DOCSLIB.ORG

Microsatellite Markers for the Tramp Ant, Cardiocondyla Obscurior (Formicidae: Myrmicinae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microsatellite Markers for the Tramp Ant, Cardiocondyla Obscurior (Formicidae: Myrmicinae) c Indian Academy of Sciences ONLINE RESOURCES Microsatellite markers for the tramp ant, Cardiocondyla obscurior (Formicidae: Myrmicinae) CHRISTINE V. SCHMIDT∗, ALEXANDRA SCHREMPF, ANDREAS TRINDL and JÜRGEN HEINZE Zoologie/Evolutionsbiologie, Universität Regensburg, 93053 Regensburg, Germany [Schmidt C. V., Schrempf A., Trindl A. and Heinze J. 2016 Microsatellite markers for the tramp ant, Cardiocondyla obscurior (Formicidae: Myrmicinae). J. Genet. 95, e1–e4. Online only: http://www.ias.ac.in/jgenet/OnlineResources/95/e1.pdf] Introduction disperse, wingless males stay inside their maternal nests throughout their lives and mate with young nestmate queens Cardiocondyla obscurior is a successful but unobtrusive (Kinomura and Yamauchi 1987;Stuartet al. 1987). This tramp ant which is widely distributed throughout the trop- results in considerable inbreeding: from fixation coefficients ics and subtropics. To understand its population structure in single-queen colonies of noninvasive Cardiocondyla,from and biology, we established six polymorphic microsatellite Mediterranean Europe and Madagascar it has been estimated markers. We determined the general variability of the six that up to 90% of the mating are between brothers and sis- loci by analysing individuals from four different popula- ters (Schrempf et al. 2005, 2014; Lenoir et al. 2007;Heinze tions. In addition, we analysed samples from a Japanese pop- et al. 2014). ulation and revealed first insights into the population and Due to the lack of variable genetic markers, nothing is colony structure of this tramp species, including high nest- known about the genetic structure of the tramp species. mate relatedness in multi-queen colonies and a relatively Their colonies typically contain multiple queens and, like in high inbreeding coefficient. other invasive species, individual nests might not be closed Numerous plants and animals have become established in against alien individuals (Heinze and Delabie 2005). Our areas far away from their native ranges due to human activ- study species C. obscurior was originally described from Tai- ities (Hulme 2009). Among these are several dozen tramp wan (Wheeler 1929) and has spread from its presumed origin species of ants. Some of them, such as the red imported fire in Southeast Asia as far as to the Ryukyus, the Caribbean, the ant, the Argentine ant, and the yellow crazy ant, quickly be- Canary Islands, Hawaii and other places (Seifert 2003). In come dominant in new ecosystems and are among the worst this study, we report the sequences of primers for microsatel- invasive species worldwide, on a par with tiger mosquitoes, lites developed for C. obscurior, data on nestmate related- black rats, or water hyacinths (reviewed by Holway et al. ness and inbreeding in colonies of this ant from Okinawa, 2002; Tsutsui and Suarez 2003). The ecological impact, Japan. Our results show that the microsatellite primers are behavioural ecology and sociobiology of these eye-catching suited well to conduct more detailed analyses, which will invaders have been intensively studied, but not much is give further insights into the population structure of this ant. known about tramps that less dramatically integrate in novel environments. Among the most widespread of these incon- spicuous tramp ants are the ‘sneaking ants’, Cardiocondyla. Material and methods At least seven of its ∼100 species are tramps and a subset of two or three of these can be found reliably on most tropical For the development of microsatellite primers, we fol- beaches, and in plantations and parks, around the tropics and lowed a method based on selective hybridization (Tenzer subtropics (Seifert 2003;Heinzeet al. 2006; Wetterer 2012a, et al. 1999; Gautschi et al. 2000). In detail, 50 individ- b, 2014). uals from a colony of Okinawa (collected in 2007) and Cardiocondyla exhibits a bizarre male diphenism with 200 individuals from three Brazilian colonies (collected at so-called ‘ergatoid’ wingless males in addition to the typical CEPLAC, Ilhéus, Brazil in 2004 and 2009) were pooled winged male of ants. While winged males are peaceful and and the genomic DNA was subsequently extracted using a modified CTAB (cetyltrimethylammonium bromide) proto- col (Sambrook and Russell 2001). According to the proto- ∗ For correspondence. E-mail: [email protected]. col of Kautz et al. (2009), we ligated the adapters onto the Keywords. relatedness; inbreeding; microsatellites; Cardiocondyla obscurior. Journal of Genetics Vol. 95, Online Resources e1 Christine V. Schmidt et al. DNA after restriction with Tsp509I. Microsatellite sequences 6) 4) 4) 5) 6) 6) = = = = = were fished with the help of magnetic beads. PCR fragments = n n n n n were cloned using the TOPO TA Cloning kit (Invitrogen, n Carlsbad, USA) following the manufacturer’s protocol. Suc- cessful recombinants were easily identified by the white 30) 206 ( 30) 139 ( colour of colonies. Two hundred and eighty six of them were = = n n 30) 110 ( dot-blotted on nylon membranes (Hybond-N Amersham) and 10) 185 ( = = n probed with (GA)13 oligonucleotide labelled with fluorescein n (MWG Biotech, Ebersberg, Germany). For detection, we used 10)10) 156 ( 161 ( = the Gene Images CDP-Star Detection Module (Amersham = n Life Science, Little Chalfont, UK). In total, 104 clones yiel- n ded a positive signal, and for the strongest 92 of them, plasmids were purified and sequenced by GATC Biotech. The obtained sequences were edited in Sequencing Analysis 4) 156,160 ( 6) 163,203 ( 6) 159,161,183,185 ( 2) 212,216,218,222,226 ( 5) 157,161,163,165,171 ( 3.4.1 (PE Biosystems, Waltham, USA) and visually checked 6) 152,154,156,158 ( = = = = = = n n n n n for microsatellites. Primers flanking the core microsatellite n repeats were manually designed and tested for 38 loci. Standard PCR was carried out in a final 20 μL reac- Alleles (bp) tion volume containing 2.5 ng DNA, 1× buffer, 2.5 mM MgCl2, 200 μM dNTP (MBI Fermentas, Amherst, NY), 0.5 148) 161 ( μM (Cobs8), 1 μM (Cobs9, Cobs13) and 1.25 μM (Cobs 137) 189 ( = = P3, Cobs13.2, Cobs 42) unlabelled reverse primer, the same n n amounts of FAM-labelled, HEX- labelled, or TET-labelled 133) PIC: 0.55 206 ( = forward primer, and 0.5 U Taq DNA polymerase (MBI, n ◦ 140) PIC: 0.40 145 ( Fermentas). Cycling conditions were 94 C for 70 s, anneal- = ◦ n ing for 45 s, 72 C for 25 s for 34 cycles with an initial denat- 149) PIC: 0.04 110 ( 7) *163*203 ( 8) *148*152*156*160 156 ( ◦ = = = uration step at 94 C for 4 min and a final extension step at n n ◦ n 72 C for 1 min. PCR products were visualized on an ABI 8) *185*187*189 ( = n PRISM genetic analyzer (PE Biosystems). Allele size was 130) PIC: 0.46 = analysed using a GeneScan 500 size standard (TAMRA) and n GeneScan 3.1 software (PE Biosystems). To determine the general variability of the six microsatel- lite loci for which primers were developed, we analysed individuals from four different populations: Ilhéus, Brazil (collected in 2004 and 2009); Lake Alfred, Florida (2004); Okinawa, Japan (2007 and 2011); Ishigaki, Japan (2007); for number of investigated individuals see table 1. Finally, . we analysed the genetic structure of eight colonies of C. obscurior from four different sites in and around Naha, Okinawa, by genotyping 2 to 9 queens and 7 to 15 workers per colony (table 2). Six colonies originate from two nearby trees C. obscurior in Onoyama Park, Naha (tree 1: OypC51, OypC32, OypC48, ◦ ◦ R: GACGTACGGCCAGATGTCA R: TTTCGACAATGACAAACCGAGC ( F: TTATCGTGAGGATTTTGAGGC 160,180 ( F: ACTCAGTGCCAATTCGAATAAACAGCR: TGAACCGGGTAGAATCAATTA F: TATCTTTTCAACCCTCTCGC 163, 203 ( F: ACTCTCACAATCGCTACGC 189 ( F: AATCGCGCCTGCGACGGCG *110*130 ( R: AGTTTCTCACTTTTGCTCG PIC: 0.09 F: TCAGAGAAGTAAATATCAG *200*204*206*208 ( *137*139*145 ( 26 12.255 N, 127 40.656 E; tree 2: OypE3, OypE5, OypE4, R: TATTCCGCGATAGCTTAAAT PIC: 0.12 ◦ ◦ 26 12.334 N, 127 40.592 E). Two additional colonies came 11 6 10 31 29 34 from Urasoe Sports Park, Naha (7 km distance to Onoyama, 11 35 26◦15.134N, 127◦43.262E) and the campus of the University TT(TC) Repeat Primer sequences Alleles (bp) Japan, Alleles (bp) Alleles (bp) of the Ryukyus (11 km distance to Onoyama, 26◦14.782N, TT(TC) ◦ C) sequence (5’ to 3’) Japan, Okinawa Ishigaki Brazil Florida a 127 45.864 E). Relatedness within the colonies and with- ◦ T in the whole population was estimated using the software Relatedness 4.2 (Goodnight and Queller 1994) based on the algorithm by Queller and Goodnight (1989). Groups were weighted equally and standard errors were esti- Accession mated by jackknifing over loci. The polymorphic infor- Primer sequences of microsatellite loci in mation content (PIC, Botstein et al. 1980) was calculated using the software Cervus 3.0 (Kalinowski et al. 2007). , annealing temperature a Cobs9 HE608812 55 (TC) Cobs 13.2 AJ784427 45 (AG) Table 1. Cobs8 HE608811 55 (AG) T Locus no. (EMBL) ( Cobs13 HE608813 60 (CT) Cobs 42 AJ784429 45 (AG) Cobs P3 AJ784426 50 (AG) To obtain information about the amount of inbreeding, *Alleles resulting from the genetic population analysis. Journal of Genetics Vol. 95, Online Resources e2 Microsatellite markers for C. obscurior Table 2. Relatedness (mean ± SE) over all individuals, and for queens and workers separately in C. obscurior colonies from Okinawa. Number of Number of r (queen) (number of r (worker) (number of Colony queens workers analysed individuals) analysed individuals) OypC32 21 76 0.838 ± 0.202 (n =9) 0.619 ± 0.176 (n =15) OypC48 15 61 0.331 ± 0.197 (n =9) 0.582 ± 0.216 (n =15) OypC51 26 34 0.817 ± 0.155 (n =9) 0.784 ± 0.133 (n =15) OypE3 14 17 0.227 ± 0.170 (n =9) 0.636 ± 0.201 (n =15) OypE5 7 11 -0.014 ± 0.229 (n =7) 0.448 ± 0.208 (n =11) OypE4 9 25 0.297 ± 0.276 (n =9) 0.357 ± 0.149 (n =15) Urasoe Sports Park 2 9 1.000 (n =2) 0.778 ± 0.119 (n =9) Univ.
Load more

Recommended publications
  • James K. Wetterer
    James K. Wetterer Wilkes Honors College, Florida Atlantic University 5353 Parkside Drive, Jupiter, FL 33458 Phone: (561) 799-8648; FAX: (561) 799-8602; e-mail: [email protected] EDUCATION UNIVERSITY OF WASHINGTON, Seattle, WA, 9/83 - 8/88 Ph.D., Zoology: Ecology and Evolution; Advisor: Gordon H. Orians. MICHIGAN STATE UNIVERSITY, East Lansing, MI, 9/81 - 9/83 M.S., Zoology: Ecology; Advisors: Earl E. Werner and Donald J. Hall. CORNELL UNIVERSITY, Ithaca, NY, 9/76 - 5/79 A.B., Biology: Ecology and Systematics. UNIVERSITÉ DE PARIS III, France, 1/78 - 5/78 Semester abroad: courses in theater, literature, and history of art. WORK EXPERIENCE FLORIDA ATLANTIC UNIVERSITY, Wilkes Honors College 8/04 - present: Professor 7/98 - 7/04: Associate Professor Teaching: Biodiversity, Principles of Ecology, Behavioral Ecology, Human Ecology, Environmental Studies, Tropical Ecology, Field Biology, Life Science, and Scientific Writing 9/03 - 1/04 & 5/04 - 8/04: Fulbright Scholar; Ants of Trinidad and Tobago COLUMBIA UNIVERSITY, Department of Earth and Environmental Science 7/96 - 6/98: Assistant Professor Teaching: Community Ecology, Behavioral Ecology, and Tropical Ecology WHEATON COLLEGE, Department of Biology 8/94 - 6/96: Visiting Assistant Professor Teaching: General Ecology and Introductory Biology HARVARD UNIVERSITY, Museum of Comparative Zoology 8/91- 6/94: Post-doctoral Fellow; Behavior, ecology, and evolution of fungus-growing ants Advisors: Edward O. Wilson, Naomi Pierce, and Richard Lewontin 9/95 - 1/96: Teaching: Ethology PRINCETON UNIVERSITY, Department of Ecology and Evolutionary Biology 7/89 - 7/91: Research Associate; Ecology and evolution of leaf-cutting ants Advisor: Stephen Hubbell 1/91 - 5/91: Teaching: Tropical Ecology, Introduction to the Scientific Method VANDERBILT UNIVERSITY, Department of Psychology 9/88 - 7/89: Post-doctoral Fellow; Visual psychophysics of fish and horseshoe crabs Advisor: Maureen K.
    [Show full text]
  • Invasive Ant Pest Risk Assessment Project: Preliminary Risk Assessment
    Invasive ant pest risk assessment project: Preliminary risk assessment Harris, R. 1) Aim To assess the threat to New Zealand of a wide range of ant species not already established in New Zealand and identify those worthy of more detailed assessment. 2) Scope 2.1. Specific exclusions Solenopsis invicta was specifically excluded from consideration as this species has already been subject to detailed consideration by Biosecurity New Zealand. 2.2 Specific inclusions Biosecurity New Zealand requested originally that the following taxa be included in the assessment: Solenopsis richteri Solenopsis geminata Wasmannia auropunctata Anoplolepis gracilipes Paratrechina longicornis Carpenter ants (Camponotus spp.) Leaf cutting ants (Atta spp.) Myrmecia pilosula Tapinoma melanocephalum Monomorium sydneyense (incursion found in New Zealand) Hypoponera punctatissima (incursion found in New Zealand) Big headed ants (Pheidole spp.) M. sydneyense and H. punctatissima have since been deemed not under official control and are now considered established in New Zealand. Profiles of these species have been prepared as part of the Ants of New Zealand section (see http://www.landcareresearch.co.nz/research/biosecurity/stowaways/Ants/antsinnewzealand.asp). INVASIVE ANT PEST RISK ASSESSMENT PROJECT: Preliminary risk assessment 3) Methodology A risk assessment scorecard was developed (Appendix 1) in consultation with a weed risk assessment expert (Dr Peter Williams) and with Simon O’Connor and Amelia Pascoe of Biosecurity New Zealand, to initially separate
    [Show full text]
  • ARTHROPODA Subphylum Hexapoda Protura, Springtails, Diplura, and Insects
    NINE Phylum ARTHROPODA SUBPHYLUM HEXAPODA Protura, springtails, Diplura, and insects ROD P. MACFARLANE, PETER A. MADDISON, IAN G. ANDREW, JOCELYN A. BERRY, PETER M. JOHNS, ROBERT J. B. HOARE, MARIE-CLAUDE LARIVIÈRE, PENELOPE GREENSLADE, ROSA C. HENDERSON, COURTenaY N. SMITHERS, RicarDO L. PALMA, JOHN B. WARD, ROBERT L. C. PILGRIM, DaVID R. TOWNS, IAN McLELLAN, DAVID A. J. TEULON, TERRY R. HITCHINGS, VICTOR F. EASTOP, NICHOLAS A. MARTIN, MURRAY J. FLETCHER, MARLON A. W. STUFKENS, PAMELA J. DALE, Daniel BURCKHARDT, THOMAS R. BUCKLEY, STEVEN A. TREWICK defining feature of the Hexapoda, as the name suggests, is six legs. Also, the body comprises a head, thorax, and abdomen. The number A of abdominal segments varies, however; there are only six in the Collembola (springtails), 9–12 in the Protura, and 10 in the Diplura, whereas in all other hexapods there are strictly 11. Insects are now regarded as comprising only those hexapods with 11 abdominal segments. Whereas crustaceans are the dominant group of arthropods in the sea, hexapods prevail on land, in numbers and biomass. Altogether, the Hexapoda constitutes the most diverse group of animals – the estimated number of described species worldwide is just over 900,000, with the beetles (order Coleoptera) comprising more than a third of these. Today, the Hexapoda is considered to contain four classes – the Insecta, and the Protura, Collembola, and Diplura. The latter three classes were formerly allied with the insect orders Archaeognatha (jumping bristletails) and Thysanura (silverfish) as the insect subclass Apterygota (‘wingless’). The Apterygota is now regarded as an artificial assemblage (Bitsch & Bitsch 2000).
    [Show full text]
  • Hymenoptera: Formicidae
    16 The Weta 30: 16-18 (2005) Changes to the classification of ants (Hymenoptera: Formicidae) Darren F. Ward School of Biological Sciences, Tamaki Campus, Auckland University, Private Bag 92019, Auckland ([email protected]) Introduction This short note aims to update the reader on changes to the subfamily classification of ants (Hymenoptera: Formicidae). Although the New Zealand ant fauna is very small, these changes affect the classification and phylogeny of both endemic and exotic ant species in New Zealand. Bolton (2003) has recently proposed a new subfamily classification for ants. Two new subfamilies have been created, a revised status for one, and new status for four. Worldwide, there are now 21 extant subfamilies of ants. The endemic fauna of New Zealand is now classified into six subfamilies (Table 1), as a result of three subfamilies, Amblyoponinae, Heteroponerinae and Proceratiinae, being split from the traditional subfamily Ponerinae. Bolton’s (2003) classification also affects several exotic species in New Zealand. Three species have been transferred from Ponerinae: Amblyopone australis to Amblyoponinae, and Rhytidoponera chalybaea and R. metallica to Ectatomminae. Currently there are 28 exotic species in New Zealand (Table 1). Eighteen species have most likely come from Australia, where they are native. Eight are global tramp species, commonly transported by human activities, and two species are of African origin. Nineteen of the currently established exotic species are recorded for the first time in New Zealand as occurring outside their native range. This may result in difficulty in obtaining species-specific biological knowledge and assessing their likelihood of becoming successful invaders. In addition to the work by Bolton (2003), Phil Ward and colleagues at UC Davis have started to resolve the phylogenetic relationships among subfamilies and genera of all ants using molecular data (Ward et al, 2005).
    [Show full text]
  • Download PDF File
    Myrmecological News 23 41-59 Vienna, September 2016 Analyzing large-scale and intranidal phenotype distributions in eusocial Hymenoptera – a taxonomic tool to distinguish intraspecific dimorphism from heterospecificity Bernhard SEIFERT Abstract Ant and termite nests are long-term stable, semi-closed systems constantly producing conspecific worker populations of related individuals over many generations. Accordingly, nests of these eusocial insects, as they are found in nature, offer free of cost an analysis situation that has to be generated in other groups of organisms by controlled rearing experiments. A test system based on analyzing intranidal and large-scale phenotype distributions and comparing the observed distributions with predictions for different scenarios of heterospecificity and intraspecific dimorphism is introduced by a case study on ants. The test system, named DIMORPH test, allows a taxonomist to distinguish if discrete character syndromes represent separate species or an intraspecific phenomenon. One of the most important parameters within the test system is the abundance and distribution of phenotypically mixed nest populations. Five biological explanations are possible for ant nests with a mixture of discrete phenotypes: They may represent (1) geneti- cally determined intraspecific morphs, (2) intraspecific modifications induced by environmental factors, (3) the associ- ation of a temporary social parasite with a host species, (4) the association of a permanent social parasite with a host species, and (5) a parabiotic association of two basically independent (self-sustaining) species. The paper explains the biological background of the scenarios (1) to (5) and presents mathematical models and generalizations from empirical data to predict phenotype distributions for each scenario under variable conditions.
    [Show full text]
  • Scope: Munis Entomology & Zoology Publishes a Wide Variety of Papers
    Munis Entomology & Zoology Mun. Ent. Zool. https://www.munisentzool.org/ (January, 2021) 457 ISSN 1306-3022 © MRG ___________________________________________________________ EXPLORING THE ACULEATA HYMENOPTERA OF BANGLADESH BY DNA BARCODING OF MALAISE TRAP COLLECTION Santosh Mazumdar*, Paul D. N. Hebert** and Badrul Amin Bhuiya*** * Department of Zoology, University of Chittagong, BANGLADESH. E-mail: [email protected]; ORCID ID: 0000-0001-6403-577X ** Centre for Biodiversity Genomics, University of Guelph, 50 Stone Road East, Guelph, Ontario, CANADA. ORCID ID: 0000-0002-3081-6700 *** Biodiversity Research for Environment & Ecosystem Protection (BREEP), Chattogram- 4325, BANGLADESH. [Mazumdar, S., Hebert, P. D. N. & Bhuiya, B. A. 2021. Exploring the Aculeata Hymenoptera of Bangladesh by DNA barcoding of Malaise trap collection. Munis Entomology & Zoology, 16 (1): 457-464] ABSTRACT: Aculeata hymenopterans play a crucial role in ecology and economics. Diversity analysis of 901 Aculeata wasps at Chittagong University Campus a site in Bangladesh was performed by sequencing DNA barcodes (658 bp sequence from the 5′-end of cytochromeoxidase I). Specimens were collected by a Malaise trap from April 2014 to March 2015. The results revealed 22 species and 42 genera from 20 families in three superfamilies namely Apoidea, Chrysidoidea and Vespoidea. Among them 15 species, 22 genera, two subfamilies (Dolichoderinae and Ponerinae), and one family named Dryinidae are the first county records in Bangladesh. All the specimen records, with the Barcode Index Numbers (BINs) are available on the Barcode of Life Data System (BOLD). KEY WORDS: Aculeata Hymenoptera, Malaise trap, DNA barcode, Bangladesh Aculeata hymenopterans or stinging wasps (Hymenoptera: Aculeata) such as bees, ants, and many wasps play vital ecological roles as predators and pollinators and some have medicinal value as well (Zimmermann & Vilhelmsen, 2016).
    [Show full text]
  • Worldwide Spread of Tetramorium Caldarium (Hymenoptera: Formicidae)
    Myrmecological News 21 93-99 Vienna, September 2015 Worldwide spread of Tetramorium caldarium (Hymenoptera: Formicidae) James K. WETTERER & Francisco HITA GARCIA Abstract Tetramorium caldarium (ROGER , 1857) is a tramp ant species originally from Africa that has dispersed around the world through human commerce. From 1862 to 1979, T. caldarium was considered a junior synonym of T. simillimum (SMITH , 1851). To document the worldwide spread of T. caldarium , we compiled > 300 published and unpublished specimen site records. In addition, in order to assess their species boundaries, we examined the type specimens of T. caldarium and T. simillimum . We documented Tetramorium caldarium records from 67 geographic areas (countries, island groups, major Caribbean islands, and US states), including several for which there are no previously published records: Austral Islands, Australia, Benin, Cameroon, Cayman Islands, Congo (Republic), Curaçao, Dubai, El Salvador, Gabon, Guadeloupe, Indonesia, Jamaica, Martinique, Namibia, Panama, Scotland, Senegal, South Africa, Tanzania, and Uganda. Tetramorium caldarium is truly cosmopolitan, with records spread across seven of the world's eight bioregions (all except the Antarctic, which has no ants). Tetramorium caldarium records are particularly common on Atlantic islands and from greenhouses and heated buildings in temperate Europe. Key words: Biogeography, biological invasion, exotic species, invasive species. Myrmecol. News 21: 93-99 (online 14 April 2015) ISSN 1994-4136 (print), ISSN 1997-3500 (online) Received 16 February 2015; revision received 17 March 2015; accepted 17 March 2015 Subject Editor: Birgit C. Schlick-Steiner James K. Wetterer (contact author) , Wilkes Honors College , Florida Atlantic University , 5353 Parkside Drive , Jupiter , FL 33458 , USA. E-mail: [email protected] Francisco Hita Garcia , Hessisches Landesmuseum Darmstadt , Friedensplatz 1 , 64283 Darmstadt , Germany.
    [Show full text]
  • Zootaxa, Hymneoptera, Formicidae
    Gregg, R.E. (1969b) New species of Pheidole from Pacific Coast islands (Hymenoptera: Formi- ZOOTAXA cidae). Entomological News, 80, 93–101. 936 Groark, K.P. (2001) Taxonomic identity of “hallucinogenic” harvester ant (Pogonomyrmex califor- nicus) confirmed. Journal of Ethnobiology, 21, 133–144. Gulmahamad, H. (1995) The genus Liometopum Mayr (Hymenoptera: Formicidae) in California, with notes on nest architecture and structural importance. Pan-Pacific Entomologist, 71, 82– 86. Gulmahamad, H. (1997) Ecological studies on Cardiocondyla ectopia Snelling (Hymenoptera: For- micidae) in southern California. Pan-Pacific Entomologist, 73, 21–27. Haldeman, S.S. (1844) Descriptions of insects, presumed to be undescribed. Proceedings of the Academy of Natural Sciences of Philadelphia, 2, 53–55. Hansen, L.D. & Akre, R. D. (1985) Biology of carpenter ants in Washington State (Hymenoptera: Formicidae: Camponotus). Melanderia, 43, i–v, 1–61. Hasegawa, E. (1998) Phylogeny and host-parasite relationships in social parasitism in Lasius ants. Entomological Science, 1, 133–135. Hasegawa, E., Tinaut, A. & Ruano, F. (2002) Molecular phylogeny of two slave-making ants: Ros- somyrmex and Polyergus (Hymenoptera: Formicidae). Annales Zoologici Fennici, 39, 267– 271. Haskins, C.P. (1928) Notes on the behavior and habits of Stigmatomma pallipes Haldeman. Journal of the New York Entomological Society, 36, 179–184. Heinze, J. (1989b) A biochemical approach toward the systematics of the Leptothorax “muscorum” group in North America (Hymenoptera: Formicidae). Biochemical Systematics and Ecology, 17, 595–601. Heinze, J. (1991) Biochemical studies on the relationship between socially parasitic ants and their hosts. Biochemical Systematics and Ecology, 19, 195–206. Heinze, J. (1998 (“1995”)) The origin of workerless parasites in Leptothorax (s.
    [Show full text]
  • Institutional Repository - Research Portal Dépôt Institutionnel - Portail De La Recherche
    Institutional Repository - Research Portal Dépôt Institutionnel - Portail de la Recherche University of Namurresearchportal.unamur.be RESEARCH OUTPUTS / RÉSULTATS DE RECHERCHE The topology and drivers of ant-symbiont networks across Europe Parmentier, Thomas; DE LAENDER, Frederik; Bonte, Dries Published in: Biological Reviews DOI: Author(s)10.1111/brv.12634 - Auteur(s) : Publication date: 2020 Document Version PublicationPeer reviewed date version - Date de publication : Link to publication Citation for pulished version (HARVARD): Parmentier, T, DE LAENDER, F & Bonte, D 2020, 'The topology and drivers of ant-symbiont networks across PermanentEurope', Biologicallink - Permalien Reviews, vol. : 95, no. 6. https://doi.org/10.1111/brv.12634 Rights / License - Licence de droit d’auteur : General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. BibliothèqueDownload date: Universitaire 07. oct.. 2021 Moretus Plantin 1 The topology and drivers of ant–symbiont networks across 2 Europe 3 4 Thomas Parmentier1,2,*, Frederik de Laender2,† and Dries Bonte1,† 5 6 1Terrestrial Ecology Unit (TEREC), Department of Biology, Ghent University, K.L.
    [Show full text]
  • Of Sri Lanka: a Taxonomic Research Summary and Updated Checklist
    ZooKeys 967: 1–142 (2020) A peer-reviewed open-access journal doi: 10.3897/zookeys.967.54432 CHECKLIST https://zookeys.pensoft.net Launched to accelerate biodiversity research The Ants (Hymenoptera, Formicidae) of Sri Lanka: a taxonomic research summary and updated checklist Ratnayake Kaluarachchige Sriyani Dias1, Benoit Guénard2, Shahid Ali Akbar3, Evan P. Economo4, Warnakulasuriyage Sudesh Udayakantha1, Aijaz Ahmad Wachkoo5 1 Department of Zoology and Environmental Management, University of Kelaniya, Sri Lanka 2 School of Biological Sciences, The University of Hong Kong, Hong Kong SAR, China3 Central Institute of Temperate Horticulture, Srinagar, Jammu and Kashmir, 191132, India 4 Biodiversity and Biocomplexity Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa, Japan 5 Department of Zoology, Government Degree College, Shopian, Jammu and Kashmir, 190006, India Corresponding author: Aijaz Ahmad Wachkoo ([email protected]) Academic editor: Marek Borowiec | Received 18 May 2020 | Accepted 16 July 2020 | Published 14 September 2020 http://zoobank.org/61FBCC3D-10F3-496E-B26E-2483F5A508CD Citation: Dias RKS, Guénard B, Akbar SA, Economo EP, Udayakantha WS, Wachkoo AA (2020) The Ants (Hymenoptera, Formicidae) of Sri Lanka: a taxonomic research summary and updated checklist. ZooKeys 967: 1–142. https://doi.org/10.3897/zookeys.967.54432 Abstract An updated checklist of the ants (Hymenoptera: Formicidae) of Sri Lanka is presented. These include representatives of eleven of the 17 known extant subfamilies with 341 valid ant species in 79 genera. Lio- ponera longitarsus Mayr, 1879 is reported as a new species country record for Sri Lanka. Notes about type localities, depositories, and relevant references to each species record are given.
    [Show full text]
  • Of Hungary: Survey of Ant Species with an Annotated Synonymic Inventory
    insects Article The Myrmecofauna (Hymenoptera: Formicidae) of Hungary: Survey of Ant Species with an Annotated Synonymic Inventory Sándor Cs˝osz 1,2, Ferenc Báthori 2,László Gallé 3,Gábor L˝orinczi 4, István Maák 4,5, András Tartally 6,* , Éva Kovács 7, Anna Ágnes Somogyi 6 and Bálint Markó 8,9 1 MTA-ELTE-MTM Ecology Research Group, Pázmány Péter sétány 1/C, 1117 Budapest, Hungary; [email protected] 2 Evolutionary Ecology Research Group, Centre for Ecological Research, Institute of Ecology and Botany, 2163 Vácrátót, Hungary; [email protected] 3 Department of Ecology and Natural History Collection, University of Szeged, Szeged Boldogasszony sgt. 17., 6722 Szeged, Hungary; [email protected] 4 Department of Ecology, University of Szeged, Közép fasor 52, 6726 Szeged, Hungary; [email protected] (G.L.); [email protected] (I.M.) 5 Museum and Institute of Zoology, Polish Academy of Sciences, ul. Wilcza 64, 00-679 Warsaw, Poland 6 Department of Evolutionary Zoology and Human Biology, University of Debrecen, Egyetem tér 1, 4032 Debrecen, Hungary; [email protected] 7 Kiskunság National Park Directorate, Liszt F. u. 19, 6000 Kecskemét, Hungary; [email protected] 8 Hungarian Department of Biology and Ecology, Babe¸s-BolyaiUniversity, Clinicilor 5-7, 400006 Cluj-Napoca, Romania; [email protected] 9 Centre for Systems Biology, Biodiversity and Bioresources, Babes, -Bolyai University, Clinicilor 5-7, 400006 Cluj-Napoca, Romania * Correspondence: [email protected]; Tel.: +36-52-512-900 (ext. 62349) Simple Summary: Abundance is a hallmark of ants (Hymenoptera: Formicidae). They are exceed- ingly common in both natural and artificial environments and they constitute a conspicuous part Citation: Cs˝osz,S.; Báthori, F.; Gallé, of the terrestrial ecosystem; every 3 to 4 out of 10 kg of insects are given by ants.
    [Show full text]
  • Hymenoptera: Formicidae) 315-321 © Zool.-Bot
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Verhandlungen der Zoologisch-Botanischen Gesellschaft in Wien. Frueher: Verh.des Zoologisch-Botanischen Vereins in Wien. seit 2014 "Acta ZooBot Austria" Jahr/Year: 2018 Band/Volume: 155_1 Autor(en)/Author(s): Wagner Herbert Christian, Seifert Bernhard, Borovsky Roman, Paill Wolfgang Artikel/Article: First insight into the ant diversity of the Vjosa valley, Albania (Hymenoptera: Formicidae) 315-321 © Zool.-Bot. Ges. Österreich, Austria; download unter www.zobodat.at Acta ZooBot Austria 155, 2018, 315–321 First insight into the ant diversity of the Vjosa valley, Albania (Hymenoptera: Formicidae) Herbert Christian Wagner, Bernhard Seifert, Roman Borovsky & Wolfgang Paill Thirty sites at the river Vjosa (Albania) were sampled with 150 pitfall traps in April 2017. The ant catches were determined and are presented. We identified 19 species; two of them show ripicolous tendencies. Nine species are considered to be first records for Albania; this demonstrates the poor investigation status of this territory. WAGNER H.CH., SEIFERT B., BOROVSKY R. & Wolfgang PAILL W., 2018: Erster Ein- blick in die Ameisendiversität des Vjosa-Tales, Albanien (Hymenoptera: Formi- cidae). Dreißig Standorte am Fluss Vjosa (Albanien) wurden im April 2017 mit 150 Barber- fallen beprobt. Die Ameisenfänge wurden determiniert und werden vorgestellt. Wir identifizierten 19 Arten, zwei davon zeigen ripikole Tendenzen. Neun Arten werden als Erstnachweise für Albanien betrachtet, was den schlechten Erforschungsstand dieses Landes demonstriert. Keywords: Vjosa river, floodplain, riparian, ripicol, new records. Introduction The Balkans probably comprise the largest ant diversity of Europe (Borowiec & Salata 2012b, Borowiec 2014, Bračko et al.
    [Show full text]