DOCSLIB.ORG

Mouse Osbpl8 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Osbpl8 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Osbpl8 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Osbpl8 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Osbpl8 gene (NCBI Reference Sequence: NM_175489 ; Ensembl: ENSMUSG00000020189 ) is located on Mouse chromosome 10. 24 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 24 (Transcript: ENSMUST00000105275). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Osbpl8 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-456P17 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. Exon 5 starts from about 8.17% of the coding region. The knockout of Exon 5 will result in frameshift of the gene. The size of intron 4 for 5'-loxP site insertion: 21997 bp, and the size of intron 5 for 3'-loxP site insertion: 7421 bp. The size of effective cKO region: ~571 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 5 24 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Osbpl8 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7071bp) | A(28.52% 2017) | C(20.24% 1431) | T(31.31% 2214) | G(19.93% 1409) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr10 + 111252439 111255438 3000 browser details YourSeq 239 2528 2913 3000 87.0% chr2 - 80389043 80389472 430 browser details YourSeq 237 2543 2991 3000 86.9% chr11 - 94613676 94614153 478 browser details YourSeq 237 2598 3000 3000 84.5% chr12 + 117473501 117473920 420 browser details YourSeq 227 2528 2924 3000 81.7% chr16 + 34428838 34429264 427 browser details YourSeq 215 2595 2957 3000 81.7% chrX - 103884868 103885233 366 browser details YourSeq 211 2595 2924 3000 84.4% chr12 + 28921023 28921352 330 browser details YourSeq 208 2540 2914 3000 84.2% chr6 - 112418339 112418729 391 browser details YourSeq 207 2284 2943 3000 79.0% chr11 - 98861260 98861745 486 browser details YourSeq 202 2595 2939 3000 84.2% chr14 - 26966678 26967026 349 browser details YourSeq 201 2570 2924 3000 81.8% chr1 - 163605622 163605963 342 browser details YourSeq 197 2529 2924 3000 85.6% chr2 - 161631598 161632030 433 browser details YourSeq 196 2536 2922 3000 85.8% chr4_GL456350_random - 96523 96919 397 browser details YourSeq 196 2536 2922 3000 85.8% chr4 - 42474873 42475269 397 browser details YourSeq 194 2529 2951 3000 87.3% chr9 - 60556912 60557363 452 browser details YourSeq 194 2541 2945 3000 86.2% chr18 + 32807573 32808054 482 browser details YourSeq 193 2543 2943 3000 80.0% chr13 - 29132655 29133049 395 browser details YourSeq 192 2528 2920 3000 82.7% chr9 + 85875485 85875897 413 browser details YourSeq 192 2536 2922 3000 84.5% chr4 + 42371231 42371627 397 browser details YourSeq 192 2529 2920 3000 87.7% chr11 + 52863615 52864050 436 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr10 + 111256010 111259009 3000 browser details YourSeq 253 118 570 3000 82.0% chr2 - 117933524 117933968 445 browser details YourSeq 253 111 608 3000 83.8% chr1 + 128747150 128747642 493 browser details YourSeq 240 111 597 3000 85.0% chr8 + 125625174 125625641 468 browser details YourSeq 228 110 570 3000 83.0% chrX + 70960117 70960563 447 browser details YourSeq 227 113 608 3000 86.4% chr4 - 100703174 100703651 478 browser details YourSeq 226 204 592 3000 84.6% chr13 + 37098934 37099311 378 browser details YourSeq 223 114 592 3000 87.2% chr5 - 143155502 143155980 479 browser details YourSeq 217 113 606 3000 84.1% chr8 - 87135063 87135512 450 browser details YourSeq 215 114 565 3000 85.0% chr9 - 120255837 120256275 439 browser details YourSeq 213 113 616 3000 90.6% chr18 + 45446537 45492851 46315 browser details YourSeq 213 111 605 3000 88.1% chr17 + 84542540 84543047 508 browser details YourSeq 212 111 605 3000 82.0% chr2 - 154180962 154181403 442 browser details YourSeq 212 110 566 3000 89.3% chr8 + 57419158 57419659 502 browser details YourSeq 212 113 592 3000 86.1% chr13 + 91293721 91294195 475 browser details YourSeq 211 108 607 3000 87.3% chr1 + 24608306 24608800 495 browser details YourSeq 207 111 610 3000 89.1% chr18 - 39951548 39952068 521 browser details YourSeq 205 193 605 3000 88.4% chr3 - 133421673 133422088 416 browser details YourSeq 203 111 575 3000 85.1% chr15 + 9785101 9785562 462 browser details YourSeq 201 114 605 3000 85.7% chr4 + 12224307 12224793 487 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Osbpl8 oxysterol binding protein-like 8 [ Mus musculus (house mouse) ] Gene ID: 237542, updated on 10-Oct-2019 Gene summary Official Symbol Osbpl8 provided by MGI Official Full Name oxysterol binding protein-like 8 provided by MGI Primary source MGI:MGI:2443807 See related Ensembl:ENSMUSG00000020189 Gene type protein coding RefSeq status REVIEWED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as ORP-8; AA536976; AA536995; C730029P18Rik; D330025H14Rik Summary This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like Expression most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Orthologs Ubiquitous expression in CNS E18 (RPKM 7.5), frontal lobe adult (RPKM 6.6) and 25 other tissues See more human all Genomic context Location: 10; 10 D1 See Osbpl8 in Genome Data Viewer Exon count: 26 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 10 NC_000076.6 (111164742..111297249) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 10 NC_000076.5 (110601858..110734303) Chromosome 10 - NC_000076.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 5 transcripts Gene: Osbpl8 ENSMUSG00000020189 Description oxysterol binding protein-like 8 [Source:MGI Symbol;Acc:MGI:2443807] Gene Synonyms D330025H14Rik, ORP-8 Location Chromosome 10: 111,164,752-111,297,249 forward strand. GRCm38:CM001003.2 About this gene This gene has 5 transcripts (splice variants), 206 orthologues, 11 paralogues, is a member of 1 Ensembl protein family and is associated with 5 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Osbpl8-202 ENSMUST00000105275.8 7204 889aa ENSMUSP00000100911.1 Protein coding CCDS36056 B9EJ86 TSL:1 GENCODE basic APPRIS ALT1 Osbpl8-201 ENSMUST00000095310.2 3622 847aa ENSMUSP00000092948.1 Protein coding CCDS24166 A0A0R4J150 TSL:1 GENCODE basic APPRIS P3 Osbpl8-205 ENSMUST00000238838.1 2523 695aa ENSMUSP00000158904.1 Protein coding - - CDS 3' incomplete Osbpl8-204 ENSMUST00000220139.1 2460 No protein - Retained intron - - TSL:1 Osbpl8-203 ENSMUST00000217693.1 624 No protein - lncRNA - - TSL:3 152.50 kb Forward strand 111.20Mb 111.25Mb 111.30Mb Genes (Comprehensive set... Gm8873-201 >processed pseudogene Osbpl8-203 >lncRNA Bbs10-202 >retained intron Osbpl8-202 >protein coding Osbpl8-201 >protein coding Osbpl8-204 >retained intron Bbs10-201 >protein coding Gm17849-201 >processed pseudogene Osbpl8-205 >protein coding Contigs AC124399.4 > < AC121871.3 Regulatory Build 111.20Mb 111.25Mb 111.30Mb Reverse strand 152.50 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding pseudogene processed transcript RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000105275 132.50 kb Forward strand Osbpl8-202 >protein coding
Load more

Recommended publications
  • Redefining the Specificity of Phosphoinositide-Binding by Human
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates.
    [Show full text]
  • Targeting PH Domain Proteins for Cancer Therapy
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2018 Targeting PH domain proteins for cancer therapy Zhi Tan Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Bioinformatics Commons, Medicinal Chemistry and Pharmaceutics Commons, Neoplasms Commons, and the Pharmacology Commons Recommended Citation Tan, Zhi, "Targeting PH domain proteins for cancer therapy" (2018). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 910. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/910 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. TARGETING PH DOMAIN PROTEINS FOR CANCER THERAPY by Zhi Tan Approval page APPROVED: _____________________________________________ Advisory Professor, Shuxing Zhang, Ph.D. _____________________________________________
    [Show full text]
  • Pancreatic Intraductal Tubulopapillary Neoplasm Is Genetically Distinct from Intraductal Papillary Mucinous Neoplasm and Ductal Adenocarcinoma
    Modern Pathology (2017) 30, 1760–1772 1760 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 Pancreatic intraductal tubulopapillary neoplasm is genetically distinct from intraductal papillary mucinous neoplasm and ductal adenocarcinoma Olca Basturk1, Michael F Berger1, Hiroshi Yamaguchi2, Volkan Adsay3, Gokce Askan1, Umesh K Bhanot1, Ahmet Zehir1, Fatima Carneiro4, Seung-Mo Hong5, Giuseppe Zamboni6, Esra Dikoglu7, Vaidehi Jobanputra7,8, Kazimierz O Wrzeszczynski7, Serdar Balci3, Peter Allen9, Naoki Ikari10, Shoko Takeuchi10, Hiroyuki Akagawa10, Atsushi Kanno11, Tooru Shimosegawa11, Takanori Morikawa12, Fuyuhiko Motoi12, Michiaki Unno12, Ryota Higuchi13, Masakazu Yamamoto13, Kyoko Shimizu14, Toru Furukawa15 and David S Klimstra1 1Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY, USA; 2Department of Pathology, Tokyo Medical University, Tokyo, Japan; 3Department of Pathology, Emory University, Atlanta, GA, USA; 4Department of Pathology, Centro Hospitalar São João/Faculty of Medicine of Porto University and Institute for Research and Innovation in Health/Institute of Molecular Pathology and Immunology of the University of Porto (Ipatimup), Porto, Portugal; 5Department of Pathology, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea; 6Department of Pathology, University of Verona, Ospedale S.C.-Don Calabria-Negrar, Verona, Italy; 7New York Genome Center, Molecular Diagnostics, New York, NY, USA; 8Department of Pathology, Colombia University Medical Center, New York, NY, USA; 9Department
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection
    CLINICAL RESEARCH www.jasn.org A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection Weijia Zhang,1 Zhengzi Yi,1 Karen L. Keung,2 Huimin Shang,3 Chengguo Wei,1 Paolo Cravedi,1 Zeguo Sun,1 Caixia Xi,1 Christopher Woytovich,1 Samira Farouk,1 Weiqing Huang,1 Khadija Banu,1 Lorenzo Gallon,4 Ciara N. Magee,5 Nader Najafian,5 Milagros Samaniego,6 Arjang Djamali ,7 Stephen I. Alexander,2 Ivy A. Rosales,8 Rex Neal Smith,8 Jenny Xiang,3 Evelyne Lerut,9 Dirk Kuypers,10,11 Maarten Naesens ,10,11 Philip J. O’Connell,2 Robert Colvin,8 Madhav C. Menon,1 and Barbara Murphy1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background In kidney transplant recipients, surveillance biopsies can reveal, despite stable graft function, histologic features of acute rejection and borderline changes that are associated with undesirable graft outcomes. Noninvasive biomarkers of subclinical acute rejection are needed to avoid the risks and costs associated with repeated biopsies. Methods We examined subclinical histologic and functional changes in kidney transplant recipients from the prospective Genomics of Chronic Allograft Rejection (GoCAR) study who underwent surveillance biopsies over 2 years, identifying those with subclinical or borderline acute cellular rejection (ACR) at 3 months (ACR-3) post-transplant. We performed RNA sequencing on whole blood collected from 88 indi- viduals at the time of 3-month surveillance biopsy to identify transcripts associated with ACR-3, developed a novel sequencing-based targeted expression assay, and validated this gene signature in an independent cohort.
    [Show full text]
  • Oral Administration of Lactobacillus Plantarum 299V
    Genes Nutr (2015) 10:10 DOI 10.1007/s12263-015-0461-7 RESEARCH PAPER Oral administration of Lactobacillus plantarum 299v modulates gene expression in the ileum of pigs: prediction of crosstalk between intestinal immune cells and sub-mucosal adipocytes 1 1,4 1,5 1 Marcel Hulst • Gabriele Gross • Yaping Liu • Arjan Hoekman • 2 1,3 1,3 Theo Niewold • Jan van der Meulen • Mari Smits Received: 19 November 2014 / Accepted: 28 March 2015 / Published online: 11 April 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract To study host–probiotic interactions in parts of ileum. A higher expression level of several B cell-specific the intestine only accessible in humans by surgery (je- transcription factors/regulators was observed, suggesting junum, ileum and colon), pigs were used as model for that an influx of B cells from the periphery to the ileum humans. Groups of eight 6-week-old pigs were repeatedly and/or the proliferation of progenitor B cells to IgA-com- orally administered with 5 9 1012 CFU Lactobacillus mitted plasma cells in the Peyer’s patches of the ileum was plantarum 299v (L. plantarum 299v) or PBS, starting with stimulated. Genes coding for enzymes that metabolize a single dose followed by three consecutive daily dosings leukotriene B4, 1,25-dihydroxyvitamin D3 and steroids 10 days later. Gene expression was assessed with pooled were regulated in the ileum. Bioinformatics analysis pre- RNA samples isolated from jejunum, ileum and colon dicted that these metabolites may play a role in the scrapings of the eight pigs per group using Affymetrix crosstalk between intestinal immune cells and sub-mucosal porcine microarrays.
    [Show full text]
  • Transparent Machine Learning for Multi-Omics Analysis of Mental Disorders
    UPTEC X20 015 Examensarbete 30 hp Juni 2020 Transparent Machine Learning for Multi-Omics Analysis of Mental Disorders Stella Belin Abstract Transparent Machine Learning for Multi-Omics Analysis of Mental Disorders Stella Belin Teknisk- naturvetenskaplig fakultet UTH-enheten Schizophrenia and bipolar disorder are two severe mental disorders that affect more than 65 million individuals worldwide. The aim of this Besöksadress: project was to find co-prediction mechanisms for genes associated with Ångströmlaboratoriet Lägerhyddsvägen 1 schizophrenia and bipolar disorder using a multi-omics data set and a Hus 4, Plan 0 transparent machine learning approach. The overall purpose of the project was to further understand the biological mechanisms of these Postadress: complex disorders. In this work, publicly available multi-omics data Box 536 751 21 Uppsala collected from post-mortem brain tissue were used. The omics types included were gene expression, DNA methylation, and SNP array data. The Telefon: data consisted of samples from individuals with schizophrenia, bipolar 018 – 471 30 03 disorder, and healthy controls. Individuals with schizophrenia or Telefax: bipolar disorder were considered as a combined CASE class. 018 – 471 30 00 Using machine learning techniques, a multi-omics pipeline was developed Hemsida: to integrate these data in a manner such that all types were adequately http://www.teknat.uu.se/student represented. A feature selection was performed on methylation and SNP data, where the most important sites were estimated and mapped to their corresponding genes. Next, those genes were intersected with the gene expression data, and another feature selection was performed on the gene expression data. The most important genes were used to develop an interpretable rule-based model with an accuracy of 88%.
    [Show full text]
  • Foraging Shifts and Visual Pre Adaptation in Ecologically Diverse Bats
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/340654059 Foraging shifts and visual preadaptation in ecologically diverse bats Article in Molecular Ecology · April 2020 DOI: 10.1111/mec.15445 CITATIONS READS 0 153 9 authors, including: Kalina T. J. Davies Laurel R Yohe Queen Mary, University of London Yale University 40 PUBLICATIONS 254 CITATIONS 24 PUBLICATIONS 93 CITATIONS SEE PROFILE SEE PROFILE Edgardo M. Rengifo Elizabeth R Dumont University of São Paulo University of California, Merced 13 PUBLICATIONS 28 CITATIONS 115 PUBLICATIONS 3,143 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Ecology of the Greater horseshoe bat View project BAT 1K View project All content following this page was uploaded by Liliana M. Davalos on 14 May 2020. The user has requested enhancement of the downloaded file. Received: 17 October 2019 | Revised: 28 February 2020 | Accepted: 31 March 2020 DOI: 10.1111/mec.15445 ORIGINAL ARTICLE Foraging shifts and visual pre adaptation in ecologically diverse bats Kalina T. J. Davies1 | Laurel R. Yohe2,3 | Jesus Almonte4 | Miluska K. R. Sánchez5 | Edgardo M. Rengifo6,7 | Elizabeth R. Dumont8 | Karen E. Sears9 | Liliana M. Dávalos2,10 | Stephen J. Rossiter1 1School of Biological and Chemical Sciences, Queen Mary University of London, London, UK 2Department of Ecology and Evolution, State University of New York at Stony Brook, Stony Brook, USA 3Department of Geology & Geophysics, Yale University,
    [Show full text]
  • Genome Wide Association of Chronic Kidney Disease Progression: the CRIC Study (Author List and Affiliations Listed at End of Document)
    SUPPLEMENTARY MATERIALS Genome Wide Association of Chronic Kidney Disease Progression: The CRIC Study (Author list and affiliations listed at end of document) Genotyping information page 2 Molecular pathway analysis information page 3 Replication cohort acknowledgments page 4 Supplementary Table 1. AA top hit region gene function page 5-6 Supplementary Table 2. EA top hit region gene function page 7 Supplementary Table 3. GSA pathway results page 8 Supplementary Table 4. Number of molecular interaction based on top candidate gene molecular networks page 9 Supplementary Table 5. Results of top gene marker association in AA, based on EA derived candidate gene regions page 10 Supplementary Table 6. Results of top gene marker association in EA, based on AA derived candidate gene regions page 11 Supplementary Table 7. EA Candidate SNP look up page 12 Supplementary Table 8. AA Candidate SNP look up page 13 Supplementary Table 9. Replication cohorts page 14 Supplementary Table 10. Replication cohort study characteristics page 15 Supplementary Figure 1a-b. Boxplot of eGFR decline in AA and EA page 16 Supplementary Figure 2a-l. Regional association plot of candidate SNPs identified in AA groups pages 17-22 Supplementary Figure 3a-f. Regional association plot of candidate SNPs identified in EA groups pages 23-25 Supplementary Figure 4. Molecular Interaction network of candidate genes for renal, cardiovascular and immunological diseases pages 26-27 Supplementary Figure 5. Molecular Interaction network of candidate genes for renal diseases pages 28-29 Supplementary Figure 6. ARRDC4 LD map page 30 Author list and affiliations page 31 1 Supplemental Materials Genotyping Genotyping was performed on a total of 3,635 CRIC participants who provided specific consent for investigations of inherited genetics (of a total of 3,939 CRIC participants).
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]