test if the PD-Ia/ATX gene product acts as an autocrine motility-stimulating factor in neu.roblastoma cells. As shown in Fig. 3, the recombinant ATX stimulated the motility of SMS-KAN cells at low nanomolar concentration. The dose-response profile of SMS concentration (nM) KAN cells for ATX was more distinctly bipolar than the broad Fig. 3. Motility-stimulating activity of recombinant ATX on SMS-KAN cells. Cell response range seen in A2058 melanoma cells (4). The exact reason motility assay was performed in triplicate using a 48-well microchemotaxis chamber. Recombinant ATX was diluted in DMEM containing 0.1% BSA and then placed in the why high concentration of ATX resulted in lower motility is not lower wells of the chambers. SMS-KAN cells were added to the upper wells. After known. It is conceivable that high concentrations of ligand cause incubation for 6 h at 37Â°C,chemotaxis was quantitated by counting five randomly chosen medium power fields (MPF) under light microscopy (X200) for each replicate. Random down-regulation of the receptor. The decreased stimulation could be motility was assayed by adding DMEM/0.1% BSA alone and subtracted for each data due to fewer cell surface receptors, decreased ability of the receptor to point. The data are shown as means of triplicate samples; bars. SD. 2519

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 1997 American Association for Cancer Research. PD-Ia/AUTOTAXIN GENE IN NEUROBLASTOMA ACGT 12 regulation of tumor cell motility, could augment the metastatic ability . of the tumor cells. However, the analysis of large samples will be necessary to define the clinical role of PD-Ia/ATX in the tumor S metastasis of neuroblastoma in a future study. S. As a first step to understand the mechanism of the PD-Ia/AiX gene .1 bases z z , @â€˜81 A

e Â°@78 â€˜@ t, . SW

S Fig. 4. Determination of the transcription start sites of human PD-JaJA7X gene by RNase protection assay. Five jzg of poly(A)@ RNA from SMS-KAN cells (Lane 1) and 10 @zgofcontrol E. coli rRNA (Lane 2) were hybridized with the radiolabeled antisense B 80@ RNA probe as described in â€œMaterialsand Methods.â€•After digested with RNase, the protected fragments were analyzed on a 6% polyacrylamide DNA sequencing gel con taming 7 M urea. Arrows on the right, positions of two protected fragments. Sizes of 60@ protected fragments were determined by comparing to the sequencing reaction of single strand M13 DNA in Lanes A, C, G, and T. Numbers on the right, the length of the â€˜0 sequencing ladder. Correspondence of protected fragments to transcription start sites is 0 describedinthetext. 40@

20@ the nuclear protein from SMS-KAN cells (Lane 1, arrow). To confirm the specificity of the binding between the protein and probe, the competition procedures were also carried out. The electrophoretic mobility shift of the radiolabeled PD-Ia/ATX GS probe with the SH SH SH SND @ â€” c@ 1@ nuclear extract of the SMS-KAN cells was competed by cold PD-Ia/

ATX OS probe (Fig. 6, Lane 2). A competition procedure using the ,@ â€˜@ â€˜@ cold Oct 1 probe, which has no similarity to PD-Ia/ATh GS probe, n@ 04 O@ 0.. was carried out to eliminate the possibility that this competition was caused by the nonspecific binding of the nuclear protein to the obigo-DNA probe. As shown in Fig. 6, Lane 3, this shift of the Luciferasegene mobility of the radiolabeled probe was not competed by the Oct 1 pGL2 Control probe. These results verify the presence of the DNA binding protein in SMS-KAN cells, which binds the putative promoter region posi tioned at â€”287to â€”237nucleotides. -1197 +17 PD-Ia Ri â€”E:::::::: DISCUSSION -833 +17 In previous studies, we reported the cDNA cloning of ATX (5) and PD-Ia R2 PD-Ia (9, 10). In this document, we investigated the expression of human PD-IaJATX gene in human neuroblastoma. Northern blot analysis showed the relatively higher expression of human PD-Ia! -287 +17 AiX gene in 2 of 14 tumor tissues from neuroblastoma patients (Fig. PD-Ia R3 1, Lanes 13 and 14). When RNA extracted from tumor tissues was subjected to more sensitive RT-PCR analysis, we could detect the -254 +17 specific signal in 13 of 14 cases. In normal tissues, the PD-Ia/A TX PD-Ia R4 gene is expressed in the human brain, lung, and kidney (9). Neurons and adrenal medullary cells did not produce positive signal (10). Fig. 5. Promoter activity in the 5' flanking region of the PD-IaJATX gene. A, expression of the PD-IaJATX gene in HeLa and SMS-KAN cells. Ten @zgoftotal RNA Neuroblastoma is considered to arise from immature sympathetic extracted from HeLa and SMS-KAN cells were electrophoresed, blotted, and hybridized neurons. Therefore, the expression of the PD-IaJATX gene in neuro with the PD-Ia/ATX cDNA probe. Left panel, ethidium bromide staining of the gel; right blastoma tumors and cell lines might be ectopic. However, the pos panel, autoradiogram showing the expression of the PD-la/AiX gene. B, luciferase assay of the various constructs. Each 2 @sgofreporter plasmids containing luciferase gene was sibility that a subset of normal immature peripheral neurons express transfected to SMS-KAN and HeLa cells using cationic liposome. A constitutive (3-gal this gene cannot be excluded from this study. vectorwas includedin eachtransfectiontonormalizethedifferencesinefficiencyof We have also shown here that recombinant ATX stimulates the transfection. After 72-h incubation, the cell lysate was added to luciferase assay reagent, and luciferase activities promoted by various fragments of the 5' flanking region of human motility of SMS-KAN neuroblastoma cells in vitro (Fig. 3). An early PD-la/AiX gene were determined by measuring the produced light intensities. All step of local and distant tumor metastasis is tumor cell invasion into measurements were made with dishes in triplicate. Transactivation was expressed as fold increase over the activity of the pGL2 control plasmid carrying the SV4O promoter. Upper surrounding tissues. Cellular motility is a critical component of this panel, data are expressed as averages; bars, SE. Lower panel, diagrams of the human process. Therefore, the expression of this gene, which allows auto PD-Ia promoter-luciferase plasmids and pGL2 control plasmid. 2520

1 2 3 GATA-2 and c-Myc. Identification of this transcriptional regulatory protein could further help us to gain insights for the metastasis of neuroblastoma.

ACKNOWLEDGMENTS

We thank Dr. Osamu Mabuchi (Department of Hemato-Oncology, Hyogo Prefectural Children's Hospital, Kobe, Japan) and Dr. Yoshiyuki Kosaka (Department of Pediatrics, Kobe University Hospital, Kobe, Japan) for pro viding us with the tumor tissues from neuroblastoma patients. We also thank Dr. June L. Biedler (Laboratory of Cellular and Biochemical Genetics, Walker Laboratory, Memorial Sloan-Kettering Cancer Center, Rye, NY) for providing us with SMS-KAN cells.

REFERENCES

I. Singer, S. J., and Kupfer, A. The directed migration of eukaryotic cells. Annu. Rev. Cell Biol., 2: 337-365, 1986. 2. Liotta, L. A., Mandler, R., Murano, G., Katz, D. A., Gordon, R. K., Chiang, P. K., and Schiffmann, E. Tumor cell autocrine motility factor. Proc. NatI. Acad. Sci. USA, 83: 3302â€”3306, 1986. 3. Stoker, M., Aherardi, E., Perryman, M., and Gray. J. Scatter factor is a fibroblast derived modulator of epithelial cell mobility. Nature (Land.), 327: 239â€”242, 1987. 4. Stracke, M. L., Krutzsch, H. C., Unsworth, E. J., Arestad, A. A., Cioce, v., Schiff mann, E., and Liotta, L. A. Identification. purification, and partial sequence analysis of autotaxin, a novel motility-stimulating protein. J. Biol. Chem., 267: 2524â€”2529, 1992. 5. Murata, J., Lee, H. Y., Clair, T., Krutzsch, H. C., Arestad. A. A., Sobel, M. E., Liotta, L. A., and Stracke, M. L. eDNA cloning of human tumor motility-stimulating protein, autotaxin, reveals a homology with phosphodiesterases. J. Biol. Chem.. 269: 30479â€” 30484, 1994. Fig. 6. The binding of the nuclear protein from SMS-KAN cells to the 5' upstream 6. Buckley, M. F., Loveland, K. A., McKinstry. W. J., Garson, 0. M., and Goding, J. W. sequenceof the humanPD-Ia/AiXgene.An end-labeledoligo-DNAprobespanning Plasma cell membrane glycoprotein PC-l : cDNA cloning of the human molecule, positions â€”286to â€”237bp ofthe human PD-ksiATXgene was incubated with the nuclear amino acid sequence, and chromosomal location. J. Biol. Chem.. 265: 17506â€”17511, extract from SMS-KAN cells and analyzed on a 4% polyacrylamide gel in the presence 1990. of the following unlabeled oligo-DNA competitors: Lane I, no competitor; Lane 2. an 7. Rebbe, N. F., Tong, B. D., Finley. E. M., and Hickman, S. Identification of nucleotide oligo-DNA spanning positions â€”286to â€”237bp of human PD-la/ATX promoter; and pyrophosphatase/alkaline phosphodiesterase I activity associated with the mouse Lane 3, a 20-bp Oct 1oligo-DNA containing no homologous sequence. Arrow on the left, plasma cell differentiation antigen PC-I. Proc. NatI. Acad. Sci. USA, 88: 5192â€”5196, the position of the DNA-protein complex. Free probe was cropped from the photograph. 1991. 8. Haugen, H. F., and Skrede, S. Nucleotide pyrophosphatase and phosphodiesterase. I. Organ distribution and activities in body fluids. Clin. Chem., 23: 1531â€”1537,1977. expression in neuroblastoma, we have analyzed its promoter region. 9. Kawagoe, H., Soma, 0., Goji. i., Nishimura, N., Narita. M., Inazawa, J., Nakamura, H., and Sano. K. Molecular cloning and chromosomal assignment of the human From the result of the RNase protection assay, it is suspected that brain-type phosphodiesterase 1/nucleotide pyrophosphatase gene (PDNP 2). Genom there are at beast two transcription initiation sites of human PD-Ia! ics, 30: 380â€”384, 1995. 10. Narita, M., Goji, J., Nakamura, H., and Sano, K. Molecular cloning. expression, and AiX gene in SMS-KAN cells (Fig. 4). These two transcription initi localization of a brain-specific phosphodiesterase 1/nucleotide pyrophosphatase (PD ation sites are located upstream from the previously reported 5' Ia) from rat brain. J. Biol. Chem., 269: 28235â€”28242, 1994. sequence of ATX cDNA, which was obtained by rapid amplification 11. Suzuki, S., Oldberg, A., Hayman, E. G.. Pierschbacher, M. D., and Ruoslahti, E. Complete amino acid sequence of human vitronectin deduced from cDNA. Similarity of the5' cDNAendmethod(5).In apreviousstudy,wehavereported of cell attachment sites in vitronectin and fibronectin. EMBO J., 4: 25 19â€”2524,1985. that the 5' region of the human PD-IcvJATX gene lacks typical TATA 12. Seiffert, D., Ciambrone, G., Wagner, N. V., Binder, B. R., and Loskutoff, D. J. The somatomedin B domain of vitronectin. Structural requirements for the binding and or CAAT box (9). This type of promoter region tends to have multiple stabilization of active type I plasminogen activator inhibitor. J. Biol. Chem., 269: transcription initiation sites (18). 2659â€”2666, 1994. The promoter activity assay demonstrated that the region from 13. Ruoslahti, E. Integrins. J. Clin. Invest., 87. 1â€”5,1991. 14. Ruoslabti, E., and Pierschbacher, M. D. New perspectives in cell adhesion: RGD and â€”287to â€”254nucleotides is essential for PD-JaJATX gene expres integrins. Science (Washington DC), 238: 491â€”497, 1987. sion in SMS-KAN neuroblastoma cells (Fig. 5). Gel-shift assay con 15. Reynolds, C. P., Biedler, J. L., Spengler, B. A., Reynolds, D. A.. Ross, R. A., Frenkel, firmed that there is a nuclear protein that binds this putative promoter E. P., and Smith, R. G. Characterization of human neuroblastoma cell lines estab lished before and after therapy. J. Nail. Cancer Inst., 76: 375â€”387,1986. region in SMS-KAN cells (Fig. 6). This nuclear protein possibly acts 16. Davidson, A. J., and Moss, B. New vaccinia virus recombination plasmids incorpo as a transcriptional regulatory factor for the human PD-JcJATX gene rating a synthetic late promoter for high level expression of foreign proteins. Nucleic Acids Res., 18: 4285â€”4286, 1990. in SMS-KAN cells. This transcriptional regulatory mechanism is 17. Fierst, T. R., Earl, P. L., and Moss, B. Use of a hybrid vaccinia virus-T7 RNA likely to be specific to SMS-KAN cells, because this promoter region polymerase system for expression of target genes. Mol. Cell. Biol., 7: 2538â€”2544, had no activity in HeLa cells (Fig. 5), which do not express human 1987. 18. Kageyama. R., Merlino, G. T., and Pastan, I. Nuclear factor ETF specifically stim PD-IcsJATX gene. There are four putative Spl binding sites in the 5' ulates transcription from promoters without a TATA box. J. Biol. Chem., 264: region of the human PD-IaJATX gene (9); however, none of them is 15508â€”15514,1989. located in this region. Therefore, Spi might not be essential for the 19. Merika, M.. and Orkin, S. H. DNA-binding specificity of GAlA family transcription factors. Mol. Cell. Biol., /3: 3999â€”4010, 1993. tissue-specific expression of this gene in neuroblastoma cells. There 20. Blackwell, T. K., Huang, J., Ma, A., Kretzner, L., Alt, F. W., Eisenman, R. N., and are two known putative transcription factor binding sites in this Weintraub, H. Binding of myc proteins to canonical and noncanonical DNA se quence. Mol. Cell. Biol., 13: 5216â€”5224, 1993. region. One is the GATA-2 binding site (position: â€”2641â€”259nu 21. Dorfman, D. M., Wilson, D. B., Bruns, G. A. P., and Orkin, S. H. Human transcription cleotides; Ref. 19), and the other is the c-Myc binding site (position: factor GATA-2. Evidence for regulation of preproendothelin- I gene expression in â€”258/â€”253nucleotides; Ref. 20). However, these two transcription endothelial cells. J. Biol. Chem., 267: 1279â€”1285, 1992. 22. Herrick, D., and Ross, J. The half-life of c-myc mRNA in growing and serum factors were reported to be expressed in HeLa cells (21, 22); therefore, stimulated cells: influence of the coding and 3' untranslated regions and role of the nuclear protein that binds this region is likely to be different from ribosometranslocation.Mol.Cell.Biol.,14:2119â€”2128,1994. 2521

Hiroyuki Kawagoe, Mary L. Stracke, Hajime Nakamura, et al.

Cancer Res 1997;57:2516-2521.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/12/2516

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/57/12/2516. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.