Upregulation of Two BH3-Only Proteins, Bmf and Bim, During Tgfb-Induced Apoptosis

Oncogene (2007) 26, 970–981 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Upregulation of two BH3-only proteins, Bmf and Bim, during TGFb-induced apoptosis

AR Ramjaun1, S Tomlinson2 A Eddaoudi3 and J Downward1

1Signal Transduction, Cancer Research UK London Research Institute, London, UK; 2Bioinformatics and Biostatistics, Cancer Research UK London Research Institute, London, UK and 3Fluorescence Activated Cell Sorting Laboratories, Cancer Research UK London Research Institute, London, UK

Transforming growth factor-b (TGFb)-activated signal- teristic of TGFb-induced apoptosis is the slow onset, ling pathways can lead to apoptosis, growth arrest or with requirement for changes in gene expression (Inayat- promotion of malignant behaviour, dependent on cellular Hussain et al., 1997; Teramoto et al., 1998). This has context. The molecular mechanisms involved in TGFb- precipitated a search for potential apoptotic regulators induced apoptosis remain controversial; although changes whose expression is controlled by TGFb (Coyle et al., in gene expression are thought to be pivotal to the process, 2003; Yang et al., 2003). several different candidate apoptotic initiators and To date, several proteins have been put forward as mediators have been proposed. Smad4, a critical compo- potential candidates for such a role, including IkB-a nent of the TGFb-induced transcriptional machinery, is (Arsura et al., 1996), death-associated protein kinase shown here to be essential for induction of apoptosis. (DAP-kinase) (Jang et al., 2002), the lipid phosphatase Gene expression analysis identified the proapoptotic Bcl-2 SHIP-1 (Valderrama-Carvajal et al., 2002), the stress family members, Bmf and Bim, as induced by TGFb, and cytokine inducible GADD45b protein (Yoo et al., dependent on both Smad4 and p38 function and the 2003) and the connective tissue growth factor (CTGF) generation of reactive oxygen species. TGFb-induced Bmf (Hishikawa et al., 1999). Other proteins that play a and Bim localize to cellular membranes implicated in facilitative role in TGFb-induced death, but whose apoptosis. Inhibition of the TGFb-induced expression of expression is not induced by it, include the adaptor both these proteins together provides significant protection proteins DAXX (Perlman et al., 2001) and CD2AP of cells fromapoptosis. The TGF b-triggered cell death (Schiffer et al., 2004) and the septin ARTS-(Larisch programme thus involves induction of multiple BH3-only et al., 2000). In addition, the proapoptotic Bcl-2 family proteins during the induction of apoptosis. protein Bim is a Smad3-dependent TGFb-induced Oncogene (2007) 26, 970–981. doi:10.1038/sj.onc.1209852; protein in B lymphocytes (Wildey et al., 2003), whose published online 14 August 2006 binding to Bcl-XL increases during TGFb-induced apoptosis (Ohgushi et al., 2005). Furthermore, Bad Keywords: Smad4; TGFb; apoptosis; p38; Bmf; Bim (Kim et al., 2002) and Bid (Kim et al., 2004) undergo caspase-dependent cleavage to more potently apoptotic forms after TGFb stimulation, while the antiapoptotic proteins Bcl-XL and Bcl-2 have been demonstrated to Introduction undergo TGFb-mediated downregulation in several cell types (Saltzman et al., 1998; Francis et al., 2000; Chipuk The transforming growth factor-b (TGFb) family of et al., 2001; Kanamaru et al., 2002). Finally, TGFb may cytokines activates an array of signalling pathways, antagonise survival signalling through the physical including Smad2-, Smad3- and Smad4-mediated trans- interaction of Smad3 with Akt (Conery et al., 2004; cription and stress-activated kinases such as p38 and Remy et al., 2004). Jun-N-terminal kinase (JNK) (Wakefield and Roberts, Although many of these proteins may play some role 2002). These pathways can lead to reduction in cell in TGFb-induced apoptosis, likely with variations growth and survival (Derynck and Zhang, 2003), with between cell types, it has proved difficult to establish Smad4 expression being lost in certain tumours (Hahn an unequivocal requirement for any of them as the key et al., 1996). A key outcome of TGFb signalling in some activator of the apoptotic machinery, leading to the idea cell types is the induction of apoptosis; lymphocytes and that there might exist substantial redundancy in the hepatocytes are particularly sensitive. A striking charac- transcriptional response to TGFb that ensures efficient execution of the cell death programme. We report here Correspondence:Professor J Downward, Signal Transduction the results of a microarray analysis of TGFb-regulated Laboratory, Cancer Research UK London Research Institute, 44 transcription in a mouse hepatocyte cell line where Lincoln’s Inn Fields, London WC2A 3PX, UK. apoptosis is the overwhelming response to TGFb treat- E-mail:[email protected] Received 2 February 2006; revised 27 June 2006; accepted 28 June 2006; ment. We find that TGFb strongly induces expression published online 14 August 2006 of the proapoptotic Bcl-2 family proteins Bmf and Bim Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 971 in these cells and also in a number of other cell systems. differences as to whether TGFb induces p38 activation Suppression of the induction of both of these two BH3- and whether this is Smad-dependent or Smad-indepen- only proteins together significantly inhibits TGFb- dent (Takekawa et al., 2002; Yu et al., 2002; Yoo et al., driven apoptosis, suggesting that they might play at 2003), with early and late phases of p38 activation also least partially redundant roles in the regulation of cell likely employing different mechanisms. In the cell lines death. Bmf and Bim acting together may be significant used here, TGFb induced only minor activation of p38 inducers of TGFb-regulated apoptosis in a number of as shown by analysis of MAPKAPK-2 phosphorylation cell types. (Figure 2b) and p38 phosphorylation at various time points (data not shown). The p38 kinase inhibitors SB202190 (Figure 2b) and SB203580 (data not shown) Results markedly inhibited the basal level of p38 activity in AML12 and NMuMG cells. In order to address In order to investigate the mechanisms involved in whether, and over what time period, p38 activity might TGFb-induced cell death, we used the normal murine be essential for TGFb-mediated cell death, the p38 hepatocyte cell line, AML12, and the normal murine inhibitors were either used during the first 12 h or during mammary epithelial cell line, NMuMG. Addition of the final 36 h of TGFb stimulation. Inhibition of the p38 TGFb caused extensive cell death by 48 h in both cells pathway in AML12 cells robustly abrogated TGFb- with concomitant caspase-3 cleavage (Figure 1a and b). induced cell death, but only when the inhibitor was Analysis of the two cell types by Annexin V/4, applied at the later time interval (12–48 h). By contrast, 6-diamidino-2-phenylindole (DAPI) or propidium io- NMuMG cells demonstrated little alteration in their dide (PI) staining revealed differences in the kinetics of response to TGFb on treatment with p38 inhibitors changes in their fluorescence-activated cell sorting (Figure 2b). The importance of the p38 pathway in the (FACS) profiles after TGFb stimulation (Figure 1c). induction of apoptosis by TGFb therefore differs AML12 cells rapidly became both Annexin V-positive between these two cell types, while Smad function is and DAPI-positive, whereas NMuMG cells appeared to essential in both cases. As TGFb only causes relatively progress more slowly through the cell death programme, small increases in p38 activity, basal p38 signalling may accumulating in the Annexin V-positive only state play an important role in the induction of apoptosis by before membrane rupture and subsequent DAPI stain- TGFb in AML12 cells. In these cells, it has been ing (Figure 1c). AML12 cells also appeared to undergo proposed that p38 activation is downstream of Smad- loss of mitochondrial membrane potential more rapidly mediated induction of GADD45b (Yoo et al., 2003). than NMuMG cells (Figure 1c). As caspase-3 was As changes in gene expression are required for TGFb- activated in both cell types, it appeared likely that induced apoptosis, we sought to identify apoptotic genes caspases were responsible for mediating cell death in regulated by TGFb in a Smad4- and/or p38-dependent both AML12 and NMuMG cells. This was confirmed manner in AML12 cells using Affymetrix microarrays. using the broad-spectrum caspase inhibitor, Boc-D- From three independent replicates, a number of cell FMK, which prevents TGFb-induced apoptosis in both death-associated proteins were identified as being cell types (Figure 1d). However, AML12 cells are only differentially up- or downregulated by TGFb between partially protected by the more selective caspase wild-type and the Smad4-deficient cells, or between inhibitor Z-VAD-FMK (Figure 1d), possibly suggesting wild-type cells in the presence or absence of the p38 the involvement of other effector caspases in this line. inhibitor. In addition, well-characterized TGFb-regu- To investigate the role of the various TGFb-induced lated genes such as PAI-1 (induced 4.1-fold) and c-Myc signalling pathways in the induction of apoptosis, we (suppressed 2.8-fold) were identified, acting as positive knocked down Smad4 expression in both cell types controls for microarray function. The Bcl-2 protein using RNA interference (RNAi). Both stable cell clones family was significantly represented in our data set, with expressing a short hairpin RNA vector and cell Bmf, Bim and Bcl-XL detected in the TGFb-regulated populations transiently transfected with synthetic small Smad4-dependent gene list, as well as Bmf and Bim in interfering RNA oligonucleotides showed downregula- the p38-dependent gene list. We chose to focus on cell tion of Smad4 (Figure 2a). The transient and stable death-associated genes whose expression was most RNAi systems targeted different sequences in the Smad4 differentially regulated by TGFb (greater than 1.5-fold; mRNA, reducing the likelihood of artifactual off-target Table 1). Significantly, the proapoptotic BH3-only effects. Smad4 downregulation dramatically inhibited protein, Bmf, emerged as the most strongly upregulated the induction of cell death by TGFb in both cell types cell death-associated protein in both the Smad4-depen- (Figure 2a), confirming the importance of the Smad dent and p38-dependent gene lists. None of the other pathway in apoptosis. previously reported TGFb-induced apoptosis regulators The p38 pathway has also been implicated in TGFb- were found in this analysis to be modulated in the induced cell death (Liao et al., 2001; Schrantz et al., direction expected, a result also confirmed by Western 2001; Park et al., 2002; Yu et al., 2002), with use of an blotting for IkB-a, DAP-kinase, Bid and Bad MKK3 dominant-negative construct or p38 inhibitors (Figure 3b) and SHIP-1 (data not shown). providing protection against TGFb-induced killing To confirm that Bmf and Bim are both TGFb- in some systems (Yu et al., 2002; Edlund et al., 2003; induced Smad4- and p38-dependent genes in AML12 Yoo et al., 2003). However, there are cell type cells, we used reverse transcription–polymerase chain

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 972

Figure 1 Characterization of TGFb-mediated apoptosis in AML12 and NMuMG cells. (a) Photographs of AML12 and NMuMG cells undergoing TGFb-induced apoptosis taken 48 h after TGFb stimulation. Scale bars:25 mm. (b) A Western blot time course analysis of caspase-3 cleavage during TGFb-induced apoptosis. The processed and cleaved form of caspase-3 are indicated. (c) Kinetics of TGFb-mediated cell death. Alexa Fluor 647 Annexin V/DAPI staining showing cell death in AML12 and NMuMG cells at the indicated times after addition of TGFb. Mitochondrial membrane potential was also monitored with TMRE. (d) Different caspase inhibitors have different effects on cell death in AML12 and NMuMG cells. Cells preincubated with the broad-spectrum caspase inhibitors, Z-VAD-FMK (Z-VAD) or Boc-D-FMK (Boc-D) were scored for the percentage of Annexin V and PI-positive cells after 48 h of TGFb exposure. The bar graphs are a representative example of the experiment. This experiment was repeated at least three independent times. The data show means þ s.d. The numbers shown represent the fold changes over unstimulated cells.

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 973

Figure 2 Smad4 and p38 play distinct roles during TGFb-mediated cell death. (a) Western blots showing downregulation of Smad4 in a clone of AML12 cells stably expressing smad4 RNAi oligonucleotides, and a pool of NMuMG cells transfected with smad4 siRNA for 48 h (left panel). Smad4 downregulation inhibits TGFb-induced cell death. Stable AML12 cells or transiently transfected NMuMG cells scored for cell death using Annexin V/PI staining following TGFb-stimulation for 48 and 24 h, respectively. The numbers shown represent the fold changes over unstimulated conditions (right panel). (b) The p38 MAPK pathway plays a role during the later phase of apoptotic cell death in AML12 cells, but not in NMuMG cells. Western blotting analysis of the p38-substrate MAPKAPK-2 after 24 h of TGFb stimulation with or without the p38 inhibitor, SB202190 (top panel). Cell death analysis after inhibition of the p38 MAPK pathway during early (0–12 h) and late (12–48 h) phases of TGFb-induced apoptotic cell death (bottom panel). The bar graphs are a representative example of the experiment. This experiment was repeated at least three independent times. The data show means þ s.d. The numbers shown represent the fold changes over unstimulated cells. reaction (RT–PCR) (Figure 3a) and Western blotting absence of Smad4. In addition, Bmf induction is very (Figure 3b). TGFb-mediated upregulation of Bmf and sensitive to inhibition of p38, while Bim induction is Bim protein and mRNA is greatly reduced in the partially inhibited. Reduction of both Smad4 and p38

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 974 function results in complete loss of Bmf and Bim nents of the cytoskeleton (Puthalakath et al., 1999, expression in response to TGFb. Bmf and Bim proteins 2001). Thus, we sought to determine the localization of were induced rapidly, between 1 and 4 h after addition the TGFb upregulated Bmf and Bim through subcel- of TGFb (Figure 3c), suggesting that they are relatively lular fractionation. Purified components of the cytoske- direct targets of these pathways. leton revealed enrichment for a large portion of the Bmf and Bim are reported to be additionally induced BH3-only proteins (data not shown). However, regulated through their interaction with specific compo- we also detected significant noncytoskeletal-associated

Table 1 Smad4/p38-dependent TGFb-regulated genes associated with cell death Genbank ID Fold difference Gene symbol Full name

TGFb-upregulated genes (smad4 dependent) NM_138313 2.5 Bmf Bcl2 modifying factor NM_011611 2.3 Tnfrsf5 Tumour necrosis factor receptor superfamily, member 5 BB183854 1.9 Bcl6 B-cell leukaemia/lymphoma 6 BC012955 1.8 Trib3 Trib3:tribbles homologue 3 (induced in fatty liver dystrophy 2) AV005520 1.8 Sh3glb1 SH3-domain GRB2-like B1 (endophilin) AJ005074 1.7 Pdcd6ip Programmed cell death 6 interacting protein NM_009397 1.7 Tnfaip3 Tumour necrosis factor, a-induced protein 3 AF032460 1.6 Bcl2l11 Bcl2-like 11 (Bim) NM_011577 1.6 Tgfb1 Transforming growth factor-b1 BG094331 1.6 Polb Polymerase (DNA directed), beta TGFb-upregulated genes (p38 dependent) NM_138313 3.3 Bmf Bcl2 modifying factor M12573 2.5 Hsp70-1 Heat shock protein 1B NM_019464 1.7 Sh3glb1 SH3-domain GRB2-like B1 (endophilin) NM_130859 1.7 Card10 Caspase recruitment domain family, member 10 NM_021897 1.5 Stinp Stress-induced protein (Trp53inp1) AF032460 1.4 Bcl2l11 Bcl2-like 11 (Bim) TGFb-downregulated genes (smad4 dependent) NM_028133 4.2 Egln3 EGL nine homologue 3 AF109769 2.1 Mapk8ip Mitogen-activated protein kinase 8 interacting protein NM_007611 1.8 Casp7 Caspase 7 BC021490 1.7 Dapk1 Death-associated protein kinase 1 BG972377 1.7 Tnfrsf21 tumour necrosis factor receptor superfamily, member 21 NM_020275 1.7 Tnfrsf10b Tumour necrosis factor receptor superfamily, member 10b BC003755 1.7 Eya2 Eyes absent 2 homologue BQ176371 1.6 Sgpp1 Sphingosine-1-phosphate phosphatase 1 NM_007499 1.6 Atm Ataxia telangiectasia mutated homologue NM_009743 1.4 Bcl2l1 Bcl2-like 1 (Bcl-X) TGFb-downregulated genes (p38 dependent) NM_007837 4.3 Ddit3 DNA-damage inducible transcript 3 NM_028133 3.7 Egln3 EGL nine homologue 3 BC012955 2.2 Trib3 Trib3:tribbles homologue 3 (induced in fatty liver dystrophy 2) AF375476 1.9 Atf5 Activating transcription factor 5 NM_007544 1.8 Bid BH3 interacting domain death agonist NM_010444 1.7 Nr4a1 Nuclear receptor subfamily 4, group A, member 1 AK017841 1.6 E2f1 E2F transcription factor 1 NM_009163 1.5 Sgpl1 Sphingosine phosphate lyase 1

Smad4- and p38-dependent cell death-associated genes that are regulated by TGFb by greater than 1.5-fold. Differentially regulated genes are assigned biological functions using the Affymetrix GO browser analysis software. Bmf and Bim are highlighted in bold.

Figure 3 TGFb induces expression of the apoptotic proteins, Bmf and Bim, which localize to mitochondria/ER membranes. (a) TGFb induces transcription of Bmf and Bim in a Smad4- and p38-dependent manner. RT–PCR performed from wild-type or Smad4-deﬁcient AML12 cell total RNA after 0, 4 and 16 h of TGFb incubation in the presence or absence of the p38 inhibitor (SB202190). (b) TGFb induces proapoptotic Bmf and Bim protein expression and downregulates the prosurvival Bcl-2 family member, Bcl-XL. Western blot analysis of Bmf, Bim and Bcl-xL after 24 h of TGFb stimulation, in wild-type and Smad4-deﬁcient AML12 cells, as well as in the presence of the p38 inhibitor (SB202190). The Bmf and Bim antibodies recognize multiple isoforms of the proteins. Other Bcl-2 family members, Bid and Bad, as well as the apoptosis-associated proteins DAP kinase and IkB-a were also assessed. A p38 antibody was used to show equal protein loading. (c) TGFb-mediated upregulation of Bmf and Bim is an early event. Western blot of time course analysis of Bmf and Bim upregulation after TGFb addition. (d) Preincubation of cycloheximide inhibits Bmf and Bim upregulation (upper panel) and partially abrogates TGFb-induced apoptosis (lower panel). The bar graphs are a representative example of the experiment. This experiment was repeated at least three independent times. The data show means þ s.d. The numbers shown represent the fold changes over unstimulated cells. (e) Upregulated Bmf and Bim localize to mitochondrial/endoplasmic reticulum (ER) membranes in Western blot analysis of subcellular fractionation of AML12 cells. AML12 cells stimulated for 24 h with TGFb, before performing subcellular fractionation of cellular membranes. The HDM fraction consists mainly of mitochondrial and ER membranes. Other fractions include the PNS from which nuclei and cell debris have been removed, LDMenriched for small vesicular membranes and the cytosol (Cyt). Equal protein was loaded from each fraction.

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 975 pools of Bmf and Bim in cells. Subcellular fractionation through their sequestration of prosurvival members of revealed that upregulated Bmf and Bim were also the Bcl-2 family away from the apoptotic regulators, enriched on high-density microsomes (HDM), which Bax and Bak. Indeed, Bmf was able to interact with consist of endoplasmic reticulum and mitochondrial Bcl-XL in vitro (data not shown). In addition, similar to membranes (Figure 3d). The presence of Bmf and Bim previous data demonstrating downregulation of Bcl-XL here is consistent with their ability to induce cell death in TGFb-stimulated cells (Nass et al., 1996; Saltzman

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 976 et al., 1998; Chipuk et al., 2001; Herrera et al., 2001b), inactive mutant of Bmf, can induce cell death, with Bmf we also detected Bcl-XL as one of the apoptotic genes being particularly potent. downregulated by TGFb in the microarray. Further- In order to determine the importance of the induction more, Bcl-XL protein levels in both AML12 (Figure 3b) of Bmf and Bim in the TGFb-mediated cell death and NMuMG (Figure 3d) cells were correspond- process, we sought to inhibit their upregulation using ingly lower in cells exposed to TGFb and were also siRNA oligonucleotides. In both AML12 and NMuMG dependent upon both Smad signalling and p38 activity cells, Bmf levels were undetectable in the absence of (Figure 3b). TGFb and their induction by the cytokine was almost To demonstrate that TGFb-mediated regulation of totally blocked by transient transfection of siRNA the Bcl-2 family was not unique to AML12 cells, a oligos targeting Bmf (Figure 5a). Bim levels were barely survey of different cell lines demonstrated that similar detectable in NMuMG cells in the absence of TGFb and regulation occurs in other cell systems. Bmf was induced their induction was completely blocked by siRNA oligos by TGFb in rat FAO hepatoma cells, the lung CMT170 targeting Bim. In AML12 cells, a significant basal level cell line and the B lymphoma cell line, A20 (Figure of Bim expression could be detected:50 n M oligo against S1A), as well as the myeloid cell, M1 (data not shown). Bim reduced the level of Bim following TGFb treatment Bim was also induced in FAO cells. In addition, to about the basal level in control cells (Figure 5a, right examination of NMuMG cells revealed a very similar hand lane). Combinations of the two oligos effectively pattern of regulation of Bmf and Bim to that in AML12 inhibited the induction of the two targets together. It cells, with major inhibition by Smad4 RNAi and at least was thus possible to use RNAi to maintain the amounts partial sensitivity to p38 inhibition (Figure 4a). In all of both Bmf and Bim in each cell line at the basal level cases where the BH3 proteins underwent TGFb-induc- even following prolonged exposure to TGFb. A second tion, TGFb-induced cell death was observed (Figure pair of siRNA oligos against different sequences on Bmf S1B). To ensure the phenomenon was not specific to cell and Bim could cause similar inhibition of protein lines only, TGFb-sensitive primary rat hepatocytes were expression (Figure S2A). also examined. Similar TGFb-mediated regulation of Individually preventing Bmf or Bim upregulation Bmf and Bim was also observed in primary cells to that provided only partial protection for AML12 and seen in the cell lines (Figure S1C). NMuMG cells, as determined by FACS analysis Previous reports have suggested a role for reactive (Figure 5b, Figure S2B) or by the appearance of the oxygen species (ROS), which can be rapidly generated activated, cleaved fragment of caspase-3 (Figure 5a, after TGFb addition, in the induction of apoptosis bottom panel). However, simultaneous use of RNAi to (Thannickal and Fanburg, 1995; Sanchez et al., 1996; reduce Bmf and Bim to basal levels was sufficient to Herrera et al., 2001a). In order to determine if ROS provide significantly more protection in both cell types played a role in the regulation of the Bcl-2 family (Figure 5b, Figure S2B), with protection being close to proteins, we used the ROS scavengers pyrrolidinedithio- complete in NMuMG cells, indicating that Bmf and Bim carbamic acid (PDTC) and ascorbic acid to inhibit ROS induction function together during TGFb-mediated generation. Similar to previous reports, we found that apoptosis. As loss of neither one alone is sufficient to TGFb-mediated Bcl-XL down-regulation was atte- protect cells, increasing levels of Bmf and Bim are likely nuated in the presence of the ROS scavengers in both to have at least partially redundant function in the AML12 and NMuMG cells. More strikingly, TGFb- induction of cell death by TGFb. mediated Bmf and Bim induction were almost completely prevented in the presence of the ROS scavengers (Figure 4b). This suggested a role for ROS in the TGFb- Discussion mediated regulation of changes in apoptotic gene transcription. To determine whether oxidative stress To date it has been unclear exactly which proteins alone was sufficient to induce changes in the expression induced on TGFb treatment of cells lead to activation of the apoptotic proteins, we treated the cells with of the apoptotic programme, in particular the identity exogenous hydrogen peroxide. In both AML12 and of the entry points into the apoptosis signalling path- NMuMG cells, hydrogen peroxide failed to induce ways. While several proapoptotic proteins have been either Bmf or Bim protein levels (data not shown). This shown to be induced by TGFb, intervention to change suggested that TGFb-mediated ROS production alone is their levels within the range controlled by TGFb has insufficient to induce changes to Bcl-2 family protein generally proved ineffective in providing major protec- levels, but only in conjunction with other TGFb- tion in different cell types. In some cases where the mediated signalling pathways, most likely involving expression or activity of TGFb-induced proteins has Smad-mediated transcription, can such changes occur. been targeted, appropriate controls to check for the To address whether overexpression of Bim or Bmf by specificity of any protective effects have not been themselves is sufficient to induce cell death in AML12 carried out (Hishikawa et al., 1999; Jang et al., 2002). cells, a GFP marker plasmid was co-transfected along In other cases, the importance of signalling intermedi- with Bim or Bmf expression constructs. The level of cell ates varies between cell systems, such as GADD45b- death in the transfected cells was assessed 48 h later mediated activation of p38 in hepatocytes (Yoo et al., using FACS analysis of Annexin V and PI staining 2003), while p38 signalling is not essential in mammary (Figure 4c). As expected, both Bim and Bmf, but not an cells (Figure 1).

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 977

Figure 4 Bmf and Bim are regulated by the same pathways in NMuMG cells as in AML12 cells, and are capable of causing apoptosis through overexpression. (a) NMuMG cells upregulate Bmf and Bim in response to TGFb. NMuMG cell lysates from cells exposed to TGFb and/or the p38 inhibitor (SB202190) for 24 h, probed with antibodies to Bmf, Bim, Bcl-XL and tubulin (left panel). Western blot analysis of Bmf, Bim and Bcl-xL after 24 h of TGFb stimulation, in wild-type and Smad4-deﬁcient AML12 cells, as well as in the presence of the p38 inhibitor (SB202190; right panel). (b) ROS scavengers prevent Bim and Bmf upregulation. Western blot analysis of AML12 and NMuMG cells pretreated with PDTC and ascorbic acid (Asc) before addition of TGFb.(c) GFP/Bim or GFP/Bmf co-transfected AML12 cells were subjected to cell death analysis using Annexin V/PI FACS.

From the data provided here, it is likely that the of both Bmf and Bim increases the robustness of the difﬁculty in ﬁnding single mediators of TGFb-induced apoptotic response to TGFb and makes it less likely that apoptosis is due to redundancy in the proapoptotic susceptible cells can escape TGFb-induced killing by transcriptional programme. The combination of induction inactivation of single genes. Downregulation of Bcl-XL

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 978

Figure 5 Inhibition of Bmf and Bim expression protects cells from TGFb-mediated apoptosis. (a) siRNA oligonucleotides to Bmf and Bim reduce their TGFb-induced expression in AML12 and NMuMG cells. Western blot analysis of cells transfected with either GFP (control), Bmf #1, and/or Bim #1 siRNA oligonucleotides 18 h before addition of TGFb. After 24 h, lysates were prepared and probed with antibodies to Bmf, Bim, tubulin and caspase-3. The 17 kDa fragment of cleaved caspase-3 is shown. (b) Inhibition of Bmf and Bim expression protects cells from TGFb-induced apoptosis. Cell death analysis of cells transfected with either GFP (control) or Bmf #1 and/or Bim #1 siRNA oligonucleotides before addition of TGFb. After 48 h cells were subjected to Annexin-V/PI FACS analysis to determine percentage of cell death. The bar graphs are a representative example of the experiment. This experiment was repeated at least three independent times. The data show means þ s.d. Numbers shown represent the fold changes over unstimulated cells.

may also be important in contributing to cell death in of the transcriptional repressor Bcl-6 (Table 1), a known certain systems and may explain the incomplete protec- suppressor of Bcl-XL transcription, could explain its tion provided by Bmf and Bim inhibition in AML12 suppression by TGFb (Tang et al., 2002). cells. Bcl-XL downregulation at the same time that Bmf ROS play an important role in the apoptotic response and Bim are upregulated means that not only do the to TGFb, being necessary, but not sufﬁcient, for higher levels of these BH3-only proteins sequester more upregulation of Bmf and Bim expression and down- of the Bcl-XL and other similar prosurvival proteins, but regulation of Bcl-XL expression (Figure 3f). TGFb also the overall reduced level of Bcl-XL limits that treatment of hepatocytes has been reported to suppress available for sequestration of Bax and Bak. the expression of a number of key proteins involved in Analysis of the promoter regions of Bmf and Bim protecting cells from oxidative stress, including manga- reveals consensus binding sequences for Smad3/4 com- nese-superoxide dismutase, copper/zinc-superoxide dis- plexes, as well as, in the case of Bmf, for the known mutase and catalase (Kayanoki et al., 1994). An earlier p38-regulated transcription factor, MEF2C, (data not microarray analysis of TGFb-regulated transcription in shown) suggesting that the transcriptional regulation of a hepatoma cell line reported downregulation of some these genes by TGFb may be relatively direct. In the case nine antioxidant defence proteins, which could lead to of Bim, ROS upregulation of FoxO Forkhead transcrip- elevation of the levels of ROS (Coyle et al., 2003). Many tion factors (Liu et al., 2005) could also play a role in of these genes are components of the Phase II Bim induction by TGFb (Dijkers et al., 2000), possibly detoxiﬁcation response, which are regulated by Smad3- with FoxO and Smad3/Smad4 acting coordinately ATF3-mediated repression of the ARE antioxidant (Seoane et al., 2004). In the case of Bcl-XL, upregulation response element (Kang et al., 2003; Bakin et al., 2005).

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 979 The data presented here suggest that no single Bcl-2 primer:5-AGCTTTTCCAAAAAGGTGGGGAAAGTGA family member is the sole critical mediator of the TGFb- AACCTTCTCTTGAAAGGTTTCACTTTCCCCACCGGG. induced cell death response, but instead apoptosis is a The forward and reverse oligos were annealed, phosphorylated result of activation of a transcriptional programme in and cloned into the BglII–HindIII sites of pSuper, using which a small subset of regulatory proteins, including standard techniques. AML12 cells were co-transfected with both the Smad4 RNAi vector and pBabe-puro (Morgenstern Bcl-XL, Bmf and Bim, undergo significant expression and Land, 1990) using Effectene (Qiagen, Valencia, CA, USA) changes, the combined effect of which is to trigger the at a ratio of 10:1. After 48 h, cells were selected with puro- cell death programme. In certain cell types, other mycin, and colonies were available for picking several weeks proapoptotic proteins could also contribute, such as later. SHIP in haematopoietic cells, although this is not For synthetic siRNA oligonucleotides against Smad4, Bim induced in the cell systems used here (Valderrama- and Bmf, predesigned mouse-specific oligos were obtained Carvajal et al., 2002). The redundancy of the apoptotic from Ambion Inc. (Austin, TX, USA). The oligo sequences programme of gene expression induced by TGFb is were as follows:(control/GFP) 5 0-GACCCGCGCCGAGGU GAAGtt, (Smad4) 50-GGAUUUCCUCAUGUGAUCUtt, likely to be critical in ensuring that death of sensitive cell 0 types occurs on exposure to TGFb and minimizing the (Bim #1) 5 -GGAGGAACCUGAAGAUCUGtt, (Bim #2) 5-GACGAGUUCAACGAAACUUtt, (Bmf #1) 50-GGAUU possibility of escape from this fate. The full significance AUUCAAGGACUUUGtt, (Bmf #2) 5-GGUCUUCCUUU of the combined induction of Bmf and Bim by TGFb UCCUUCAAtt. These were transfected into cells using Oligo- will require study of the phenotype of mice in which fectamine (Invitrogen, Carlsbad, CA, USA) at a concentration both genes have been deleted; unfortunately the close of – 2–100 nM according to the manufacturer’s recommenda- proximity of these two genes, less than 10 Mb apart on tions. For transient Bmf and Bim RNAi, cells were transfected mouse chromosome 2, will hamper the generation of 18 h before addition of TGFb and cells were analysed for cell these animals. death after 48 h. For Smad4 oligonucleotides, cells were transfected 48 h before TGFb was added, and cell death was quantified 24 h later. Materials and methods Cell death assays Reagents Cells were stimulated with TGFb and cell death was quantified The AML12, NMuMG, CMT170 (clone E9) and A20 cell lines 48 h later. At 10 min before harvesting, TMRE was added to were from ATCC. The FAO cells were a kind gift from Kelvin the media to label active mitochondria. Cells were processed Cain/Marion MacFarlane (Leicester, UK), and the primary for levels of cell death using Alexa Fluor 647 Annexin V rat hepatocytes were a gift from the Sharon Tooze laboratory conjugate and PI or DAPI staining. Dead and dying cells (Cancer Research UK). The p38 mitogen-activated protein were scored as Annexin V-positive and/or PI-positive on a kinase (MAPK) inhibitor (SB202190) and the caspase inhibi- FACSCalibur or LSR (BD Biosciences). For the caspase tors (Z-VAD-FMK and Boc-D-FMK) were purchased from inhibitor experiments, 50 mM Z-VAD-FMK or Boc-D-FMK Calbiochem Inc. (San Diego, CA, USA). Alexa Fluor 647 were preincubated with cells 2 h before addition of TGFb. Annexin V and tetramethyl rhodamine ethyl ester (TMRE) The cells were replaced with media containing fresh inhibitor were purchased from Molecular Probes Inc. (Eugene, OR, (and TGFb) after 24 h. In the case of the p38 inhibitor USA), ascorbic acid, pyrrolidine carbodithioic acid (PDTC), experiments, inhibition of early p38 activity (0–12 h) was DAPI, PI and cycloheximide were obtained from Sigma Inc. achieved by preincubation of the inhibitor 30 min before (St Louis, MO, USA). Cycloheximide was used at a final TGFb addition, before being washed out and replaced concentration of 0.5 mg/ml. Recombinant human TGFb was with fresh media containing TGFb 12 h later. At this 12 h from R&D Systems Inc. (Minneapolis, MN, USA) and was time point, the p38 inhibitor was also added to cells for used at a final concentration of 10ng/ml in all experiments. inhibition of late p38 activity (12–48 h). All cell death experiments were performed in triplicate, and at least three independent times. Antibodies The Smad4 (B-8), IkB-a (C-21) and Bax (P-19) antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, Protein expression analysis Ca, USA). The phospho-MAPKAPK-2, MAPKAPK-2 and For analysis of protein levels, crude cell homogenates were p38 polyclonal antibodies were all obtained from Cell Signal- lysed in sample buffer (without bromophenol blue or b- ling Technology Inc. (Danvers, MA, USA). The Bcl-XL, mercaptoethanol) following 24 h of TGFb stimulation in the cytochrome c, Caspase-3 and Bad antibodies were obtained presence of dexamethasone. Lysed samples were sonicated from BD Biosciences (Bedford, MA, USA). Anti-Bim anti- briefly, and total protein was quantified using BCA reagent bodies was obtained from Calbiochem. The antibody recogniz- (Pierce, Rockford, IL, USA). Samples were routinely sepa- ing DAP-kinase was from Sigma, and the Bid antibody from rated on 12% sodium dodecyl sulphate–polyacrylamide gel R&D systems. The monoclonal hybridoma tubulin (TAT-1) electrophoresis gels. In the case of ROS scavenger experiments, antibody was generated in-house. Finally, the mouse-specific cells were pretreated with PDTC (50 mM for AML12; 100 mM Bmf antibody was a kind gift from David Huang. for NMuMG cells) and Ascorbic acid (1 mM for AML12; 2mM for NMuMG) for 1 h before addition of TGFb. Cell RNAi lysates were prepared 24 h later. All protein expression analysis To generate stable Smad4 downregulated AML12 cells, the was carried out at least twice. following oligonucleotides were synthesized and high-perfor- mance liquid chromatography purified:forward primer Microarray acquisition and analysis 5-GATCCCCGGTGGGGAAAGTGAAACCTTTCAAGAG Experiments using Affymetrix GeneChip Mouse Genome AAGGTTTCACTTTCCCCACCTTTTTGGAAA, and reverse MOE 430A Array oligonucleotide arrays were performed

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 980 following the manufacturers recommendation (http://www. Subcellular fractionation of membranes affymetrix.com/support/technical/manual/expression_manual. Membrane fractions were prepared as described previously affx). A complete description of all procedures and statistical (Kaufmann et al., 2003). Essentially, cells were grown in 15 cm analysis is available in the MIAME checklist file in the plates to 80% confluency. TGFb was incubated with cells for Supplementary information. Annotation and classification of 24 h, before harvesting in lysis buffer (210 mM Mannitol, the genes was performed using the Gene Ontology browser on 70 mM Sucrose, 20 mM Hepes, pH 7.4, 1 mM ethylenediamine- the Affymetrix website (http://www.affymetrix.com/analysis/ N, N, N0, N0-tetraacetic acid and protease inhibitors). Cells index.affx). were homogenized in a Dounce homogenizer (20 strokes) and nuclei and cellular debris were removed by centrifugation at RT–PCR 500 g for 5 min to obtain a postnuclear supernatant (PNS). The Total RNA was extracted from cells using the RNeasy kit PNS was centrifuged at 5100 g for 10 min to obtain the (Qiagen), and subjected to RT and PCR using standard mitochondrial/endoplasmic reticulum pellet (HDM). Centri- protocols. Primers used for PCR were as follows:Bim forward fugation of the post-HDM supernatant at 100 000 g for 60 min primer 50-ATGGCCAAGCAACCTTCTGATGTAAG, Bim in a TLA100.1 yielded the low-density microsomal pellet reverse primer 50-TCAATGCCTTCTCCATACCAGACGG. (LDM) and the cytosolic supernatant (Cyt). 100 mg protein/ For Mouse Bmf, the forward primer was 50-ATGCCCG lane of each fraction were separated on 12% polyacrylamide GAGCGGGCGTATTTTG, and the reverse primer was gels. Protein localization analysis was carried out at least twice. 50-TCACCAGGGCCCCACCCCTTC. For Rat Bmf, the sequences were as follows:the forward primer was 5 0-GAG ACATGGAGCCACCTCAGTG, and the reverse primer was Acknowledgements 50-GTAGCCAGCGTTGCCGTAAAAGAGTC. For Bim We would like to thank Yvonne Hey at the Paterson Institute PCR, the parameters used were Tm ¼ 561C for 25 cycles, and for performing the Affymetrix Microarray analysis. We would for Bmf PCR the parameters Tm ¼ 611C, 35 cycles were used. Control glyceraldehyde-3-phosphate dehydrogenase primers also like to thank David Huang, Lorraine O’Reilly and and parameters were described previously (Yoo et al., 2003). Andreas Strasser for Bmf antibody, as well as members of the All RT–PCR experiments were carried out at least two Downward laboratory for helpful discussions and advice. This independent times. work was funded by Cancer Research UK.

References

Arsura M, Wu M, Sonenshein GE. (1996). TGF beta 1 inhibits 1 induces apoptosis independently of p53 and selectively NF-kappa B/Rel activity inducing apoptosis of B cells: reduces expression of Bcl-2 in multipotent hematopoietic transcriptional activation of I kappa B alpha. Immunity 5: cells. J Biol Chem 275:39137–39145. 31–40. Hahn SA, Schutte M, Hoque AT, Moskaluk CA, da Costa LT, Bakin AV, Stourman NV, Sekhar KR, Rinehart C, Yan X, Rozenblum E et al. (1996). DPC4, a candidate tumor Meredith MJ et al. (2005). Smad3-ATF3 signaling mediates suppressor gene at human chromosome 18q21.1. Science TGF-beta suppression of genes encoding Phase II detoxify- 271:350–353. ing proteins. Free Radic Biol Med 38:375–387. Herrera B, Alvarez AM, Sanchez A, Fernandez M, Roncero C, Chipuk JE, Bhat M, Hsing AY, Ma J, Danielpour D. (2001). Benito M et al. (2001a). Reactive oxygen species (ROS) Bcl-xL blocks transforming growth factor-beta 1-induced mediates the mitochondrial-dependent apoptosis induced by apoptosis by inhibiting cytochrome c release and not by transforming growth factor (beta) in fetal hepatocytes. directly antagonizing Apaf-1-dependent caspase activation FASEB J 15:741–751. in prostate epithelial cells. J Biol Chem 276:26614–26621. Herrera B, Fernandez M, Alvarez AM, Roncero C, Benito M, Conery AR, Cao Y, Thompson EA, Townsend Jr CM, Gil J et al. (2001b). Activation of caspases occurs down- Ko TC, Luo K. (2004). Akt interacts directly with Smad3 stream from radical oxygen species production, Bcl-xL to regulate the sensitivity to TGF-beta induced apoptosis. down-regulation, and early cytochrome C release in apop- Nat Cell Biol 6:366–372. tosis induced by transforming growth factor beta in rat fetal Coyle B, Freathy C, Gant TW, Roberts RA, Cain K. (2003). hepatocytes. Hepatology 34:548–556. Characterization of the transforming growth factor-beta Hishikawa K, Oemar BS, Tanner FC, Nakaki T, Luscher TF, 1-induced apoptotic transcriptome in FaO hepatoma cells. Fujii T. (1999). Connective tissue growth factor induces J Biol Chem 278:5920–5928. apoptosis in human breast cancer cell line MCF-7. J Biol Derynck R, Zhang YE. (2003). Smad-dependent and Chem 274:37461–37466. Smad-independent pathways in TGF-beta family signalling. Inayat-Hussain SH, Couet C, Cohen GM, Cain K. (1997). Nature 425:577–584. Processing/activation of CPP32-like proteases is involved in Dijkers PF, Medema RH, Lammers JW, Koenderman L, transforming growth factor beta1-induced apoptosis in rat Coffer PJ. (2000). Expression of the pro-apoptotic Bcl-2 hepatocytes. Hepatology 25:1516–1526. family member Bim is regulated by the forkhead transcrip- Jang CW, Chen CH, Chen CC, Chen JY, Su YH, Chen RH. tion factor FKHR-L1. Curr Biol 10:1201–1204. (2002). TGF-beta induces apoptosis through Smad-mediated Edlund S, Bu S, Schuster N, Aspenstrom P, Heuchel R, Heldin expression of DAP-kinase. Nat Cell Biol 4:51–58. NE et al. (2003). Transforming growth factor-beta1 (TGF- Kanamaru C, Yasuda H, Fujita T. (2002). Involvement of beta)-induced apoptosis of prostate cancer cells involves Smad proteins in TGF-beta and activin A-induced apoptosis Smad7-dependent activation of p38 by TGF-beta-activated and growth inhibition of liver cells. Hepatol Res 23:211–219. kinase 1 and mitogen-activated protein kinase kinase 3. Mol Kang Y, Chen CR, Massague J. (2003). A self-enabling Biol Cell 14:529–544. TGFbeta response coupled to stress signaling:Smad engages Francis JM, Heyworth CM, Spooncer E, Pierce A, Dexter stress response factor ATF3 for Id1 repression in epithelial TM, Whetton AD. (2000). Transforming growth factor-beta cells. Mol Cell 11:915–926.

Oncogene Bmf and Bim in TGFb-induced apoptosis AR Ramjaun et al 981 Kaufmann T, Schlipf S, Sanz J, Neubert K, Stein R, Borner C. Saltzman A, Munro R, Searfoss G, Franks C, Jaye M, (2003). Characterization of the signal that directs Bcl-x(L), Ivashchenko Y. (1998). Transforming growth factor-beta- but not Bcl-2, to the mitochondrial outer membrane. J Cell mediated apoptosis in the Ramos B-lymphoma cell line is Biol 160:53–64. accompanied by caspase activation and Bcl-XL down- Kayanoki Y, Fujii J, Suzuki K, Kawata S, Matsuzawa Y, regulation. Exp Cell Res 242:244–254. Taniguchi N. (1994). Suppression of antioxidative enzyme Sanchez A, Alvarez AM, Benito M, Fabregat I. (1996). expression by transforming growth factor-beta 1 in rat Apoptosis induced by transforming growth factor-beta in hepatocytes. J Biol Chem 269:15488–15492. fetal hepatocyte primary cultures:involvement of reactive Kim BC, Mamura M, Choi KS, Calabretta B, Kim SJ. (2002). oxygen intermediates. J Biol Chem 271:7416–7422. Transforming growth factor beta 1 induces apoptosis Schiffer M, Mundel P, Shaw AS, Bottinger EP. (2004). A novel through cleavage of BAD in a Smad3-dependent mechanism role for the adaptor molecule CD2-associated protein in in FaO hepatoma cells. Mol Cell Biol 22:1369–1378. transforming growth factor-beta-induced apoptosis. J Biol Kim SG, Jong HS, Kim TY, Lee JW, Kim NK, Hong SH et al. Chem 279:37004–37012. (2004). Transforming growth factor-beta 1 induces apoptosis Schrantz N, Bourgeade MF, Mouhamad S, Leca G, Sharma S, through Fas ligand-independent activation of the Fas death Vazquez A. (2001). p38-mediated regulation of an Fas- pathway in human gastric SNU-620 carcinoma cells. Mol associated death domain protein-independent pathway Biol Cell 15:420–434. leading to caspase-8 activation during TGFbeta-induced Larisch S, Yi Y, Lotan R, Kerner H, Eimerl S, Tony Parks W apoptosis in human Burkitt lymphoma B cells BL41. Mol et al. (2000). A novel mitochondrial septin-like protein, Biol Cell 12:3139–3151. ARTS, mediates apoptosis dependent on its P-loop motif. Seoane J, Le HV, Shen L, Anderson SA, Massague J. (2004). Nat Cell Biol 2:915–921. Integration of Smad and forkhead pathways in the control Liao JH, Chen JS, Chai MQ, Zhao S, Song JG. (2001). The of neuroepithelial and glioblastoma cell proliferation. involvement of p38 MAPK in transforming growth factor Cell 117:211–223. beta1-induced apoptosis in murine hepatocytes. Cell Res 11: Takekawa M, Tatebayashi K, Itoh F, Adachi M, Imai K, 89–94. Saito H. (2002). Smad-dependent GADD45beta expression Liu JW, Chandra D, Rudd MD, Butler AP, Pallotta V, mediates delayed activation of p38 MAP kinase by TGF- Brown D et al. (2005). Induction of prosurvival molecules beta. EMBO J 21:6473–6482. by apoptotic stimuli:involvement of FOXO3a and ROS. Tang TT, Dowbenko D, Jackson A, Toney L, Lewin DA, Oncogene 24:2020–2031. Dent AL et al. (2002). The forkhead transcription factor Morgenstern JP, Land H. (1990). Advanced mammalian gene AFX activates apoptosis by induction of the BCL-6 transfer:high titre retroviral vectors with multiple drug transcriptional repressor. J Biol Chem 277:14255–14265. selection markers and a complementary helper-free packa- Teramoto T, Kiss A, Thorgeirsson SS. (1998). Induction of ging cell line. Nucleic Acids Res 18:3587–3596. p53 and Bax during TGF-beta 1 initiated apoptosis in Nass SJ, Li M, Amundadottir LT, Furth PA, Dickson RB. rat liver epithelial cells. Biochem Biophys Res Commun 251: (1996). Role for Bcl-xL in the regulation of apoptosis by 56–60. EGF and TGF beta 1 in c-myc overexpressing mammary Thannickal VJ, Fanburg BL. (1995). Activation of an H2O2- epithelial cells. Biochem Biophys Res Commun 227:248–256. generating NADH oxidase in human lung ﬁbroblasts Ohgushi M, Kuroki S, Fukamachi H, O’Reilly LA, Kuida K, by transforming growth factor beta 1. J Biol Chem 270: Strasser A et al. (2005). Transforming growth factor beta- 30334–30338. dependent sequential activation of Smad, Bim, and caspase- Valderrama-Carvajal H, Cocolakis E, Lacerte A, Lee EH, 9 mediates physiological apoptosis in gastric epithelial cells. Krystal G, Ali S et al. (2002). Activin/TGF-beta induce Mol Cell Biol 25:10017–10028. apoptosis through Smad-dependent expression of the lipid Park HJ, Kim BC, Kim SJ, Choi KS. (2002). Role of phosphatase SHIP. Nat Cell Biol 4:963–969. MAP kinases and their cross-talk in TGF-beta1-induced Wakeﬁeld LM, Roberts AB. (2002). TGF-beta signaling: apoptosis in FaO rat hepatoma cell line. Hepatology 35: positive and negative effects on tumorigenesis. Curr Opin 1360–1371. Genet Dev 12:22–29. Perlman R, Schiemann WP, Brooks MW, Lodish HF, Wildey GM, Patil S, Howe PH. (2003). Smad3 potentiates Weinberg RA. (2001). TGF-beta-induced apoptosis is transforming growth factor beta (TGFbeta)-induced mediated by the adapter protein Daxx that facilitates JNK apoptosis and expression of the BH3-only protein Bim in activation. Nat Cell Biol 3:708–714. WEHI 231 B lymphocytes. J Biol Chem 278:18069–18077. Puthalakath H, Huang DC, O’Reilly LA, King SM, Strasser A. Yang YC, Piek E, Zavadil J, Liang D, Xie D, Heyer J et al. (1999). The proapoptotic activity of the Bcl-2 family member (2003). Hierarchical model of gene regulation by trans- Bim is regulated by interaction with the dynein motor forming growth factor beta. Proc Natl Acad Sci USA 100: complex. Mol Cell 3:287–296. 10269–10274. Puthalakath H, Villunger A, O’Reilly LA, Beaumont JG, Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Coultas L, Cheney RE et al. (2001). Bmf:a proapoptotic Fornace Jr AJ et al. (2003). Transforming growth factor- BH3-only protein regulated by interaction with the myosin beta-induced apoptosis is mediated by Smad-dependent V actin motor complex, activated by anoikis. Science 293: expression of GADD45b through p38 activation. J Biol 1829–1832. Chem 278:43001–43007. Remy I, Montmarquette A, Michnick SW. (2004). PKB/Akt Yu L, Hebert MC, Zhang YE. (2002). TGF-beta receptor- modulates TGF-beta signaling through a direct interaction activated p38 MAP kinase mediates Smad-independent with Smad3. Nat Cell Biol 6:358–365. TGF-beta responses. EMBO J 21:3749–3759.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc).

Oncogene