Rhipicephalus (Boophilus) Microplus and Rhipicephalus Appendiculatus Ticks and Determination of the Expression Profile of Bm86

001-008 - Title page & table of contents 17x24 020810.pdf 1 2-8-2010 20:42:11

A contribution to the development of anti-tick vaccines A.M. Nijhof, 2010 PhD thesis Utrecht University, the Netherlands

Printed by Atalanta Drukwerkbemiddeling, Houten ISBN 978-90-393-5376-9

001-008 - Title page & table of contents 17x24 020810.pdf 2 2-8-2010 20:42:11 A contribution to the development of anti-tick vaccines

Een bijdrage aan de ontwikkeling van vaccins tegen teken

(met een samenvatting in het Nederlands)

Proefschrift

ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. dr. J.C. Stoof, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op dinsdag 7 september 2010 des middags te 12.45 uur

door

Ard Menzo Nijhof geboren op 24 maart 1978 te Zeist

001-008 - Title page & table of contents 17x24 020810.pdf 3 2-8-2010 20:42:11

Promotoren: Prof. dr. F. Jongejan

Prof. dr. J.P.M. van Putten

This research described in this thesis was financially supported by the Wellcome Trust under the 'Animal Health in the Developing World' initiative through project 075799 entitled 'Adapting recombinant anti-tick vaccines to livestock in Africa'.

001-008 - Title page & table of contents 17x24 020810.pdf 4 2-8-2010 20:42:11 In liefdevolle herinnering aan Bert Nijhof (1946-1998)

001-008 - Title page & table of contents 17x24 020810.pdf 5 2-8-2010 20:42:11 001-008 - Title page & table of contents 17x24 020810.pdf 6 2-8-2010 20:42:11 Table of contents

Chapter 1 General introduction 9

Chapter 2 Gene silencing of the tick protective antigens, Bm86, Bm91 45 and subolesin, in the one-host tick Boophilus microplus by RNA interference

Chapter 3 Evidence of the role of tick subolesin in gene expression 69

Chapter 4 Selection of reference genes for quantitative RT-PCR studies in 97 Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86

Chapter 5 Bm86 orthologues and the novel ATAQ protein family with 125 multi Epidermal Growth Factor (EGF)-like domains from hard and soft ticks

Chapter 6 Expression of recombinant Rhipicephalus (Boophilus) 153 microplus, R. annulatus and R. decoloratus Bm86 orthologs as secreted proteins in Pichia pastoris

Chapter 7 Summarizing discussion 181

Summary in Dutch / Samenvatting 197

Acknowledgements 205

Curriculum Vitae 211

List of Publications 213

001-008 - Title page & table of contents 17x24 020810.pdf 7 2-8-2010 20:42:11

001-008 - Title page & table of contents 17x24 020810.pdf 8 2-8-2010 20:42:11

GENERAL INTRODUCTION

2 PhD thesis Nijhof - Title page chapter 1.pdf 1 26-7-2010 22:46:20

001-125 - Dissertatie Ard.pdf 10 21-7-2010 0:13:07 General introduction

1.1 Evolution, diversity and systematics of ticks

Ricini e gramine oriuntur – Ticks originate from grass

Aristotle, 350 BC. Historia Animalium

The oldest tick fossils known to date are those that are entrapped in amber, an an- cient tree resin. When this sticky resin was exuded by a tree, insects and other small organisms were glued to its surface and became gradually engulfed by the flowing resin which could preserve them in fine detail. The majority of the tick inclusions in amber originate from Baltic (35-50 mya) and Dominican (15-40 mya) amber, but the oldest tick fossils of 90-100 million years of age were found in amber outcroppings in New Jersey and Burma (presently Myanmar) [1-3]. Carios jerseyi, the fossil found in New Jersey was identified as a soft tick, whereas the fossils found in Burmese amber belonged to two different genera of hard ticks, demonstrating that these lineages of ticks were well established by this time in the middle Cretaceous. The origin of ticks is thus pre-middle Cretaceous. Fossil tick specimens of a more recent origin include those found in Oligocene deposits (ca. 30 mya) [4] and in the ears of a frozen woolly rhinoceros from 2-5 mya [5]. Fossilized faeces or coprolites and mummies containing tick specimens of several thousand years old have been found in the Americas [6-8]. Of similar age is the drawing found in the Egyptian tomb of Antef from 1500 B.C. on which a hyena-like animal is depicted with round shapes resembling ticks in its ear, which may be the first drawing of ticks (Fig. 1) [9].

001-125 - Dissertatie Ard.pdf 11 21-7-2010 0:13:07 Chapter 1

Figure 1. Fragment from the drawing of hyena-like animal discovered in the Egyp- tian tomb of Antef, dating from the time of Thutmose III (eighteenth dynasty), about 1500 B.C.

In literature, the first appearance of ticks is probably made in Homer’s Odyssey (ca. 800 B.C.). Upon his return home twenty years after leaving for the Trojan War Odysseus is recognized - despite being disguised as a beggar - by his faithful dog Argos who is overgrown with ticks. The dog wags its tail and then dies in peace. Another Greek, the philosopher Aristotle, was the first to explicitly describe the bloodsucking habit of ticks in one of Aesop’s fables. In this tale the fox is trapped in a gully while trying to cross a river and suffered for a long time, in particular from the large number of ticks she had on her. A passing hedgehog took pity and offered to take the ticks of her which is refused by the fox. When asked why, the fox replied ‘These ticks have already had their fill of me, and they are taking only a little blood. But if you take these away, others will come and in hunger drink up the rest of my blood’ (Rhetoric 2.20) [10, 11]. Aristotle, in his Historia Animal- ium, also mentions that dogs, cows, sheep and goats have ticks, but claims that donkeys are free of them [11].

001-125 - Dissertatie Ard.pdf 12 21-7-2010 0:13:08 General introduction

The Swedish botanist Karl Linnaeus (1707-1778), founder of modern biological nomenclature, included the first binominal classification and description of three tick species which are nowadays known as Ixodes ricinus, Hyalomma aegyptium and Amblyomma americanum in his Systema Naturae [12]. More descriptions of new tick species followed, most numerously by men such as Carl Ludwig Koch (1778-1857), Louis-Georges Neumann (1846-1930), Paul Schulze (1887-1949), Glen M. Kohls (1905-1986) and Harry Hoogstraal (1917-1986). Approximately 879 different tick species have been described to date [13] which can be found throughout the terrestrial world from regions as high as 15,000 feet altitude in the Himalaya mountain range [14] to dark abandoned and bat-inhabited mines and from the coldness of the Antarctic peninsula [15] to the heat of Africa’s deserts.

Ticks are classified as members of the Arachnida class, sharing the subclass Acari together with mites. A distinguishing feature between the arachnids and insects is the presence of four pair of legs in adult arachnids compared to three pair of legs in insects. Ticks are further divided into three families: the Argasidae or soft ticks, the Ixodidae or hard ticks and the Nuttalliellidae. A hard sclerotized shield or scu- tum found on the anterior dorsal surface of hard ticks is absent in soft ticks and forms a striking difference between these two families. Other anatomical differences include the aspect of the outer body wall or integument which is leathery in soft ticks while smooth with fine grooves in hard ticks, and the position of the mouthparts. These are located ventrally in soft ticks and anterior in hard ticks, making them always visible from a dorsal aspect in ticks of the latter family (Fig. 2). The sole representative of the monotypic Nuttalliellidae family, the illustrious Nuttalliella namaqua of which very few specimens have been recorded, has fea- tures characteristic of both soft and hard ticks [16, 17].

The hard ticks form the largest family with approximately 692 species divided over 12 genera while the soft ticks comprise 4 genera with 186 species. The hard ticks can be further divided in two lines: the Prostriata and the Metastriata. The Prostriata is regarded as the most primitive line and consist of the Ixodes genus only. The majority of the 245 species which make up this genus are nest- or bur- row-dwelling (nidicolous) parasites. Ixodes adults can copulate both on and off the host in contrast to Metastriata adults which mate only on the host. The Metas- triata can be further divided into four subfamilies: the Bothriocrotoninae, a small group of five species of the Bothriocroton genus indigenous to Australia, the Am- blyomminae containing ticks of the Amblyomma genus, the Haemaphysalinae containing ticks of the Haemaphysalis genus and the Rhipicephalinae containing ticks of the Anomalohimalaya, Cosmiomma, Dermacentor, Hyalomma, Margaro-

001-125 - Dissertatie Ard.pdf 13 21-7-2010 0:13:08 Chapter 1

pus, Nosomma, Rhipicentor and Rhipicephalus genera [18]. The latter includes ticks of the economically important Boophilus genus since these were synonymized with Rhipicephalus following phylogenetic analyses [19]. Boophilus (from Latin bos = ox and Greek philein = loving) was retained as a subgenus, but the suggested synonymization is controversial and not universally accepted [20]. Carios is the largest soft tick genus with 89 species, followed by the Argas, Orni- thodoros and Otobius genera.

Figure 2. Top panel: dorsal (left) and ventral (right) view of an Ixodes ricinus female, representative of a hard tick species. Bottom panel: dorsal (left) and ventral (right) view of an Ornithodoros savignyi female, representative of a soft tick species.

001-125 - Dissertatie Ard.pdf 14 21-7-2010 0:13:08 General introduction

1.2 Importance of ticks

‘Mix white cattle ticks, one tick for each year of age, with rice powder and make a cake. Let the child take it with an empty stomach. When a foul stool is passed, the child will be immune from smallpox for his entire life.’

Li Shih-chen, 1596. Pen Ts’ao Kang Mu (the Great Pharmacopeia) 1

‘They [ticks, ed.] not only attach themselves to people but to all kinds of animals. These pests cause horrible suffering to domestic animals. They often completely cover the groin causing it to become rough and leathery. In New Sweden, I knew of several persons who had lost their best horses because of these noxious pests. The entire belly was so tightly covered with them that there was scarcely room to place the point of a knife between them. They burrowed deep into the flesh sucking out the blood. Finally, emaciated and in great pain, the animal died.’

Pehr Kalm, 1754. Berättelse om et slags yrfä i Norra America, Skogs-Löss kalladt. Kon- gliga Svenska Vetenskapsakademiens Handlingar 15: 19-31 2

By the late 19th century, a disease known as Texas fever or cattle fever which had been known to occur in cattle for over two centuries in the United States was demonstrated to be transmitted by ticks [21, 22]. Since this seminal finding, which was the first demonstration of an arthropod acting as a vector of disease, many other tick-pathogen associations have been described and ticks are nowadays associated with a great variety of pathogens including over 84 bacteria, 124 viruses, 59 protozoan parasites, 3 nematodes and 1 Trypanosoma species.

Of the approximately 260 tick species endogenous to Africa, about 30 may act as vectors of pathogens causing diseases [23]. An overview of the economically most important tick-borne diseases of livestock is shown in Table 1. Many of these diseases are not restricted to Africa and may occur wherever its natural vector is found. Bovine anaplasmosis and babesiosis for instance, caused by the intracellular bacteria Anaplasma marginale and the protozoa Babesia bovis and Babe- sia bigemina respectively, threatens cattle in tropical and subtropical regions of the world where the vector Rhipicephalus (Boophilus) microplus occurs [24, 25]. Similarly, heartwater caused by the rickettsial pathogen Ehrlichia ruminantium

1 Translation in Hoeppli R: Parasites and parasitic infections in early medicine and science. Singapore: University of Malaya Press, 1959 2 Translation in Larsen, EL: Pehr Kalm’s description of a type of creature in North America called the wood tick. Ann Entomol Soc Am 1955, 48: 178-181.

001-125 - Dissertatie Ard.pdf 15 21-7-2010 0:13:08 Chapter 1

spread from Africa to the Caribbean with the introduction of infected Amblyomma variegatum ticks which established itself on the islands of Guadeloupe, Antigua and Marie Galante and spread further via cattle trade and African cattle egrets (Bubulcus ibis) which are commonly infested with A. variegatum juveniles and migrate between the islands [26].

Other important pathogens transmitted by ticks in Africa include those with zoonotic potential such as Crimean-Congo Hemorrhagic Fever virus (CCHF) [27], African tick bite fever caused by Rickettsia africae [28] and Tick Borne Relapsing Fever caused by Borrelia crocidurae [29]. Several other pathogens associated with disease and mortality in (endangered) wildlife species like the black rhinoceros (Diceros bicornis), roan- and sable antelope (Hippotragus equinus and Hip- potragus niger) have been reported as well [30, 31].

Various species of hard and soft ticks have been implicated in tick paralysis caused by secreted toxins. In Africa the most important paralysis-inducing ticks are Ixodes rubicundus, and Rhipicephalus e. evertsi, whereas Hyalomma trunca- tum may cause a non-paralytic toxicosis of cattle named sweating sickness [32].

Irritation and blood loss caused by tick feeding may also result in a decrease in weight and milk production. An unfed female hard tick can increase 50-200 times in weight during feeding while at the same time concentrating the blood meal 2-3 times [33]. With an average weight of nearly 3 grams, a single engorged A. variegatum female may thus have imbibed over 6 ml of blood [34].

Skin lesions caused by ectoparasites such as ticks may also result in leather damage, as they create small holes marring the smoothness of the grain [35].

001-125 - Dissertatie Ard.pdf 16 21-7-2010 0:13:08 General introduction

Table 1. List of the economically most important tick-borne diseases in Africa with their associated tick vector and distribution. Modified after Jongejan and Uilenberg [36].

Disease Pathogen Main African tick vector(s) Distribution Reference

African Swine African Swine Ornithodoros erraticus Scattered [37] Fever Fever virus Ornithodoros moubata throughout Ornithodoros porcinus sub-Saharan Africa and Madagascar Anaplasmosis Anaplasma Rhipicephalus (B.) annulatus Sub-Saharan [24] marginale Rhipicephalus (B.) decoloratus Africa and the Rhipicephalus (B.) microplus Mediterranean Rhipicephalus bursa Rhipicephalus e. evertsi Rhipicephalus simus Dermatophilosis Dermatophilus Amblyomma variegatum West-Africa [38] congolensis Heartwater Ehrlichia ru- Amblyomma astrion Sub-Saharan [26] minantium Amblyomma gemma Africa Amblyomma hebraeum Amblyomma lepidum Amblyomma marmoreum Amblyomma pomposum Amblyomma tholloni Amblyomma variegatum Tropical Theil- Theileria annu- Hyalomma anatolicum Mediterranean [39] eriosis lata Hyalomma detritum Hyalomma marginatum East Coast Fe- Theileria parva Rhipicephalus appendiculatus Sub-Saharan [40] ver / Corridor Rhipicephalus zambeziensis Africa Disease

Redwater Babesia bovis Rhipicephalus (B.) annulatus Sub-Saharan [25] Rhipicephalus (B. ) geigyi Africa Rhipicephalus (B.) microplus Babesia Rhipicephalus (B.) annulatus Sub-Saharan [25] bigemina Rhipicephalus (B.) decoloratus Africa Rhipicephalus (B.) geigyi Rhipicephalus (B.) microplus Rhipicephalus e. evertsi

001-125 - Dissertatie Ard.pdf 17 21-7-2010 0:13:08 Chapter 1

1.3 Chemical tick control

Mox etiam convenit tota tergora et tractare, et respergere mero, quo familiariores bubulco fiant; ventri quoque et sub femina manum subicere, ne ad eiusmodi tactum postmodum pavescent, et ut ricini qui plerumque feminibus inhaerent, eximantur. – […] it is also a good plan to stroke their hides all over and to sprinkle them with un- mixed wine, so that they may become on more familiar terms with their oxherd; it is well also to put the hand on the belly and under the thighs, so that they may not be alarmed if they are touched in this way afterwards, and also that ticks, which generally fasten on the thighs, may be removed.

Lucius Junius Moderatus Columella, 50 AD, de Re Rustica. Lib. 6 (How to train oxen) c.2

The application of chemical acaricides is the main form of controlling ticks and tick-borne diseases of animals worldwide and costs thereof have been estimated to range between US$2.50 and US$25.00 annually per head of cattle, depending on locality and farming system [41].

Pliny the Elder was probably the first to describe the use of an acaricide, the juice of an ‘Ixia’ plant which kills ticks, in his Historia Naturalis [11]. But it was not until the late 19th century that a recipe based on arsenic was formulated which proved to be successful for the control of ticks on a large scale using dipping vats which had previously been developed in the United States. Various other components had been tried before in efforts to control the cattle tick, including tobacco extract, cottonseed and fish oil, soap, soda, kerosene and mineral oils but arsenic proved to be superior to these formulations [22, 42]. Arsenicals were soon adopted by farmers in Southern Africa and the United States Department of Agri- culture (USDA) in their efforts to eradicate East Coast Fever (ECF) caused by Theileria parva in South Africa and Texas fever with its associated R. annulatus and R. microplus ticks in the United States. Various farmer bulletins were published in effort to overcome the initial resistance of some American farmers to the governmental meddling in their daily practice and the associated costs of the im- posed eradication campaign. One of these even focused on rural children, inform- ing them about the life cycle of ticks and damage which they cause (Fig. 3) [43]. Both the South African and US eradication campaigns were successful and resulted in the eradication of ECF from South Africa in 1954 [44] and the United States were considered to be free of the one-host ticks R. annulatus and R. microplus in 1943. These statuses are however continuously threatened and quarantine zones are still present around game reserves in the northeastern part of South Af-

001-125 - Dissertatie Ard.pdf 18 21-7-2010 0:13:08 General introduction

rica where T. parva infections occur in African buffalo (Syncerus caffer) [45] and along the border between Texas and Mexico [46].

Figure 3. Cover of the 1927 United States Department of Agriculture publication ‘The story of the cattle-fever tick: what every Southern child should know about cattle ticks’.

Traditional methods of applying acaricides on cattle include hand sprays, spray races, powders or the immersion of animals in vats (cattle dips or plunge dips). More recent treatment possibilities include the use of pour-on or spot-on products, injectables, an intraruminal boluses and acaricide impregnated ear tags.

Another interesting novel approach is the use of pheromone-assisted tick control, either applied on the vegetation or on the host. In these systems, pheromones are used to attract ticks which are subsequently killed when they come into contact with the acaricide that was applied simultaneously with the pheromones. These pheromone/acaricide compounds have been combined as oily droplets for spray- ing of the vegetation or as tick decoys. The impregnated decoys can be plastic strips which are attached to the neck or tail of cows, but have also been made as

001-125 - Dissertatie Ard.pdf 19 21-7-2010 0:13:08 Chapter 1

plastic spherules resembling the shape of partially fed females. When the latter are attached to the hair coat of animals, mate-seeking males are attracted by the pheromones, attempt to mate with the decoy and are subsequently killed by the acaricide with which the decoy was also coated [47].

The first reports of resistance against arsenic in R. decoloratus and R. microplus date from 1935 and it was not until the mid-1940s that an alternative was found with the discovery of the acaricidal properties from organochlorines such as di- chlorodiphenyltrichloroethane (DDT) for which the Swiss chemist Paul Hermann Müller was awarded with the Nobel Prize for Medicine in 1948. Resistance of ticks against DDT was reported only a few years after its introduction. This has been followed by the development of tick resistance against all but the most recent commercial acaricides typically within a few years of their introduction [22, 48]. For instance in New Caledonia where R. microplus was introduced with the importation of cattle from Australia in 1942. The authorities started using the chemical amitraz in 1996 to control this tick species on deltamethrin-resistant farms and resistance was first observed only five years later [49]. This rapid development and spread of resistance against each new class of chemical, combined with the high costs of developing new acaricides and an overall decrease in size of the cattle acaricide market makes the pharmaceutical industry reluctant to invest heavily in the development of new classes of acaricides. It is expected that only chemicals with a spectrum broader than the bovine acaricide market, e.g. having anthelmintic properties as well, may be profitable enough to return the development costs [50, 51].

Public awareness of the detrimental effects of pesticides on the environment was first raised by the landmark publication in 1962 of ‘Silent Spring’ by Rachel Car- son which arguably initiated the birth of environmentalism. Contamination of milk and meat products with drug residues is also of growing concern, as well as its detrimental effect on non-target organisms and health hazards posed by the application of pesticides without protective clothing or gloves by agricultural work- ers in developing countries [52-54]. There is thus a clear need for alternative ‘greener’ approaches to control tick infestations which address these issues.

1.4 Biological tick control

The potential of using natural predators or pathogens of ticks for their control has been well documented, but their practical use is often surrounded by difficulties which have yet to be resolved.

001-125 - Dissertatie Ard.pdf 20 21-7-2010 0:13:08 General introduction

Predators Sub-Saharan African birds such as the yellow and red-billed oxpeckers (Buphagus africanus and Buphagus erythrorhynchus, Fig. 4) are known to feed on ectoparasites and especially on ticks, of which a single bird may eat over 14 grams per day in captivity. They may thus play an important role in the reduction of the number of ticks [55]. The population sizes of these birds, in particular that of the yellow- billed oxpecker, have declined in the 20th century as a result of the use of bird- poisoning acaricides, a decrease in the number of game animals and possibly by decreased tick populations. Both species are currently recovering from this fall in numbers as a result of translocation efforts, the introduction of safer acaricides and an increase in game animals [56]. Several other bird species such as the om- nivorous domestic fowl (Gallus gallus) and helmeted guinea fowl (Numida me- leagris) will also eat ticks but do not specifically feed on them. Their consumption thus depends largely on alternative food availability and they are not expected to reduce tick densities below a certain level [56]. Other general predators which oc- casionally feed on ticks and may contribute to a reduction of natural tick populations include several species of ants, beetles and spiders [57, 58]. The discovery of tick allomones, chemical signals secreted by ticks which repel predators, endorses the importance of predation in nature [59]. Exploitation of these generalist predators for biological control is possible but has the potential danger of resulting in unwanted changes in the populations of non-target species. The introduction of mongoose (Herpestes javanicus) in the 19th century to control introduced rats but decimating endemic birds and snake populations on the Hawaii islands is a noto- rious example of this.

Figure 4. A red-billed oxpecker (Buphagus erythrorhynchus). Photograph by Hugh Chittenden (www.birdinfo.co.za).

001-125 - Dissertatie Ard.pdf 21 21-7-2010 0:13:08 Chapter 1

Parasitoids Ixodiphagus species are minute (0.7-2 mm) parasitoid wasps of the insect order Hymenoptera and have a worldwide distribution. Females of this species oviposit in the body cavity of ticks and development starts with the ingestion of blood by the nymphal host tick [60]. During development, the larvae consume the contents of the body cavity before transformation to the adult stage and subsequent emer- gence, with fatal consequences for the host tick. The mass release of I. hookeri has therefore been proposed as an alternative means of tick control. Indeed, the release of 150 000 specimens over one year on a field with 10 A. variegatum infested cows in Kenya did result in a reduction in tick numbers from 44 to 2 ticks per animal [61], but two studies whereby I. hookeri was released in the United States on islands near Cape Cod did not yield sustainable tick control [62, 63]. The lack of sufficient data on the efficacy in nature and efficiency of inundative release, high production costs of the cultivation of I. hookeri and its potential susceptibility against insecticides make this means of tick control in the near future unlikely [56].

Pathogens Of the approximately twenty species of entomopathogenic fungi which have been reported to attack and kill ticks, only a handful have been extensively studied, in particular Metarhizium anisopliae and Beauveria bassiana. The conidia of these fungi may germinate when they come into contact with the tick’s cuticle. Assisted by chitinases and proteases, the fungus penetrates the cuticle and invades the internal organs. The production of mycotoxins and depletion of nutrients may eventually result in the death of its host or cause sublethal effects [56, 64]. Entomopa- thogenic fungi for the control of ticks have been applied in field trials both on- and off-host with reasonable success and commercial products have been developed [56].

Disadvantages of the use of fungi for the control of ticks are their susceptibility to environmental conditions, e.g. they need a high humidity to germinate and sporulate and spore viability may degrade by direct sunlight, are slow in killing their host and have been reported to exert potential non-target effects on other ar- thropods, fish eggs and immunocomprised individuals [65-67]. Improved formulations, selection of highly pathogenic strains with little to none non-target effects and optimized delivery and deployment strategies are required to make full use of the potential of entomopathogenic fungi for tick control.

001-125 - Dissertatie Ard.pdf 22 21-7-2010 0:13:08 General introduction

Bacillus thuringiensis products are popular insecticidal biological control agents in agriculture and are amongst the few bacteria reported to be pathogenic to ticks as well. Ingestion of the bacterium by the tick appears to be necessary for the bacterium to be effective. This diminishes the prospects of using B. thuringiensis for biological control since ticks tend to ingest only host blood [56].

The juvenile stage of certain entomopathogenic nematodes actively locates and enters ticks, mainly engorged females, usually via natural openings. Once in the haemocoel it releases symbiotic bacteria which kill the host. In insects, the nematodes subsequently feed on the bacteria and host material and mature to adults, but not so in ticks where juveniles die shortly after entry and cannot complete their life cycle. In field trials, the pathogenicity of entomopathogenic nematodes to ticks are strongly influenced by environmental conditions, limiting the application of currently identified nematodes to defined ecological niches [56].

1.5 Ecological tick control

The relationship between ticks, host and the environment can be manipulated in several ways to establish tick control. For instance through the use of toxic plants against ticks (e.g. Stylosanthes spp. which produces a sticky secretion poisonous to R. microplus larvae) on pastures [68], bush fires that might reduce tick populations in grazing land, pasture rotation to deprive larval ticks of their host or zero grazing (total confinement to reduce the exposure to ticks). These methods require an understanding of the local livestock management practices, e.g. pasture rotation might be suitable for private farms, but not for lands where grazing is com- munal [69]. Detailed knowledge of the behaviour of certain ticks can also result in the identification of ecological control methods. For example in South Africa where Karoo tick paralysis is a major disease of small ruminants in winter which is caused by feeding Ixodes rubicundus females. Researchers discovered that these ticks quest on grasses at a height of approximately 45 cm and in the crown cover associated with the presence of wild olive trees. Ticks survive longer on tall grass and are twice as likely to infest sheep grazing tall grasses compared to sheep kept on short grass. Raising the crown height by cutting the lower branches of wild olive trees to mimic the effect of browsing goats resulted in a decrease in tick densities in the vicinity of these trees. Introduction of coarse grazers such as cattle or horses to graze down long grasses before introduction of small ruminants and the use of goats to keep wild olive trees pruned by browsing were recommended as ecological control measures to reduce the incidence of Karoo tick paralysis [70].

001-125 - Dissertatie Ard.pdf 23 21-7-2010 0:13:08 Chapter 1

1.6 Genetic tick control

Some animals or whole breeds have a heritable ability to become immunologi- cally resistant to tick infestations. This trait is most commonly manifested in indigenous zebu (Bos indicus) breeds of cattle. The resistance status can be improved by selection of increased tick resistance as demonstrated by the development of highly tick resistant breeds such as the Belmont Adaptaur [71]. A disad- vantage of this approach is the difficulty of selecting for tick resistance while maintaining desirable production characteristics such as high milk yield [72]. Genetic control of a different order is the suggested release of sterilized ticks into the environment, similar to sterile insect techniques developed for the control of insect pests. Ticks can be sterilized through hybridization [73], irradiation [74], treatment with chemicals [75] or by RNA interference (RNAi) [76]. Practical difficulties such as the mass rearing of sufficient amounts of sterile ticks and expected difficulties in obtaining the public and political support for the mass release of ticks may pose hurdles too high to make the field application of this technique possible.

1.7 Immunological tick control

William Trager demonstrated in 1939 that injection of guinea pigs with extracts of whole larvae, salivary glands or digestive tracts of female Dermacentor variabilis ticks conferred partial protection against subsequent tick challenge. This partial resistance could be transferred through serum from immune animals to susceptible ones [77, 78]. Various reports have been published since in which crude antigenic extracts of different tissues from a number of soft and hard tick species were used as vaccine preparations in different hosts [79-87], including even tortoises [88], with varying degrees of success.

Immunization with heterogeneous preparations such as tissue extracts results in a polyclonal and multifactorial immune response by the experimental animal. This obscures the link of an immune effector, such as an antibody, to any particular antigen. Antibody cross-reactivity and antigen immunodominance are factors which complicate the identification of the efficacious antigens even further [89]. By biochemical fractionation and evaluation of increasingly simpler midgut protein mixtures in vaccination trials, scientists succeeded in the isolation of a major antigen named Bm86 which conferred significant protection of cattle against R. microplus infestations [90]. This protein of unknown function is localized on the microvilli of the midgut digest cells and the ingestion of antibodies leads to lysis of these cells which line the tick gut, an effect which may be enhanced by the

001-125 - Dissertatie Ard.pdf 24 21-7-2010 0:13:08 General introduction

presence of complement [91]. Leakage of blood constituents to the haemocoel is macroscopically evident by a red coloration of the tick and results in mortality and a deleterious effect on the reproductive performance of the tick [72]. The efficacy of vaccination with recombinant Bm86 is strongly correlated with antibody response. Since Bm86 is found exclusively in the midgut of ticks and therefore a so- called ‘concealed’ antigen, i.e. not exposed to the host’s immune system, regular booster vaccinations are required to maintain a strong antibody response [51].

Vaccination with recombinant Bm86 typically leads to a reduction of maximal 50% in the number of R. microplus ticks engorging on vaccinated animals, lower engorgement weights and a decrease in the reproductive capacity. The impact of vaccination on the reproductive performance is mainly seen in the second and subsequent tick generations by a reduced number of larvae in the field. Most farmers will therefore chose for an integrated tick management system in which the vaccine is applied in combination with the strategic use of acaricides since a significant effect of vaccination alone may otherwise not be seen for an unacceptably long time. The reduction in acaricide usage following the introduction of vaccination has therefore been a useful measure of vaccine efficacy [51].

TickGARD was the first commercial vaccine available in Australia and contained the recombinant Bm86 produced in E. coli. An improved vaccine, TickGARD Plus was released one year later and contained the recombinant Bm86 antigen produced in the yeast Pichia pastoris with a different adjuvant. In Cuba, vaccines containing the same antigen were marketed as Gavac [92].

In Australia, vaccination with TickGARD of a dairy herd resulted in a 56% reduction of tick numbers in the field over a single generation, a 72% reduction in tick reproductive performance and an increase in cattle liveweight gain of 18.6 kg over a 6 month period compared to an unvaccinated control group [93]. The state- sponsored use of the tick vaccine Gavac in Cuba, where the socialist state econ- omy controls cattle production, has provided a unique opportunity to evaluate the field performance of this vaccine. A retrospective analysis of the field application of Gavac from 1995 to 2003 during which almost 600,000 dairy cattle were vaccinated showed that the number of acaricide treatments was reduced by 87% with an overall reduction of 82% in the country’s acaricide consumption for tick control. The incidence of mortality due to bovine babesiosis was reduced as well [94]. The state of Tamaulipas in Mexico, which borders the state of Texas in the north, is also sponsoring the use of Gavac as a result of the increasing incidence of acaricide resistant ticks and the resulting increasing demand for the vaccine. Commercialization difficulties and the lack of efficacy against the Cayenne tick

001-125 - Dissertatie Ard.pdf 25 21-7-2010 0:13:08 Chapter 1

Amblyomma cajennense, which occurs together with Rhipicephalus (Boophilus) spp. in some regions, has limited the usage of Gavac elsewhere in Mexico [92].

Although the Bm86 vaccines do not give protection against A. cajennense as reported above, cross protection of Bm86 vaccines against tick species other than R. microplus has been reported. Bm86 vaccines give a high protection efficacy (>99% reduction on the number of engorging ticks) against Rhipicephalus (Boo- philus) annulatus infestations [95-97], partial cross-protection against several other tick species, e.g. Rhipicephalus (Boophilus) decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii and Rhipicephalus sanguineus, but do not work against Amblyomma cajennense, Amblyomma variegatum and Rhipicephalus appendiculatus [98-101]. Vaccination with rHaa86, the recombinant Bm86 homologue protein from Hy. a. anatolicum, resulted in a significant decrease in the number of engorging Hy. a. anatolicum larvae and females [102].

Although the existing Bm86 vaccines can make an important contribution to an integrated tick control strategy, more efficacious and ideally stand-alone vaccines are required to control multiple tick species in wide geographical areas.

The efficacy of any anti-tick vaccine may be enhanced by the inclusion of a second or even multiple additional antigens in a multi-antigen formulation, although the number of publications in which such antigen cocktails have been examined are few [103]. An example of a successful cocktail vaccine approach is the addition of recombinant Bm91, a tick homologue of angiotensin-converting enzyme, to recombinant Bm86 in a vaccine formulation. Combining Bm91 with Bm86 did not adversely affect the immune response against Bm86 and appeared to double its efficacy [104].

Three approaches have been distinguished to identify useful vaccine candidates, which is pivotal in anti-tick vaccine development. Firstly, the immunological response of an immune host may be studied to identify antigens which elicit the antibody response. The second approach is the identification of proteins which are important to the tick’s function or survival and subsequent evaluation of these proteins in vaccination trials. The third option is the one that led to the identification of Bm86: the evaluation of progressively simpler protein mixtures by vaccination trials [51]. A fourth approach may be the identification of proteins which are similar or interact with successful vaccine candidates. A list showing all tick antigens which have been evaluated in published vaccination trials to date is shown in Table 2.

001-125 - Dissertatie Ard.pdf 26 21-7-2010 0:13:08 General introduction

New and emerging molecular techniques may assist in the identification of potential tick-protective antigens. An example is the use of cDNA expression library immunization (ELI). Immunization of mice with pools of cDNA clones from an Ixodes scapularis cell line expression library followed by a controlled I. scapularis tick challenge led to the identification of protective pools. Individual clones from the pools that induced immunity were sequenced, grouped according to putative function in sub-pools which were subsequently screened in an immunization and challenge trial again [105]. Amongst the tick-protective antigens which were found using this method was subolesin, which was later shown to have efficacy as a recombinant antigen in vaccination trials with various tick species [106, 107]. Similar results were obtained by the same group through the screening for protective antigens using RNA interference (RNAi). Ticks which were injected with dsRNA coding for the genes identified by ELI as being protective and subsequently fed on naive animals showed higher mortality, lower engorgement weights and reduced reproductive capacities after feeding compared to mock- injected controls [108].

001-125 - Dissertatie Ard.pdf 27 21-7-2010 0:13:08 Chapter 1

Table 2. Tick antigens which have been evaluated in vaccination trials. -, no significant effect; +, >25% efficacy; ++, 25-50% efficacy; +++, 50-75% efficacy; ++++, 75-100% efficacy.

Antigen Species Location Protein type Result Reference

4E6 I. scapularis Various Recombinant - [106] 4F8 I. scapularis Various Recombinant ++ [106] 5’- R. microplus Malpighian Recombinant - [109] nucleotidase tubules 64TRP I. ricinus Salivary gland Recombinant +++ [110] 64TRP R. appendicula- Salivary gland Recombinant +++ [111] tus 64TRP R. sanguineus Salivary gland Recombinant +++ [110] Ba86 R. annulatus Midgut Recombinant ++++ [95] Ba86 R. microplus Midgut Recombinant +++ [95] Bm86 A. variegatum Midgut Recombinant - [98] Bm86 Hy. anatolicum Midgut Recombinant ++ [98] Bm86 Hy. dromedarii Midgut Recombinant ++++ [98] Bm86 R. annulatus Midgut Recombinant ++++ [95-97, 107] Bm86 R. appendicula- Midgut Recombinant - [98, 99] tus Bm86 R. decoloratus Midgut Recombinant +++ [98, 99] Bm86 R. microplus Midgut Native ++++ [90] Bm86 R. microplus Midgut Recombinant +++ / [93, 112- ++++ 115] Bm86 R. sanguineus Midgut Recombinant ++ [101] Bm86 & R. microplus Midgut & Sali- Recombinant ++++ [104] Bm91 vary gland Bm86 & R. microplus Various Recombinant +++ [116] BMA7 Bm86, Native BMA7 Bm91 R. microplus Salivary gland Native ++ [117] BMA7 R. microplus Various Native + [116] BmTI R. microplus Salivary gland Native +++ [118] BmTI-A R. microplus Salivary gland Synthetic + [119] BYC R. microplus Eggs Native + [120] BYC R. microplus Eggs Recombinant ++ [121] CHT1 H. longicornis Exoskeleton Recombinant + [122] Haa86 H. anatolicum Midgut Recombinant +++ [102] HL34 H. longicornis Salivary gland Recombinant + [123] HLMP1 H. longicornis Salivary gland Recombinant + [124] HLS1 H. longicornis Salivary gland Recombinant + [125] HLS2 H. longicornis Hemolymph Recombinant ++ [126]

001-125 - Dissertatie Ard.pdf 28 21-7-2010 0:13:08 General introduction

Table 2 [cont.]. Tick antigens which have been evaluated in vaccination trials. -, no significant effect; +, >25% efficacy; ++, 25-50% efficacy; +++, 50-75% efficacy; ++++, 75-100% efficacy.

Antigen Species Location Protein type Result Reference

Hq05 Hae. qinghaiensis Salivary gland Recombinant ++ (mainly on [127] eggs) HqCRT Hae. qinghaiensis Various Recombinant + [128] HqTnT Hae. qinghaiensis Various Recombinant - [129] IRAC I. ricinus Salivary gland Recombinant - [130] IRIS I. ricinus Salivary gland Recombinant ++ [131] Metis 1 I. ricinus Salivary gland Recombinant ++ [132] Oe45 O. erraticus Midgut Native + [133] Om44 O. moubata Salivary gland Native - / ++ (de- [134] pending on life stage) P29 H. longicornis Salivary gland Recombinant ++ [135] RAS-3, R. appendiculatus Salivary gland Recombinant ++ [136] RAS-4 and RIM36 RH50 R. haemaphysa- Salivary gland Recombinant + [137] loides Sialostatin I. scapularis Salivary gland Recombinant ++ [138] L2 Subolesin I. scapularis Various Recombinant +++ [106] Subolesin R. annulatus Various Recombinant +++ [107] Subolesin R. microplus Various Recombinant +++ [107] Subolesin, I. scapularis Various Recombinant +++ [106] 4E6 and 4F8 Ubiquitin R. annulatus Various Recombinant + [107] Ubiquitin R. microplus Various Recombinant +++ [107] Voraxin- R. appendiculatus Testicle Recombinant +++ [139] alpha VTDCE R. microplus Eggs Native + [140]

001-125 - Dissertatie Ard.pdf 29 21-7-2010 0:13:08 Chapter 1

1.8 Aims and outline of this thesis

Ticks and tick-borne diseases seriously affect animal and human health worldwide with the highest economic losses occurring in livestock production in the developing world. As described above, the control of ticks and the disease they transmit depends mainly on chemical tick control using acaricides. The development of acaricide resistance, concerns about environmental pollution, pesticide residues in food products and the expense of developing new acaricides result in the need for alternative tick control methods such as anti-tick vaccines. Two commercial vaccines, both based on the same recombinant antigen named Bm86, have been developed for the control of Rhipicephalus (Boophilus) microplus infestations on cattle. Although the existing Bm86 vaccines can make an important contribution to an integrated tick control strategy, more efficacious and ideally stand-alone vaccines are required to control multiple tick species in wide geographical areas. There is thus a need for improved (e.g. multi-antigen) vaccine formulations and for the discovery of new tick-protective antigens.

The identification of tick-protective antigens is a pivotal step in vaccine development. To study gene function and to identify genes which are important to the tick’s function and survival, RNA interference (RNAi) can be a valuable tool. In Chapter 2, a strategy for gene silencing by RNAi in the one-host tick R. microplus is outlined and tick-protective antigens Bm86, Bm91 and subolesin were successfully silenced. In addition, a novel RNAi application for the transovarial silencing of genes in ticks is introduced. This method caused gene-specific silencing in the oviposited eggs and larvae that hatched from these eggs and may for instance be used to study gene function in tick embryogenesis.

Subolesin, a protein which was discovered by expression library immunization (ELI) and RNAi screening to be a tick-protective antigen is further characterized in Chapter 3 where evidence of the role of subolesin in gene expression in ticks is provided. Two subolesin-interacting proteins, including Elongation Factor 1- alpha, were identified by yeast two-hybrid screen, co-affinity purification and RNAi.

Cross protection of Bm86 vaccines against tick species other than R. microplus has been reported, but Bm86 vaccines do not protect against Rhipicephalus appendiculatus infestations, despite a high degree of sequence homology. One possible explanation is the variation in Bm86 expression levels between R. microplus and R. appendiculatus. This is further investigated in Chapter 4.

001-125 - Dissertatie Ard.pdf 30 21-7-2010 0:13:08 General introduction

To measure the Bm86 gene expression in a reliable and accurate manner, normalization of gene expression data against reference genes is essential and the expression stability of commonly used reference genes was evaluated in R. appendiculatus and R. microplus ticks. The most stable reference genes were subsequently used for normalization of the Bm86 expression profile in all life stages of both species to examine whether antigen abundance plays a role in Bm86 vaccine susceptibility.

Partial protection of the Bm86 vaccine against other Rhipicephalus (Boophilus) and Hyalomma tick species suggests that the efficacy of a Bm86-based vaccine may be enhanced when based on the orthologous recombinant Bm86 antigen. We therefore identified and analysed the Bm86 homologues from species representing the main argasid and ixodid tick genera in Chapter 5. A novel protein from metastriate ticks with multiple Epidermal Growth Factor (EGF)-like domains which is structurally related to Bm86 was discovered and named ATAQ. The vaccine potential of ATAQ proteins against tick infestations is to be evaluated.

Chapter 6 describes the expression and purification of Bm86 (R. microplus), Ba86 (R. annulatus) and Bd86 (R. decoloratus) as secreted products from Pichia pastoris. The secretion of recombinant Bm86 ortholog proteins in P. pastoris allowed for a simple purification process rendering a final product with high recovery (35-42%) and purity (80-85%) which is likely to result in a more reproducible conformation closely resembling the native protein and increase the efficacy of these vaccines. Rabbit immunization experiments with recombinant proteins showed immune cross-reactivity between Bm86 ortholog proteins.

In Chapter 7, the major results of this thesis are summarized and placed in per- spective. In addition, future lines of investigation are proposed.

001-125 - Dissertatie Ard.pdf 31 21-7-2010 0:13:08 Chapter 1

References

1. Klompen H, Grimaldi D: First Mesozoic Record of a Parasitiform Mite: A Larval Argasid Tick in Cretaceous Amber (Acari: Ixodida: Argasi- dae). Ann Entomol Soc Am 2001, 94(1):10-15. 2. Poinar G, Jr., Brown AE: A new genus of hard ticks in Cretaceous Burmese amber (Acari: Ixodida: Ixodidae). Syst Parasitol 2003, 54(3):199-205. 3. Grimaldi DA, Engel MS, Nascimbene PC: Fossiliferous Cretaceous Am- ber from Myanmar (Burma): Its Rediscovery, Biotic Diversity, and Paleontological Significance. American Museum Novitates 2002:1-71. 4. Scudder SH: A contribution to our knowledge of Paleozoic Arachnides. Proc Am Acad Sci 1885, 2:12. 5. Schille F: Entomologie aus der Mammut- und Rhinoceros-Zeit Gal- iziens. Entomol Z 1916, 30:42-43. 6. Johnson KL, Reinhardt KJ, Sianto L, Araujo A, Gardner SL, Janovy J, Jr.: A tick from a prehistoric Arizona coprolite. J Parasitol 2008, 94(1):296-298. 7. Martinson E, Reinhard KJ, Buikstra JE, de la Cruz KD: Pathoecology of Chiribaya parasitism. Mem Inst Oswaldo Cruz 2003, 98 Suppl 1:195- 205. 8. Guerra RMSNC, Gazêta GS, Amorim M, Duarte AN, Serra-Freire NM: Ecological analysis of Acari recovered from coprolites from archaeo- logical site of Northeast Brazil. Mem Inst Oswaldo Cruz 2003, 98(Suppl 1):181-190. 9. Arthur DR: Ticks in Egypt in 1500 B.C.? Nature 1965, 206(988):1060- 1061. 10. Gagarin M, Woodruff P: Early Greek political thought from Homer to the sophists Cambridge, UK: Cambridge University Press; 1995. 11. Oudemans AC: Kritisch historisch overzicht der Acarologie. Eerste gedeelte, 850 v. C. tot 1758. Tijdschr Entomol 1926, 69(Suppl. 1). 12. Linnaeus C: Systema naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synony- mis, locis. Stockholm: Laurentii Salvii 1758. 13. Nava S, Guglielmone AA, Mangold AJ: An overview of systematics and evolution of ticks. Front Biosci 2009, 14:2857-2877. 14. Hoogstraal H, Kaiser MN: Observations on the subgenus Argas (Ixo- doidae: Argasidae, Argas). 7. A. (A.) himalayensis, new species parasi-

001-125 - Dissertatie Ard.pdf 32 21-7-2010 0:13:08 General introduction

tizing the snow partridge, Lerwa lerwa, in Nepal. Ann Entomol Soc Am 1973, 66(1):1-3. 15. Benoit JB, Yoder JA, Lopez-Martinez G, Elnitsky MA, Lee RE, Jr., Denlinger DL: Habitat requirements of the seabird tick, Ixodes uriae (Acari: Ixodidae), from the Antarctic Peninsula in relation to water balance characteristics of eggs, nonfed and engorged stages. J Comp Physiol B 2007, 177(2):205-215. 16. Sonenshine DE: Biology of ticks. Volume I: Biology of ticks. Volume I.. 1991. xix + 447 pp. 26 pp. of ref.; 1991. 17. El-Shoura SM: Nuttalliella namaqua (Acarina: Ixodoidea: Nuttallielli- dae): the female morphology in relation to the families Argasidae and Ixodidae: a review. Int J Acarol 1990, 16(3):135-142. 18. Barker SC, Murrell A: Systematics and evolution of ticks with a list of valid genus and species names. Parasitology 2004, 129 Suppl:S15-36. 19. Murrell A, Barker SC: Synonymy of Boophilus Curtice, 1891 with Rhipicephalus Koch, 1844 (Acari: Ixodidae). Syst Parasitol 2003, 56(3):169-172. 20. Uilenberg G, Thiaucourt F, Jongejan F: On molecular taxonomy: what is in a name? Exp Appl Acarol 2004, 32(4):301-312. 21. Smith T, Kilborne FL: Investigations into the nature, causation, and prevention of Texas or southern cattle fever. United States Department of Agriculture, Bureau of Animal Industries Bulletin 1893, 1:1-301. 22. George JE, Pound JM, Davey RB: Chemical control of ticks on cattle and the resistance of these parasites to acaricides. Parasitology 2004, 129 Suppl:S353-366. 23. Walker AR, Bouattour A, Camicas J-L, Estrada-Pena A, Horak IG, Latif AA, Pegram RG, Preston PM: Ticks of domestic animals in Africa: a guide to identification of species. Edinburgh: BioScience Reports; 2003. 24. Kocan KM, de la Fuente J, Blouin EF, Garcia-Garcia JC: Anaplasma marginale (Rickettsiales: Anaplasmataceae): recent advances in defin- ing host-pathogen adaptations of a tick-borne rickettsia. Parasitology 2004, 129 Suppl:S285-300. 25. Bock R, Jackson L, de Vos A, Jorgensen W: Babesiosis of cattle. Parasi- tology 2004, 129 Suppl:S247-269. 26. Allsopp BA: Natural history of Ehrlichia ruminantium. Vet Parasitol 2010, 167(2-4):123-135. 27. Ergonul O: Crimean-Congo haemorrhagic fever. Lancet Infect Dis 2006, 6(4):203-214.

001-125 - Dissertatie Ard.pdf 33 21-7-2010 0:13:08 Chapter 1

28. Jensenius M, Fournier PE, Raoult D: Rickettsioses and the international traveler. Clin Infect Dis 2004, 39(10):1493-1499. 29. Vial L, Diatta G, Tall A, Ba el H, Bouganali H, Durand P, Sokhna C, Rogier C, Renaud F, Trape JF: Incidence of tick-borne relapsing fever in west Africa: longitudinal study. Lancet 2006, 368(9529):37-43. 30. Nijhof AM, Penzhorn BL, Lynen G, Mollel JO, Morkel P, Bekker CP, Jongejan F: Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick-borne parasites associated with mortality in the black rhinoceros (Diceros bicornis). J Clin Microbiol 2003, 41(5):2249-2254. 31. Nijhof AM, Pillay V, Steyl J, Prozesky L, Stoltsz WH, Lawrence JA, Pen- zhorn BL, Jongejan F: Molecular characterization of Theileria species associated with mortality in four species of African antelopes. J Clin Microbiol 2005, 43(12):5907-5911. 32. Mans BJ, Gothe R, Neitz AW: Biochemical perspectives on paralysis and other forms of toxicoses caused by ticks. Parasitology 2004, 129 Suppl:S95-111. 33. Rechav Y, Strydom WJ, Clarke FC, Burger LB, Mackie AJ, Fielden LJ: Isotopes as host blood markers to measure blood intake by feeding ticks (Acari: Ixodidae). J Med Entomol 1994, 31(4):511-515. 34. Garris GI: Colonization and life cycle of Amblyomma variegatum (Acari: Ixodidae) in the laboratory in Puerto Rico. J Med Entomol 1984, 21(1):86-90. 35. Everett AL, Miller RW, Gladney WJ, Hannigan MV: Effects of some important ectoparasites on the grain quality of cattle hide leather. J Am Leath Chem Ass 1977, 72:6-23. 36. Jongejan F, Uilenberg G: The global importance of ticks. Parasitology 2004, 129 Suppl:S3-14. 37. Penrith ML, Vosloo W: Review of African swine fever: transmission, spread and control. J S Afr Vet Assoc 2009, 80(2):58-62. 38. Walker AR: Amblyomma tick feeding in relation to host health. Trop Anim Health Prod 1996, 28(2 Suppl):26S-28S. 39. Pipano E, Shkap V: Vaccination against tropical theileriosis. Ann N Y Acad Sci 2000, 916:484-500. 40. Di Giulio G, Lynen G, Morzaria S, Oura C, Bishop R: Live immunization against East Coast fever--current status. Trends Parasitol 2009, 25(2):85-92. 41. Pegram RG: Getting a handle on tick control: a modern approach may be needed. Vet J 2001, 161(3):227-228.

001-125 - Dissertatie Ard.pdf 34 21-7-2010 0:13:08 General introduction

42. Angus BM: The history of the cattle tick Boophilus microplus in Aus- tralia and achievements in its control. Int J Parasitol 1996, 26(12):1341-1355. 43. Anonymous: The story of the cattle-fever tick: what every Southern child should know about cattle ticks. In. Edited by Agriculture USDo. Washington D.C.: U.S. Department of Agriculture; 1927. 44. Brown K: Veterinary entomology, colonial science and the challenge of tick-borne diseases in South Africa during the late nineteenth and early twentieth centuries. Parassitologia 2008, 50(3-4):305-319. 45. Thompson BE, Latif AA, Oosthuizen MC, Troskie M, Penzhorn BL: Oc- currence of Theileria parva infection in cattle on a farm in the Lady- smith district, KwaZulu-Natal, South Africa. J S Afr Vet Assoc 2008, 79(1):31-35. 46. Perez de Leon AA, Strickman DA, Knowles DP, Fish D, Thacker E, de la Fuente J, Krause PJ, Wikel SK, Miller RS, Wagner GG et al: One Health Approach to Identify Research Needs in Bovine and Human Babesio- ses: Workshop Report. Parasit Vectors 2010, 3(1):36. 47. Sonenshine DE: Pheromones and other semiochemicals of ticks and their use in tick control. Parasitology 2004, 129 Suppl:S405-425. 48. Willadsen P: Vaccines, genetics and chemicals in tick control: the Aus- tralian experience. Trop Anim Health Prod 1997, 29(4 Suppl):91S-94S. 49. Ducornez S, Barré N, Miller RJ, Garine-Wichatitsky Md: Diagnosis of amitraz resistance in Boophilus microplus in New Caledonia with the modified Larval Packet Test. Vet Parasitol 2005, 130(3-4):285-292. 50. Graf JF, Gogolewski R, Leach-Bing N, Sabatini GA, Molento MB, Bordin EL, Arantes GJ: Tick control: an industry point of view. Parasitology 2004, 129 Suppl:S427-442. 51. Willadsen P: Anti-tick vaccines. Parasitology 2004, 129 Suppl:S367- 387. 52. Adeyemi I, Adedeji O: Acute toxicity of acaricide in lizards (Agama agama) Inhabiting dog kennel in Ibadan, Nigeria: An environmental hazard in urban vector control. The Environmentalist 2006, 26(4):281- 283. 53. Awumbila B, Bokuma E: Survey of pesticides used in the control of ectoparasites on farm animals in Ghana. Trop Anim Health Prod 1994, 26(1):7-12. 54. Kunz SE, Kemp DH: Insecticides and acaricides: resistance and environmental impact. Rev Sci Tech 1994, 13(4):1249-1286.

001-125 - Dissertatie Ard.pdf 35 21-7-2010 0:13:08 Chapter 1

55. Bezuidenhout JD, Stutterheim CJ: A critical evaluation of the role played by the red-billed oxpecker Buphagus erythrorhynchus in the biological control of ticks. Onderstepoort J Vet Res 1980, 47(2):51-75. 56. Samish M, Ginsberg H, Glazer I: Biological control of ticks. Parasitology 2004, 129 Suppl:S389-403. 57. Samish M, Rehacek J: Pathogens and predators of ticks and their potential in biological control. Ann Rev Entomol 1999, 44(1):159-182. 58. Jemal A, Hugh-Jones M: A review of the red imported fire ant (So- lenopsis invicta Buren) and its impacts on plant, animal, and human health. Prev Vet Med 1993, 17(1-2):19-32. 59. Yoder JA, Domingus JL: Identification of hydrocarbons that protect ticks (Acari: Ixodidae) against fire ants (Hymenoptera: Formicidae), but not lizards (Squamata: Polychrotidae), in an allomonal defense secretion. Int J Acarol 2003, 29(1):87 - 91. 60. Hu R, Hyland KE: Effects of the feeding process of Ixodes scapularis (Acari: Ixodidae) on embryonic development of its parasitoid, Ixodi- phagus hookeri (Hymenoptera: Encyrtidae). J Med Entomol 1998, 35(6):1050-1053. 61. Mwangi EN, Hassan SM, Kaaya GP, Essuman S: The impact of Ixodi- phagus hookeri, a tick parasitoid, on Amblyomma variegatum (Acari: Ixodidae) in a field trial in Kenya. Exp Appl Acarol 1997, 21(2):117- 126. 62. Cobb S: Tick Parasites on Cape Cod. Science 1942, 95(2472):503. 63. Smith CN, Cole MM: Studies of parasites of the American dog tick. J Econom Entomol 1943, 36:469-472. 64. Fernandes EK, Bittencourt VR: Entomopathogenic fungi against South American tick species. Exp Appl Acarol 2008, 46(1-4):71-93. 65. Middaugh DP, Genthner FJ: Infectivity and teratogenicity of Beauveria bassiana in Menidia beryllina embryos. Arch Environ Contam Toxicol 1994, 27(1):95-102. 66. Tucker DL, Beresford CH, Sigler L, Rogers K: Disseminated Beauveria bassiana infection in a patient with acute lymphoblastic leukemia. J Clin Microbiol 2004, 42(11):5412-5414. 67. Ginsberg H, Lebrun RA, Heyer K, Zhioua E: Potential Nontarget Effects of Metarhizium anisopliae (Deuteromycetes) Used for Biological Con- trol of Ticks (Acari: Ixodidae). Environmental Entomology 2002, 31(6):1191-1196.

001-125 - Dissertatie Ard.pdf 36 21-7-2010 0:13:08 General introduction

68. Sutherst RW, Jones RJ, Schnitzerling HJ: Tropical legumes of the genus Stylosanthes immobilize and kill cattle ticks. Nature 1982, 295(5847):320-321. 69. Uilenberg G: Integrated control of tropical animal parasitoses. Trop Anim Health Prod 1996, 28(4):257-265. 70. Fourie LJ, Kok DJ, Krugel L, Snyman A, Van Der Lingen F: Control of Karoo paralysis ticks through vegetation management. Med Vet Ento- mol 1996, 10(1):39-43. 71. Frisch JE: Towards a permanent solution for controlling cattle ticks. Int J Parasitol 1999, 29(1):57-71; discussion 73-55. 72. Tellam RL, Smith D, Kemp DH, Willadsen P: Vaccination against ticks. In: Animal Parasite Control Utilizing Biotchnology. Edited by Yong WK. Boca Raton: CRC Press; 1992: 303-331. 73. Hilburn LR, Davey RB, George JE, Pound JM: Non-random mating between Boophilus microplus and hybrids of B. microplus females and B. annulatus males, and its possible effect on sterile male hybrid control releases. Exp Appl Acarol 1991, 11(1):23-36. 74. Galun R, Sternberg S, Mango C: The use of sterile females for the control of the tick, Argas persicus (Oken). Israel J Entomol 1972, 7:109- 115. 75. Hayes MJ, Oliver JH, Jr.: Immediate and latent effects induced by the antiallatotropin precocene 2(P2) on embryonic Dermacentor variabilis (Say) (Acari: Ixodidae). J Parasitol 1981, 67(6):923-927. 76. de la Fuente J, Almazan C, Naranjo V, Blouin EF, Meyer JM, Kocan KM: Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem Biophys Res Commun 2006, 344(1):332-338. 77. Trager W: Acquired Immunity to Ticks. J Parasitol 1939, 25(1):57-81 pp. 78. Trager W: Further Observations on Acquired Immunity to the Tick Dermacentor variabilis Say. J Parasitol 1939, 25(2):137-139 pp. 79. Allen JR, Humphreys SJ: Immunisation of guinea pigs and cattle against ticks. Nature 1979, 280(5722):491-493. 80. Chinzei Y, Minoura H: Reduced oviposition in Ornithodoros moubata (Acari: Argasidae) fed on tick-sensitized and vitellin-immunized rabbits. J Med Entomol 1988, 25(1):26-31. 81. Johnston LA, Kemp DH, Pearson RD: Immunization of cattle against Boophilus microplus using extracts derived from adult female ticks: effects of induced immunity on tick populations. Int J Parasitol 1986, 16(1):27-34.

001-125 - Dissertatie Ard.pdf 37 21-7-2010 0:13:08 Chapter 1

82. Jongejan F, Pegram RG, Zivkovic D, Hensen EJ, Mwase ET, Thielemans MJ, Cosse A, Niewold TA, el Said A, Uilenberg G: Monitoring of naturally acquired and artificially induced immunity to Amblyomma variegatum and Rhipicephalus appendiculatus ticks under field and laboratory conditions. Exp Appl Acarol 1989, 7(3):181-199. 83. Rechav Y, Spickett AM, Dauth J, Tembo SD, Clarke FC, Heller-Haupt A, Trinder PK: Immunization of guinea-pigs and cattle against adult Rhipicephalus appendiculatus ticks using semipurified nymphal homogenates and adult gut homogenate. Immunology 1992, 75(4):700- 706. 84. Wikel SK: Immunological control of hematophagous arthropod vectors: utilization of novel antigens. Vet Parasitol 1988, 29(2-3):235-264. 85. Astigarraga A, Oleaga-Perez A, Perez-Sanchez R, Encinas-Grandes A: A study of the vaccinal value of various extracts of concealed antigens and salivary gland extracts against Ornithodoros erraticus and Orni- thodoros moubata. Vet Parasitol 1995, 60(1-2):133-147. 86. Ghosh S, Khan MH, Gupta SC: Immunization of rabbits against Hya- lomma anatolicum anatolicum using homogenates from unfed immature ticks. Indian J Exp Biol 1998, 36(2):167-170. 87. Manzano-Roman R, Encinas-Grandes A, Perez-Sanchez R: Antigens from the midgut membranes of Ornithodoros erraticus induce lethal anti-tick immune responses in pigs and mice. Vet Parasitol 2006, 135(1):65-79. 88. Schneider CC, Roth B, Lehmann HD: Studies on the parasite-host relationship of the tick Amblyommo testudinis (Conil 1877). Zeitschrift fur Tropenmedizin und Parasitologie 1971, 22(1):2-17. 89. Foy BD, Killeen GF, Magalhaes T, Beier JC: Immunological targeting of critical insect antigens. American Entomologist 2002, 48(3):150-158, 163. 90. Willadsen P, Riding GA, McKenna RV, Kemp DH, Tellam RL, Nielsen JN, Lahnstein J, Cobon GS, Gough JM: Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus. J Immunol 1989, 143(4):1346-1351. 91. Kemp DH, Pearson RD, Gough JM, Willadsen P: Vaccination against Boophilus microplus: localization of antigens on tick gut cells and their interaction with the host immune system. Exp Appl Acarol 1989, 7(1):43-58. 92. de la Fuente J, Almazan C, Canales M, Perez de la Lastra JM, Kocan KM, Willadsen P: A ten-year review of commercial vaccine performance for

001-125 - Dissertatie Ard.pdf 38 21-7-2010 0:13:08 General introduction

control of tick infestations on cattle. Anim Health Res Rev 2007, 8(1):23-28. 93. Jonsson NN, Matschoss AL, Pepper P, Green PE, Albrecht MS, Hunger- ford J, Ansell J: Evaluation of tickGARD(PLUS), a novel vaccine against Boophilus microplus, in lactating Holstein-Friesian cows. Vet Parasitol 2000, 88(3-4):275-285. 94. Valle MR, Mendez L, Valdez M, Redondo M, Espinosa CM, Vargas M, Cruz RL, Barrios HP, Seoane G, Ramirez ES et al: Integrated control of Boophilus microplus ticks in Cuba based on vaccination with the anti- tick vaccine Gavac. Exp Appl Acarol 2004, 34(3-4):375-382. 95. Canales M, Almazan C, Naranjo V, Jongejan F, de la Fuente J: Vaccina- tion with recombinant Boophilus annulatus Bm86 ortholog protein, Ba86, protects cattle against B. annulatus and B. microplus infestations. BMC Biotechnol 2009, 9:29. 96. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. off. Vaccine 1998, 16(20):1990-1992. 97. Pipano E, Alekceev E, Galker F, Fish L, Samish M, Shkap V: Immunity against Boophilus annulatus induced by the Bm86 (Tick-GARD) vaccine. Exp Appl Acarol 2003, 29(1-2):141-149. 98. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245-261. 99. Odongo D, Kamau L, Skilton R, Mwaura S, Nitsch C, Musoke A, Taracha E, Daubenberger C, Bishop R: Vaccination of cattle with TickGARD induces cross-reactive antibodies binding to conserved linear peptides of Bm86 homologues in Boophilus decoloratus. Vaccine 2007, 25(7):1287-1296. 100. Rodríguez M, Jongejan F: Recombinant Rhipicephalus microplus Bm86 vaccine GavacTM protect against Hyalomma dromedarii but not against Amblyomma cajennense ticks. In: Unpublished. 2002. 101. Perez-Perez D, Bechara GH, Machado RZ, Andrade GM, Del Vecchio RE, Pedroso MS, Hernandez MV, Farnos O: Efficacy of the Bm86 antigen against immature instars and adults of the dog tick Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae). Vet Parasitol 2010, 167(2-4):321-326. 102. Azhahianambi P, De La Fuente J, Suryanarayana VV, Ghosh S: Cloning, expression and immunoprotective efficacy of rHaa86, the homologue

001-125 - Dissertatie Ard.pdf 39 21-7-2010 0:13:08 Chapter 1

of the Bm86 tick vaccine antigen, from Hyalomma anatolicum anatolicum. Parasite Immunol 2009, 31(3):111-122. 103. Willadsen P: Antigen cocktails: valid hypothesis or unsubstantiated hope? Trends Parasitol 2008, 24(4):164-167. 104. Willadsen P, Smith D, Cobon G, McKenna RV: Comparative vaccination of cattle against Boophilus microplus with recombinant antigen Bm86 alone or in combination with recombinant Bm91. Parasite Im- munol 1996, 18(5):241-246. 105. Almazan C, Kocan KM, Bergman DK, Garcia-Garcia JC, Blouin EF, de la Fuente J: Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine 2003, 21(13-14):1492-1501. 106. Almazan C, Kocan KM, Blouin EF, de la Fuente J: Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine 2005, 23(46-47):5294-5298. 107. Almazan C, Lagunes R, Villar M, Canales M, Rosario-Cruz R, Jongejan F, de la Fuente J: Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations. Parasitol Res 2010, 106(2):471-479. 108. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: RNA interference screening in ticks for identification of protective antigens. Parasitol Res 2005, 96(3):137-141. 109. Hope M, Jiang X, Gough J, Cadogan L, Josh P, Jonsson N, Willadsen P: Experimental vaccination of sheep and cattle against tick infestation using recombinant 5'-nucleotidase. Parasite Immunol 2010, 32(2):135- 142. 110. Trimnell AR, Davies GM, Lissina O, Hails RS, Nuttall PA: A cross- reactive tick cement antigen is a candidate broad-spectrum tick vaccine. Vaccine 2005, 23(34):4329-4341. 111. Trimnell AR, Hails RS, Nuttall PA: Dual action ectoparasite vaccine targeting 'exposed' and 'concealed' antigens. Vaccine 2002, 20(29- 30):3560-3568. 112. Garcia-Garcia JC, Montero C, Rodriguez M, Soto A, Redondo M, Valdes M, Mendez L, de la Fuente J: Effect of particulation on the immunogenic and protective properties of the recombinant Bm86 antigen expressed in Pichia pastoris. Vaccine 1998, 16(4):374-380. 113. Khalaf-Allah SS: Control of Boophilus microplus ticks in cattle calves by immunization with a recombinant Bm86 glucoprotein antigen preparation. Dtsch Tierarztl Wochenschr 1999, 106(6):248-251.

001-125 - Dissertatie Ard.pdf 40 21-7-2010 0:13:09 General introduction

114. Rodriguez M, Massard CL, da Fonseca AH, Ramos NF, Machado H, La- barta V, de la Fuente J: Effect of vaccination with a recombinant Bm86 antigen preparation on natural infestations of Boophilus microplus in grazing dairy and beef pure and cross-bred cattle in Brazil. Vaccine 1995, 13(18):1804-1808. 115. Willadsen P, Bird P, Cobon GS, Hungerford J: Commercialisation of a recombinant vaccine against Boophilus microplus. Parasitology 1995, 110 Suppl:S43-50. 116. McKenna RV, Riding GA, Jarmey JM, Pearson RD, Willadsen P: Vacci- nation of cattle against the Boophilus microplus using a mucin-like membrane glycoprotein. Parasite Immunol 1998, 20(7):325-336. 117. Riding GA, Jarmey J, McKenna RV, Pearson R, Cobon GS, Willadsen P: A protective "concealed" antigen from Boophilus microplus. Purifica- tion, localization, and possible function. J Immunol 1994, 153(11):5158- 5166. 118. Andreotti R, Gomes A, Malavazi-Piza KC, Sasaki SD, Sampaio CA, Ta- naka AS: BmTI antigens induce a bovine protective immune response against Boophilus microplus tick. Int Immunopharmacol 2002, 2(4):557- 563. 119. Andreotti R: A synthetic bmti n-terminal fragment as antigen in bovine immunoprotection against the tick Boophilus microplus in a pen trial. Exp Parasitol 2007, 116(1):66-70. 120. da Silva Vaz I, Jr., Logullo C, Sorgine M, Velloso FF, Rosa de Lima MF, Gonzales JC, Masuda H, Oliveira PL, Masuda A: Immunization of bovines with an aspartic proteinase precursor isolated from Boophilus microplus eggs. Vet Immunol Immunopathol 1998, 66(3-4):331-341. 121. Leal AT, Seixas A, Pohl PC, Ferreira CA, Logullo C, Oliveira PL, Farias SE, Termignoni C, da Silva Vaz I, Jr., Masuda A: Vaccination of bovines with recombinant Boophilus Yolk pro-Cathepsin. Vet Immunol Im- munopathol 2006, 114(3-4):341-345. 122. You M, Fujisaki K: Vaccination effects of recombinant chitinase protein from the hard tick Haemaphysalis longicornis (Acari: Ixodidae). J Vet Med Sci 2009, 71(6):709-712. 123. Tsuda A, Mulenga A, Sugimoto C, Nakajima M, Ohashi K, Onuma M: cDNA cloning, characterization and vaccine effect analysis of Hae- maphysalis longicornis tick saliva proteins. Vaccine 2001, 19(30):4287- 4296. 124. Imamura S, da Silva Vaz I, Jr., Konnai S, Yamada S, Nakajima C, Onuma M, Ohashi K: Effect of vaccination with a recombinant metalloprote-

001-125 - Dissertatie Ard.pdf 41 21-7-2010 0:13:09 Chapter 1

ase from Haemaphysalis longicornis. Exp Appl Acarol 2009, 48(4):345- 358. 125. Sugino M, Imamura S, Mulenga A, Nakajima M, Tsuda A, Ohashi K, Onuma M: A serine proteinase inhibitor (serpin) from ixodid tick Haemaphysalis longicornis; cloning and preliminary assessment of its suitability as a candidate for a tick vaccine. Vaccine 2003, 21(21- 22):2844-2851. 126. Imamura S, da Silva Vaz Junior I, Sugino M, Ohashi K, Onuma M: A serine protease inhibitor (serpin) from Haemaphysalis longicornis as an anti-tick vaccine. Vaccine 2005, 23(10):1301-1311. 127. Gao J, Luo J, Fan R, Schulte-Spechtel UC, Fingerle V, Guan G, Zhao H, Li Y, Ren Q, Ma M et al: Characterization of a concealed antigen Hq05 from the hard tick Haemaphysalis qinghaiensis and its effect as a vaccine against tick infestation in sheep. Vaccine 2009, 27(3):483-490. 128. Gao J, Luo J, Fan R, Fingerle V, Guan G, Liu Z, Li Y, Zhao H, Ma M, Liu J et al: Cloning and characterization of a cDNA clone encoding cal- reticulin from Haemaphysalis qinghaiensis (Acari: Ixodidae). Parasitol Res 2008, 102(4):737-746. 129. Gao J, Luo J, Fan R, Guan G, Fingerle V, Sugimoto C, Inoue N, Yin H: Cloning and characterization of a cDNA clone encoding troponin T from tick Haemaphysalis qinghaiensis (Acari: Ixodidae). Comp Bio- chem Physiol B Biochem Mol Biol 2008, 151(3):323-329. 130. Gillet L, Schroeder H, Mast J, Thirion M, Renauld JC, Dewals B, Vander- plasschen A: Anchoring tick salivary anti-complement proteins IRAC I and IRAC II to membrane increases their immunogenicity. Vet Res 2009, 40(5):51. 131. Prevot PP, Couvreur B, Denis V, Brossard M, Vanhamme L, Godfroid E: Protective immunity against Ixodes ricinus induced by a salivary serpin. Vaccine 2007, 25(17):3284-3292. 132. Decrem Y, Mariller M, Lahaye K, Blasioli V, Beaufays J, Zouaoui Boud- jeltia K, Vanhaeverbeek M, Cerutti M, Brossard M, Vanhamme L et al: The impact of gene knock-down and vaccination against salivary met- alloproteases on blood feeding and egg laying by Ixodes ricinus. Int J Parasitol 2008, 38(5):549-560. 133. Manzano-Roman R, Garcia-Varas S, Encinas-Grandes A, Perez-Sanchez R: Purification and characterization of a 45-kDa concealed antigen from the midgut membranes of Ornithodoros erraticus that induces lethal anti-tick immune responses in pigs. Vet Parasitol 2007, 145(3- 4):314-325.

001-125 - Dissertatie Ard.pdf 42 21-7-2010 0:13:09 General introduction

134. Garcia-Varas S, Manzano-Roman R, Fernandez-Soto P, Encinas-Grandes A, Oleaga A, Perez-Sanchez R: Purification and characterisation of a P- selectin-binding molecule from the salivary glands of Ornithodoros moubata that induces protective anti-tick immune responses in pigs. Int J Parasitol 2010, 40(3):313-326. 135. Mulenga A, Sugimoto C, Sako Y, Ohashi K, Musoke A, Shubash M, Onuma M: Molecular characterization of a Haemaphysalis longicornis tick salivary gland-associated 29-kilodalton protein and its effect as a vaccine against tick infestation in rabbits. Infect Immun 1999, 67(4):1652-1658. 136. Imamura S, Konnai S, Vaz Ida S, Yamada S, Nakajima C, Ito Y, Tajima T, Yasuda J, Simuunza M, Onuma M et al: Effects of anti-tick cocktail vaccine against Rhipicephalus appendiculatus. Jpn J Vet Res 2008, 56(2):85-98. 137. Zhou J, Gong H, Zhou Y, Xuan X, Fujisaki K: Identification of a gly- cine-rich protein from the tick Rhipicephalus haemaphysaloides and evaluation of its vaccine potential against tick feeding. Parasitol Res 2006, 100(1):77-84. 138. Kotsyfakis M, Anderson JM, Andersen JF, Calvo E, Francischetti IM, Mather TN, Valenzuela JG, Ribeiro JM: Cutting edge: Immunity against a "silent" salivary antigen of the Lyme vector Ixodes scapularis im- pairs its ability to feed. J Immunol 2008, 181(8):5209-5212. 139. Yamada S, Konnai S, Imamura S, Ito T, Onuma M, Ohashi K: Cloning and characterization of Rhipicephalus appendiculatus voraxinalpha and its effect as anti-tick vaccine. Vaccine 2009, 27(43):5989-5997. 140. Seixas A, Leal AT, Nascimento-Silva MC, Masuda A, Termignoni C, da Silva Vaz I, Jr.: Vaccine potential of a tick vitellin-degrading enzyme (VTDCE). Vet Immunol Immunopathol 2008, 124(3-4):332-340.

001-125 - Dissertatie Ard.pdf 43 21-7-2010 0:13:09

001-125 - Dissertatie Ard.pdf 44 21-7-2010 0:13:09

GENE SILENCING OF THE TICK PROTECTIVE ANTIGENS, BM86, BM91 AND SUBOLESIN, IN THE ONE-HOST TICK BOOPHILUS MICROPLUS BY RNA INTERFERENCE

NIJHOF AM, TAOUFIK A, DE LA FUENTE J, KOCAN KM, DE VRIES E, JONGEJAN F

INTERNATIONAL JOURNAL FOR PARASITOLOGY 2007; 37(6): 653-62

4 PhD thesis Nijhof - Title page chapter 2.pdf 1 26-7-2010 22:47:5022:49:55

046-068a - Chapter 2 17x24.pdf 1 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

Abstract

The use of RNA interference (RNAi) to assess gene function has been demonstrated in several three-host tick species but adaptation of RNAi to the one-host tick, Boophilus microplus, has not been reported. We evaluated the application of RNAi in B. microplus and the effect of gene silencing on three tick-protective antigens: Bm86, Bm91 and subolesin. Gene-specific double-stranded (dsRNA) was injected into two tick stages, freshly molted unfed and engorged females, and specific gene silencing was confirmed by real time PCR. Gene silencing occurred in injected unfed females after they were allowed to feed. Injection of dsRNA into engorged females caused gene silencing in the subsequently oviposited eggs and larvae that hatched from these eggs, but not in adults that developed from these larvae. dsRNA injected into engorged females could be detected by quantitative real-time RT-PCR in eggs 14 days from the beginning of oviposition, demonstrating that unprocessed dsRNA was incorporated in the eggs. Eggs produced by engorged females injected with subolesin dsRNA were abnormal, suggesting that subolesin may play a role in embryonic development. The injection of dsRNA in- to engorged females to obtain gene-specific silencing in eggs and larvae is a novel method which can be used to study gene function in tick embryogenesis.

046-068a - Chapter 2 17x24.pdf 2 26-7-2010 22:08:11 Chapter 2

Introduction

The cattle tick Boophilus microplus is an important pest of cattle in subtropical and tropical regions of the world [1]. Although all Boophilus species including B. microplus have been reclassified to the genus Rhipicephalus [2], we maintain use of the previous genus assignment for the purpose of biological clarity. Besides causing direct production losses and leather damage, B. microplus transmits several cattle pathogens, including Babesia bovis, Babesia bigemina and Anaplasma marginale. Control of B. microplus depends primarily on the use of acaricides or genetically resistant animals. Both approaches have limitations, including development of acaricide resistance, environmental contamination, pesticide residues in food products, the expense of developing new pesticides and the difficulty of pro- ducing tick-resistant cattle while maintaining desirable production characteristics [3]. Other tick control approaches which show promise are the use of biological control agents (reviewed by [4]) and anti-tick vaccines (reviewed by [3, 5]).

Two commercial vaccines have been developed for control of tick infestations on cattle, TickGARD Plus® in Australia and Gavac® in Cuba. Both are based on the same recombinant antigen named Bm86, a glycoprotein of unknown function which is located predominantly on the surface of midgut digest cells [6]. This ‘concealed’ antigen is not naturally exposed to the host’s immune system. Lysis of midgut digest cells occurs in ticks that feed on vaccinated cattle, resulting in leakage of blood meal into the tick hemocoel. The overall effect of the vaccine is on engorging female ticks and includes a decrease in the number and weight of replete ticks and oviposition. While Bm86-based vaccines were effective against several other tick species, including Boophilus annulatus [7, 8], Boophilus decoloratus, Hyalomma anatolicum anatolicum and Hyalomma dromedarii, they were not effective against Amblyomma variegatum, Amblyomma cajennense and Rhipi- cephalus appendiculatus [9, 10].

Another ‘concealed’ antigen, Bm91, was shown to increase the efficacy of the Bm86 vaccine for B. microplus when co-administered [11]. Bm91 is a low- abundance glycoprotein located in the salivary glands and midgut of B. microplus [12]. The protein, a homologue of carboxydipeptidase, shares many biochemical and enzymatic properties with mammalian angiotensin converting enzyme, but its natural substrate has not been identified [13].

More recently, a protein first labeled 4D8 and now called subolesin was identified through Ixodes scapularis cDNA expression library immunisation as a potential

046-068a - Chapter 2 17x24.pdf 3 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

tick-protective antigen. Immunisation trials using recombinant subolesin caused reductions of larval, nymphal and adult I. scapularis infestations [13-16]. The protein was later found to be conserved among ixodid tick species. Characterisation of its function by RNA interference (RNAi) in I. scapularis, Amblyomma americanum, Rhipicephalus sanguineus, Dermacentor variabilis and Dermacentor marginatus suggested involvement of this protein in the modulation of blood ingestion and reproduction. Therefore, the generic name “subolesin” was introduced for the 4D8 proteins and “subA” for the subolesin-encoding gene [17]. Gene silencing by RNAi of subA and Rs86, the homologue of Bm86, in R. sanguineus, revealed a synergistic effect in which the expression of both genes was silenced and resulted in decreased tick attachment, feeding and oviposition [18].

RNAi is a conserved post-transcriptional gene-silencing mechanism present in ticks and a wide range of eukaryotes in which double-stranded RNA (dsRNA) triggers a sequence-specific degradation of cognate mRNAs. It has been an effective tool to study the function of tick proteins at the tick–pathogen interface in a number of three-host tick species such as in I. scapularis which transmits Anap- lasma phagocytophilum and Borrelia burgdorferi [19-21]. RNAi was used to study the function of several tick salivary gland proteins involved in feeding of A. americanum [22, 23], Haemaphysalis longicornis [24] and I. scapularis [25]. The inducer of RNAi, dsRNA, is injected into nymphal or adult ticks which are then allowed to feed normally. Capillary feeding of dsRNA [26] or incubation of isolated tick tissues with dsRNA [22, 27] are other methods used successfully to silence genes in ticks. These studies suggest that RNAi is systemic and effects gene silencing throughout the tick.

In one-host Boophilus ticks, with all life stages feeding and molting on the same host, alternative strategies are required to conduct gene silencing by RNAi as compared with three-host tick species which spend their non-parasitic life stages off-host. Herein, we examined two methods of dsRNA delivery and its effect on the one-host tick B. microplus: (i) injection of dsRNA into freshly molted females and (ii) injection of dsRNA into engorged females. The latter method caused gene-specific silencing in the oviposited eggs and larvae that hatched from these eggs. We believe this is the first report of the silencing of the expression of Bm86, Bm91 and subolesin in Boophilus ticks as quantified by real-time RT-PCR using two routes of dsRNA delivery.

046-068a - Chapter 2 17x24.pdf 4 26-7-2010 22:08:11 Chapter 2

Materials and methods

Experimental animals Three Holstein–Friesian calves, 5 months of age (#7793, #7794 and #7799), were used. All animals had no previous exposure to ticks. All tick feedings were approved by the Animal Experiments Committee (DEC) of the Faculty of Veteri- nary Medicine, Utrecht University (DEC No. 0111.0807).

Ticks and tick feeding Boophilus microplus ticks originating from Mozambique were provided by Clin- Vet International (Pty), Bloemfontein, South Africa. The ticks were subsequently maintained on cattle at our tick rearing facility. Larvae were kept off-host at 20 °C with 95% relative humidity. Patches used for tick feeding with inner dimensions of 60 × 85 mm and sewn to an open cotton bag were glued to the shaved back of calf #7793 and #7794 using Pattex® contact glue (Henkel Nederland, Nieuwegein, The Netherlands). A batch of larvae eclosed from 1500 mg of pooled eggs oviposited by 25 females (approximately 24,000 larvae), was divided on day 0 between two patches on calf #7794. Since males appear earlier from the nymphal stage than females, approximately 500 unfed males were collected on days 13 and 14 and 600 unfed females on days 14 and 15 and incubated at 27 °C with 95% relative humidity. Freshly molted females were subjected to injection of dsRNA on day 15 as described below. For gene silencing in engorged females and their progeny, 25 engorged females with an average weight of 261 mg (248–272 mg) fed on calf #7794 were collected on day 21. Larvae which hatched from eggs laid by mock-injected, Bm86- and Bm91-dsRNA injected engorged females were fed in three patches on calf #7799.

RNA extraction and synthesis of tick cDNA for dsRNA preparations The viscera of five partially fed B. microplus females were dissected in ice-cold PBS and immediately stored in 1 ml Tri reagent (Sigma–Aldrich, Zwijndrecht, The Netherlands) at−80 °C. Total RNA was isolated and subsequently purified using the Nucleospin RNA II kit (Macherey-Nagel, Düren, Germany) in accordance with the reagent and kit manufacturer’s directions. Total RNA concentration was determined spectrophotometrically and the material was stored at −80 °C before use. Complementary DNA was made with the Revertaid first strand cDNA synthesis kit (Fermentas, St. Leon-Rot, Germany) in accordance with the manufacturer’s protocol using random hexamer primers. Control reactions were performed using the same procedures but without RT as a control for DNA contamination in the RNA preparations.

046-068a - Chapter 2 17x24.pdf 5 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

Cloning and sequencing of the B. microplus subolesin gene Cloning and sequencing of the subA gene from the Mozambiquan B. microplus strain was performed as described elsewhere [17]. The sequence has been submitted to GenBank and can be retrieved under Accession No. DQ923495.

dsRNA synthesis Oligonucleotide primers containing T7 promotor sequences at the′ 5 -end for in vitro transcription and synthesis of dsRNA were used to PCR-amplify cDNA encoding B. microplus Bm86 (421 bp), Bm91 (417 bp) and subolesin (381 bp). All oligonucleotide primers used in this study were synthesised by Isogen Life Science, IJsselstein, The Netherlands and their sequences are shown in Table 1. PCR products were purified using the GfX PCR purification kit (Amersham) and used as templates to produce dsRNA using the T7 Ribomax Express RNAi system (Promega, Leiden, The Netherlands). dsRNA aliquots were stored at−80 °C until used.

Injection of ticks with dsRNA Freshly molted females were placed on double-sided sticky tape with the ventral sides upwards and injected into the anal aperture with 0.5 μl Bm86, Bm91 or subolesin dsRNA alone or a combination of Bm86 and subolesin dsRNA (6– 9 × 1011 molecules/μl) using a 10 μl syringe with a 33 G needle (Hamilton, Bona- duz, Switzerland) mounted on a MM3301-M3 micromanipulator (World Precision Instruments (WPI), Berlin, Germany) and connected to an UMPII syringe pump (WPI). The tip of a 27 G needle was used to slightly pierce the anal aperture before the 33 G needle was inserted. The dsRNA was dissolved in injection buffer (10 mM Tris–HCl, pH 7 and 1 mM EDTA). A control group was injected with injection buffer alone. The ticks were placed in an incubator at 27 °C with 95% relative humidity for 3–10 h following injection, before they were examined for mortality and placed in five separate patches, one for each group, on calf #7793. One hundred male ticks were placed in each patch simultaneously with the injected females. The ticks were checked twice daily and collected when they dropped from the host. Ticks still attached 14 days after the dsRNA-injection (day 29 after application of the larvae) were removed manually. All ticks were weighed separately within 1 h after collection and stored individually in 1.5 ml Eppendorf tubes with pierced lids at 27 °C and 95% relative humidity for oviposition. For the second experiment, engorged B. microplus females were injected with 5 μl of Bm86, Bm91 or subolesin dsRNA (1–2 × 1012 molecules/μl) or injection buffer alone in the right spiracular plate within 6 h after dropping off the host, using the same methods as described above, or left uninjected. They were stored individual-

046-068a - Chapter 2 17x24.pdf 6 26-7-2010 22:08:11 Chapter 2

ly in 2 ml Eppendorf tubes with pierced lids in an incubator at 27 °C and 95% relative humidity. Eggs were removed daily and each daily egg batch was stored separately under the same conditions.

Table 1. List of oligonucleotide primers used and the purpose for which they were used in this study.

Primer Sequence (5′ → 3′) Purpose

Bm86h-F3T7 GTAATACGACTCACTA- Bm86 dsRNA synthesis TAGGTGCTCTGACTTCGGGAA Bm86h-R3T7 GTAATACGACTCACTA- Bm86 dsRNA synthesis TAGGTCGCAGAG(AG)TC(TC)TTGCA Bm91h-F1T7 GTAATACGACTCACTATAGGCCAA- Bm91 dsRNA synthesis CATCAC(GC)GA(GT)TACAAC Bm91h-R1T7 GTAATACGACTCACTA- Bm91 dsRNA synthesis TAGGG(AT)GACGCTGCTTC(GA)TTG G BmsubA-FT7 TAATACGACTCACTATAGGGTAC- subolesin dsRNA synthesis TACATGACTGGGACCCCTTGCAC BmsubA-RT7 TAATACGACTCACTA- subolesin dsRNA synthesis TAGGGTACTCTGTTCTGCGAGTTTGG TAGATAG Bm86h-F6 CTGC(GA)ACAGAAAT(CT)GAAGAAG Measure Bm86 transcript level A Bm86h-R4 GC(GA)CACT(GT)GAACCA(GA)AAGA Measure Bm86 transcript level Bm91-F2 T(GA)TTGGACAAGTGGCG(GC)T Measure Bm91 transcript level Bm91-R3 AAGAAGGACTCGTTGCGCT Measure Bm91 transcript level Bm-subA-F2 GAGACCAGCCCCTGTTCA Measure subolesin transcript level Bm-subA-R2 CCGCTTCTGAATTTGGTCG Measure subolesin transcript level Actin-F2 GACATCAAGGAGAAGCT(TC)TGC Measure β-actin transcript level Actin-R CGTTGCCGATGGTGAT(GC) Measure β-actin transcript level Bm86-F7 ACGGATGGGTTTATTGGC Measure Bm86 transcript level, located within dsRNA region Bm86h-R3 TCGCAGAG(AG)TC(TC)TTGCA Measure Bm86 transcript level, located within dsRNA region Bm91-F3 GGAATATGAAGGAAGTTGGC Measure Bm91 transcript level, located within dsRNA region Bm91-R1 G(AT)GACGCTGCTTC(GA)TTGG Measure Bm91 transcript level, located within dsRNA region BmsubA-F2 GAGACCAGCCCCTGTTCA Measure subolesin transcript level, located within dsRNA region BmsubA-R1 CTGTTCTGCGAGTTTGGTAGATAG Measure subolesin transcript level, located within dsRNA region

046-068a - Chapter 2 17x24.pdf 7 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

Analysis to confirm gene silencing by quantitative RT-PCR Viscera was dissected from five females of each dsRNA-injected or mock- injected group after 6 days of feeding. Total RNA was isolated from these samples using Tri reagent and subsequently purified using the Nucleospin RNA II kit in accordance with the reagent and kit manufacturer’s directions. Total RNA was isolated from 100 mg eggs (14 days after injection), 50 mg larvae (at 6 days and 5 weeks after hatching) laid by/eclosed from the dsRNA- and mock-injected engorged females, 50 mg larvae at 10 weeks after hatching laid by the dsRNA- and mock-injected unfed females and from the dissected viscera of five females and five males which developed from 7-week-old larvae fed on animal #7799 using the same methods. cDNA from 1 μg of RNA (adults, eggs and 6-day-old larvae) and 0.3 μg of RNA (5-week-old larvae) was prepared using the Revertaid first strand cDNA synthesis kit (Fermentas) using random hexamer primers in accordance with the manufacturer’s protocol. All samples were analyzed for transcription of target genes by quantitative real-time RT-PCR using primers Bm86h-F6 and Bm86h-R4, amplifying a 117 bp section of the Bm86 gene; Bm91-F2 and Bm91-R3, amplifying a 129 bp section of the Bm91 gene and Bm-subA-F2 and Bm-subA-R2, amplifying a 166 bp section of the subolesin gene. Tick β-actin was included as a control and used for normalisation. A 126 bp fragment was amplified using primers Actin-F2 and Actin-R. All primer combinations amplified a different part of the targeted genes than the sections which were used for dsRNA synthesis, circumventing re-amplification of any unprocessed dsRNA. Twenty- five microlitres of real-time PCRs were performed using the Quantitect SYBR green PCR kit in accordance with the manufacturer’s protocol (Qiagen, Venlo, The Netherlands) on an iCycler real-time detection system (Bio-Rad Laboratories, Veenendaal, The Netherlands). Real-time PCR data were analyzed by iCycler IQ software version 1.0.

Analysis to check for the presence of dsRNA in eggs cDNA from 1 μg of total RNA of eggs 14 days post-oviposition was screened by quantitative real-time RT-PCR for the presence of non-processed Bm86, Bm91 and subolesin dsRNA to see whether the injected dsRNA was incorporated into the eggs and could be re-amplified. Oligonucleotide primers located within the region used for dsRNA synthesis of the Bm86, Bm91 and subolesin genes were used for this purpose. The following primer combinations were used: Bm86-F7 and Bm86h-R3, amplifying a 121 bp section of the Bm86 gene, primers Bm91-F3 and Bm91-R1, amplifying a 128 bp region of the Bm91 gene, primers BmsubA-F2 and BmsubA-R1, amplifying a 121 bp section of the subolesin gene. Real-time RT-PCR conditions were identical to those used to confirm gene silencing.

046-068a - Chapter 2 17x24.pdf 8 26-7-2010 22:08:11 Chapter 2

Statistical analysis Statistical analysis of data from two quantitative RT-PCR experiments, the weights of ticks after feeding and oviposited egg masses, was performed using Microsoft Excel and consisted of an unpaired t-test with unequal variances. Tick mortality was compared between the dsRNA- and mock-injected ticks by χ2-test. P values of 0.05 or less were considered statistically significant.

Results

Cloning and sequencing of the subolesin gene from B. microplus The subolesin gene (subA) from the Mozambiquan B. microplus strain was cloned and sequenced. This gene was found to be 99–100% identical to subA from B. microplus strains from Mexico and Brazil [17].

RNAi in freshly molted B. microplus females Five groups consisting of 120 freshly molted B. microplus females were each injected with 0.5 μl of injection buffer in the following groups: (i) injection buffer alone, (ii) Bm86, (iii) Bm91, (iv) subolesin and (v) both Bm86 and subolesin- dsRNA. An average of 81 (76–82; 32.8% overall mortality) females were alive in each group 3–10 h following injection. These ticks were subsequently fed together on a calf with an excess of B. microplus males until the females became replete or for a maximum of 14 days. Tick weight after engorgement or manual removal, mortality rate, egg mass and hatching rate is presented in Table 2. A significant decrease in tick weight and oviposited egg mass, together with a higher mortality rate, was observed in the subolesin dsRNA injected groups compared with the control group (P < 0.01). Hatching rates were uniformly constant in the control, Bm86- and Bm91-dsRNA-injected groups (>90%), while in the ticks injected with subolesin dsRNA the hatching rate was lower (<20%).

046-068a - Chapter 2 17x24.pdf 9 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

Table 2. Tick weight, mortality after feeding, egg mass weight and egg hatching rate in double stranded RNA (dsRNA)-injected Boophilus microplus ticks, injected as freshly molted females.

Group (n) Number Tick weight Mortality Eggs / tick Hatching of ticks (mg) a (%) b (mg) c rate (%)d

Control 82 297 ± 71 27 139 ± 63 >90 Bm86 82 276 ± 62 23 108 ± 60 >90 Bm91 76 277 ± 67 16 125 ± 67 >90 Subolesin 81 75 ± 80 * 46** 1 ± 7 * <20* Bm86 and Subolesin 82 42 ± 42 * 59** 0 * ND

ND, not determined a Ticks which completed feeding and those removed after day 29 (14 days after mock- or dsRNA injection) were weighed individually and average ± S.D. calculated and compared between dsRNA and mock-injected control ticks by Student’s t- test with unequal variance (*P<0.01) b Tick mortality was evaluated as the ratio of dead female ticks after day 29 (14 days after mock- or dsRNA injection) to the total number of female ticks placed on the animal and was compared between dsRNA and mock-injected control ticks by χ2-test (**α<0.025) c The egg mass oviposited by each tick was weighed individually and average ± S.D. calculated and compared between dsRNA and mock-injected control ticks by Student’s t-test with unequal variance (*P<0.01) d The hatching rate was determined 6 weeks post oviposition and compared between control injected and dsRNA injected ticks by Student’s t-test with unequal variance (*P<0.01)

Gene silencing was confirmed by quantitative real-time RT-PCR (Fig. 1). The normalised transcript level of Bm86 was reduced with 86% in the Bm86-dsRNA- injected ticks and with 79% in the combined Bm86/subolesin-dsRNA-injected ticks, compared with the normalised transcript level of the mock-injected group (Fig. 1A). For Bm91, the normalised transcript level was reduced with 90% in the Bm91 RNAi-silenced ticks compared with the control ticks. A significant decrease in the Bm91 transcript level of 58% was observed in the subolesin dsRNA- injected ticks (P < 0.01) as well, but this reduction was not observed in the combined Bm86/subolesin-dsRNA-injected ticks (Fig. 1B). Normalised transcript levels of subolesin in the subolesin dsRNA- and combined Bm86/subolesin dsRNA- injected ticks compared with the control group were reduced with 90% and 80%, respectively (Fig. 1C). No differences were observed in the normalised Bm86 and Bm91 transcript levels of 10-week-old larvae which hatched from the Bm86- and Bm91-dsRNA-injected ticks compared with the mock-injected ticks (results not shown).

046-068a - Chapter 2 17x24.pdf 10 26-7-2010 22:08:11 Chapter 2

1,00E+03 9,00E+02 8,00E+02 7,00E+02 β-actin

4 6,00E+02 5,00E+02 4,00E+02 3,00E+02 2,00E+02 * Bm86 / 10 * 1,00E+02 0,00E+00 Control Bm86 Bm91 Subolesin Bm86 & Subolesin A

6,00E+01 5,00E+01 4,00E+01 β-actin 4 3,00E+01 2,00E+01 *

Bm91 / 10 1,00E+01 * 0,00E+00 Control Bm86 Bm91 Subolesin Bm86 & Subolesin B

6,00E+03 5,00E+03 β-actin

4 4,00E+03 3,00E+03 2,00E+03 * * 1,00E+03 Subolesin / 10 0,00E+00 Control Bm86 Bm91 Subolesin Bm86 & Subolesin C

Figure 1. Quantitative real-time RT-PCR analysis showing the relative Bm86 (A), Bm91 (B) and subolesin (C) transcript levels in the viscera of five partially fed females, 6 days after they were injected with injection buffer alone (Control), Bm86-, Bm91-, or subolesin-double stranded RNA (dsRNA) or a combination of Bm86- and subolesin-dsRNA and fed on calf #7793. The data represent mean values + SD, normalized relative to β-actin transcript levels. Asterisk (*) denotes the difference compared to the control injected group is significant as determined by Student’s t- test (P<0.01).

RNAi in engorged B. microplus females Five groups of five engorged females each with an average weight of 261 mg (248–272 mg) were injected with 5 μl of Bm86 dsRNA, Bm91 dsRNA, subolesin dsRNA, injection buffer alone or left uninjected within 6 h after dropping from the host. No reflux of the injected solution or hemolymph was observed from the puncture when the needle was gently withdrawn. Oviposition began in all groups within 3 days, except for one tick from the control-injected group and another tick from the Bm91 dsRNA-injected group which did not lay any eggs. The course of oviposition was not significantly influenced by the injection of dsRNA (Table 3),

046-068a - Chapter 2 17x24.pdf 11 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

and dried or shriveled eggs were not observed, indicating that all eggs were successfully coated with a secretion from Gené’s organ. Interestingly, nearly all (>99.4%) eggs oviposited by engorged females injected with subolesin dsRNA showed an aberrant phenotype compared with those from the other groups. A typ- ical example is shown in Fig. 2. Development of embryos in these eggs was not observed while many undifferentiated cells with some yolk cells were seen in Giemsa-stained egg crush smears. Most eggs did not hatch and eventually dried up and shriveled after 6–7 weeks of incubation at 27 °C/95% relative humidity. The few eggs from this group which did develop and hatched normally (<0.6%) were all laid during the first day of oviposition.

Figure 2. Representative Boophilus microplus eggs from females injected with injection buffer alone (left) showing normal development, or subolesin double- stranded RNA showing an undifferentiated mass (right). Photographs were taken 20 days after injection of the engorged females and 17 days after oviposition. Bar = 0.1 mm.

046-068a - Chapter 2 17x24.pdf 12 26-7-2010 22:08:11 Chapter 2

Table 3. Tick weight, egg mass weight and egg hatching rate, of engorged Boophilus microplus females injected with double-stranded RNA (dsRNA).

Group Tick weight a (mg) Eggs/tick b (mg) Hatching rate c (%)

Uninjected 258 (248–266) 159 (149-167) >90 Control injected 260 (251–272) 159 (152–168) >90 Bm86 263 (252–270) 159 (149–167) >90 Bm91 263 (252–273) 143 (133–158) >90 Subolesin 262 (253–271) 151 (142–160) 0.6*

aReplete B. microplus ticks were collected and weighed individually before injection with dsRNA, all within 6 h after dropping of the host. The average weight and variation (between parentheses) of each group are shown. bThe egg mass oviposited by each tick was weighed individually. The average egg mass and variation (between parentheses) was calculated and compared between uninjected and injected ticks using the Student’s t-test with unequal variance. No significant statistical differences were observed (P > 0.05). cThe hatching rate was determined 6 weeks post oviposition and compared between uninjected and injected ticks by using the Student’s t-test with unequal variance (*P < 0.01).

A 64% decrease of subolesin transcript levels was found in eggs from the subolesin dsRNA-injected engorged females (Fig. 3C). Interestingly, a 30-fold increase in the Bm86 transcript level and a 56% decrease in Bm91 transcript level were also found in these aberrant eggs (Figs. 3A and B). An 84% decrease in the number of Bm86 copies was observed in eggs laid by the engorged females injected with Bm86 dsRNA (Fig. 3A) and the transcript level of Bm91 was reduced by 97% in eggs from the Bm91 dsRNA-injected engorged females compared with the mock- injected control group (Fig. 3B), confirming gene-specific silencing in the eggs of dsRNA-injected engorged females.

Injected dsRNA could be re-amplified from the eggs of dsRNA-injected engorged females when primers located within the dsRNA sections were used, instead of primers located downstream of the dsRNA region which were used to demonstrate gene silencing (Table 1). Results of quantitative real-time RT-PCR performed with these primers showed levels of Bm86, Bm91 and subolesin which were 10.5, 4.3 and 4.5 times higher, respectively, in the Bm86, Bm91 and subolesin injected groups than levels found in the mock-injected group (Fig. 4).

046-068a - Chapter 2 17x24.pdf 13 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

8,00E+00 3,00E+02 7.00E+03 * 7,00E+00 2,50E+02 6.00E+03 6,00E+00 5.00E+03 2,00E+02 β-actin

5,00E+00 4 4.00E+03 β-actin 4 4,00E+00 1,50E+02 3.00E+03 2.00E+03

3,00E+00 β-actin (subolesin value) Bm86 / 10 Bm86 / 4 Bm86 / 10 1,00E+02 1.00E+03 2,00E+00 0.00E+00 * 5,00E+01 1,00E+00 Bm86 / 10 Control Bm86 0,00E+00 0,00E+00 A Control Bm86 Bm91 Subolesin A

1,60E+02 1.20E+03 1,40E+02 * 1.00E+03 1,20E+02 8.00E+02 1,00E+02 β-actin 4 β-actin 4 8,00E+01 6.00E+02 * 6,00E+01 4.00E+02 Bm91 / 10 Bm91 / 10 Bm91 / 4,00E+01 2.00E+02

2,00E+01 0.00E+00 * Control Bm91 0,00E+00 Control Bm86 Bm91 Subolesin B B

1,60E+01

1,40E+01 1.80E+00 * 1,20E+01 1.60E+00 1.40E+00 1,00E+01 β-actin

β-actin 1.20E+00 4 4

8,00E+00 1.00E+00 8.00E-01 6,00E+00 6.00E-01

Subolesin / 10 Subolesin 4,00E+00 * 4.00E-01 subolesin / 10 2.00E-01 2,00E+00 0.00E+00 0,00E+00 Control Subolesin Control Bm86 Bm91 Subolesin C C

Figure 3. Quantitative real-time RT-PCR Figure 4. Quantitative real-time RT-PCR analysis showing the relative Bm86 (A), analysis using primers located within the Bm91 (B) and subolesin (C) transcript levels double-stranded RNA (dsRNA) region in eggs originating from mock-injected, showing the relative Bm86 (A), Bm91 (B) Bm86-, Bm91- or subolesin-double stranded and subolesin (C) transcript levels in eggs RNA-injected engorged females. The data originating from Bm86-(A), Bm91-(B), or represent mean values + SD, normalised subolesin-(C) dsRNA-injected engorged relative to β-actin transcript levels. Asterisk females compared with levels in the mock- (*) denotes the difference compared with the injected control group. The data represent control injected group is significant as de- mean values + SD, normalised relative to β- termined by Student’s t-test (P < 0.01). actin transcript levels. Asterisk (*) denotes the difference compared with the control injected group is significant as determined by Student’s t-test (P < 0.01).

046-068a - Chapter 2 17x24.pdf 14 26-7-2010 22:08:11 Chapter 2

Gene silencing was observed in larvae 6 days after hatching; a decrease of 86% in Bm86 transcript level and of 91% in Bm91 transcript level in the Bm86- and Bm91 dsRNA-injected groups, respectively (Figs. 5A and B, grey bars). Subolesin transcript levels were not measured in the few larvae which hatched from the subolesin dsRNA-injected females due to their small number. Quantitative real-time RT- PCR analysis of RNA extracted from larvae 5 weeks after hatching (9 weeks after the initial injection of engorged females with dsRNA) revealed that genes re- mained silenced in both Bm86- and Bm91-silenced groups (Figs. 5A and B, black bars). This effect diminished over time, in particular for the Bm86-silenced group, in which transcript levels were now 67% lower compared with the control group. Bm91 transcript levels were still 90% lower in the Bm91-silenced group compared with the control group. When 7-week-old larvae from these three groups were fed in separate patches on a calf and total RNA from the viscera of adults which had developed from these larvae was analyzed by quantitative real-time RT-PCR, gene silencing was not observed (results not shown).

2,50E+03

2,00E+03

1,50E+03 β-actin 4

1,00E+03

Bm86 / 10 * 5,00E+02

* 0,00E+00 Control Bm86 Bm91 A

3,00E+02

2,50E+02

2,00E+02 β-actin 4 1,50E+02

Bm91 / 10 1,00E+02

5,00E+01 * * 0,00E+00 Control Bm86 Bm91 B

Figure 5. Quantitative real-time RT-PCR analysis showing the relative Bm86 (A) and Bm91 (B) transcript levels in 6-day-old larvae (grey bars) and 5-week-old larvae (black bars) originating from mock-injected, Bm86- or Bm91-double-stranded RNA-injected engorged females. The data represent mean values + SD, normalised relative to β-actin transcript levels. Asterisk (*) denotes the difference compared with the control injected group is significant as determined by Student’s t-test (P < 0.01).

046-068a - Chapter 2 17x24.pdf 15 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

Discussion

The production characteristics of the subolesin-silenced female B. microplus ticks corresponded with previous results from subolesin RNAi studies in other ixodid tick species, and typically resulted in decreased tick and egg mass weights and high mortality [17, 18, 28]. The synergistic effect of combined silencing of the Bm86 and subolesin gene reported previously in R. sanguineus [18] could not be confirmed for B. microplus (Table 2).

Significant changes in the production characteristics of the Bm86- and Bm91- silenced females were not observed, suggesting that the deleterious effect on ticks feeding on Bm86- or Bm91-vaccinated cattle is not caused by a loss of function of the Bm86 or Bm91 protein alone. In fact, the protective effect of Bm86-based vaccines is through gut damage mediated by anti-Bm86 antibodies during tick feeding [29]. These results suggest that the protection mechanisms of Bm86 and subolesin-based vaccines are different and may contribute to the increased efficacy of Bm86 and subolesin combined vaccines.

Quantitative real-time RT-PCR performed on samples taken 6 days after dsRNA injection and feeding resulted in a decrease of 79–90% of the targeted gene transcript level compared with the mock-injected group. This result was comparable with previous semi-quantitative measurements of the gene silencing effect by dsRNA-injection in A. americanum. In this RNAi study, a decrease of ~90% to 50% in cystatin transcript level was observed from 24 h to 9 days of feeding [27]. In the present study, although gene silencing was specific in the Bm86 and Bm91 dsRNA-injected groups, subolesin dsRNA injection resulted in both significantly decreased subolesin as well as Bm91 expression levels. This effect was not observed in the combined Bm86/subolesin silenced group, which may be explained by a slight difference in midgut:salivary gland ratio in the dissected viscera between the groups. Since Bm91 is present in relatively high concentrations in salivary glands compared with midgut [12], a shift in the midgut:salivary gland ratio of the dissected viscera in favor of midgut tissue could result in the lower Bm91 expression levels we found in this specific sample. Alternatively, the effect of silencing subolesin expression may affect the expression of other genes. The pleio- tropic effect on tick tissues in which subolesin expression has been silenced suggests that this gene may be involved in the regulation of multiple pathways in ticks [17].

046-068a - Chapter 2 17x24.pdf 16 26-7-2010 22:08:11 Chapter 2

Injection of pilocarpine solution into the hemocoel via the spiracular plate of engorged ticks has been described for inducement of salivation in engorged B. microplus ticks [30]. These openings of the tracheae are sclerotised structures located posterior to the fourth pair of legs. Their rigid structure allows for punctur- ing and injection of small quantities of fluid by a fine needle without subsequent reflux of the injected solution, hemolymph or tissue. When we injected Bm86, Bm91 or subolesin dsRNA into the hemocoel of engorged females, the course of oviposition appeared to be unaffected. Only one Bm91 dsRNA-injected female and one mock-injected female tick died before ovipositing. Interestingly, embryogenesis was undisturbed in eggs oviposited by the Bm86 dsRNA-, Bm91 dsRNA- and mock-injected engorged females, but an aberrant development was seen in the majority of egg masses oviposited by the subolesin dsRNA-injected engorged females. This egg phenotype has not been described previously and suggests that subolesin plays a role in embryonic development. When total RNA isolated from these aberrant eggs was analyzed by real-time RT-PCR, significantly higher Bm86 levels and decreased Bm91 and subolesin levels were found. Again, these results suggest that subolesin may be a regulator of transcription in ticks.

Injected dsRNA was detected in eggs from dsRNA-injected engorged females by real-time RT-PCR using primers located within the dsRNA section, indicating that unprocessed dsRNA is incorporated in the eggs. The suggested route of incorporation of exogenously produced yolk directly from the hemolymph into oocytes [31] may be followed for the incorporation of dsRNA into oocytes as well. Further experiments are needed to determine whether this dsRNA forms a reser- voir of mobile silencing signals inducing gene-specific silencing in eggs, or whether small interfering RNAs are responsible for this effect. Other possible routes for the mobile silencing signal to enter the oocyte are through the pedicel in the ovary or, once the oocyte has ovulated, by contact with cells from the genital tract.

Some eggs (<0.6%) found in the batches laid during the first day of oviposition by subolesin dsRNA-injected engorged females, hatched normally. It is likely that these eggs developed to a stage which was not accessible by the dsRNA prior to injection of the dsRNA. They may have been ovulated eggs which were not in direct contact with the hemolymph or ones in which the shell was hardened during the oocyte passage through the oviduct and thus became impermeable to dsRNA during this process [32]. After dsRNA was injected into the body cavity of B. microplus, the gene silencing effect spread throughout the organism and its progeny. This systemic RNAi has

046-068a - Chapter 2 17x24.pdf 17 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

been associated with the sid-1 protein, a transmembrane protein which enables passive cellular uptake of dsRNA [33, 34]. Unfortunately, our attempts to detect a B. microplus sid-1 homologue, as described previously in studies on presence of a sid-1 homologue in grasshopper species Schistocerca americana, were not successful (data not shown) [35]. The only protein currently present in the B. microplus expressed sequence tag (EST) database [36] which is associated with the RNAi machinery is the nuclease Argonaute-2 (Ago-2), the central catalytic component of the RNA-induced silencing complex (RISC) in mammals and Drosophi- la [37, 38]. Homologues of other RNAi-associated proteins such as Dicer, which is responsible for the cleavage of exogenous long dsRNA into short interfering RNA (siRNA), remain to be identified in B. microplus and other tick species as well.

RNAi described herein provides an important tool to screen for tick-protective antigens in this one-host tick species, B. microplus [28] and allowed for characterisation of the effect and function of tick protective antigens, as well as the role of genes involved in tick–host–pathogen interactions and the transmission of tick- borne pathogens [39]. Initiation and completion of the B. microplus genome sequencing project would greatly enhance these kinds of studies [36], as well as the availability of the genomes from cattle and the pathogens transmitted by B. microplus, most notably: A. marginale [40], B. bigemina and B. bovis, which are currently being sequenced. Although sequences of the dsRNAs used in this study do not contain any significant overlap with other known B. microplus genes, the possibility of off-target gene silencing effects cannot be excluded due to the limited amount of sequence data available. Availability of the complete B. microplus genome sequence data will facilitate screening for potential off-target effects. These can subsequently be minimised by avoiding the use of dsRNAs or siRNAs containing sequences which are present in multiple genes.

The effect of silencing tick genes suggested to be involved in embryogenesis such as vitellin degrading cysteine endopeptidase [41], in the transovarial transmission of Babesia spp. or genes associated with acaricide resistance, which is measured in larvae by the Larval Packet Test [42], could be studied using our method to silence genes in B. microplus embryos and larvae by injecting engorged females with dsRNA. These experimental approaches are more efficient and less labour intensive than the three other dsRNA delivery approaches into oocytes and embryos using microinjection [43], transgenic RNAi [44] and electroporation [45].

046-068a - Chapter 2 17x24.pdf 18 26-7-2010 22:08:11 Chapter 2

Acknowledgements

This research was supported by the Wellcome Trust under the ‘Animal Health in the Developing World’ initiative through project 075799 entitled ‘Adapting recombinant anti-tick vaccines to livestock in Africa’. Prof. Leon Fourie (ClinVet, Bloemfontein, South Africa) is acknowledged for providing Boophilus microplus ticks.

046-068a - Chapter 2 17x24.pdf 19 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

References

1. Estrada-Pena A, Bouattour A, Camicas JL, Guglielmone A, Horak I, Jon- gejan F, Latif A, Pegram R, Walker AR: The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodi- dae) in Africa and Latin America. Exp Appl Acarol 2006, 38(2-3):219- 235. 2. Murrell A, Barker SC: Synonymy of Boophilus Curtice, 1891 with Rhi- picephalus Koch, 1844 (Acari: Ixodidae). Syst Parasitol 2003, 56(3):169-172. 3. Willadsen P: Anti-tick vaccines. Parasitology 2004, 129 Suppl:S367- 387. 4. Samish M, Ginsberg H, Glazer I: Biological control of ticks. Parasitology 2004, 129 Suppl:S389-403. 5. de la Fuente J, Kocan KM: Advances in the identification and characterization of protective antigens for recombinant vaccines against tick infestations. Expert Rev Vaccines 2003, 2(4):583-593. 6. Gough JM, Kemp DH: Localization of a low abundance membrane protein (Bm86) on the gut cells of the cattle tick Boophilus microplus by immunogold labeling. J Parasitol 1993, 79(6):900-907. 7. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. off. Vaccine 1998, 16(20):1990-1992. 8. Pipano E, Alekceev E, Galker F, Fish L, Samish M, Shkap V: Immunity against Boophilus annulatus induced by the Bm86 (Tick-GARD) vaccine. Exp Appl Acarol 2003, 29(1-2):141-149. 9. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245-261. 10. Rodríguez M, Jongejan F: Recombinant Rhipicephalus microplus Bm86 vaccine GavacTM protect against Hyalomma dromedarii but not against Amblyomma cajennense ticks. In: Unpublished. 2002. 11. Willadsen P, Smith D, Cobon G, McKenna RV: Comparative vaccination of cattle against Boophilus microplus with recombinant antigen Bm86 alone or in combination with recombinant Bm91. Parasite Im- munol 1996, 18(5):241-246. 12. Riding GA, Jarmey J, McKenna RV, Pearson R, Cobon GS, Willadsen P: A protective "concealed" antigen from Boophilus microplus. Purifica-

046-068a - Chapter 2 17x24.pdf 20 26-7-2010 22:08:11 Chapter 2

tion, localization, and possible function. J Immunol 1994, 153(11):5158- 5166. 13. Jarmey JM, Riding GA, Pearson RD, McKenna RV, Willadsen P: Car- boxydipeptidase from Boophilus microplus: a "concealed" antigen with similarity to angiotensin-converting enzyme. Insect Biochem Mol Biol 1995, 25(9):969-974. 14. Almazan C, Blas-Machado U, Kocan KM, Yoshioka JH, Blouin EF, Man- gold AJ, de la Fuente J: Characterization of three Ixodes scapularis cDNAs protective against tick infestations. Vaccine 2005, 23(35):4403- 4416. 15. Almazan C, Kocan KM, Bergman DK, Garcia-Garcia JC, Blouin EF, de la Fuente J: Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine 2003, 21(13-14):1492-1501. 16. Almazan C, Kocan KM, Blouin EF, de la Fuente J: Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine 2005, 23(46-47):5294-5298. 17. de la Fuente J, Almazan C, Blas-Machado U, Naranjo V, Mangold AJ, Blouin EF, Gortazar C, Kocan KM: The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine 2006, 24(19):4082-4095. 18. de la Fuente J, Almazan C, Naranjo V, Blouin EF, Kocan KM: Synergis- tic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference. Parasitol Res 2006. 19. Pal U, Li X, Wang T, Montgomery RR, Ramamoorthi N, Desilva AM, Bao F, Yang X, Pypaert M, Pradhan D et al: TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi. Cell 2004, 119(4):457-468. 20. Ramamoorthi N, Narasimhan S, Pal U, Bao F, Yang XF, Fish D, Anguita J, Norgard MV, Kantor FS, Anderson JF et al: The Lyme disease agent exploits a tick protein to infect the mammalian host. Nature 2005, 436(7050):573-577. 21. Sukumaran B, Narasimhan S, Anderson JF, Deponte K, Marcantonio N, Krishnan MN, Fish D, Telford SR, Kantor FS, Fikrig E: An Ixodes scapularis protein required for survival of Anaplasma phagocytophilum in tick salivary glands. J Exp Med 2006. 22. Aljamali MN, Bior AD, Sauer JR, Essenberg RC: RNA interference in ticks: a study using histamine binding protein dsRNA in the female tick Amblyomma americanum. Insect Mol Biol 2003, 12(3):299-305.

046-068a - Chapter 2 17x24.pdf 21 26-7-2010 22:08:11 Gene silencing in Boophilus microplus by RNA interference

23. Karim S, Ramakrishnan VG, Tucker JS, Essenberg RC, Sauer JR: Am- blyomma americanum salivary glands: double-stranded RNA- mediated gene silencing of synaptobrevin homologue and inhibition of PGE2 stimulated protein secretion. Insect Biochem Mol Biol 2004, 34(4):407-413. 24. Miyoshi T, Tsuji N, Islam MK, Kamio T, Fujisaki K: Gene silencing of a cubilin-related serine proteinase from the hard tick Haemaphysalis longicornis by RNA interference. J Vet Med Sci 2004, 66(11):1471- 1473. 25. Narasimhan S, Montgomery RR, DePonte K, Tschudi C, Marcantonio N, Anderson JF, Sauer JR, Cappello M, Kantor FS, Fikrig E: Disruption of Ixodes scapularis anticoagulation by using RNA interference. Proc Natl Acad Sci U S A 2004, 101(5):1141-1146. 26. Soares CA, Lima CM, Dolan MC, Piesman J, Beard CB, Zeidner NS: Ca- pillary feeding of specific dsRNA induces silencing of the isac gene in nymphal Ixodes scapularis ticks. Insect Mol Biol 2005, 14(4):443-452. 27. Karim S, Miller NJ, Valenzuela J, Sauer JR, Mather TN: RNAi-mediated gene silencing to assess the role of synaptobrevin and cystatin in tick blood feeding. Biochem Biophys Res Commun 2005, 334(4):1336-1342. 28. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: RNA interference screening in ticks for identification of protective antigens. Parasitol Res 2005, 96(3):137-141. 29. Willadsen P, Riding GA, McKenna RV, Kemp DH, Tellam RL, Nielsen JN, Lahnstein J, Cobon GS, Gough JM: Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus. J Immunol 1989, 143(4):1346-1351. 30. Bechara GH, Szabo MP, Machado RZ, Rocha UF: A technique for col- lecting saliva from the cattle-tick Boophilus microplus (Canestrini, 1887) using chemical stimulation. Environmental and temporal influ- ences on secretion yield. Braz J Med Biol Res 1988, 21(3):479-484. 31. Saito KC, Bechara GH, Nunes ET, de Oliveira PR, Denardi SE, Mathias MI: Morphological, histological, and ultrastructural studies of the ovary of the cattle-tick Boophilus microplus (Canestrini, 1887) (Acari: Ixodidae). Vet Parasitol 2005, 129(3-4):299-311. 32. Diehl PA, Aeschlimann A, Obenchain FD: Tick reproduction: oogenesis and oviposition. In: Physiology of Ticks. Edited by Obenchain FD, Galun R, 1st edn. Oxford: Pergamon Press; 1982: 277-350. 33. Feinberg EH, Hunter CP: Transport of dsRNA into cells by the transmembrane protein SID-1. Science 2003, 301(5639):1545-1547.

046-068a - Chapter 2 17x24.pdf 22 26-7-2010 22:08:11 Chapter 2

34. Winston WM, Molodowitch C, Hunter CP: Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1. Science 2002, 295(5564):2456-2459. 35. Dong Y, Friedrich M: Nymphal RNAi: systemic RNAi mediated gene knockdown in juvenile grasshopper. BMC Biotechnol 2005, 5:25. 36. Guerrero FD, Nene VM, George JE, Barker SC, Willadsen P: Sequencing a new target genome: the Boophilus microplus (Acari: Ixodidae) genome project. J Med Entomol 2006, 43(1):9-16. 37. Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, Song JJ, Hammond SM, Joshua-Tor L, Hannon GJ: Argonaute2 is the catalytic engine of mammalian RNAi. Science 2004, 305(5689):1437-1441. 38. Miyoshi K, Tsukumo H, Nagami T, Siomi H, Siomi MC: Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev 2005, 19(23):2837-2848. 39. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol Res 2006. 40. Brayton KA, Kappmeyer LS, Herndon DR, Dark MJ, Tibbals DL, Palmer GH, McGuire TC, Knowles DP, Jr.: Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two super- families of outer membrane proteins. Proc Natl Acad Sci U S A 2005, 102(3):844-849. 41. Seixas A, Dos Santos PC, Velloso FF, Da Silva Vaz I, Jr., Masuda A, Horn F, Termignoni C: A Boophilus microplus vitellin-degrading cysteine endopeptidase. Parasitology 2003, 126(Pt 2):155-163. 42. Li AY, Davey RB, Miller RJ, George JE: Resistance to coumaphos and diazinon in Boophilus microplus (Acari: Ixodidae) and evidence for the involvement of an oxidative detoxification mechanism. J Med En- tomol 2003, 40(4):482-490. 43. Wargelius A, Ellingsen S, Fjose A: Double-stranded RNA induces specific developmental defects in zebrafish embryos. Biochem Biophys Res Commun 1999, 263(1):156-161. 44. Tavernarakis N, Wang SL, Dorovkov M, Ryazanov A, Driscoll M: Herit- able and inducible genetic interference by double-stranded RNA encoded by transgenes. Nat Genet 2000, 24(2):180-183. 45. Grabarek JB, Plusa B, Glover DM, Zernicka-Goetz M: Efficient delivery of dsRNA into zona-enclosed mouse oocytes and preimplantation embryos by electroporation. Genesis 2002, 32(4):269-276.

046-068a - Chapter 2 17x24.pdf 23 26-7-2010 22:08:11

EVIDENCE OF THE ROLE OF TICK SUBOLESIN IN GENE EXPRESSION

DE LA FUENTE J, MARITZ-OLIVIER C, NARANJO V, AYOUBI P, NIJHOF AM, ALMAZÁN C, CANALES M, PÉREZ DE LA LASTRA JM, GALINDO RC, BLOUIN EF, GORTAZAR C, JONGEJAN F, KOCAN KM BMC GENOMICS 2008; 9:372

6 PhD thesis Nijhof - Title page chapter 3.pdf 1 26-7-2010 22:52:27 001-125 - Dissertatie Ard.pdf 70 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

Abstract

Subolesin is an evolutionary conserved protein that was discovered recently in Ixodes scapularis as a tick protective antigen and has a role in tick blood digestion, reproduction and development. In other organisms, subolesin orthologs may be involved in the control of developmental processes. Because of the profound effect of subolesin knockdown in ticks and other organisms, we hypothesized that subolesin plays a role in gene expression, and therefore affects multiple cellular processes. The objective of this study was to provide evidence for the role of subolesin in gene expression. Two subolesin-interacting proteins were identified and characterized by yeast two-hybrid screen, co-affinity purification and RNA interference (RNAi). The effect of subolesin knockdown on the tick gene expression pattern was characterized by microarray analysis and demonstrated that subolesin RNAi affects the expression of genes involved in multiple cellular pathways. The analysis of subolesin and interacting protein sequences identified regulatory mo- tifs and predicted the presence of conserved protein kinase C (PKC) phosphorylation sites. Collectively, these results provide evidence that subolesin plays a role in gene expression in ticks.

001-125 - Dissertatie Ard.pdf 71 21-7-2010 0:13:10 Chapter 3

Introduction

Ticks are obligate hematophagous ectoparasites of wild and domestic animals and humans, and are important vectors of diseases to humans and animals worldwide [1]. Ticks are classified in the subclass Acari, order Parasitiformes, suborder Ixo- dida and are distributed worldwide from Arctic to tropical regions [2]. Despite efforts to control tick infestations, these ectoparasites remain a serious threat for human and animal health [3, 4]. Recently, both vaccine studies using key tick antigens as well as characterization of tick gene function by RNA interference (RNAi) have provided new information on genes that impact tick life cycle and the tick-pathogen interface [3-6].

One of these genes, subolesin (also called 4D8), was discovered recently in Ixodes scapularis and was shown by both RNAi and immunization with recombinant proteins to protect against tick infestations, resulting in reduced tick survival, feeding and reproduction [7-11]. The silencing of subolesin expression by RNAi in ticks resulted in degeneration of gut, salivary gland, reproductive and embryonic tissues as well as causing sterility in males [10-13]. In addition, targeting subolesin by RNAi or vaccination decreased the ability of ticks to become infected with Anaplasma marginale or A. phagocytophilum [14, 15]. Evidence of the conservation of subolesin throughout evolution was provided by the high homology of amino acid sequences in higher eukaryotes, which suggests an essential conserved biological function for this protein [10]. For example, the expression of subolesin orthologs has been detected in a variety of adult and immature tissues of several tick species [7, 10, 13], Drosophila melanogaster [16, 17] and Caenorhabditis elegans [18]. These studies have suggested that subolesin orthologs may be involved in the control of developmental processes in these organisms [7, 10, 13, 16-18]. However, despite the important role that subolesin plays in tick reproduction, development and pathogen infection, the biological function of subolesin and its orthologs has not been reported.

Because of the profound effect of subolesin knockdown in ticks and other organisms we hypothesized that subolesin may play a role in gene expression, thus affecting multiple cellular processes. Herein, gene expression is understood as the process by which a gene gets turned on in a cell to make RNA and proteins and therefore may be affected at the transcriptional and/or translational levels. The objective of this study was to provide evidence for the role of subolesin in gene expression through a combination of methodological approaches that included characterization of subolesin-interacting proteins, the effect of gene knockdown on tick gene expression pattern and the prediction of subolesin post-translational

001-125 - Dissertatie Ard.pdf 72 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

modifications. Although the biological function of subolesin is unkown, the results provided evidence that this protein plays a role in gene expression in ticks and most likely other organisms.

Material and Methods

Ticks I. scapularis female ticks were obtained from the laboratory colony maintained at the Oklahoma State University tick rearing facility. Off-host ticks were maintained in a 12 hr light: 12 hr dark photoperiod at 22–25°C and 95% relative humidity. R. microplus female ticks (Mozambique strain) were reared in Holstein- Friesian cattle at the Utrecht Centre for Tick-borne Diseases, Utrecht University. Animals were housed with the approval and supervision of the respective Institu- tional Animal Care and Use Committees.

cDNA library construction R. microplus eggs were used for RNA extraction and cDNA library construction. cDNA synthesis and amplification was performed using the Super SMART Sys- tem™ principle (Clontech Laboratories, Mountain View, CA, USA) with adapted anchor primers containing unique SfiI restriction sites for directional cloning (SMART IV: 5'- AAGCAGTGGTATCAACGCAGAGTGGCCATGGAGGCCGGG-3'and CDS III: 5'-ATTCTAGAGGCCTCCATGGCCGACATG(T)30VN-3'). Amplified cDNA was polished using the protocol described by the SMART PCR cDNA synthesis manual (Clontech Laboratories), purified using the DNA Extract II Kit (Macherey-Nagel, Düren, Germany) and subjected to directional cloning in pACT2 plasmid via the SfiI sites. Repetitive electroporation of E. coli JM109 cells was performed to obtain a library with a titer exceeding 3 × 107 cfu/ml.

Yeast two-hybrid screen The yeast two-hybrid screen was performed as dictated in the MATCHMAKER Two-Hybrid user manual (Clontech Laboratories). Full-length subolesin cDNA from R. microplus was inserted in yeast expression vector pAS2_1 at NdeI and PstI sites. Yeast strain AH109 was co-transformed with plasmid pAS2_1_subolesin (bait) and pACT2 R. microplus egg cDNA library (prey) in sequential transformation procedure. The co-transformants were selected after incubation at 30°C for 5 days on synthetic defined (SD) minimal medium lacking tryptophan and leucine. All colonies were pooled from the plates and replated on SD minimal medium lacking tryptophan, leucine, histidine and adenine. Positive

001-125 - Dissertatie Ard.pdf 73 21-7-2010 0:13:10 Chapter 3

clones were analyzed for β-galactosidase activity by colony-filter assays. Prey plasmids of positive clones were rescued using E. coli KC8 and subjected to DNA sequencing.

Confirmation of protein-protein interaction by co-affinity purification The GI and GII cDNA fragments, encoding for putative prey proteins interacting with the subolesin bait, were amplified by PCR using oligonucleotide primers QEGI5: 5'-GGCCATGGAGGCCGGGATAGGA and QEGI3: 5'- GGAGATCTATGCTCATTAAGACAAATCTC, and QEGII5: 5'- GGCCATGGCCTCAACCAGGCCCACGGACAAACCCCTC and QEGII3: 5'- GGAGATCTGGCGACCGTTTGCCTCATGTC, respectively and the Access RT- PCR system (Promega, Madison, WI, USA). The PCR primers introduced NcoI and BglII restriction sites for cloning into the expression vector pQE-60 fused to a 6xHis tag (Qiagen Inc., Valencia, CA, USA). The full-length cDNA of I. scapularis subolesin was inserted into the expression plasmid pFLAG-CTC (Sigma, St. Louis, MO, USA) as described previously [7]. Recombinant subolesin, GI and GII proteins were expressed in E. coli JM109 as described previously [7]. For co- affinity purification of subolesin-interacting proteins, the Ni-NTA spin columns (Qiagen) were used following manufacturer's protocol. The supernatant of GI and GII cell lysates were loaded onto the columns. The columns were washed three times with washing buffer (Qiagen) before loading the purified subolesin. The columns were incubated at 4°C for 4 hours to allow protein-protein interaction and then washed again. The proteins were eluted with elution buffer (Qiagen) and the eluted proteins were subjected to 12% sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) and immunoblotted with anti-subolesin antibodies [7]. Controls included affinity purification of GI and GII in the absence of subolesin and loading subolesin onto Ni-NTA columns in the absence of His-tagged GI and GII proteins and in the presence of an unrelated His-tagged protein. GI and GII proteins were detected by Western blot using the HisDetector Western Blot Kit HRP (KPL, Gaithersburg, Maryland, USA).

RNA interference in ticks Oligonucleotide primers homologous to I. scapularis and R. microplus subolesin containing T7 promoters were used for in vitro transcription and synthesis of subolesin dsRNA as described previously [10, 13], using the Access RT-PCR system (Promega) and the Megascript RNAi kit (Ambion, Austin, TX, USA). For the synthesis of R. microplus GI and GII dsRNAs, oligonucleotide primers GI5: 5'- ATGGAGGCCGGGATAGGA and GI3: 5'-TGCTCATTAAGACAAATCTC, and GII5: 5'-GGCCCACGGACAAACCCCTC and GII3: 5'-

001-125 - Dissertatie Ard.pdf 74 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

CGACCGTTTGCCTCATGTC were used, respectively, with the same procedure described above. The dsRNA was purified and quantified by spectrophotometry. Unfed I. scapularis female ticks were injected with approximately 0.5 μl dsRNA in the lower right quadrant of the ventral surface of the exoskeleton of ticks [10]. Freshly molted R. microplus females were placed on double-sided sticky tape with the ventral side upwards and injected with approximately 0.5 μl dsRNA into the anal aperture using a syringe mounted on a MM3301-M3 micromanipulator (World Precision Instruments (WPI), Berlin, Germany) and connected to an UM- PII syringe pump (WPI) [13]. Engorged R. microplus females were injected with 5 μl of dsRNA (5 × 1010–5 × 1011 molecules/μl) in the right spiracular plate within 6 hours after dropping off the host [13]. The injections were done using a 10 μl syringe with a 1 inch, 33 gauge needle (Hamilton, Bonaduz, Switzerland). Control ticks were injected with injection buffer (10 mM Tris-HCl, pH 7, 1 mM EDTA) alone (saline negative control). We demonstrated previously that there is no difference between using an unrelated dsRNA or injection buffer alone for negative control in tick RNAi experiments [10].

Two RNAi experiments were conducted with I. scapularis. In the first experiment, designed to determine the time after dsRNA injection in which subolesin knockdown occurs, 20 female ticks per group were injected with subolesin dsRNA or injection buffer. The ticks were held in a humidity chamber for 1 day after which they were allowed to feed on a sheep for 10 days. Three ticks from each group were collected at 1, 3, 6, 9 and 11 days post injection (dpi). Only the ticks collected after 10 days of feeding (11 dpi) were fed together with male ticks to evaluate the effect of subolesin knockdown on tick weight. After collection, ticks were weighed and the tick weight was compared between subolesin dsRNA- injected and saline controls by Student's t-test (P = 0.05). Internal organs were then dissected and stored in RNALater (Ambion) for RNA extraction to determine subolesin mRNA levels by real-time RT-PCR. In the second experiment, 100 I. scapularis female ticks per group were injected with subolesin dsRNA or injection buffer alone. The ticks were held in a humidity chamber for 1 day and then allowed to feed on a sheep without males for 5 and 8 days (6 and 9 dpi) in groups of 50 dsRNA- and 50 saline-injected ticks each. Ten additional female ticks per group were fed with males for 10 days to compare the weight of replete dsRNA- injected and control ticks after RNAi by Student's t-test with unequal variance (P = 0.05). Unattached ticks were removed two days after infestation. After feeding, ticks were removed from the sheep and dissected for RNA extraction.

001-125 - Dissertatie Ard.pdf 75 21-7-2010 0:13:10 Chapter 3

For RNAi in R. microplus, unfed and replete female ticks were injected with GI dsRNA, GII or subolesin dsRNA or injection buffer alone as described previously [13]. In the experiment with unfed ticks, 60–76 freshly molted female ticks were injected and fed on a calf for 15 days with untreated males to determine female tick mortality, weight, oviposition and hatching. Tick mortality was evaluated as the ratio of dead female ticks 15 dpi to the total number of female ticks placed on the calf and was compared between dsRNA and mock-injected control ticks by χ2- test as implemented in Mstat 4.01 (α = 0.01). Ticks completing feeding and egg masses oviposited by each tick were weighed individually and the average ± SD were calculated and compared between dsRNA and saline injected control ticks by Student's t-test with unequal variance (P = 0.05). In the experiment with replete female ticks, 6 ticks were used per group. Each tick was weighed before injection and stored individually in 2 ml Eppendorf tubes with pierced lids in an incubator at 27°C and 95% relative humidity to evaluate oviposition and hatching after RNAi. The weight of replete ticks before injection and the eggs mass per tick were compared with the control saline injected ticks by Student's t-test with unequal variance (P = 0.05). mRNA levels of RNAi targeted genes were determined by real-time RT-PCR. For real-time RT-PCR, internal organs were dissected and total RNA was extracted from 6 females of each dsRNA- or saline-injected group after 6 days of feeding and from 100 mg eggs oviposited by injected replete ticks.

Suppression-subtractive hybridization (SSH) Total RNA was isolated from pooled guts and salivary glands of I. scapularis female ticks injected with subolesin dsRNA or injection buffer at 9 dpi (8 days of feeding) using TriReagent (Sigma) according to manufacturer's instructions. RNA quality was assessed by gel electrophoresis. SSH was performed at Evrogen JCS (Moscow, Russia) as described previously [6, 19]. Tester and driver RNAs were subtracted in both directions to construct two SSH libraries enriched for differentially expressed cDNAs in subolesin dsRNA-injected (reverse-subtracted) and saline-injected (forward-subtracted) ticks. Approximately 100 clones from each library were randomly picked up and subjected to differential hybridization with subtracted and non-subtracted probes using the PCR-select differential screening kit (Clontech, Palo Alto, CA, USA), which resulted in > 95% candidate differentially expressed cDNAs.

Microarray construction and analysis Tick cDNA fragments (384 from each of the reverse and forward subtracted SSH libraries) were amplified by PCR using pAL-16 vector-specific primers, purified (MultiScreen PCR plates, Millipore, Billerica, MA, USA) and arrayed onto gam-

001-125 - Dissertatie Ard.pdf 76 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

ma amino propyl silane coated GAPS II slides (Corning, Lowell, MA, USA). Eight pools of 12 clones each from an unsubtracted I. scapularis cDNA library [19] and subolesin cDNA were also arrayed and used to validate normalization. Total RNA was prepared from subolesin dsRNA- and saline-injected ticks at 6 and 9 dpi (5 and 8 days of feeding) using the RNeasy Mini Kit (Qiagen) including the on-column DNA digestion with the RNase-free DNase set following manufacturer's instructions. Total RNA (5 μg) were labeled using the 3DNA Array900 kit with Alexa Fluor dyes (Genisphere, Hatfield, PA, USA), Superscript II (Invitro- gen, Carlsbad, CA, USA), the supplied formamide-based hybridization buffer and 24 × 60 mm LifterSlips (Erie Scientific, Portmouth, NH, USA) according to the manufacturer's (Genisphere) instructions. Hybridization signals were measured using a ScanArray Express (PerkinElmer, Boston, MA, USA) and the images were processed using GenePix Pro version 4.0 (Axon, Union City, CA, USA). Ra- tios were calculated as subolesin dsRNA-injected ticks versus saline-injected control ticks. Normalized ratio values obtained for each probe were averaged across 50 biological replicates and four technical replicates and significant differences were defined as displaying an expression fold change greater than 2-fold. All the microarray data were deposited at the NCBI Gene Expression Omnibus (GEO) under the platform accession number GPL6394 and the series number GSE10222.

Real-time RT-PCR analysis The RNA samples prepared as described above from I. scapularis female ticks and from R. microplus female ticks and eggs after RNAi experiments were used for real-time RT-PCR analysis. The RNA from I. scapularis female ticks injected with an unrelated 4A8 dsRNA [20] was used as a control in the analysis of mRNA levels for selected differentially expressed genes after subolesin RNAi. Two primers were synthesized based on the sequences determined for subolesin, GI, GII and three differentially expressed genes after subolesin RNAi (identical to I. scapularis putative secreted salivary WC peptide [Genbank:AAY66498] and putative secreted protein [Genbank:AAM93633] and M. rosenbergii Cu-Zn SOD; [Gen- bank:AAZ29240]) and used for real-time RT-PCR analysis of mRNA levels in dsRNA- and control ticks. Real-time RT-PCR was done using the QuantiTec SYBR Green RT-PCR kit (Qiagen, Valencia, CA, USA) and a Bio-Rad iQ5 thermal cycler (Hercules, CA, USA) following manufacturer's recommendations and oligonucleotide primers and PCR conditions described in Table 1. mRNA levels were normalized against tick β-actin using the comparative Ct method. mRNA levels were compared between dsRNA-infected and control ticks by Student's t- Test (P = 0.05).

001-125 - Dissertatie Ard.pdf 77 21-7-2010 0:13:10 Chapter 3

Table 1. RT-PCR oligonucleotide primers and conditions.

Gene description Upstream/downstream primer sequences PCR anneal- (5'-3') ing conditions

R. microplus

GI [Genbank:EU436162] CACCATCACTGAAAGCGGT 50°C, 30s GTGTTAAATAGTTATGCTCATTAAGAC GII [Genbank:EU436163] GATCATTGACCTGGTACCTTCC 50°C, 30s GACTTGATGACACCGACGG Subolesin [Gen- CACAGTCCGAGTGGCAGAT 50°C, 30s bank:DQ923495] GATGCACTGGTGACGAGAGA Beta actin [Gen- CACGGTATCGTCACCAACTG 50°C, 30s bank:AY255624] TGATCTGCGTCATCTTCTCG

I. scapularis

Putative secreted salivary WC GATATTGATCCAGCCGGAGA 60°C, 30s peptide [Genbank:AAY66498] ATGTCGTCCCTCCATTGTGT Putative secreted protein [Gen- TGAAGGCAACCATTGCAGTT 56°C, 30s bank:AAM93633] ATTGATGGCAATCCTGTGGA Identical to M. rosenbergii Cu- TGACCTGGGCAACGTTGA 54°C, 30s Zn SOD [Genbank:AAZ29240] ATGACGCAGCAGGCAATG Subolesin [Gen- AGCAGCTCTGCTTCTCGTCT 54°C, 30s bank:AY652654] TCGTACTCGTCGCGTATCTG Beta actin [Gen- GAGAAGATGACCCAGATCA 50°C, 30s bank:AF426178] GTTGCCGATGGTGATCACC

Sequence analysis and database search The sequences of positive clones in the yeast two-hybrid screen were sequenced and searched for homology with the PSI-BLAST algorithm through NCBI web site. Proteins with similar domain architectures were characterized with CDART [21, 22].

The tick cDNAs identified in the microarray analysis as down or up-regulated by more than two-fold after subolesin RNAi were sequenced and analyzed. Multiple sequence alignment were performed to exclude vector sequences and to identify redundant (not unique) sequences using the program AlignX (Vector NTI Suite V 8.0, InforMax, Invitrogen, Carisbad, CA, USA) with an engine based on the Clus- tal W algorithm. Searches for sequence similarity were performed with the BLASTX program against the non-redundant (nr) peptide sequence database and the database of tick specific sequences at NCBI and VectorBase. Protein ontology was determined using the protein reference database [23]. The possibility of subolesin RNAi off-target effects were analyzed by searching for exact complemen-

001-125 - Dissertatie Ard.pdf 78 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

tarity between the seed region (bases 2–8) of all possible 20–22 bp subolesin siR- NAs and cDNA sequences of tick differentially regulated genes identified in the microarray analysis, including the sequence of 3' UTRs when known [24].

The pattern search and predictions for tick GI, GII and subolesin post-translational modifications were done by PIR searching against the PROSITE database [25]. The search for human ortholog (C6orf166; Genbank accession number NP_060534) protein-protein interactions was done by STRING [26, 27].

Nucleotide sequence accession numbers The nucleotide sequences of GI, GII and the ESTs reported in this paper have been deposited in the GenBank database under accession numbers [Gen- bank:EU436162, Genbank:EU436163 and Genbank:FD482610–FD482874], respectively.

Results

Identification of subolesin interaction proteins by yeast two-hybrid screen and co- affinity purification For discovery of subolesin-interacting proteins, subolesin was used as a bait to search for preys in Rhipicephalus (Boophilus) microplus using the yeast two- hybrid system. Two sequences, GI and GII, were identified that encoded for candidate subolesin-interacting proteins. These sequences were represented in 50% and 10% of the positive clones, respectively. BLAST analysis of the GI sequences did not result in identity to known sequences, except for the EST910636 from a R. microplus cDNA library. However, a transduction/transcription domain was found within the GI open reading frame (ORF) (Fig.1). The GII sequence was 99% identical (Expect = 4e-102) to Amblyomma sp. elongation factor-1 alpha (EF-1a; [Genbank:AAK12647]) and to other proteins containing EF1_alpha_II and EF1_alpha_III domains (Fig.2). Both GI and GII sequences contained multiple N- myristoylation and casein kinase II (CK2) and protein kinase C (PKC) phosphorylation sites (Figs. 1 and 2).

The proteins encoded by GI and GII were expressed in Escherichia coli fused to a 6xHis tag with molecular weights of 10 and 22 kDa, respectively and the interaction of these proteins with subolesin was confirmed by co-affinity purification on Ni-NTA columns (Fig. 3). In the absence of either GI or GII recombinant proteins or in the presence of an unrelated His-tagged protein, co-purification of subolesin

001-125 - Dissertatie Ard.pdf 79 21-7-2010 0:13:10 Chapter 3

did not occur, confirming the specificity of the interaction between subolesin and GI or GII (Fig. 3 and data not shown).

Figure 1. Analysis of GI sequence encoding for subolesin-interacting protein. GI nucleotide and deduced amino acid sequences are shown. The GI sequence contains a transduction/transcription domain (boxed letters) and multiple N-myristoylation (solid line) and CK2 (dotted line) and PKC (dashed line) phosphorylation sites.

Figure 2. Analysis of GII sequence encoding for subolesin-interacting protein. GII nucleotide and deduced amino acid sequences are shown. The GII sequence contains EF1_alpha_II and EF1_alpha_III domains (boxed letters) and multiple N- myristoylation (solid line) and CK2 (dotted line) and PKC (dashed line) phosphorylation sites.

001-125 - Dissertatie Ard.pdf 80 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

Figure 3. Co-affinity purification assays. The supernatant of GI- and GII- expressing E. coli cell lysates were loaded onto Ni-NTA columns, washed, then loaded with purified recombinant subolesin and washed again before protein elution for SDS-PAGE and Western blot. The top panel shows subolesin bait detection after affinity purification on Ni-NTA columns in the presence (+) or absence (-) of His-tagged GI/GII protein extracts, demonstrating binding to His-tagged prey. The bottom panel shows detection of GI/GII His-prey after affinity purification on Ni- NTA columns.

Characterization of the effect of GI and GII knockdown on tick survival, feeding, oviposition, hatching and egg development RNAi was used to study the effect of the knockdown of subolesin-interacting protein-coding genes, GI and GII, on female tick survival, feeding, oviposition, hatching and egg development. Subolesin, GI or GII dsRNAs or injection buffer (saline control) were injected into either unfed or replete R. microplus female ticks. The injection of GI dsRNA did not affect tick survival, feeding and oviposition, a fact that correlated with the absence of GI knockdown in ticks (Table 2). Although GI expression was reduced in tick eggs, it did not affect hatching (Table 3). Gene knockdown was demonstrated for GII and subolesin in both ticks and eggs (Tables 2 and 3). GII knockdown produced a phenotype similar to that obtained with the silencing of subolesin expression. The injection of GII dsRNA in unfed ticks resulted in reduced tick survival, feeding, oviposition and hatching when compared to control ticks (Table 2). When GII dsRNA was injected into replete ticks, hatching and egg development were affected (Table 3 and Fig. 4). Undifferentiated egg masses were observed in eggs oviposited by replete ticks injected with GII and subolesin dsRNA when compared to saline injected controls (Fig. 4).

001-125 - Dissertatie Ard.pdf 81 21-7-2010 0:13:10 Chapter 3

Table 2. R. microplus tick survival, weight, oviposition and hatching after RNAi in unfed female ticks.

Experimental Number Expression Tick Mortality Eggs Hatching group of ticks silencing weight (%)c per tick rate (%) (%)a (mg)b (mg)d

Saline control 76 --- 295 ± 85 21 111 ± 75 > 90 GI 60 -44 ± 29 266 ± 17 110 ± 72 > 90 114 GII 63 98 ± 0.4* 131 ± 60*** 1 ± 0***** 161** 4**** Subolesin 66 91 ± 3* 73 ± 80*** 0**** ND 94**

ND, not determined because ticks did not laid eggs. aThe expression silencing of target genes was determined by real-time RT-PCR and average ± SD mRNA levels calculated and compared between dsRNA and saline-injected control ticks by Student's t-test with unequal variance (*P < 0.01). Am- plification efficiencies were normalized against β-actin. bTicks which completed feeding and those removed after 30 days (15 days after saline or dsRNA injection) were weighed individually and average ± S.D. calculated and compared between dsRNA and saline-injected control ticks by Student's t- test with unequal variance (**P < 0.01). cTick mortality was evaluated as the ratio of dead female ticks after day 30 (15 days after saline or dsRNA injection) to the total number of female ticks placed on the animal and was compared between dsRNA and saline-injected control ticks by χ2-test (***α < 0.001). dThe egg mass oviposited by each tick was weighed individually and average ± S.D. calculated and compared between dsRNA and saline-injected control ticks by Student's t-test with unequal variance (****P < 0.01). eThe hatching rate was determined 6 weeks after oviposition and compared with the saline-injected control ticks by Stu- dent's t-test with unequal variance (*****P < 0.01).

Table 3. Weight, oviposition and hatching of replete R. microplus female ticks after RNAi.

Experimental Tick weight Eggs per tick Hatching rate Expression silencing group (mg)a (mg)b (%)c (%)d

Saline control 318 (272–367) 173 (128–229) > 90 --- GI 318 (260–369) 123 (31–175) > 90 55 ± 8** GII 315 (267–349) 132 (95–182) 0.2* 84 ± 5** Subolesin 318 (270–360) 142 (101–175) 0.4* 46 ± 8**

aReplete R. microplus ticks were collected and weighed individually before injection with dsRNA, all within 6 hours after dropping of the host. The average weight and variation (between parentheses) of each group are shown. No significant statistical differences were observed (P > 0.05). bThe egg mass oviposited by each tick was weighed individually. The average egg mass and variation (between parentheses) was calculated and compared with the saline-injected control ticks by Student's t-test with unequal variance. No significant statistical differences were observed (P > 0.05). cThe hatching rate was determined 6 weeks post oviposition and compared with the saline-injected control ticks by Stu- dent's t-test with unequal variance (*P < 0.01). dThe expression silencing of target genes was determined in eggs by real-time RT-PCR and average ± S.D. mRNA levels calculated and compared between dsRNA and saline-injected control ticks by Student's t-test with unequal variance (**P < 0.05). Amplification efficiencies were normalized against β-actin.

001-125 - Dissertatie Ard.pdf 82 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

Figure 4. Representative R. microplus eggs from replete female ticks injected with injection buffer alone (saline control) showing normal development, or GII and subolesin dsRNA showing an undifferentiated egg mass. Eggs were incubated at 27°C and 95% relative humidity. Photographs were taken 22 dpi of replete females and 19 days after oviposition. Bar = 0.1 mm.

Characterization of the effect of subolesin knockdown on tick gene expression profile The results of the subolesin-protein interactions and RNAi experiments with GI and GII, encoding for subolesin-interacting proteins, suggested that subolesin may be involved in gene expression in ticks. Therefore, the subsequent experiments were directed towards analyzing the effect of subolesin knockdown on the tick gene expression profile.

In the first experiment, the kinetics of subolesin silencing by RNAi was investigated in unfed I. scapularis female ticks. The results showed that over 90% silencing of subolesin transcription was obtained 6 days post injection (dpi) and continued until at least 11 dpi (Fig. 5). Significant differences (P = 0.02) in tick weight between subolesin dsRNA (78 ± 33 mg) and saline injected controls (142 ± 47 mg) were observed in ticks that completed feeding on the host in the presence of males at 11 dpi.

001-125 - Dissertatie Ard.pdf 83 21-7-2010 0:13:10 Chapter 3

Figure 5. Kinetics of subolesin RNAi. Ticks were injected with subolesin dsRNA (RNAi group) or injection buffer alone (control group). Three ticks from each group were collected at 1, 3, 6, 9 and 11 days post injection to determine mean ± SD subolesin mRNA ratio by real-time RT-PCR.

In the second experiment, unfed I. scapularis female ticks were injected with subolesin dsRNA or injection buffer alone. Ticks were then placed on a sheep without males and collected at 6 and 9 dpi, by which time subolesin knockdown was regarded as significant based on the RNAi kinetics experiment (Fig. 5). Subolesin knockdown was corroborated by real-time RT-PCR as 81 ± 3% and 79 ± 5% silencing at 6 and 9 dpi, respectively. A group of ticks collected after 10 days of feeding with males was used to corroborate the effect of subolesin knockdown on tick weight, giving results similar to those obtained in the RNAi kinetics experiment described above. The ticks collected at 6 and 9 dpi were then dissected and used to extract RNA for suppression-subtractive hybridization (SSH) and microarray construction and analysis.

The SSH libraries constructed with the RNA of subolesin dsRNA and saline injected ticks collected at 9 dpi were used for random clone amplification and microarray construction. This microarray was enriched for genes differentially expressed after subolesin knockdown. The microarray was hybridized with total RNA prepared from subolesin dsRNA- and saline-injected ticks at 6 and 9 dpi to evaluate how the expression pattern of candidate differentially expressed genes varied at two different time points after subolesin knockdown (Table 4). The results revealed 34 unique (not redundant) genes that were down or up-regulated by at least two-fold after subolesin knockdown at 6 or 9 dpi (Fig.6). Of these genes, 28 were down-regulated and 6 were up-regulated after subolesin RNAi. Of the down-regulated genes, 4 were down-reglated at 6 dpi, 20 at 9 dpi and 4 at both 6 and 9 dpi (Fig.6). Up-regulated genes were found at 9 dpi only (Fig. 6). In the mi-

001-125 - Dissertatie Ard.pdf 84 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

croarray analysis, subolesin expression was silenced by approximately 35% at both 6 and 9 dpi. Although 62% of the unique differentially expressed genes did not have homology to available sequences or were identical to genes with unknown function, the remaining sequences indicated that various biological processes were affected by subolesin knockdown. These included regulation of protein and nucleic acid metabolism (54% of protein ontology assignments), energy pathways (15%), immunity (15%), cell communication and signal transduction (8%) and transport (8%).

Table 4. I. scapularis differentially expressed genes after subolesin knockdown.

Clone IDa Accession number, name and speciesb Fold SD Fold SD change (6 dpi)d change (9 (6 dpi)c (9 dpi)c dpi)d

LibPlateC1_wellB12 [Genbank:AAT92189] KUN-6 (Ixodes pacifi- -1.1196 0.2519 -2.2057 0.3109 cus) LibPlateC1_wellB6 [Genbank:AAZ29240] copper/zinc superoxide -2.7645 0.5455 -2.5136 0.2930 dismutase (Macrobrachium rosenbergii) LibPlateC1_wellD9 [Genbank:AAY66901] histone 2B (Ixodes -1.5922 1.5332 -2.5298 0.9579 scapularis) LibPlateC1_wellE6 [Genbank:AAY66498] putative secreted sali- 1.2320 1.4160 -5.2598 1.3686 vary WC peptide (Ixodes scapularis) LibPlateC1_wellF10 [Genbank:AAY66817] anticoagulant Salp9- -2.0332 0.2959 -1.2037 0.1124 like (I.scapularis) LibPlateC1_wellG12 [Genbank:AAZ29240] copper/zinc superoxide -1.6426 0.2527 -2.2118 0.4974 dismutase (M. rosenbergii) LibPlateC1_wellH10 No homology found -1.8346 0.7216 -2.0350 1.0821 LibPlateC1_wellH4 No homology found -1.6161 0.4640 -2.0602 0.5671 LibPlateC2_wellB11 [Genbank:AAY66498] putative secreted sali- -1.8612 0.1952 -2.1981 0.1664 vary WC peptide (I. scapularis) LibPlateC2_wellB12 No homology found -1.1313 0.1588 -2.1133 0.2023 LibPlateC2_wellD5 No homology found -1.6882 0.0965 -2.2689 0.2158 LibPlateC2_wellE3 [Genbank:AAY66498] putative secreted sali- -1.0794 0.2033 -2.2673 0.2302 vary WC peptide (I. scapularis) LibPlateC2_wellG1 [Genbank:AAM93633|AF483711_1] putative -1.4409 0.2000 -3.5351 0.3250 secreted protein (I. scapularis) LibPlateC3_wellB10 [Genbank:AAH67494] HIST1H3I protein -2.0111 0.2174 -2.3299 0.4323 (Homo sapiens) LibPlateC3_wellB8 No homology found -2.0438 1.5307 -1.3772 0.5537 LibPlateC3_wellC7 [Genbank:AAZ29240] copper/zinc superoxide -4.1699 0.1770 -3.1053 0.0638 dismutase (M. rosenbergii) LibPlateC3_wellD7 [Genbank:AAZ29240] copper/zinc superoxide -2.5487 0.1977 -2.1210 0.4374 dismutase (M. rosenbergii) LibPlateC3_wellE2 [Genbank:XP_624446.2] Predicted similar to -2.4606 1.6665 -1.0115 0.3122 ruby CG11427-PA isoform 2 (Apis mellifera) LibPlateC3_wellE9 [Genbank:AAZ29240] copper/zinc superoxide -3.4248 0.3717 -2.0792 0.2988 dismutase (M. rosenbergii) LibPlateC3_wellF10 [Genbank:AAM93633|AF483711_1] putative -1.3583 0.2449 -3.9731 0.1679 secreted protein (I. scapularis) LibPlateC3_wellF11 [Genbank:AAM93633|AF483711_1] putative -1.0215 0.1441 -2.9246 0.1172 secreted protein (I. scapularis)

001-125 - Dissertatie Ard.pdf 85 21-7-2010 0:13:10 Chapter 3

Table 4 [continued]. I. scapularis differentially expressed genes after subolesin knockdown.

Clone IDa Accession number, name and speciesb Fold SD Fold SD change (6 dpi)d change (9 dpi)d (6 dpi)c (9 dpi)c

LibPlateC3_wellG5 [Genbank:AAM93633|AF483711_1] putative -1.1451 0.2311 - 0.1890 secreted protein (I. scapularis) 3.7711 LibPlateC4_wellB1 No homology found -1.7450 0.6400 - 0.3409 2.2268 LibPlateC4_wellB10 [Genbank:AAQ01562] von Willebrand factor 1.1202 0.3737 - 0.2800 (Ixodes ricinus) 3.9449 LibPlateC4_wellB5 [Genbank:ABD83654] hemelipoglycoprotein -1.9958 0.5689 - 0.6757 precursor (Dermacentor variabilis) 3.5813 LibPlateC4_wellB7 [Genbank:AAP84098] ML domain-containing -1.5703 0.3164 - 0.4105 protein (I. ricinus) 4.5599 LibPlateC4_wellB8 No homology found -2.6551 0.3564 - 0.3325 3.5944 LibPlateC4_wellC1 [Genbank:AAY66502] secreted salivary 1.0009 0.2427 - 0.3518 gland protein (I. scapularis) 2.2922 LibPlateC4_wellC2 No homology found -1.0286 0.0610 - 0.1338 2.0853 LibPlateC4_wellC6 No homology found -1.1217 0.1682 - 0.1235 2.7104 LibPlateC4_wellD3 No homology found 1.6859 0.2075 2.6468 0.1954 LibPlateC4_wellD4 [Genbank:XP_974124] PREDICTED: similar -2.1335 0.2315 - 0.3642 to CG2972-PA (Tribolium castaneum) 2.6578 LibPlateC4_wellF6 [Genbank:BAE53722] aspartic protease -1.4881 0.2385 - 0.3690 (Haemaphysalis longicornis) 4.8576 LibPlateC4_wellG3 [Genbank:AAY66629] putative secreted 1.0601 0.1625 2.0049 0.1481 salivary protein (I. scapularis) LibPlateC4_wellG4 [Genbank:XP_794044] Predicted similar to -2.2835 0.2324 - 0.5510 Endoplasmic reticulum-golgi intermediate 1.7916 LibPlateC4_wellH4 [Genbank:AAY66660] putative salivary se- -1.5502 0.2177 - 0.2056 creted protein (I. scapularis) 5.1239 LibPlateC4_wellH6 [Genbank:AAY66982] cyclophilin A (I. sca- -1.0545 0.0098 2.0388 0.2239 pularis) LibPlateR1_wellG3 No homology found 1.2792 0.2664 2.2118 0.1902 LibPlateR1_wellH7 [Genbank:AAY66764] putative secreted 1.2470 0.0447 - 0.0708 salivary protein (I. scapularis) 2.0598 LibPlateR2_wellB2 [Genbank:AAY66713] putative secreted 1.4186 0.2490 2.2141 0.2145 salivary protein (I. scapularis) LibPlateR2_wellF10 [Genbank:AAK97818|AF209915_1] 16 kDa -1.8100 0.4667 - 0.3690 salivary gland protein A (I. scapularis) 2.4275 LibPlateR2_wellG7 [Genbank:AAY66713] putative secreted 1.4101 0.1056 2.1495 0.1347 salivary protein (I. scapularis) LibPlateR3_wellA7 No homology found -1.0338 0.1570 2.0213 0.1464 LibPlateR4_wellA3 No homology found -1.0990 1.1277 - 1.6338 3.4438

aClone ID identifies the clone based on SSH Library Plate well. bName: This output only contains descriptions of the top blast hit (most significant alignment based on E value). cFold change is of the global normalized ratio (log2(635/532)) of background-corrected means averaged between replicates (determined from valid spots only). Only genes down-regulated (negative values) and up-regulated (positive values) after subolesin knockdown by at least two fold at 6 or 9 dpi were considered. dSD is the standard deviation determined from the normalized average log2 ratio (determined from valid spots only).

001-125 - Dissertatie Ard.pdf 86 21-7-2010 0:13:10 Evidence of the role of tick subolesin in gene expression

Figure 6. Effect of subolesin knockdown on tick gene expression pattern. The expression fold change was determined by microarray hybridization at 6 and 9 days post injection (dpi). Clone ID (SSH library plate and well) are shown and corres- pond to entries in Table 3. The graph was constructed with the HCE software (http://www.cs.umd.edu/hcil/hce/hce3.html).

001-125 - Dissertatie Ard.pdf 87 21-7-2010 0:13:10 Chapter 3

Three of the down-regulated genes after subolesin knockdown, identical to I. scapularis putative secreted salivary WC peptide [Genbank:AAY66498] and putative secreted protein [Genbank:AAM93633] and Macrobrachium rosenbergii copper/zinc superoxide dismutase (Cu-Zn SOD) [Genbank:AAZ29240], were selected to corroborate the results of the microarray analysis by real-time RT-PCR. The results demonstrated that the expression of these genes was silenced after subolesin RNAi by 98% and 100% (for [Genbank:AAM93633]), 41% and 59% (for [Genbank:AAY66498]) and 93% and 74% (for [Genbank:AAZ29240]) at 6 and 9 dpi, respectively. Ticks injected with an unrelated 4A8 dsRNA control did not show silencing of these genes after RNAi. The possibility of subolesin RNAi off-target effects was analyzed and complementary 7 bp regions were not found between all possible 20–22 bp subolesin siRNAs and tick cDNA sequences of differentially expressed genes identified in the microarray analysis. Prediction of subolesin conserved post-translational modifications I. scapularis subolesin [Genbank:AAV67031] and human ortholog C6orf166 [Genbank:NP_060534] proteins were compared to predict conserved post- translational modifications. Three conserved PKC phosphorylation sites were found (Fig. 7), which were also present in all known tick subolesin protein sequences (data not shown).

Figure 7. Prediction of subolesin post-translational modifications. Sequence alignment of I. scapularis subolesin [Genbank:AAV67031] and human ortholog [Genbank:NP_060534] proteins using the one letter amino acid code. Identical amino acids are indicated with asterisks. Three conserved PKC phosphorylation sites were predicted by PIR searching against the PROSITE database.

001-125 - Dissertatie Ard.pdf 88 21-7-2010 0:13:11 Evidence of the role of tick subolesin in gene expression

Discussion

Subolesin, discovered and characterized in I. scapularis as a tick protective antigen [7-9], is an evolutionary conserved protein which is involved in modulation of tick blood digestion, reproduction and development [10-13]. In other organisms, subolesin orthologs may be involved in the control of developmental processes [16-18]. Although the function of subolesin is unknown, these results suggest a conserved function for subolesin. Because of the profound effect of subolesin knockdown in ticks and other organisms [10-13, 18], our hypothesis was that subolesin may have a role in gene expression, thus affecting multiple cellular processes. Therefore, the objective of this study was to provide evidence of the role of subolesin in gene expression. To test this hypothesis, three experiments were conducted. In the first series of experiments, subolesin-interacting proteins were identified and characterized in R. microplus, suggesting the interaction of subolesin with regulatory proteins. Therefore, in the second series of experiments, the effect of subolesin knockdown was analyzed in I. scapularis and showed the effect of subolesin on gene expression affecting different biological processes. Finally, post-translational modifications were predicted for tick subolesin. All together, the results of these experiments suggested a role for tick subolesin in gene expression.

To identify proteins that interact with subolesin in yeast two-hybrid experiments, we used a cDNA library obtained from tick eggs because subolesin is expressed in tick embryos and gene knockdown affects egg development [7, 13]. Two genes, GI and GII, were identified encoding for proteins that interact with tick subolesin. These proteins contained domains and post-translational modification sites found in proteins with regulatory functions. The transduction/transcription domain found in GI is present in phosphorylated proteins involved in transcriptional regulation and other cell functions related to gene expression [28, 29]. The EF1_alpha_II and EF1_alpha_III domains present in GII are found in proteins with different functions such as protein biosynthesis, DNA binding, transcriptional regulation, RNA processing, structural constituent of cytoskeleton as well as ATP and GTP binding that are also involved in gene expression (see for example proteins with accession numbers [Genbank:EAY95388, Genbank:XP_657651, Genbank:XP_404184, Genbank:XP_312333, Genbank:XP_001651261]).

001-125 - Dissertatie Ard.pdf 89 21-7-2010 0:13:11 Chapter 3

The results reported herein suggested that subolesin may interact with regulatory proteins. In other organisms, subolesin orthologs interact with proteins with gene expression regulatory activities. The human subolesin ortholog interacts with LNXp80 [Genbank:AK056823], DIPA [Genbank:NM_006848] and SPG21 [Genbank:NM_016630] proteins. LNX is an E3 ubiquitin-protein ligase that me- diates ubiquitination and subsequent proteasomal degradation of Numb, implicated in the control of cell fate decisions during development. DIPA interacts with the viral phosphoprotein hepatitis delta antigen (HDAG) and acts as a repressor of gene transcription [30]. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation [31]. In D. melanogaster, the subolesin ortholog bhringi (bhr; CG8580) may act to regulate Twist activity through recruitment of the chromatin remodeling Brahma complex [16]. Therefore, subolesin may exert its effect on gene expression through the interaction with GI, GII and possibly other regulatory proteins. Interestingly, the GII knockdown phenotype was similar to that obtained with subolesin, suggesting that these proteins may functionally interact in ticks.

The results of the microarray analysis of gene expression profile in ticks after subolesin knockdown provided evidence for the role for subolesin in gene expression. Subolesin knockdown affected the expression of genes involved in multiple cellular pathways. The nonspecific effect of dsRNA injection on tick global gene expression was not addressed in these studies. However, the injection of an unrelated dsRNA did not affect the expression of selected genes differentially expressed after subolesin knockdown. Although we cannot rule out off-target effects of subolesin RNAi in ticks, evidence suggested that this was not a likely possibility to explain the effect of subolesin knockdown on tick gene expression pattern. Firstly, we did not find complementary sequences between subolesin and identified differentially expressed genes that could support off-target effects of subolesin RNAi. To search for complementary sequences between subolesin and identified differentially expressed genes, we used the approach proposed by Birming- ham et al. [24] who showed that although maximum complementarity by itself is an unsatisfactory predictor of off-target RNAi effects, a highly significant associa- tion exists between off-targeting and exact complementarity between the seed region (bases 2–8) of siRNA and their off-targeted gene 3' untranslated region (UTR). Secondly, the analysis of D. melanogaster subolesin ortholog RNAi off- target effects demonstrated the presence of a single off-targeted gene [32], suggesting that off-target effects of subolesin RNAi may also be minimal in ticks.

001-125 - Dissertatie Ard.pdf 90 21-7-2010 0:13:11 Evidence of the role of tick subolesin in gene expression

A common characteristic of many regulatory protein sequences is the presence of phosphorylation sites. Although we did not demonstrate phosphorylation of tick subolesin, there is evidence that the human ortholog protein undergoes phosphorylation at serine 21 (AS*PKRRR) [33], a PKC phosphorylation site that is conserved in tick sequences. Therefore, as with other regulatory proteins, subolesin may be regulated by reversible phosphorylation by PKC.

Figure 8. The regulatory function of subolesin on gene expression may be exerted through interactions with regulatory proteins that act at the transcriptional and/or translational levels. Tick subolesin interacts with GI and GII proteins with putative regulatory functions on gene expression. Other hypothetical interactions with regulatory proteins may exist based on data for the human ortholog. The search for human ortholog (C6orf166; [Genbank:NP_060534]) protein-protein interactions was done by STRING.

001-125 - Dissertatie Ard.pdf 91 21-7-2010 0:13:11 Chapter 3

Conclusion

In summary, the results presented herein provide evidence that support a role for subolesin in gene expression in ticks and other organisms. The regulatory function of subolesin in gene expression may be exerted through interaction with other regulatory proteins at the transcriptional level (Fig. 8). In fact, a recent publication by Goto et al. [34] that appeared after submission of our work renamed subolesin orthologs in insects and vertebrates as Akirins and proposed that they constitute transcription factors required for NF-kB-dependent gene expression in Drosophila and mice. Alternatively, subolesin may also interact with proteins involved in translational control in ticks (Fig. 8). The experimental approach used in this study may be important for the annotation of tick sequences that result from genome sequencing efforts [35] and for the characterization of candidate tick protective antigens for the development of vaccines for the control of tick infestations and the transmission of tick-borne pathogens [3].

Authors' contributions

JdlF conceived and coordinated the study, participated in its design and helped to draft the manuscript. CM-O carried out two hybrid screening. VN, PA, AMN, CA, JMPdlL, RCG, EFB and KMK carried out RNAi, microarray analysis and real-time RT-PCR experiments. MC carried out confirmation of protein-protein interactions. PA and JdlF carried out computational analyses. KMK, FJ, CG, PA and CM-O participated in study design and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank A. Taoufik (UCTD) for technical assistance. This research was supported by the Oklahoma Agricultural Experiment Station (project 1669), the Wal- ter R. Sitlington Endowed Chair for Food Animal Research (K. M. Kocan, Okla- homa State University), Pfizer Animal Health, Kalamazoo, MI, USA, the Junta de Comunidades de Castilla-La Mancha, Spain (project 06036-00 ICS-JCCM), and the Wellcome Trust under the "Animal Health in the Developing World" initiative (project 075799). V. Naranjo was founded by Consejería de Educación, JCCM, Spain. R.C. Galindo was funded by Ministerio de Educación y Ciencia, Spain.

001-125 - Dissertatie Ard.pdf 92 21-7-2010 0:13:11 Evidence of the role of tick subolesin in gene expression

References

1. Parola P, Raoult D: Tick-borne bacterial diseases emerging in Europe. Clin Microbiol Infect 2001, 7(2):80-83. 2. Barker SC, Murrell A: Systematics and evolution of ticks with a list of valid genus and species names. Parasitology 2004, 129 Suppl:S15-36. 3. de la Fuente J, Kocan KM: Strategies for development of vaccines for control of ixodid tick species. Parasite Immunol 2006, 28(7):275-283. 4. Willadsen P: Tick control: thoughts on a research agenda. Vet Parasitol 2006, 138(1-2):161-168. 5. de la Fuente J, Almazan C, Canales M, Perez de la Lastra JM, Kocan KM, Willadsen P: A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 2007, 8(1):23-28. 6. de la Fuente J, Blouin EF, Manzano-Roman R, Naranjo V, Almazan C, Perez de la Lastra JM, Zivkovic Z, Jongejan F, Kocan KM: Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics 2007, 90(6):712-722. 7. Almazan C, Blas-Machado U, Kocan KM, Yoshioka JH, Blouin EF, Man- gold AJ, de la Fuente J: Characterization of three Ixodes scapularis cDNAs protective against tick infestations. Vaccine 2005, 23(35):4403- 4416. 8. Almazan C, Kocan KM, Bergman DK, Garcia-Garcia JC, Blouin EF, de la Fuente J: Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine 2003, 21(13-14):1492-1501. 9. Almazan C, Kocan KM, Blouin EF, de la Fuente J: Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine 2005, 23(46-47):5294-5298. 10. de la Fuente J, Almazan C, Blas-Machado U, Naranjo V, Mangold AJ, Blouin EF, Gortazar C, Kocan KM: The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine 2006, 24(19):4082-4095. 11. de la Fuente J, Almazan C, Naranjo V, Blouin EF, Meyer JM, Kocan KM: Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem Biophys Res Commun 2006, 344(1):332-338. 12. Kocan KM, Manzano-Roman R, de la Fuente J: Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of

001-125 - Dissertatie Ard.pdf 93 21-7-2010 0:13:11 Chapter 3

replete females with subolesin dsRNA. Parasitol Res 2007, 100(6):1411- 1415. 13. Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F: Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int J Parasitol 2007, 37(6):653-662. 14. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol Res 2006. 15. de la Fuente J, Kocan KM, Almazan C, Blouin EF: RNA interference for the study and genetic manipulation of ticks. Trends Parasitol 2007, 23(9):427-433. 16. Gonzalez K, Baylies M: Bhringi: a novel twist co-regulator. In: Annual Drosophila Research Conference 2005: Genetics Society Of America, San Diego, California; 2005: 320B. 17. Pena-Rangel MT, Rodriguez I, Riesgo-Escovar JR: A misexpression study examining dorsal thorax formation in Drosophila melanogaster. Genetics 2002, 160(3):1035-1050. 18. Maeda I, Kohara Y, Yamamoto M, Sugimoto A: Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr Biol 2001, 11(3):171-176. 19. Naranjo V, Hofle U, Vicente J, Martin MP, Ruiz-Fons F, Gortazar C, Ko- can KM, de la Fuente J: Genes differentially expressed in oropharyn- geal tonsils and mandibular lymph nodes of tuberculous and nontu- berculous European wild boars naturally exposed to Mycobacterium bovis. FEMS Immunol Med Microbiol 2006, 46(2):298-312. 20. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: RNA interference screening in ticks for identification of protective antigens. Parasitol Res 2005, 96(3):137-141. 21. Bechara GH, Szabo MP, Machado RZ, Rocha UF: A technique for col- lecting saliva from the cattle-tick Boophilus microplus (Canestrini, 1887) using chemical stimulation. Environmental and temporal influ- ences on secretion yield. Braz J Med Biol Res 1988, 21(3):479-484. 22. Geer LY, Domrachev M, Lipman DJ, Bryant SH: CDART: protein homology by domain architecture. Genome Res 2002, 12(10):1619-1623. 23. Estrada-Pena A, Bouattour A, Camicas JL, Guglielmone A, Horak I, Jon- gejan F, Latif A, Pegram R, Walker AR: The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodi-

001-125 - Dissertatie Ard.pdf 94 21-7-2010 0:13:11 Evidence of the role of tick subolesin in gene expression

dae) in Africa and Latin America. Exp Appl Acarol 2006, 38(2-3):219- 235. 24. Birmingham A, Anderson EM, Reynolds A, Ilsley-Tyree D, Leake D, Fe- dorov Y, Baskerville S, Maksimova E, Robinson K, Karpilow J et al: 3' UTR seed matches, but not overall identity, are associated with RNAi off-targets. Nat Methods 2006, 3(3):199-204. 25. Protein Information Resource 26. Grabarek JB, Plusa B, Glover DM, Zernicka-Goetz M: Efficient delivery of dsRNA into zona-enclosed mouse oocytes and preimplantation embryos by electroporation. Genesis 2002, 32(4):269-276. 27. von Mering C, Jensen LJ, Kuhn M, Chaffron S, Doerks T, Kruger B, Snel B, Bork P: STRING 7--recent developments in the integration and prediction of protein interactions. Nucleic Acids Res 2007, 35(Database issue):D358-362. 28. Beausoleil SA, Jedrychowski M, Schwartz D, Elias JE, Villen J, Li J, Cohn MA, Cantley LC, Gygi SP: Large-scale characterization of HeLa cell nuclear phosphoproteins. Proc Natl Acad Sci U S A 2004, 101(33):12130-12135. 29. Brand M, Yamamoto K, Staub A, Tora L: Identification of TATA- binding protein-free TAFII-containing complex subunits suggests a role in nucleosome acetylation and signal transduction. J Biol Chem 1999, 274(26):18285-18289. 30. Du X, Wang Q, Hirohashi Y, Greene MI: DIPA, which can localize to the centrosome, associates with p78/MCRS1/MSP58 and acts as a repressor of gene transcription. Exp Mol Pathol 2006, 81(3):184-190. 31. Zeitlmann L, Sirim P, Kremmer E, Kolanus W: Cloning of ACP33 as a novel intracellular ligand of CD4. J Biol Chem 2001, 276(12):9123- 9132. 32. Dietzl G, Chen D, Schnorrer F, Su KC, Barinova Y, Fellner M, Gasser B, Kinsey K, Oppel S, Scheiblauer S et al: A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 2007, 448(7150):151-156. 33. Olsen JV, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M: Global, in vivo, and site-specific phosphorylation dynamics in sig- naling networks. Cell 2006, 127(3):635-648. 34. Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Ta- keuchi O, Hoffmann JA, Akira S, Boutros M, Reichhart JM: Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent

001-125 - Dissertatie Ard.pdf 95 21-7-2010 0:13:11 Chapter 3

gene expression in Drosophila and mice. Nat Immunol 2008, 9(1):97- 104. 35. Jongejan F, Nene V, de la Fuente J, Pain A, Willadsen P: Advances in the genomics of ticks and tick-borne pathogens. Trends Parasitol 2007, 23(9):391-396.

001-125 - Dissertatie Ard.pdf 96 21-7-2010 0:13:11

SELECTION OF REFERENCE GENES FOR QUANTITATIVE RT-PCR STUDIES IN RHIPICEPHALUS (BOOPHILUS) MICROPLUS AND RHIPICEPHALUS APPENDICULATUS TICKS AND DETERMINATION OF THE EXPRESSION PROFILE OF BM86

NIJHOF AM, BALK JA, POSTIGO M, JONGEJAN F

BMC MOLECULAR BIOLOGY 2009; 10:112

8 PhD thesis Nijhof - Title page chapter 4.pdf 1 26-7-2010 22:53:50 001-125 - Dissertatie Ard.pdf 98 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Abstract

For accurate and reliable gene expression analysis, normalization of gene expression data against reference genes is essential. In most studies on ticks where (semi-)quantitative RT-PCR is employed, normalization occurs with a single reference gene, usually β-actin, without validation of its presumed expression stability. The first goal of this study was to evaluate the expression stability of commonly used reference genes in Rhipicephalus appendiculatus and Rhipicephalus (Boophilus) microplus ticks. To demonstrate the usefulness of these results, an unresolved issue in tick vaccine development was examined. Commercial vaccines against R. microplus were developed based on the recombinant antigen Bm86, but despite a high degree of sequence homology, these vaccines are not effective against R. appendiculatus. In fact, Bm86-based vaccines give better protection against some tick species with lower Bm86 sequence homology. One possible explanation is the variation in Bm86 expression levels between R. microplus and R. appendiculatus. The most stable reference genes were therefore used for normalization of the Bm86 expression profile in all life stages of both species to examine whether antigen abundance plays a role in Bm86 vaccine susceptibility. The transcription levels of nine potential reference genes: β-actin (ACTB), β- tubulin (BTUB), elongation factor 1α (ELF1A), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glutathione S-transferase (GST), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TATA box binding protein (TBP) were measured in all life stages of R. microplus and R. appendiculatus. ELF1A was found to be the most stable expressed gene in both species following analysis by both geNorm and Normfinder software applications, GST showed the least stability. The expression profile of Bm86 in R. appendiculatus and R. microplus revealed a more continuous Bm86 antigen abundance in R. microplus throughout its one-host life cycle compared to the three-host tick R. appendiculatus where large variations were observed between different life stages. Based on these results, ELF1A can be proposed as an initial reference gene for normalization of quantitative RT-PCR data in whole R. microplus and R. appendiculatus ticks. The observed differences in Bm86 expression profile between the two species alone can not adequately explain the lack of a Bm86 vaccination effect in R. appendiculatus.

001-125 - Dissertatie Ard.pdf 99 21-7-2010 0:13:11 Chapter 4

Introduction

The ixodid ticks Rhipicephalus appendiculatus and Rhipicephalus (Boophilus) microplus are important pests of livestock. Besides causing direct production losses and leather damage due to their blood-feeding habit, both ticks are able to transmit a wide variety of pathogens. Both tick species overlap in their distribution, but R. microplus is more widespread and occurs in subtropical and tropical areas of the world whereas the distribution of R. appendiculatus, also known as the brown ear tick, is limited to areas with a humid climate from southern Sudan to the southeastern coast of South Africa. Their life cycle differs quite dramatical- ly too: R. microplus is a one-host tick species with all life stages feeding on the same, usually bovine, host whereas R. appendiculatus is a three-host tick species with each life stage requiring a new host to feed on. As a consequence of this, R. microplus can complete its life cycle in less than 2 months, whereas R. appendiculatus takes about 3 months to complete its life cycle under the most favorable conditions [1]. Control of ticks worldwide relies principally on the use of acaricides, but two vaccines targeting R. microplus were commercialized in the 1990s: TickGARD Plus® in Australia and Gavac® in Cuba. Both are based on the same recombinant antigen named Bm86, a glycoprotein of unknown function which is located predominantly on the surface of midgut digest cells [2]. Although Bm86- based vaccines showed cross-protection against various other tick species, e.g. Rhipicephalus (Boophilus) annulatus [3], Rhipicephalus (Boophilus) decoloratus, Hyalomma anatolicum and Hyalomma dromedarii [4], they were not effective against Amblyomma variegatum and R. appendiculatus [4, 5].

Due to the veterinary and economical importance of R. microplus and R. appendiculatus in subtropical and tropical areas of the world, expressed sequence tag (EST) datasets for these tick species have been established [6-8]. The availability of these data greatly facilitates research in tick biology and tick-host-pathogen interactions. Microarrays and quantitative RT-PCR are two important techniques measuring gene expression which may help in unraveling such interactions and provide insight into the complex regulatory networks behind biological processes. Output data require normalization to control for variables such as the intrinsic variability of RNA, impurities during RNA extraction, reverse transcription and PCR efficiencies [9]. A frequently used method for the accurate normalization of quantitative RT-PCR data involves the measurement of internal reference genes (also referred to as housekeeping genes). Such genes should ideally have a stable expression independent of cell or tissue type, or experimental condition. A survey of 20 papers using quantitative RT-PCR in tick research published between 2004

100

001-125 - Dissertatie Ard.pdf 100 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

and 2008 shows β-actin as the most popular reference gene used for normalization in 19 publications, with the one remaining article employing the 18S rRNA gene. However, the presumed expression stability of these genes in ticks has never been examined and the use of a single reference gene may lead to erroneous normalization [10]. In this study, the mRNA transcript levels of nine commonly used reference genes from different functional classes: β-actin (ACTB), β-tubulin (BTUB), elongation factor 1α (ELF1A), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glutathione S-transferase (GST), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TATA box binding protein (TBP) were measured by quantitative RT-PCR in all life stages of whole R. microplus and R. appendiculatus ticks. The results were evaluated using geNorm [10] and Normfinder [11]. Although both programs have the same aim of identifying the most stably expressed reference genes, they make use of different strategies. geNorm is a software application which determines the expression stability of reference genes by calculating a gene-stability measure (M) for each gene. This measure relies on the principle that the expression ratio of two ideal reference genes is identical in all samples, regardless of the experimental condition or cell type. Pairwise variation for each combination of reference genes is determined and assigned a value for M, and genes with the highest M value (i.e. least stable expression) are progressively eliminated until the two most stably expressed genes remain. It thus ranks the reference genes according to the similarity in expression profiles across the samples [10]. Incorporation of co-regulated reference genes will affect the outcome of this approach and care must therefore be taken in selecting candidate reference genes from different functional classes. Normfinder is an application on a model-based approach which ranks the reference genes according to the estimated intra- and intergroup expression variation. Normalization with the six most stable expressed reference genes of the Bm86 mRNA transcript levels in all life stages of R. microplus and R. appendiculatus was carried out with the aim to elucidate the role of antigen abundance in Bm86 vaccine susceptibility.

101

001-125 - Dissertatie Ard.pdf 101 21-7-2010 0:13:11 Chapter 4

Material and Methods

Experimental animals One Holstein-Friesian calf 6 months of age (#1471) was used. The animal had no previous exposure to ticks. All tick feedings were approved by the Animal Expe- riments Committee (DEC) of the Faculty of Veterinary Medicine, Utrecht Univer- sity (DEC No. 0111.0807).

RNA isolation from bovine blood Total RNA was isolated from 2 ml blood from calf #1471 prior to the tick feedings using the RNeasy mini kit (Qiagen, Venlo, the Netherlands) according to the manufacturer's protocol.

Ticks and tick feeding R. microplus ticks originating from Mozambique were provided by ClinVet Inter- national (Pty), Bloemfontein, South Africa and R. appendiculatus ticks originating from South Africa were provided by the Onderstepoort Veterinary Institute, On- derstepoort, South Africa. Both species were subsequently maintained on experimental animals at the tick rearing facility of the Utrecht Centre for Tick-borne Diseases (UCTD) for several generations. Free-living stages were kept at 20°C at 95% relative humidity. Ticks from all life stages of R. appendiculatus and unfed larvae of R. microplus were available at the start of the experiment. Circular patches used for tick feeding with an inner diameter of 120 mm and sewn to an open cotton bag were glued to the shaved back of the calf using Pattex® contact glue (Henkel Nederland, Nieuwegein, the Netherlands). The scheme shown in Table 1 was used for tick feedings. This schedule allowed for the synchronous feeding of all life stages from both tick species in separate patches on the same animal, minimizing possible variations in tick gene expression due to external (e.g. host or environmental) factors.

RNA isolation For the isolation of total RNA from eggs and unfed larvae, triplicate pools of 100 mg eggs or larvae were homogenized in 1 ml TRIzol reagent using a Potter- Elvejhem glass/Teflon homogenizer. Other whole tick samples were homogenized in 1 ml TRIzol reagent using an ultra-turrax homogenizer (IKA werke GmbH & Co., Staufen, Germany), again in triplicate. All samples were further homogenized by passage through 24- and 27-gauge needles and centrifuged at 12,000 g at 4°C for 10 min to remove insoluble material after which and the supernatant was frozen at -80°C until RNA extraction. Total RNA was isolated and treated with

102

001-125 - Dissertatie Ard.pdf 102 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

DNase I (Fermentas GmbH, St. Leon Rot, Germany) prior to purification using the Nucleospin RNA II kit (Machery-Nagel, Düren, Germany), all in accordance with the manufacturer's protocols. Sample concentrations and purity were determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) at 260 nm (A260) wavelength. Only samples with A260/A280 and A260/A230 ratios between 1.8 and 2.2 were included in subsequent analyses. Lack of genomic DNA contamination was confirmed by PCR amplification of RNA samples followed by electrophoresis on a 1% agarose gel.

Table 4. Schedule of tick feeding employed for the synchronous feeding of all life stages from both R. microplus and R. appendiculatus on calf 1471.

Action Species Time point (days)

Collection of eggs R. microplus 4, 10, 15, 20, 22 and 24 days post- oviposition R. appendiculatus 20 days post-oviposition Collection of unfed larvae R. microplus & 21 days post-hatching (45 days post- R. appendiculatus oviposition) Placement of unfed larvae R. microplus & 0 R. appendiculatus Collection of partially fed R. microplus & 4 larvae R. appendiculatus Collection of pharate R. microplus 6 nymphs R. appendiculatus 7 days post-engorgement Collection of unfed R. microplus 7 nymphs R. appendiculatus 21 days post-molting Placement of unfed R. appendiculatus 7 nymphs Collection of partially fed R. microplus & 11 nymphs R. appendiculatus Collection of pharate adults R. microplus 13 R. appendiculatus 7 days post engorgement Collection of unfed males R. microplus 14 R. appendiculatus 21 days post-molting Collection of unfed females R. microplus 15 R. appendiculatus 21 days post-molting Placement of unfed adults R. appendiculatus 15 Collection of partially fed R. microplus & 22 adults R. appendiculatus

Rapid amplification of 3'cDNA ends (3'-RACE), cloning and sequencing of the Bm86 and Ra86 gene 1 thousand ng of total RNA isolated from the midguts of partially fed R. microplus (Mozambique) and R. appendiculatus (South Africa) females was used to

103

001-125 - Dissertatie Ard.pdf 103 21-7-2010 0:13:11 Chapter 4

synthesize first-strand cDNA using SuperScript III (Invitrogen) following the manufacturer's instruction using a 3'-RACE anchor primer containing a poly-T sequence [5'-GCTATCATTACCACAACACTCT(18)(AGC)(AGCT)-3']. The Bm86 orthologues were subsequently PCR amplified from this cDNA using degenerate primer Ra86-F [5'-TCATC(CT)(AG)T(CT)TGCTCTGACTTCGG-3'] and a 3'-RACE anchor primer [5'-GCTATCATTACCACAACACTC-3']. The resulting PCR products were purified using the Nucleospin Extract kit (Machery- Nagel), cloned into the pGem-T easy vector (Promega) and five clones of each product were sequenced by Baseclear, Leiden, the Netherlands. Quantitative RT- PCR primers amplifying both Bm86 and Ra86 were designed and synthesized as described above, based upon the available sequences (Table 2). The sequences of Ra86-1, Ra86-2 (South Africa) and Bm86 (Mozambique) have been submitted to GenBank and can be retrieved under accession numbers FJ809944, FJ809945 and FJ809946 respectively. N-glycosylation and O-glycosylation of the deduced Ra86 protein sequence was predicted by the NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/) and NetOGlyc 3.1 (http://www.cbs.dtu.dk/services/NetOGlyc/) servers of the Center for Biological Sequence Analysis (CBS), Technical University of Denmark. Potential GPI- anchor sites were predicted using the online big-PI predictor tool [12] (http://mendel.imp.ac.at/gpi/gpi_server.html).

Identification of reference genes Protein sequences from a number of potential candidate reference genes from Drosophila melanogaster or Ceanorhabditis elegans were used for a tblastn search among the nr and the expressed sequence tag (EST) databases of R. microplus and R. appendiculatus. The sequences which were found for beta-actin (ACTB), β-tubulin (BTUB), elongation factor 1α (ELF1A), glyceraldehyde 3- phosphate dehydrogenase (GAPDH), glutathione S-transferase (GST), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TATA box binding protein (TBP) were subsequently aligned using ClustalW (http://www.ebi.ac.uk/clustalw/), generated in BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Non-degenerate primers were designed using the NetPrimer software application (http://www.premierbiosoft.com/netprimer/) and synthesized by Isogen Life Science, IJsselstein, the Netherlands. Accession numbers and main function of each evaluated reference gene are shown in Table 2.

104

001-125 - Dissertatie Ard.pdf 104 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Table 2. Details of the quantitative RT-PCRs of Bm86 and the candidate reference genes evaluated in this study.

a 98 97 92 91 95 98 98 Ra 103 100 100

Efficiency Rm 102 103 92 100 97 93 92 95 93 94

Amplicon length

139 bp 101 bp 140 bp 108 bp 123 bp 98 bp 152 bp 133 bp 152 bp 122 bp

Reverse primer Reverse

CGCACGATTTCACGCTCAG AGGAGCGGCTGAACAGTTTG GCAGCCATCATGTTCTTTGC CTCAGTGGTCAGGTTGGCAG GTGTGGTTCACACCCATCACAA AGAGCCCAGAGCAGGTCGTTG GTAACGACGGATCTCCCTGAG ATGAAGTTGGGGATGACGC GTTCCTCATCTTTCCCTTGCC GTGAGCACGACTTTTCCAGATAC

ACGG TTGAGC CACG

Forward primer Forward

CCCATCTACGAAGGTTACGCC CGTCCCGACTTGACCTGC AACATGGTGCCCTTCC CGTCTACAAGATTGGTGGCATT AGTCCACCGGCGTCTTCCTCA TACCTGGGCAAGAAGC AAGCAGACCGCCCGTAAGT CTGGGACGGATAGTAA AGGTTCCCCTGGTGGTGAG CTTGTCCTCACACACAGCCAGTT

a Ra AY254899 FJ809944 CD781348 CD797149 CD791831 CD789942 CD795637 CD793819 CD794864 CD780134

a GenBank accession number Rm AY255624 FJ809946 CK179480 EW679365 CK180824 CV456312 CV442167 CV445080 CV447629 CV453818

s Function

Cytoskeletal Cytoskeletal structural protein Unknown Component of microtubules Component of the eukaryotic gluconeogenesis Detoxification of endobiotic and xenobiotic substrates Involved in structure of chromatin component of the large 60S ribosomal subunit Transcription factor translational apparatus in Oxireductase glycolysis and Facilitate folding protein Structural -

alpha -

phosphate - Gene name

Beta actin Bm86 tubulin Beta Elongation factor 1 Glyceraldehyde 3 dehydrogenase S Glutathione transferase H3 Histone 3A family Cyclophilin Ribosomal protein L4 TATA box binding protein

Rm, R. microplus; Ra, R. appendiculatu R. Ra, R. microplus; Rm, Symbol

ACTB Bm86 BTUB ELF1A GAPDH GST H3F3A PPIA RPL4 TBP a

105

001-125 - Dissertatie Ard.pdf 105 21-7-2010 0:13:11 Chapter 4

Gene expression analysis cDNA was synthesized from 500 ng of DNA-free RNA isolated from bovine blood and all consecutive life stages of R. microplus and R. appendiculatus: eggs, unfed larvae, feeding larvae, pharate nymphs, unfed nymphs, feeding nymphs, pharate adults, unfed males/females and feeding males/females using the iScript cDNA synthesis kit (Bio-Rad, Veenendaal, the Netherlands) according to the manufacturer's directions and stored at -20°C until use in quantitative RT-PCR. A quantitative RT-PCR assay using SYBR® green detection was designed and optimized for the transcription profiling of nine commonly used reference genes (Ta- ble 1). Real-time analysis was carried out on an iCycler thermal cycler (Bio-Rad). RT-PCR amplification mixtures (25 μl) contained cDNA generated from 5 ng of RNA template, 12.5 μl iQ SYBR green Supermix (Bio-Rad) and 400 nM forward and reverse primer. The cycling conditions comprised a 5 min denaturation and polymerase activation step at 95°C, 40 cycles of 95°C for 10 s, 60°C for 30 s and 72°C for 30 s. Upon completion of the amplification program, a dissociation analysis (52°C-95°C) was performed to determine the purity of the PCR amplicons. To estimate amplification efficiencies, a standard curve was generated for each primer pair based on known quantities of cDNA for both R. microplus and R. appendiculatus (10-fold serial dilutions corresponding to cDNA transcribed from 50 ng to 0.05 ng of total RNA in triplicate) and analyzed using the iQ 5 software (Bio-Rad). All assays included this standard curve, a no-template control and each of the test cDNAs. Primers, amplicon lengths and PCR efficiencies are indicated in Table 2. Raw Ct values were transformed to quantities using the comparative Ct method and specific PCR efficiencies. These quantities were converted to an input file format suitable for subsequent analysis by the geNorm or Normfinder Excel applications which were downloaded from (http://medgen.ugent.be/~jvdesomp/genorm/) and (http://www.mdl.dk/publicationsnormfinder.htm) respectively. Only the egg samples collected at day 20 from R. appendiculatus and R. microplus were included in the selection of reference genes using geNorm and Normfinder. The Bm86 expression was measured on the same cDNA samples as used for the reference gene analysis but included additional R. microplus egg samples collected at days 4, 10, 15, 22 and 24 post oviposition. The Bm86 expression levels were normalized using the geometric mean of selected reference gene quantities in Microsoft Excel following the guidelines described in the geNorm manual [12] and the 95% confidence interval was calculated. Differential gene expression was considered significant when the 95% confidence interval of the mean normalized expression levels did not overlap (equivalent to P < 0.05).

106

001-125 - Dissertatie Ard.pdf 106 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Protein isolation and Western Blot Midguts from partially fed females were dissected in a drop of ice-cold phosphate buffered saline (PBS) using a sterile scalpel and watchmaker forceps under a stereo microscope. The midguts of three females from each species were pooled in a tube with 1 ml washing buffer [10 mM Tris, pH 7.4; 10 mM NaCl; 1 × complete mini protease inhibitor cocktail (Roche Applied Science, Almere, the Nether- lands)] and homogenized by passing the tissues through a 22G needle coupled to a 2 ml syringe followed by a similar passage using a 27G needle. The homogenized samples were then centrifuged at 4°C for 30 min at 15,000 g, followed by a similar second wash. The final pellet was resuspended in 200 μl of a sample buffer [62,5 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 1 × complete mini protease inhibitor (Roche Applied Science)] and boiled at 100°C for 5 min. The suspension was centrifuged as described above and the protein concentration of the supernatant was measured using a Pierce BCA protein assay kit (Thermo Fisher Scientific, Etten-Leur, the Netherlands) and the Nanodrop ND-1000 spectrophotometer. Five μg of midgut proteins were separated on a 10% SDS-PAGE gel and transferred electrophoretically onto Hybond C nitrocellulose membranes (GE Healthcare, Diegem, Belgium). The membranes were blocked overnight at 4°C with 2% fish gelatin (Sigma-Aldrich, Zwijndrecht, the Netherlands) in Tris-buffered saline Tween 20 buffer (TBST; 20 mM Tris HCl, 0.9% NaCl and 0.05% Tween 20) and washed at room temperature (RT) for 3 × 5 min in TBST buffer. The membranes were subsequently incubated with ovine Bm86 or control antisera diluted 1:2500 in TBST buffer for 1 h at RT followed by 3 × 5 min washing with TBST. Incuba- tion with secondary rabbit antiserum to sheep IgG conjugated with horseradish peroxidase (Nordic Immunology, Tilburg, the Netherlands) diluted 1: 25000 for 1 h at RT followed by a third washing step with TBST for 3 × 12 min at RT was done prior to 2 min incubation with ECL detection reagent (GE Healthcare) and exposure to Hyperfilm ECL (GE Healthcare).

Results

Quantitative RT-PCR The efficiencies of the quantitative RT-PCR's were uniformly high and ranged from 91% to 103%, making all assays suitable for quantitative analysis (Table 2). All PCR's generated a single band and the absence of primer dimer formation was confirmed by a dissociation assay performed with each assay (results not shown). None of the primer combinations amplified cDNA synthesized from bovine blood RNA, which excludes interference with the PCR results caused by the possible presence of host RNA in fed ticks. Raw Ct values ranged from 14.8 (ACTB) to

107

001-125 - Dissertatie Ard.pdf 107 21-7-2010 0:13:11 Chapter 4

31.0 (GST) in R. microplus and from 11.8 (ACTB) to 34.3 (GST) in R. appendiculatus (Table 3, Fig. 1 & 2). GAPDH, GST and TBP were expressed at low levels in both tick species with median Ct values above 22 cycles. The smallest Ct variation between all samples of R. microplus was exhibited by TBP (2.27) and by GAPDH (3.42) in R. appendiculatus. GST showed the most variable expression between all samples for both tick species; 10.77 in R. microplus and 13.41 in R. appendiculatus.

Table 3. Cycle threshold (Ct) values of candidate reference genes and Bm86.

Gene Ct Range Ct Min. Ct Max mean Ct ± s.e.m. Rma Raa Rma Raa Rma Raa Rma Raa ACTB 5.62 5.92 14.85 11.80 20.47 17.72 16.48 ± 0.25 15.59 ± 0.24 BTUB 4.01 4.74 19.57 19.22 23.58 23.96 21.00 ± 0.16 21.76 ± 0.24 ELF1A 2.36 3.90 16.36 15.34 18.72 19.24 17.29 ± 0.12 17.01 ± 0.17 GAPDH 4.39 3.47 21.67 20.56 26.06 24.04 23.02 ± 0.20 22.29 ± 0.17 GST 10.77 13.41 20.28 20.90 31.05 34.31 24.27 ± 0.51 27.22 ± 0.67 H3F3A 4.03 4.69 16.35 17.68 20.39 22.36 18.74 ± 0.15 19.90 ± 0.20 PPIA 4.38 3.90 17.92 17.98 22.30 21.88 19.31 ± 0.20 19.91 ± 0.20 RPL4 3.09 3.83 17.68 17.39 20.77 21.22 18.82 ± 0.12 18.87 ± 0.15 TBP 2.27 4.28 25.74 25.70 28.01 29.98 27.01 ± 0.09 26.99 ± 0.20 Bm86 10.38 7.56 21.28 19.86 31.66 27.42 24.05 ± 0.40 22.85 ± 0.44 aRm, R. microplus; Ra, R. appendiculatus

geNorm and Normfinder analysis The gene expression stability of nine candidate reference genes over the life cycle of R. microplus and R. appendiculatus was analyzed using the geNorm and Norm- finder software applications (Table 4). The geNorm approach identified ELF1A and RPL4 as the best pair of reference genes over the life cycle of both R. microplus and R. appendiculatus, as well as in a combined analysis of all samples from both species. Normfinder ranked these genes as second and third best in R. microplus and R. appendiculatus with TBP and GAPDH being indicated as the best reference gene, respectively. A combined analysis of both species by Normfinder ranked ELF1A as best reference gene followed by GAPDH, TBP, PPIA, RPL4, H3F3A, BTUB, ACTB and GST. GST and ACTB were identified as the least stable genes in all groups by both methods.

108

001-125 - Dissertatie Ard.pdf 108 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Figure 1. Bm86 and control gene expression during all life stages of R. microplus. Ct values represent mean +/- SEM from three biological replicates. The Ct values of samples from adult females are indicated with an open symbol, Ct values from adult males with a closed symbol. Note that the y-axis differs in the two panels: highly expressed genes are shown in the top panel, moderately expressed genes in the bottom panel.

Figure 2. Ra86 and control gene expression during all life stages of R. appendiculatus. Ct values represent mean +/- SEM from three biological replicates. The Ct values of samples from adult females are indicated with an open symbol, Ct values from adult males with a closed symbol. Note that the y-axis differs in the two panels: highly expressed genes are shown in the top panel, moderately expressed genes in the bottom panel.

109

001-125 - Dissertatie Ard.pdf 109 21-7-2010 0:13:11 Chapter 4

Table 4. Candidate reference genes ranked according to their expression stability as calculated by the Normfinder and geNorm programs. The candidates are listed with decreasing expression stabil-

ity from top to bottom. Average expression stability values are shown between parentheses. R. microplus R. appendiculatus R. microplus and R. appendiculatus geNorm Normfinder geNorm Normfinder geNorm Normfinder

ELF1A and TBP (0.400) ELF1A and GAPDH ELF1A and ELF1A RPL4 (0.301) RPL4 (0.371) (0.359) RPL4 (0.376) (0.477) ELF1A ELF1A GAPDH (0.459) (0.424) (0.521) H3F3A RPL4 TBP (0.614) RPL4 TBP (0.619) TBP (0.549) (0.559) (0.463) (0.481) TBP (0.656) BTUB GAPDH PPIA (0.580) H3F3A PPIA (0.555) (0.485) (0.764) (0.778) BTUB (0.771) PPIA (0.512) H3F3A TBP (0.583) PPIA (0.926) RPL4 (0.856) (0.563) PPIA (0.824) H3F3A PPIA (0.959) H3F3A GAPDH H3F3A (0.577) (0.709) (0.995) (0.623) GAPDH GAPDH ACTB (1.097) ACTB BTUB (1.074) BTUB (0.940) (0.649) (0.720) (0.680) ACTB (1.159) ACTB BTUB (1.203) BTUB ACTB (1.259) ACTB (0.952) (0.852) (0.962) GST (1.512) GST (1.450) GST (1.818) GST (2.128) GST (1.795) GST (1.899)

To determine the minimum number of reference genes necessary for accurate normalization, calculation of the pairwise variation (Vn/n+1) was performed by ge- Norm. The lowest V values were found to be 0.131 for V5/6 in R. microplus and 0.168 for V7/8 in R. appendiculatus. Combined analysis of both tick species yielded a lowest V value of 0.156 at V6/7 (Fig. 3).

Figure 3. Optimal number of control genes for normalization as determined by ge- Norm for R. microplus (white bars), R. appendiculatus (black bars) and in a combined analysis (grey bars).

110

001-125 - Dissertatie Ard.pdf 110 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Bm86 and Ra86 sequence analysis One sequence for Bm86 (Mozambique) and two sequences from the Bm86 homologue of R. appendiculatus, Ra86-1 and Ra86-2, were obtained by 3'RACE with degenerate primer Ra86-F, which is located one amino acid downstream of the signal peptide of Bm86. The open reading frame (ORF) of the Bm86 (Mozambi- que) nucleotide sequence is 1890 bp, coding for a protein of 629 amino acids which is 96.5% identical to the Bm86 Yeerongpilly reference strain (Australia) with similar structural properties. The 22 amino acid gap reported previously in a second Bm86 (Mozambique) sequence (GenBank accession number ABY58968) was not detected in any of the five sequenced clones. Both R. appendiculatus sequences contain a 1905 bp-long ORF which encodes for 634 amino acids. The alleles differ by 45 nucleotides of which 13 are silent mutations and 32 result in a change in the deduced amino acid sequence of the protein. The identity of the amino acid sequence of Ra86-1 and Ra86-2 are 72.9% and 73.8% with the Bm86 proteins of R. microplus (Australia) and 73.7% and 74.6% with R. microplus (Mozambique) respectively. A comparison between the amino acid sequence of Ra86 and Bm86 shows that Ra86 contains the same Epidermal Growth Factor (EGF)-like domains as Bm86 [13]. These domains are also present in Ba86, Bd86 and Haa86, the Bm86 homologues of R. annulatus, R. decoloratus and Hy. a. anatolicum respectively (Fig. 4). The Ra86 sequences contain 5 potential sites for N-linked glycosylation (Asn- Xaa-Ser/Thr) and Ra86-2 has 1 potential O-glycosylation site (Ser/Thr). Both Ra86-1 and Ra86-2 are predicted to contain a glycosylphosphatidylinositol (GPI) modification site at position 613 (serine), which provides linkage of the molecule to the cell membrane. The presence of a GPI anchor is a common feature found in all ixodid tick Bm86 homologues characterized thus far. Western Blot analysis showed that ovine Bm86 antiserum recognized bands of the expected Ra86 protein size in the isolated midguts from partially fed R. appendiculatus females whereas serum from a sheep vaccinated with adjuvant only did not (Fig. 5).

Bm86/Ra86 expression analysis The expression profile of Bm86/Ra86 mRNA (referred to as Bm86 from this point onwards for convenience) in both R. microplus and R. appendiculatus was obtained by normalizing its expression with six reference genes that ranked highest in the geNorm and Normfinder analysis of the combined R. microplus and R. appendiculatus samples: ELF1A, GAPDH, H3F3A, PPIA, RPL4 and TBP (Fig. 6). In eggs of R. microplus, Bm86 expression was detected at low levels in eggs 4 and 10 days after initiation of the oviposition (p.o.: post oviposition) and increased by three-fold in eggs collected 15 days p.o. This formed the start of a rap-

111

001-125 - Dissertatie Ard.pdf 111 21-7-2010 0:13:11 Chapter 4

id increase in the expression of Bm86 in the third trimester of the embryogenesis to levels similar to that found in unfed larvae. Bm86 expression decreased with feeding and molting in the immature life stages, with the lowest expression found in the pharate life stages. The decrease of Bm86 expression levels following feeding of immatures was significantly more pronounced in the larvae and nymphs of R. appendiculatus compared to R. microplus where a more continuous expression pattern was observed during the life cycle with less dramatic variation. The expression level of Bm86 in adults did not differ significantly between males and females of both species.

112

001-125 - Dissertatie Ard.pdf 112 21-7-2010 0:13:11 Selection of reference genes for quantitative RT-PCR studies in ticks

Figure 4. Alignment of the amino acid sequences of the Bm86 homologues from ticks for which Bm86 vaccine efficiency has been documented: Bm86 AUS (Austra- lian strain) (AAA30098), Bm86 MOZ (Mozambique strain) (FJ809946), Ba86 (ABY58969), Bd86 (ABG21131), Haa86 (AAL36024), Ra86-1 (FJ809944) and Ra86-2 (FJ809945). Cross reactive linear B-cell epitopes mapped using pin-coupled peptides by Odongo et al. [5] are boxed, the regions identified using biotin-coupled peptides by the same authors are underlined. Three synthetic peptides used by Patar- royo et al. [14] which induced an immune response against R. microplus are double underlined and EGF-like domains fitting the pattern Cys-Xaa48-Cys-Xaa3-6-Cys- Xaa8-11-Cys-Xaa0-1-Cys-Xaa5-15-Cys (where Xaa is any amino acid except for cysteine) with 5 or 6 cysteine residues are shaded grey. The phenylalanine at position 507 of Bm86 AUS was predicted to be a cysteine when the sequence of a second cDNA clone from a separate library was determined by Rand et al. [13].

113

001-125 - Dissertatie Ard.pdf 113 21-7-2010 0:13:12 Chapter 4

Figure 5. Immunodetection of Ra86 by Western Blot analysis using ovine Bm86 antiserum. Lanes 1 and 2: R. microplus and R. appendiculatus midgut proteins probed with control serum from a sheep vaccinated with adjuvant only, lanes 3 and 4: R. microplus and R. appendiculatus midgut proteins probed with ovine Bm86 antisera. The arrow on the right indicates the Bm86 and Ra86 proteins.

Figure 6. Bm86 (white bars) and Ra86 (grey bars) expression levels in all life stages, normalized against the six most stably expressed reference genes in both R. microplus and R. appendiculatus: ELF1A, GAPDH, H3F3A, PPIA, RPL4 and TBP. Bars represent the 95% confidence interval of the normalized expression. Eggs of R. appendiculatus were only collected at day 20 after the start of oviposition and expression levels from other time points of embryogenesis are therefore missing.

114

001-125 - Dissertatie Ard.pdf 114 21-7-2010 0:13:12 Selection of reference genes for quantitative RT-PCR studies in ticks

Discussion

To minimize RT-PCR specific errors and correct for sample-to-sample variation in order to make a comparison of the Bm86 expression profiles from R. microplus and R. appendiculatus possible, appropriate normalization is required. The use of reference genes is most frequently applied to normalize the mRNA fraction, but validation of the expression stability of such genes in ticks has not been reported until now. ACTB is the most commonly used reference gene in tick research, but recent findings in mammals revealed that this gene and other commonly used 'classical' reference genes such as GAPDH may be inappropriate for use as a reference gene because of their variability under experimental conditions [9, 15].

The ideal reference gene should be expressed at a constant level in the tissue(s) of interest at all stages of development and be unaffected by the specific experimental treatment being examined. However, no such universal reference gene has yet been identified and probably does not exist [9-11]. Normalization with multiple selected reference genes has been proposed as an alternative to overcome this problem and several tools to evaluate the expression stability of candidate reference genes have been developed. In this study, two of these tools, the geNorm [10] and Normfinder [11] programs, were employed to evaluate the expression stability of nine selected candidate reference genes.

Besides the two 'classical' reference genes ACTB and GAPDH, other candidate reference genes evaluated in this study were from different functional classes and were selected based on their reported expression stability in other organisms and their presence in the EST libraries of R. microplus and R. appendiculatus [6-8]. RPL4 for instance was among the thirteen ribosomal proteins which were ranked in the top 15 of most stable expressed reference genes in a meta-analysis performed on a large dataset of human gene arrays [15]. Other ribosomal proteins were not included in this study to prevent bias in the ranking of the reference genes due to correlated expression of proteins belonging to the same functional class.

115

001-125 - Dissertatie Ard.pdf 115 21-7-2010 0:13:12 Chapter 4

of the geNorm analysis. Normfinder is less sensitive to the incorporation of co- regulated genes since it focuses on the intra- and intergroup variation in selecting the most stable expressed genes [11]. This may altogether explain the discordance in ranking of RPL4 between the geNorm and Normfinder programs. GST turned out to be the least stable gene in all conducted analyses (Table 3). GST is known to be differentially expressed under different conditions [16-18] and so could be expected to perform poorly as a reference gene. Of the 'traditional' reference genes, ACTB was ranked among the least stable genes by both methods whereas GAPDH was ranked first in the Normfinder analysis of the R. appendiculatus life stages. This is a direct result of the small Ct variation observed in the GAPDH expression in this species, which also explains the high ranking of TBP in the Normfinder analysis of the R. microplus life stages where this gene showed the least Ct variation over all samples.

Analysis of the pairwise variation (Vn/n+1) of the samples by geNorm returned values slightly lower or higher than the arbitrarily chosen threshold of 0.15 [10], re- flecting the heterogeneous nature of the analyzed whole tick samples which varied from egg to feeding adults. A direct consequence is the need of using a larger number of reference genes for optimal normalization. To be able to compare the Bm86 mRNA expression between all life stages of R. microplus and R. appendiculatus, normalization with six reference genes: ELF1A, RPL4, TBP, H3F3A, PPIA and GAPDH was conducted. These reference genes were evaluated as being the most stable by both geNorm and Normfinder in a combined analysis of all samples from both tick species and returned the lowest pairwise variation value in the geNorm analysis (V6/7 = 0.156).

The protein sequence of the Bm86 gene from the Mozambique R. microplus strain was highly identical to previously reported Bm86 sequences from Australia and South America and shared a maximum identity of 97.0% with the Bm86 sequence from a R. microplus strain from central Brazil (GenBank accession number ACA57829). A second Bm86 sequence isolated from the viscera of partially fed females originating from the same Mozambique tick colony (GenBank accession number ABY58968) contains a 22 amino acid gap which was not present in the Bm86 sequence identified in this study [19]. This sequence was not found in any of the five sequenced clones and may be less abundant, have been the result of alternative splicing or represent an allele which was lost in the R. microplus tick population since the source material was collected several generations earlier. The presence of Bm86 alleles within the same tick population has been previously reported [20]. Two alleles, Ra86-1 and Ra86-2, were also found to be transcribed

116

001-125 - Dissertatie Ard.pdf 116 21-7-2010 0:13:12 Selection of reference genes for quantitative RT-PCR studies in ticks

in the midgut of R. appendiculatus females. The ORFs were similar in size but the alleles differed by 32 amino acids. These differences do not appear to have a striking effect on the main properties of these proteins since both Ra86-1 and Ra86-2 are predicted to contain a GPI-anchor and contain EGF-like domains similar to those found in Bm86 (Fig. 4), but Ra86-2 does have a single potential O- glycosylation site which is absent from Ra86-1. Since Boophilus species were recently synonymized with the Rhipicephalus genus [21], it is not surprising that the Ra86 protein shows a higher amino acid sequence identity with Bm86 (~73%) compared to the Haa86 protein, the Bm86 homologue from the two-host tick Hy. anatolicum (65%). However, feeding of Hy. anatolicum on cattle vaccinated with a recombinant Bm86 vaccine does result in a deleterious effect against this tick species which is not seen in R. appendiculatus [4]. Since Western Blot analysis showed that ovine Bm86 antisera does indeed recognize R. appendiculatus proteins (Fig. 5), other biological factors such as conformational epitopes, amount of blood/antibodies ingested, or antigen abundance may play a role in the biology of Bm86 vaccine susceptibility. To investigate the latter hypothesis, the Bm86 and Ra86 transcript levels were measured throughout the life cycle of both tick species feeding on the same host by quantitative RT-PCR using a single primer pair which amplifies all known alleles of Bm86 and Ra86.

The normalized Bm86 mRNA expression levels were monitored in various stages of embryonic development in R. microplus and were found to increase exponen- tially during the last 9 days prior to hatching, simultaneous with the development of the midgut in embryos which takes place in the third trimester of embryogenesis in ixodid ticks [22, 23] (Fig. 6). At day 20 p.o. expression levels of Bm86 were 18 (8-40) times higher in R. appendiculatus eggs compared to R. microplus eggs, a difference that might in part be explained by a more advanced egg development in R. appendiculatus eggs as they were noted to hatch one day earlier than eggs from R. microplus. The same large difference in Bm86 expression level was also observed in unfed larvae and nymphs where Bm86 expression levels were approximately tenfold higher in R. appendiculatus immatures in anticipation of a blood meal compared to unfed R. microplus larvae and nymphs. It should be noted that all samples were collected at single well defined points from each life stage and fluctuations possibly occurring during these life stages could therefore have been missed. The Bm86 expression decreased significantly during feeding and particularly during molting in R. appendiculatus, a decrease which was present in R. microplus nymphs as well but to a far lesser extent. Bm86 expression levels of adults from both species were similar and so the total amount of Bm86 expressed during blood feeding and exposure to the host immune system may be comparable

117

001-125 - Dissertatie Ard.pdf 117 21-7-2010 0:13:12 Chapter 4

between adults of the two species, assuming that the expression profile of Bm86 mRNA is indicative for the amount of expressed Bm86 protein. If so, differences in Bm86 vaccination susceptibility could perhaps be sought in the prolonged exposure to imbibed blood and the host immune system of R. microplus which is adapted for continuous development on one host compared to the three-host tick R. appendiculatus. The latter has a longer 'recovery' period during molting at which time no or very little Bm86 is expressed. Hence little reaction between ingested antibodies and the Bm86 protein would be expected to occur. However, effects of vaccination with Bm86 are predominantly seen in adults of R. microplus [24]. This is corroborated by the fact that if R. microplus are raised to the stage of unfed adults on non-vaccinated cattle, then transferred to either vaccinated sheep [25] or to an in-vitro feeding system using blood from vaccinated cattle [24], strong vaccine effects are seen. As mentioned earlier, this effect is not seen in R. appendiculatus adults feeding on cows vaccinated with Bm86 [4, 5], although both R. microplus and R. appendiculatus have comparable Bm86 expression levels in both unfed and fed adults.

Although the nomenclature used to distinguish the various cell types present in the midgut of ticks is not unanimous, the midgut is thought to consist of the following epithelial cell types: stem cells, also referred to as undifferentiated reserve cell [26] or replacement cell [27], various stages of digest cells, secretory cells and albeit controversial, a basophilic cell type [28-30]. The digest cells are thought to derive from the stem cells and transform from a prodigest cell type to a sessile digest cell following the absorption of blood meal haemoglobin. Sessile cells may detach from the basal lamina into the gut lumen, thus becoming detached or mo- tile digest cells. Upon release of their hematin granules and other indigestible products into the lumen they are termed spent or degenerating digest cells [29]. Exhausted digest cells are replaced by consecutive cycles of growth and differentiation from undifferentiated cells so multiple generations of a digest cell type may be present at the same time, which has led to some confusion in the interpre- tation of these events [31]. While it has been reported that the Bm86 protein is located predominantly on the microvilli surface of digest cells, the exact cell type could not be determined for technical reasons [2]. The high Bm86 expression levels found in eggs in the third trimester of embryogenesis and unfed larvae suggest that stem cells and/or prodigest cells are expressing Bm86 protein as well. This would be in concordance with the hypothesized function of Bm86 in the regulation of cell growth based on its sequence and structural homology to epidermal growth factor precursors [32] and the greater abundance of Bm86 towards the apical tips of gut digest cells associating it with a regulatory role in the apical

118

001-125 - Dissertatie Ard.pdf 118 21-7-2010 0:13:12 Selection of reference genes for quantitative RT-PCR studies in ticks

growth [2]. Since antibodies from vaccination sera will bind to tick gut cells and inhibit their endocytotic function, involvement of Bm86 in endocytosis of the blood meal seemed possible. However, the inhibition of endocytosis was suggested to be an indirect effect of Bm86 antibodies binding to the Bm86 protein [24]. The low levels of Bm86 expression in feeding and pharate immature ticks and comparable expression levels between unfed and feeding adults make a role for Bm86 in endocytosis more unlikely since the expression of proteins involved in endocytosis is expected to increase during the uptake of a bloodmeal.

Conclusion

Nine candidate reference genes from different functional classes were identified in the EST databases of R. microplus and R. appendiculatus and their expression stability throughout the life cycle of these two tick species was evaluated. ELF1A was found to be the most stable expressed gene in both tick species following analysis by both the geNorm and Normfinder software applications, GST showed the least stability. The six most stable expressed genes were used for normalization of the expression profile of the tick-protective antigen Bm86 for both R. microplus and R. appendiculatus. This expression profile revealed a more continuous Bm86 antigen abundance in R. microplus throughout its one-host life cycle compared to the three-host tick R. appendiculatus where large variations were observed between the different life stages. The observed differences in Bm86 expression profile between the two species alone can not adequately explain the lack of a Bm86 vaccination effect in R. appendiculatus.

Abbreviations

ACTB: β-actin; BTUB: β-tubulin; EGF: Epidermal Growth Factor; ELF1A: elongation factor 1α; EST: expressed sequence tag; GAPDH: glyceraldehyde 3- phosphate dehydrogenase; GPI: glycosylphosphatidylinositol; GST: Glutathione S-transferase; H3F3A: H3 histone family 3A; ORF: Open Reading Frame; PBS: Phosphate Buffered Saline; PPIA: cyclophilin; p.o.: post oviposition; RPL4: ribosomal protein L4; RT: room temperature; TBP: TATA box binding protein; TBST: Tris-buffered saline Tween 20.

119

001-125 - Dissertatie Ard.pdf 119 21-7-2010 0:13:12 Chapter 4

Authors' contributions

AMN conceived and performed the experiment and drafted the manuscript. JB and MP assisted in the protein isolations, Western Blots and cloning and sequencing of Ra86. FJ supervised the study and helped to draft the manuscript. All authors read and approved the final version of the manuscript.

Acknowledgements

The antisera used were a kind gift of Dr. Peter Willadsen from CSIRO Livestock Industries, Queensland, Australia. Peter Willadsen is also thanked for his valuable suggestions which helped to improve this paper. This research was supported by the Wellcome Trust under the 'Animal Health in the Developing World' initiative through project 075799 entitled 'Adapting recombinant anti-tick vaccines to livestock in Africa'.

120

001-125 - Dissertatie Ard.pdf 120 21-7-2010 0:13:12 Selection of reference genes for quantitative RT-PCR studies in ticks

References

1. Walker AR, Bouattour A, Camicas J-L, Estrada-Pena A, Horak IG, Latif AA, Pegram RG, Preston PM: Ticks of domestic animals in Africa: a guide to identification of species. Edinburgh: BioScience Reports; 2003. 2. Gough JM, Kemp DH: Localization of a low abundance membrane protein (Bm86) on the gut cells of the cattle tick Boophilus microplus by immunogold labeling. J Parasitol 1993, 79(6):900-907. 3. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. Vaccine 1998, 16(20):1990-1992. 4. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245-261. 5. Odongo D, Kamau L, Skilton R, Mwaura S, Nitsch C, Musoke A, Taracha E, Daubenberger C, Bishop R: Vaccination of cattle with TickGARD induces cross-reactive antibodies binding to conserved linear peptides of Bm86 homologues in Boophilus decoloratus. Vaccine 2007, 25(7):1287-1296. 6. Guerrero FD, Miller RJ, Rousseau ME, Sunkara S, Quackenbush J, Lee Y, Nene V: BmiGI: a database of cDNAs expressed in Boophilus microplus, the tropical/southern cattle tick. Insect Biochem Mol Biol 2005, 35(6):585-595. 7. Nene V, Lee D, Kang'a S, Skilton R, Shah T, de Villiers E, Mwaura S, Taylor D, Quackenbush J, Bishop R: Genes transcribed in the salivary glands of female Rhipicephalus appendiculatus ticks infected with Theileria parva. Insect Biochem Mol Biol 2004, 34(10):1117-1128. 8. Wang M, Guerrero FD, Pertea G, Nene VM: Global comparative analysis of ESTs from the southern cattle tick, Rhipicephalus (Boophilus) microplus. BMC Genomics 2007, 8:368. 9. Bustin SA: Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000, 25(2):169-193. 10. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate normalization of real-time quantitative RT- PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002, 3(7):RESEARCH0034.

121

001-125 - Dissertatie Ard.pdf 121 21-7-2010 0:13:12 Chapter 4

11. Andersen CL, Jensen JL, Orntoft TF: Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance esti- mation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004, 64(15):5245-5250. 12. geNorm manual, update July 8, 2008 [http://medgen.ugent.be/~jvdesomp/genorm/geNorm_manual.pdf] 13. Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, Co- bon GS: Cloning and expression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci U S A 1989, 86(24):9657- 9661. 14. Patarroyo JH, Portela RW, De Castro RO, Pimentel JC, Guzman F, Patar- royo ME, Vargas MI, Prates AA, Mendes MA: Immunization of cattle with synthetic peptides derived from the Boophilus microplus gut protein (Bm86). Vet Immunol Immunopathol 2002, 88(3-4):163-172. 15. de Jonge HJ, Fehrmann RS, de Bont ES, Hofstra RM, Gerbens F, Kamps WA, de Vries EG, van der Zee AG, te Meerman GJ, ter Elst A: Evidence based selection of housekeeping genes. PLoS ONE 2007, 2(9):e898. 16. de la Fuente J, Blouin EF, Manzano-Roman R, Naranjo V, Almazan C, Perez de la Lastra JM, Zivkovic Z, Jongejan F, Kocan KM: Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics 2007, 90(6):712-722. 17. Freitas DR, Rosa RM, Moraes J, Campos E, Logullo C, Da Silva Vaz I, Jr., Masuda A: Relationship between glutathione S-transferase, catalase, oxygen consumption, lipid peroxidation and oxidative stress in eggs and larvae of Boophilus microplus (Acarina: Ixodidae). Comp Biochem Physiol A Mol Integr Physiol 2007, 146(4):688-694. 18. Saldivar L, Guerrero FD, Miller RJ, Bendele KG, Gondro C, Brayton KA: Microarray analysis of acaricide-inducible gene expression in the southern cattle tick, Rhipicephalus (Boophilus) microplus. Insect Mol Biol 2008, 17(6):597-606. 19. Canales M, de la Lastra JM, Naranjo V, Nijhof AM, Hope M, Jongejan F, de la Fuente J: Expression of recombinant Rhipicephalus (Boophilus) microplus, R. annulatus and R. decoloratus Bm86 orthologs as secreted proteins in Pichia pastoris. BMC Biotechnol 2008, 8:14. 20. Sossai S, Peconick AP, Sales-Junior PA, Marcelino FC, Vargas MI, Neves ES, Patarroyo JH: Polymorphism of the bm86 gene in South American strains of the cattle tick Boophilus microplus. Exp Appl Acarol 2005, 37(3-4):199-214.

122

001-125 - Dissertatie Ard.pdf 122 21-7-2010 0:13:12 Selection of reference genes for quantitative RT-PCR studies in ticks

21. Murrell A, Barker SC: Synonymy of Boophilus Curtice, 1891 with Rhi- picephalus Koch, 1844 (Acari: Ixodidae). Syst Parasitol 2003, 56(3):169-172. 22. Jasik K, Buczek A: Origin of alimentary tract in embryogenesis of Ixodes ricinus (Acari: Ixodidae). J Med Entomol 2005, 42(4):541-547. 23. Kammah KME, Adham FK, Tadross NR, Osman M: Embryonic development of the camel tick Hyalomma dromedarii (Ixodoidea: Ixodidae). Int J Acarol 1982, 8(1):47-54. 24. Kemp DH, Pearson RD, Gough JM, Willadsen P: Vaccination against Boophilus microplus: localization of antigens on tick gut cells and their interaction with the host immune system. Exp Appl Acarol 1989, 7(1):43-58. 25. De Rose R, McKenna RV, Cobon G, Tennent J, Zakrzewski H, Gale K, Wood PR, Scheerlinck JP, Willadsen P: Bm86 antigen induces a protective immune response against Boophilus microplus following DNA and protein vaccination in sheep. Vet Immunol Immunopathol 1999, 71(3- 4):151-160. 26. Balashov YS: Bloodsucking ticks (Ixodoidea)-vectors of disease in man and animals: Miscellaneous Publications of the Entomological Society of America. 1972. 8: 5 376pp.; 1972. 27. Coons LB, Rosell-Davis R, Tarnowski BI: Bloodmeal digestion in ticks. In: Morphology, Physiology, and Behavioral Biology of Ticks. Edited by Sauer JR, Hair JA. New York: John Wiley & Sons; 1986: 248-279. 28. Agbede RI, Kemp DH: Digestion in the cattle-tick Boophilus microplus: light microscope study of the gut cells in nymphs and females. Int J Parasitol 1985, 15(2):147-157. 29. Agyei AD, Runham NW: Studies on the morphological changes in the midguts of two ixodid tick species Boophilus microplus and Rhipice- phalus appendiculatus during digestion of the blood meal. Int J Parasi- tol 1995, 25(1):55-62. 30. Walker AR, Fletcher JD: Histology of digestion in nymphs of Rhipice- phalus appendiculatus fed on rabbits and cattle naive and resistant to the ticks. Int J Parasitol 1987, 17(8):1393-1411. 31. Sonenshine DE: Biology of ticks, vol. 1. New York: Oxford University Press; 1991. 32. Tellam RL, Smith D, Kemp DH, Willadsen P: Vaccination against ticks. In: Animal Parasite Control Utilizing Biotchnology. Edited by Yong WK. Boca Raton: CRC Press; 1992: 303-331.

123

001-125 - Dissertatie Ard.pdf 123 21-7-2010 0:13:12

001-125 - Dissertatie Ard.pdf 124 21-7-2010 0:13:12

BM86 ORTHOLOGUES AND THE NOVEL ATAQ PROTEIN FAMILY WITH MULTI EPIDERMAL GROWTH FACTOR-LIKE DOMAINS FROM HARD AND SOFT TICKS

NIJHOF AM, BALK JA, POSTIGO M, RHEBERGEN AM, TAOUFIK A, JONGEJAN F

INTERNATIONAL JOURNAL FOR PARASITOLOGY 2010; IN PRESS

10 PhD thesis Nijhof - Title page chapter 5.pdf 1 26-7-2010 22:55:12 126-152 - Chapter 5 17x24 220710.pdf 1 26-7-2010 22:05:40 Bm86 orthologues and the novel ATAQ protein family

Abstract

Tick control on livestock relies principally on the use of acaricides, but the development of acaricide resistance and environmental pollution concerns underscores the need for alternative control methods, for instance through the use of anti-tick vaccines. Two commercial vaccines based on the recombinant Bm86 protein from Rhipicephalus (Boophilus) microplus ticks were developed. Partial protection of the Bm86 vaccine against other Rhipicephalus (Boophilus) and Hyalomma tick species suggests that the efficacy of a Bm86-based vaccine may be enhanced when based on the orthologous recombinant Bm86 antigen. We therefore identified and analysed the Bm86 homologues from species representing the main argasid and ixodid tick genera, including two from the prostriate Ixodes ricinus tick species. A novel protein from metastriate ticks with multiple Epidermal Growth Factor (EGF)-like domains which is structurally related to Bm86 was discovered by using a 3’ rapid amplification of cDNA ends (3’-RACE) method with a degenerate primer based on a highly conserved region of Bm86 and its orthologues. This second protein was named ATAQ after a part of its signature peptide. Quan- titative RT-PCR showed that ATAQ proteins are expressed in both midguts and Malpighian tubules, in contrast to Bm86 orthologues which are expressed exclusively in tick midguts. Furthermore, expression of this protein over the life stages of R. microplus and Rhipicephalus appendiculatus was more continuous compared to Bm86. Although a highly effective vaccine antigen, gene silencing of Bm86 by RNA interference (RNAi) produced only a weak phenotype. Similarly the RNAi phenotype of R. e. evertsi females in which the expression of Ree86, ReeATAQ or a combination of both genes was silenced by RNAi did not differ from a mock injected control group. The vaccine potential of ATAQ proteins against tick infestations is to be evaluated.

127

126-152 - Chapter 5 17x24 220710.pdf 2 26-7-2010 22:05:40 Chapter 5

Introduction

Ticks are obligate hematophagous ectoparasites which can be divided into three families. The hard ticks or Ixodidae form the largest family which can be further subdivided into two groups, the basal Prostriata which consists of the genus Ixodes, and the more recent genera of the Metastriata. The soft ticks or Argasidae form a smaller family which is considered to be more basal than the Ixodidae. The third family, the Nuttalliellidae, is monotypic [1]. Approximately ten percent of all tick species have significant medical or veterinary importance by causing direct damage or production loss through blood feeding, by injecting toxins or by acting as vectors for a broad range of pathogens. The damage caused by ticks has considerable economic impact, in particular in the tropics and subtropics [2]. Con- trol of ticks worldwide relies principally on the use of acaricides, but concerns about environmental pollution, residues in food products and the development of acaricide resistance have resulted in the search for alternative means of tick control such as anti-tick vaccines. It has been known for over 70 years that immunity to ticks can be induced by vaccination with tick tissue homogenates and many studies have since focused on the identification and characterization of tick protective antigens giving the vaccinated animal a certain degree of protection against tick infestations [3, 4].

In the 1990s, this led to the development and commercialization of two related anti-tick vaccines targeting the common cattle tick Rhipicephalus (Boophilus) microplus: TickGARD Plus® in Australia and Gavac® in Cuba [5]. These were the first, and remain the only commercially available anti-parasite vaccines using a recombinant antigen. Bm86, the recombinant antigen on which both vaccines are based, was identified through a complex series of protein fractionations followed by vaccination trials in cattle to assess the antigenic efficacy against R. microplus [6, 7]. Bm86 is a glycoprotein of unknown function which is located predominantly on the surface of tick midgut digest cells [8]. Vaccination with recombinant Bm86 typically leads to a reduction of maximal 50% in the number of R. microplus ticks engorging on vaccinated animals, lower engorgement weights and a decrease in the number of oviposited eggs. The impact of vaccination on the reproductive performance is only seen in the second and subsequent tick generations by a reduced number of larvae in the field [3]. Bm86 based vaccines give a high protection efficacy (>99% reduction on the number of engorging ticks) against Rhipi- cephalus (Boophilus) annulatus infestations [9-11], partial cross-protection against several other tick species, e.g. Rhipicephalus (Boophilus) decoloratus, Hyalomma anatolicum anatolicum and Hyalomma dromedarii, but do not work

128

126-152 - Chapter 5 17x24 220710.pdf 3 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

against Amblyomma cajennense, Amblyomma variegatum and Rhipicephalus appendiculatus [12, 13] (Rodríguez and Jongejan, unpublished data). Vaccination with rHaa86, the recombinant Bm86 homologue protein from Hy. a. anatolicum, resulted in a significant decrease in the number of engorging Hy. a . anatolicum larvae and females [14]. The inefficacy of Bm86 vaccines against some tick species and absence of a direct knock-down effect are the main disadvantages of these vaccines and justify the development of improved vaccine formulations, for instance by combining multiple tick-protective antigens. It is reasonable to as- sume that protection with the homologous form of Bm86 in each tick species will be better than heterologous cross-protection, despite the finding that the efficacy of vaccination against R. annulatus infestations with the recombinant homologue of R. annulatus (Ba86) was lower than that with Bm86 [9]. Bm86 homologues from R. annulatus, R. decoloratus, R. appendiculatus, Rhipicephalus sanguineus (GenBank Accession number EF222203), Hy. anatolicum and Haemaphysalis longicornis have previously been sequenced [12, 13, 15, 16]. This study was designed to characterize the Bm86 homologues from a broader range of ixodid and argasid tick species of veterinary and medical importance and revealed a novel group of potential anti-tick vaccine candidates.

129

126-152 - Chapter 5 17x24 220710.pdf 4 26-7-2010 22:05:41 Chapter 5

Materials and methods

Ticks and tick feeds Ornithodoros savignyi adults originating from Upington, Northern Cape province, South Africa were provided by the Department of Biochemistry, University of Pretoria, South Africa. The O. savignyi colony was maintained by regular artificial feeding [17]. Tick strains of Amblyomma variegatum (the Gambia), Derma- centor reticulatus (Noord-Brabant, the Netherlands), Dermacentor variabilis (United States), Haemaphysalis elliptica (South Africa), Hyalomma marginatum (Ajaccio, Corsica), Ixodes ricinus (the Netherlands) and Rhipicephalus evertsi evertsi (Kwazulu Natal, South Africa) were maintained on rabbits and cattle in the tick rearing facility of the Utrecht Centre for Tick-borne Diseases (UCTD). All tick feeds were approved by the Animal Experiments Committee (DEC) of the Faculty of Veterinary Medicine, Utrecht University (DEC No. 2008.II.07.068).

Tick dissections and RNA isolation While submerged in autoclaved ice-cold phosphate buffered saline (PBS; pH 7,4), partially fed ixodid females fed on calves were halved between leg pair 2 and 3 using a sterile scalpel blade. Field-collected O. savignyi females were immobi- lized in paraffin wax, submerged in autoclaved ice-cold PBS and their integument was removed by an incision with a sterile scalpel blade all around the lateral mar- gin of the body. Separate tissues were subsequently collected from the body of ixodid and argasid ticks using watchmaker’s forceps under a stereo microscope, transferred to 1 ml TRIzol (Invitrogen, Breda, the Netherlands) and homogenized by passage through 24- and 27-gauge needles. For the isolation of total RNA from unfed first stage nymphs (N1) from O. savignyi, pools of 100 mg O. savignyi N1 nymphs were homogenized in 1 ml TRIzol reagent using a Potter-Elvejhem glass/Teflon homogenizer. All samples collected in TRIzol were centrifuged at 12,000 x g at 4°C for 10 min to remove insoluble material after which the supernatant was frozen at -80°C until RNA extraction. Total RNA was isolated and treated with DNase I (Fermentas GmbH, St. Leon Rot, Germany) prior to purification using the Nucleospin RNA II kit (Machery-Nagel, Düren, Germany), all in accordance with the manufacturer’s protocols. Sample concentrations and purity were determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) at 260 nm (A260) wavelength.

cDNA synthesis and rapid amplification of cDNA ends (3’-RACE and 5’-RACE) For the 3’-RACE of Bm86 homologues, 1 μg of total RNA was used to synthesize first-strand cDNA using SuperScript III (Invitrogen) following the manufacturer’s

130

126-152 - Chapter 5 17x24 220710.pdf 5 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

instruction using a 3’-RACE anchor primer containing a poly-T sequence [5'- GCTATCATTACCACAACACTCT(18)(AGC)(AGCT)-3']. This and all other primers used in this study were synthesized by Invitrogen, Paisley, UK. The Bm86 orthologues of D. reticulatus (Dr86), Hy. marginatum (Hm86) and R. e. evertsi (Ree86) were subsequently PCR amplified from this cDNA using GoTaq Hot Start consumables (Promega, Leiden, the Netherlands) with degenerate primer Ra86-F [5’- TCATC(CT)(AG)T(CT)TGCTCTGACTTCGG-3’] and a 3’-RACE anchor primer [5’-GCTATCATTACCACAACACTC-3'].

The same strategy was used for amplification of the Ixodes ricinus Bm86 orthologues (Ir86-1 and Ir86-2) using forward primers Is86-1F [5’- TCCCCTGTCCTTGGATTGG -3’] and Is86-2F [5’- CAGCCAAGACATAC- CATAACG -3’] the designs of which were based on expressed sequence tag (EST) sequence information for the Ixodes scapularis Bm86 homologues discovered by a BLAST search on the database made available at the I. scapularis vectorbase website (http://iscapularis.vectorbase.org/Tools/BLAST/) (Is86-1: alignment of EW846881, EW825613 and EW943081; Is86-2: alignment of EW929369, EW893350 and EW858856) of the Ixodes scapularis genome project [18]. The conserved Bm86 peptide sequence (RCCQGWN, pos. 173-179 of Bm86, GenBank Accession Number AAA30098) was used to design degenerate primer Bm86 catchall-F [5’- CGITG(CT)TG(CT)CA(AG)GG(AG)TGG(AG)AC- 3’] which amplified the partial Bm86 orthologues from A. variegatum (Av86) and O. savignyi (Os86) when used in combination with the 3’-RACE anchor primer.

A second protein, referred to as ATAQ later in this manuscript, was also amplified from A. variegatum by the Bm86 catchall-F primer. Based on the this sequence and additional ESTs from the R. microplus EST database (http://compbio.dfci.harvard.edu/tgi/tgipage.html), additional primer ATAQ catchall-F [5’-ACIGCTCA(GA)CGATGCTACCA-3’] was developed for 3’-RACE of the ATAQ homologues from R. annulatus, R. decoloratus, R. microplus, R. e. evertsi, R. appendiculatus, Hy. marginatum, D. reticulatus, D. variabilis and Hae. elliptica.

The resulting sequences from the 3’-RACE reactions were used to design 5’- RACE primers for 5’-RACE. The 5’-RACE cDNA synthesis was conducted with 1 μg total RNA of each species using a 2nd generation RACE kit (Roche Applied Science, Almere, the Netherlands) in accordance with the manufacter’s protocols, followed by two PCRs with the 5’-RACE anchor primer [5’- GAC- CACGCGTATCGATGTCGAC -3’] from this kit and the primers shown in Sup- plementary Table 1. The PCR products were purified using the Nucleospin Ex-

131

126-152 - Chapter 5 17x24 220710.pdf 6 26-7-2010 22:05:41 Chapter 5

tract kit (Machery-Nagel, Düren, Germany), cloned into the pGem-T easy vector (Promega) and sequenced by Baseclear, Leiden, the Netherlands. All sequences have been submitted to GenBank and can be retrieved under the respective accession numbers shown in Table 1.

Gene sequence and phylogenetic analysis Sequence alignments were created using the BioEdit sequence alignment editor program (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) with ClustalW. An identity/similarity matrix was generated using MatGAT v2.01 [19]. Signal peptides were predicted by SignalP (http://www.cbs.dtu.dk/services/SignalP/) and N- glycosylation and O-glycosylation of the deduced protein sequences were predicted by the NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/) and Ne- tOGlyc 3.1 (http://www.cbs.dtu.dk/services/NetOGlyc/) servers of the Center for Biological Sequence Analysis (CBS), Technical University of Denmark. The predicted molecular weight and the isoelectric point (pI) were determined using the Compute pI/MW tool of the ExPASy proteomics server (http://www.expasy.ch/tools/pi_tool.html). Potential glycosyl-phosphatidylinositol (GPI) anchor sites and transmembrane helices were predicted using the predGPI GPI predictor tool (http://gpcr.biocomp.unibo.it/predgpi/) and the TMHMM server (http://www.cbs.dtu.dk/services/TMHMM/). Proteins were scanned for repeat regions using RADAR (http://www.ebi.ac.uk/Tools/Radar/index.html).The annotated Is86-1 and Is86-2 genes were blasted against the assembled I. scapularis supercontigs (version IscaW1) of the I. scapularis genome sequencing project on Vectorbase (www.vectorbase.org/Tools/BLAST). Phylogenetic trees were generated using Treecon [20]. Antigenic peptides were predicted using the method of Kolaskar and Tongaonkar [21], with a reported accuracy of approximately 75% (http://imed.med.ucm.es/Tools/antigenic.pl).

Expression analysis by quantitative RT-PCR cDNA was synthesized from 500 ng of DNA-free RNA isolated from tissues of adult A. variegatum, I. ricinus, R. microplus and O.savignyi ticks using the iScript cDNA synthesis kit (Bio-Rad, Veenendaal, the Netherlands) according to the manufacturer’s directions and stored at -20°C until use in quantitative RT-PCR. Quantitative RT-PCR assays using SYBR® green detection were designed and optimized for the amplification of the reference genes elongation factor 1α (ELF1A) and TATA box binding protein (TBP) and members of the Bm86 protein family: Av86, AvATAQ, Ir86-1, Ir86-2, BmATAQ and Os86. The methodology of the Bm86 quantitative RT-PCR assay was published previously [16]. Real-time analysis was carried out on an iCycler thermal cycler (Bio-Rad). RT-PCR ampli-

132

126-152 - Chapter 5 17x24 220710.pdf 7 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

fication mixtures (25 μl) contained cDNA generated from 5 ng of RNA template, 12.5 μl MAXIMA ™ SYBR green qPCR mastermix (Fermentas) and 400 nM forward and reverse primer. The cycling conditions comprised a 5 min denaturation and polymerase activation step at 95°C, 40 cycles of 95°C for 10 s, 60°C for 30 s and 72°C for 30 s. Upon completion of the amplification program, a dissociation analysis (52°C-95°C) was performed to determine the purity of the PCR amplicons. To estimate amplification efficiencies, a standard curve was generated for each primer pair based on known quantities of cDNA for the corresponding tick species (10-fold serial dilutions corresponding to cDNA transcribed from 50 ng to 0.05 ng of total RNA in triplicate) and analyzed using the iQ 5 software (Bio- Rad). The expression data were normalized using the geometric mean of the selected reference genes quantities and their respective amplification efficiencies [16]. Normalized quantities were rescaled to the expression of the partially fed female midgut sample for comparison purposes and are shown as the mean ± standard deviation in Figs. 3-5. All assays included this standard curve, a no- template control and each of the test cDNAs. Primers, amplicon lengths and PCR efficiencies are indicated in Supplementary Table 2.

RNA interference (RNAi) Oligonucleotide primers RsATAQ dsRNA F1 (5’- TAATACGACTCACTATAGGCGAGAACTCATCAAATCCTTACTAC-3’), RsATAQ dsRNA R1 (5’- TAATACGACTCACTATAG- GATTCTGTTCAATAGTGCTGGTGC-3’), Bm86h-F3T7 and Bm86h-R3T7 [22] all containing T7 promotor sequences at the 5′-end for in vitro transcription and synthesis of dsRNA were used to PCR-amplify cDNA from R. e. evertsi encoding ReeATAQ (548 bp) and Ree86 (421 bp) respectively. PCR products were purified using the Nucleospin Extract kit (Machery-Nagel) and used as templates to produce dsRNA using the T7 Ribomax Express RNAi system (Promega, Leiden, the Netherlands). dsRNA aliquots were stored at −80 °C until used. For the injection of dsRNA, three groups of twenty R. e. evertsi females each were placed on double-sided sticky tape with the ventral sides upwards and injected into the base of the fourth leg on the right ventral side with 0.5 μl Ree86, ReeATAQ or a combination of Ree86 and ReeATAQ dsRNA (5-7 x 1011 molecules/μl) using a 10 μl syringe with a 33 G needle (Hamilton, Bonaduz, Switzerland) mounted on a MM3301-M3 micromanipulator (World Precision Instruments (WPI), Berlin, Germany) and connected to an UMPII syringe pump (WPI). The tip of a 27 G needle was used to slightly pierce the integument before the 33 G needle was inserted. The dsRNA was dissolved in injection buffer (10 mM Tris–HCl, pH 7 and 1 mM EDTA). A fourth control group (n=20) was injected with injection buffer

133

126-152 - Chapter 5 17x24 220710.pdf 8 26-7-2010 22:05:41 Chapter 5

alone. The ticks were placed in an incubator at 27 °C with 95% relative humidity for 4-6 h following injection, before they were examined for mortality and placed in four separate patches, one for each group, on calf #9918. Twenty-five male ticks were placed in each patch simultaneously with the injected females. The ticks were checked twice daily and collected when they dropped from the host. All ticks were weighed separately within 1 h of collection and stored individually in 15 ml jars with pierced lids at 27 °C and 95% relative humidity for oviposition. For gene expression analysis by quantitative RT-PCR, total RNA was isolated from the guts of six partially fed females from each group collected at day 5 post injection. Biological triplicates were created for each group by dividing these six guts over three tubes, pooling two guts in each tube filled with TRIzol. RNA isolation, DNAse treatment and cDNA synthesis were performed as described under sections 2.2 and 2.5. The primer combinations used for the quantitative RT-PCR are shown in Supplementary Table 2.

Statistical analysis Statistical analyses of data from the quantitative RT-PCR and RNAi experiments were performed using Microsoft Excel as previously described [16, 22]. In short, gene expression levels were normalized using the geometric mean of selected reference gene quantities in Microsoft Excel following the guidelines described in the geNorm manual (http://medgen.ugent.be/~jvdesomp/genorm/geNorm_manual.pdf) and the 95% confidence interval was calculated. Differential gene expression was considered significant when the 95% confidence interval of the mean normalized expression levels did not overlap (equivalent to P < 0.05). Statistical analysis of data from the weights of ticks after feeding and oviposited egg mass was performed using Mi- crosoft Excel and consisted of an unpaired t-test with unequal variances. Tick mortality was compared between the dsRNA- and mock-injected ticks by χ2-test. P values of 0.05 or less were considered statistically significant.

134

126-152 - Chapter 5 17x24 220710.pdf 9 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

Results

Characterization of the Bm86 homologues The Bm86 homologues from the metastriate ticks A. variegatum (Av86), D. reticulatus (Dr86), Hy. marginatum (Hm86) and R. e. evertsi (Ree86) were successfully amplified using 3’-RACE and 5’-RACE PCR and subsequently sequenced. The translated proteins showed structures similar to Bm86 with a signal peptide, multiple Epidermal Growth Factor (EGF)-like domains fitting the pattern C- x(3,9)-C-x(3,6)-C-x(8,11)-C-x(0,1)-C-x(5,15)-C (where x is any amino acid except cysteine), multiple glycosylation sites and a glycosyl-phosphatidylinositol (GPI) anchor (Fig. 1). Their size, predicted molecular weight, isoelectric point (pI), glycosylation sites, number of EGF-like domains and membrane anchors are shown in Table 1. A single Bm86-like protein (Os86) of 570 AA with a signal peptide, six full and one partial EGF-like domain and a transmembrane anchor was found to be expressed in nymphs and adults of O. savignyi, the only soft tick used in this study.

A second sequence coding for a Bm86-like protein from A. variegatum was discovered following sequencing of products from a 3’-RACE PCR with the Bm86 catchall primer. When the full sequence encoding for this protein was obtained by 5’RACE PCR, the translated complete protein sequence showed only 40% similarity to the Australian Bm86 isolate from R. microplus. We therefore had two sequences from A. variegatum: one with 62% similarity and a second one with only 40% similarity to Bm86, while the two A. variegatum sequences again showed only 38% similarity to each other (Table 2). Despite this difference on sequence level, the cysteine-rich protein was predicted to have a structure similar to Bm86 with multiple EGF-like domains and a GPI anchor. This suggested that we were dealing with a distinct, though related, protein. A tblastn search with this protein sequence revealed the presence of a similar protein in the R. microplus EST database. 3’-RACE and 5’-RACE PCR were employed to amplify the gene coding for this protein from R. annulatus, R. decoloratus, R. microplus, R. e. evertsi, Hae. elliptica, Hy. marginatum, D. reticulatus and Dermacentor variabilis. An alignment of all amino acid sequences from this protein group showed the presence of a signature peptide: YFNATAQRCYH which largely overlaps with the first EGF- like domain. Part of this signature peptide, ATAQ, was chosen as a name for proteins from this group to distinguish them from Bm86 orthologues. Besides this signature peptide, all proteins in this group contain a signal peptide, a large number of cysteine residues, multiple glycosylation sites and six full and one partial EGF-like domain. The predicted anchoring does however differ; the proteins from

135

126-152 - Chapter 5 17x24 220710.pdf 10 26-7-2010 22:05:41 Chapter 5

A. variegatum (AvATAQ) and Hae. elliptica (HeATAQ) were predicted to contain a GPI anchor, species belonging to the Hyalomminae and Rhipicephalinae subfamilies were predicted to contain a transmembrane anchor (Fig. 1 and Table 1). From the brown ear tick R. appendiculatus, two different homologues (RaA- TAQ-1 and RaATAQ-2) were found. The RaATAQ-2 protein contains a 44 amino acid gap compared to RaATAQ-1 with which it shares 90% overall similarity. An in silico prediction of antigenic peptides for Bm86 and BmATAQ did not result in the identification of common predicted antigenic regions with similarities higher than 60%.

Table 1. Novel Bm86 homologues and ATAQ genes identified in this study. GPI, glycosylphosphatidylinositol anchor; TM, transmembrane anchor.

Gene Tick species GenBank AA Molecular pI Glycosylation EGF do- Anchor Accession number weight (N-linked/O- mains number linked) (full/partial) BmATAQ R. microplus GU144589 605 66.6 4.82 8/2 6/1 TM BdATAQ R. decoloratus GU144591 605 66.5 5.16 8/4 6/1 TM BaATAQ R. annulatus GU144590 605 66.4 5.05 8/2 6/1 TM ReeATAQ R. e. evertsi GU144592 605 66.4 4.95 8/3 6/1 TM RaATAQ- R. appendicu- GU144594 605 66.7 5.42 7/3 6/1 TM 1 latus RaATAQ- R. appendicu- GU144593 561 61.6 5.33 8/1 6/1 TM 2 latus HmATAQ Hy.marginatum GU144595 601 65.5 5.18 5/1 6/1 TM DrATAQ D. reticulatus GU144596 596 64.7 4.79 9/2 6/1 TM DvATAQ D. variabilis GU144597 598 65.0 4.84 6/4 6/1 TM HeATAQ H. elliptica GU144598 597 65.6 5.47 3/17 6/1 GPI AvATAQ A. variegatum GU144599 522 57.5 5.04 4/1 6/1 GPI Ree86 R. e. evertsi GU144600 680 75.1 6.29 4/0 8/1 GPI Dr86 D. reticulatus GU144601 664 73.3 5.96 4/1 8/1 GPI Hm86 Hy. margina- GU144602 664 72.3 6.23 4/6 8/1 GPI tum Av86 A. variegatum GU144603 650 72.1 5.66 2/2 7/1 GPI Ir86-1 I. ricinus GU144605 619 68.0 6.33 5/10 7/1 GPI Is86-1 I. scapularis alignment 619 68.1 6.50 7/11 7/1 GPI of EW846881, EW825613 and EW943081 Ir86-2 I. ricinus GU979808 610 68.4 7.22 7/7 7/1 GPI Is86-2 I. scapularis alignment 610 68.6 6.95 8/3 7/1 GPI of EW929369, EW893350 and EW858856 Os86 O. savignyi GU979809 572 64.7 5.23 3/1 6/1 TM

136

126-152 - Chapter 5 17x24 220710.pdf 11 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

Figure 1. Comparison of the Bm86 structure of Rhipicephalus (Boophilus) microplus (Australia) with representative Bm86- and ATAQ-orthologues from other tick genera: Amblyomma variegatum (Av86 & AvATAQ), Dermacentor reticulatus (Dr86 & DrATAQ), Haemaphysalis elliptica (HeATAQ), Haemaphysalis longicornis (Hl86), Hyalomma anatolicum anatolicum (Haa86), Hyalomma marginatum (HmATAQ), Ixodes ricinus (Ir86-1 and Ir86-2), Ornithodoros savignyi (Os86), Rhipicephalus appendiculatus (Ra86) and Rhipicephalus evertsi evertsi (Ree- ATAQ). The signal peptides (red boxes), EGF-like domains (green boxes), partial EGF-like domains (light blue boxes), GPI anchors (dark blue boxes), transmembrane domain (orange highlights) and intracellular domain (yellow highlights) are indicated. Potential O-linked carbohydrate additions are indicated by a vertical line, potential N-linked carbohydrate additions by a Y symbol. The numbers corresponds to the amino acid positions of the start and end of each protein domain.

137

126-152 - Chapter 5 17x24 220710.pdf 12 26-7-2010 22:05:41 Chapter 5

Table 2. Identity / Similarity matrix of the Bm86 protein family. The numbers represent the percentage identity (in italics, upper right triangle) and similarity (lower left triangle) found

between the full amino acid sequences.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 1. Bm86 94 86 84 73 71 67 66 53 46 39 30 28 26 25 26 26 26 24 25 25 26 25 22 2. Ba86 96 88 86 74 72 67 66 53 47 40 30 29 27 26 26 26 26 25 25 25 26 24 22 3. Bd86-1 92 93 87 75 72 68 67 53 48 40 30 28 26 24 25 25 25 24 24 24 25 23 22 4. Ree86 89 91 93 76 75 68 68 54 46 41 31 28 27 25 25 25 25 24 25 25 26 24 23 5. Ra86-1 81 82 84 85 74 66 65 54 47 40 31 30 27 25 26 26 25 25 25 25 26 24 23 6. Rs86 83 83 84 86 85 68 69 56 49 42 30 30 28 25 25 25 25 24 24 25 26 23 22 7. Hm86 78 78 79 80 78 81 91 54 50 41 32 30 26 26 26 26 26 25 25 25 25 25 24 8. Haa86 79 79 81 81 78 81 95 52 48 42 31 30 27 27 26 26 25 26 26 26 25 24 24 9. Dr86 68 68 68 70 68 72 69 69 48 41 32 32 26 25 25 26 26 25 26 25 27 24 25 10. Av86 62 63 63 63 63 65 63 63 66 42 31 29 26 23 23 24 24 25 25 24 25 23 24 11. Hl86 55 55 55 57 57 57 57 56 56 58 33 30 30 29 29 29 29 29 29 28 29 26 25 12. Ir86-1 49 48 45 48 47 46 47 48 49 48 51 44 33 26 26 26 26 28 28 27 28 28 27 13. Ir86-2 45 45 44 45 46 47 45 45 46 46 49 62 30 28 27 28 27 27 28 28 28 25 26 14. Os86 41 41 41 43 43 41 42 42 41 44 47 51 47 29 28 30 29 29 30 30 29 28 28 15. BmATAQ 44 45 42 43 43 44 44 45 43 43 48 44 44 46 98 95 94 88 77 76 73 37 36 16. BaATAQ 43 44 42 42 43 44 44 44 42 43 47 43 43 46 99 95 94 87 77 75 72 37 36 17. BdATAQ 44 43 41 42 43 43 43 44 42 43 47 43 43 46 98 98 95 89 77 76 73 37 36 18. ReeATAQ 43 44 42 43 43 44 44 44 42 44 47 43 43 46 98 97 98 90 77 76 73 37 36 19. RaATAQ-1 43 43 42 43 43 44 43 44 41 45 48 43 44 47 94 93 94 94 79 75 73 38 36 20. HmATAQ 43 44 41 43 43 42 43 42 43 43 47 45 44 47 88 87 87 88 88 76 73 36 38 21. DrATAQ 43 42 42 43 43 44 43 43 41 42 47 46 44 47 85 85 85 85 86 87 89 37 36 22. DvATAQ 42 42 41 41 42 43 42 42 43 43 47 45 44 46 84 84 84 84 85 85 94 37 36 23. AvATAQ 40 39 38 40 37 38 38 40 38 38 43 41 40 44 51 51 50 52 51 51 52 51 40 24. HeATAQ 40 38 40 40 39 39 41 41 42 42 44 45 41 46 54 54 53 54 52 54 54 54 53

Two Bm86 homologues from the prostriate tick Ixodes ricinus (Ir86-1 and Ir86-2) were sequenced following 3’-RACE and 5’-RACE PCR with primers based on two Bm86-like sequences from the Ixodes scapularis EST database. Their amino acid sequences show 49% and 45% similarity to the Australian Bm86 sequence respectively and 59% similarity between each other (Table 2). Both proteins have seven full and one partial EGF-like domain and are predicted to contain a GPI anchor. The signature peptide found in the ATAQ proteins is not present in either of the sequenced Bm86 homologues from I. ricinus.

Phylogenetic analysis separated both Ir86-1 and Ir86-2 from the Bm86 and ATAQ protein groups (Fig. 2). Is86-1, the homologue of Ir86-1 from I. scapularis was annotated from EST data and shares 92% identity on nucleotide level with Ir86-1. When a tblastn search against assembled I. scapularis supercontigs was performed to study the genomic organization of Is86-1 and Is86-2, Is86-1 was shown to consist of 20 exons ranging from 48 to 171 bp in size and spanning >56 kb of genomic DNA. Exons 15 and 16 (AA 515-535 and 537-557) encode for repeats which are predicted to be extensively O-glycosylated. Similar repeats are also found in the Ir86-1 (AA515-535 and 537-557), Hl86 (BAF56919, AA 529-543 and 546-560) and HeATAQ (AA 531-549 and 552-570) sequences. The 19 exons of the annotated coding sequence of Is86-2, the I. scapularis homologue of Ir86-2 with which it shares 93% identity on nucleotide level, span >52 kb on the genome and range from 30 to 168 bp in size. The introns of Is86-1 and Is86-2 have a con-

138

126-152 - Chapter 5 17x24 220710.pdf 13 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

sensus GT/AG splice junction and average sizes of 3346 bp (205 – 15282 bp) and 3119 bp (498 - 12398 bp) respectively. Each of the first six full and one partial EGF-like domains of Is86-1 and Is86-2 is encoded by single exons whereas the last EGF-like domain is encoded by two exons (Is86-1: 17 and 18, Is86-2: 16 and 17). Sequence data for the region upstream of the start codon for Is86-1 is of poor quality in the IscaW1 assembly of supercontigs, but not for Is86-2 where a TATA box is found on position -59 to -54. The 3’ untranslated region (3’UTR) of both genes contain a polyadenylation signal (AATAAA).

Figure 2. Neighbor-joining tree showing the phylogenetic relationship of the Bm86 protein family based on protein sequences without the signal peptides. The numbers represent the percentage of 1000 replications (bootstrap support) for which the same branching patterns were obtained. The country of origin from each strain and GenBank Accession number are indicated. The Bm86 homologue from the soft tick Ornithodoros savignyi (Os86) was used as an outgroup.

139

126-152 - Chapter 5 17x24 220710.pdf 14 26-7-2010 22:05:41 Chapter 5

Blast analysis of all identified proteins belonging to the Bm86 family did not return significant hits other than the Bm86 homologues deposited at GenBank. The closest related proteins other than Bm86 are those with similar EGF or EGF-like domains such as latent transforming growth factor binding protein 4, fibrillin and matrilin.

Expression patterns of members of the Bm86 protein family Total RNA of various tissues from A. variegatum, R. microplus, I. ricinus and O. savignyi was screened by quantitative RT-PCR with gene specific primers for the expression of members of the Bm86 protein family. Expression levels were normalized using geometric averaging of reference genes ELF1A and TBP. The Bm86 homologues, Ir86-1 and Ir86-2 were found to be transcribed almost exclusively in the midgut whereas ATAQ proteins and the Bm86-like protein from O. savignyi were expressed in both midgut and Malpighian tubules (MT) (Fig. 3).

Figure 3. Quantitative RT-PCR analysis showing the transcription levels of Av86 and AvATAQ (A), Bm86 and BmATAQ (B), Ir86-1 and Ir86-2 (C) and Os86 (D) in various tissues of Amblyomma variegatum (A), Rhipicephalus (Boophilus) microplus (B), Ixodes ricinus (C) and Ornithodoros savignyi (D). Bars represent the 95% confidence interval of the expression normalized against ELF1A and TBP.

140

126-152 - Chapter 5 17x24 220710.pdf 15 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

The expression of BmATAQ and RaATAQ was also measured throughout all life stages of R. microplus and R. appendiculatus respectively by quantitative RT- PCR and normalization with multiple reference genes ELF1A, glyceraldehyde 3- phosphate dehydrogenase (GAPDH), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TBP (Fig. 4). BmATAQ was shown to be expressed constantly throughout the life cycle of R. microplus with limited variation. The expression of RaATAQ decreased slightly with feeding and molting of the juvenile lifestages of R. appendiculatus. The highest RaATAQ expression levels were found in unfed adults, where the expression also decreased during feeding in both females and males.

Figure 4. Relative BmATAQ (white bars) and RaATAQ (grey bars) expression levels in all life stages, normalized against the six most stably expressed reference genes in both B. microplus and R. appendiculatus: ELF1A, GAPDH, H3F3A, PPIA, RPL4 and TBP [16]. Bars represent the 95% confidence interval of the normalized expression.

Gene silencing of Ree86 and ReeATAQ in R. e. evertsi females by RNAi A small scale RNAi experiment was performed to determine the effect of silencing the expression of Ree86 and ReeATAQ, both alone and in combination, on the feeding of R. e. evertsi females. Mortality, engorgement weight and oviposited egg mass did not differ significantly between the test and mock-injected control groups (Table 3). Quantitative RT-PCR on total RNA extracted from the guts of females from each group demonstrated that the target genes were successfully silenced (Fig. 5). Ree86 expression levels normalized for the total amount of RNA used to generate the cDNA were 16% (±29%) higher in the ReeATAQ dsRNA injected group compared to the control group.

141

126-152 - Chapter 5 17x24 220710.pdf 16 26-7-2010 22:05:41 Chapter 5

Similarly, the ReeATAQ expression levels were found to be 14% (±5%) higher in the Ree86 dsRNA injected group compared to the control group. These differences were not significant (P>0.05) when the expression levels were normalized with reference genes ELF1A and TBP.

Table 3. Tick weight, mortality after feeding and egg mass weight in double-stranded RNA (dsRNA)-injected Rhipicephalus e. evertsi females. Each group consisted of 14 injected females.

Group Tick weight (mg) Mortality (%) Eggs/tick (mg)

Control 684 ± 117 0 310 ± 64 Ree86 575 ± 130 0 229 ± 129 ReeATAQ 629 ± 123 0 275 ± 56 Ree86 & ReeATAQ 671 ± 108 0 277 ± 92

Figure 5. Quantitative real-time RT-PCR analysis showing the relative Ree86 (grey bars) and ReeATAQ (white bars) transcript levels in the guts of partially fed females, 5 days after they were injected with injection buffer alone (TEl), Ree86-, ReeATAQ-, or a combination of Ree86- and ReeATAQ-dsRNA, and fed on calf #9918. Bars represent the 95% confidence interval of the expression normalized against the ELF1A and TBP transcript levels.

142

126-152 - Chapter 5 17x24 220710.pdf 17 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

Discussion

In this study, the diversity of Bm86 homologues from representatives of the main tick genera was characterized using RACE strategies with primers based on available sequence information from GenBank and the Ixodes scapularis genome project [18] followed by sequencing. The results of the phylogenetic analysis for these Bm86 orthologues (Fig. 2) are in general agreement with recent insights in the systematics of ticks with the Hyalomminae being embedded in the Rhipice- phalinae [1] and a clear division between the homologues from metastriate and prostriate ticks.

Interestingly, the combination of bioinformatics and RACE strategies led to the discovery of novel proteins which are structurally related to Bm86 and may be potential anti-tick vaccine candidates based on this similarity: two Bm86 homologues occurring in the prostriate ticks Ixodes ricinus (Ir86-1 and Ir86-2) and Ixodes scapularis (Is86-1 and Is86-2) and the ATAQ protein group from metastriate ticks. ATAQ orthologues could not be identified in the partially assembled genome and EST database of Ixodes scapularis or by 3’-RACE PCR using various degenerate primers on I. ricinus RNA (results not shown). The apparent lack of ATAQ orthologues in prostriate (Ixodes) ticks would indicate that these proteins developed after the divergence of Prostriata and Metastriata in acarine evolution. The combined results suggest that the evolution of the Bm86 protein family has been characterized by at least two gene duplication events: one in the prostriate lineage and a second one in the metastriate lineage resulting in the formation of the ATAQ protein group.

A clear function can not be attributed to members of the Bm86 protein family due to a lack of significant similarity to proteins with known functions. All members of the Bm86 protein family have a large number of cysteine residues and contain several regions with similarity to EGF-like domains. The consensus sequence for these EGF-like domains from Bm86 was previously defined as C-x(4,8)-C-x(3,6)- C-x(8,11)-C-x(0,1)-C-x(5,15)-C, based on the single sequence of Bm86 from R. microplus [23]. The majority of the EGF-like domains found in members of the Bm86 protein family do fall within this definition. However, the first EGF-like domain from Ir86-2 and Is86-2 contains 9 non-cysteine AA between its first two cysteine residues and the sixth EGF-like domain of BmATAQ contains only 3 non-cysteine AA between its first two cysteine residues. Based on these excep- tions, the new consensus sequence for the EGF-like domains of the Bm86 family can be broadened to C-x(3,9)-C-x(3,6)-C-x(8,11)-C-x(0,1)-C-x(5,15)-C.

143

126-152 - Chapter 5 17x24 220710.pdf 18 26-7-2010 22:05:41 Chapter 5

Bm86 from R. microplus was demonstrated to be anchored to the cell membrane by a GPI anchor [24]. All Bm86 orthologues, the Bm86 homologues from the Prostriata and the ATAQ proteins of A. variegatum and H. elliptica are predicted to be GPI anchored as well, whereas the ATAQ proteins of the Rhipicephalinae and Os86 are predicted to have a transmembrane anchor (Fig. 1, Table 1). Prece- dents exist in other protein families where some members are inserted into the cell membrane by a GPI anchor and others by a transmembrane anchor, for example in the cadherin superfamily [25] and the carcinoembryonic antigen (CAE) gene family. In the CAE family, only a small number of mutations in the transmembrane domain resulted in a shift from transmembrane- to GPI-anchorage [26]. The GPI anchor in Bm86 orthologues may thus be derived from an ancestral transmembrane domain found in the ATAQ proteins of the Rhipicephalinae and Os86. The relevance of the GPI anchor of Bm86 orthologues and the ATAQ protein of A. variegatum and H. elliptica is unknown. Putative cellular functions of GPI anchors include involvement in (I) the partitioning of lipid rafts, subdomains of the cell membrane enriched in cholesterol, sphingolipid and GPI-anchored proteins that organize the bioactivity of cell membranes [27], (II) signal transduction, (III) prion disease pathogenesis and (IV) acting as an apical-targeting signal [28]. The latter function may provide an explanation for the demonstrated polarized distribution of Bm86 on the apical region of gut digest cells [29]. However, many GPI anchored membrane proteins function equally well when the GPI anchor is substi- tuted by a transmembrane proteinaceous anchor [30]. Thus, it remains to be investigated if there is a functional difference between the GPI anchored and transmembrane anchored ATAQ proteins.

The tissue distribution of the Bm86 protein family differs: ixodid Bm86 orthologues, including the homologues from Ixodes ricinus are expressed exclusively in the midgut but ATAQ proteins and argasid Bm86 homologue (Os86) can be found in both the midgut and MT (Fig. 3). Although it is currently not known which cells expresses ATAQ in the MT, cells expressing the related Bm86 protein during embryogenesis are thought to be stem cells and/or prodigest cells of the tick midgut [16]. It is tempting to speculate that ATAQ may be expressed by stem cells of the tick midgut and MT in a similar fashion associating it with cell growth or differentiation. Although multipotent stem cells have recently been identified in the MT of Drosophila species [31], it is not known whether this cell type is present in the MT of ticks as well. Possible differences between prostriate and metastriate ticks that may explain the apparent lack of expression of a Bm86 protein family member in the MT of the prostriate I. ricinus (Fig. 3) have not been identified, as little is known about physiological processes occurring in the MT of ticks.

144

126-152 - Chapter 5 17x24 220710.pdf 19 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

The expression of ATAQ proteins in both midgut and MT is of interest in the development of vaccines for the control of tick infestations. Intuitively, its structural similarity to Bm86, the midgut antigen on which commercial tick vaccines targeting R. microplus are based, suggests that vaccination with a recombinant ATAQ protein may confer protection against homologous tick infestations to a similar extent as vaccination with Bm86 by damaging the midgut. If so, this may result in an increased cross-protection against heterologous Rhipicephalinae tick infestations compared to that found for Bm86-based vaccines since the ATAQ proteins of the Rhipicephalinae are more conserved than this group’s Bm86 orthologues (Table 2). The in silico prediction of antigenic peptides for both Bm86 and BmA- TAQ, which share 44% overall similarity, did not result in the identification of common epitopes with significant similarity. Furthermore, regions of Bm86 previously identified as immunogenic [13, 32] have no significant similarity with BmATAQ either (ranging from 9 to 29%), making it less likely that anti-Bm86 antibodies target BmATAQ as well. The expression of ATAQ in the MT could transform this organ into a potential second immunological attack site. Supporting data for the potential of the MT as a target tissue for an anti-tick vaccine comes from a recent vaccination trial in sheep targeting 5’-nucleotidase, an enzyme which is principally located in the MT. Vaccination with recombinant 5’- nucleotidase resulted in an overall egg mass reduction by a standard number of infesting R. microplus adults of 73% [33].

Though a highly effective vaccine antigen, gene silencing of Bm86 by RNA interference (RNAi) in R. microplus did not result in a phenotype which was significantly different than that of the control group and gene silencing of its orthologue Hl86 in H. longicornis produced only a weak phenotype [15, 22]. Similarly, the RNAi phenotype of R. e. evertsi females in which the expression of Ree86, ReeA- TAQ or a combination of both genes was silenced by RNAi did not differ from a mock injected control group (Table 3). It has previously been hypothesized that the expression of functional paralogues of a silenced gene in the salivary glands of ticks may be induced to compensate for the loss of function caused by the RNAi, thus representing a “fall-back” strategy of the tick [34]. We could not observe a similar effect for Ree86 and ReeATAQ, i.e. no upregulation of Ree86 was found when ReeATAQ was silenced and vice versa. RNAi as conducted here thus failed to suggest a function for these proteins or to provide indirect evidence that Bm86 orthologues (Ree86) and ATAQ proteins (ReeATAQ) are functional paralogues, despite their structural similarities.

145

126-152 - Chapter 5 17x24 220710.pdf 20 26-7-2010 22:05:41 Chapter 5

In conclusion, Bm86 homologues from various hard and soft tick species of veterinary and medical importance were isolated and sequenced. All Bm86 orthologues from hard ticks contains a signal peptide, six to eight EGF-like domains and a GPI anchor and are expressed in the midguts of ticks. A group of structurally similar proteins with a signal peptide, multiple EGF-like domains and a GPI- or transmembrane anchor were identified in several metastriate tick species and named ATAQ after a part of their signature peptide. ATAQ proteins were found to be expressed in both the midgut and MT of ticks. The potential of these Bm86 orthologues and the ATAQ proteins as anti-tick vaccine candidates, alone or in combination, remains to be investigated.

146

126-152 - Chapter 5 17x24 220710.pdf 21 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

Acknowledgements

Prof. A.W. Neitz and Dr. C. Maritz-Olivier (Department of Biochemistry, Univer- sity of Pretoria, South Africa), Prof. L. Fourie (ClinVet International, Bloemfonte- in, South Africa), Dr. B. Faburay (International Trypanotolerance Centre, the Gambia), Dr. M.A. Darghouth (Ecole Nationale de Médecine Vétérinaire, Sidi Thabet, Tunisia), Dr. A Latif (ARC-Onderstepoort Veterinary Institute, South Africa) and Prof. G. Uilenberg are acknowledged for supplying the tick strains used in this study. Peter Willadsen (CSIRO Livestock Industries, Queensland, Australia), José de la Fuente (Department of Veterinary Pathobiology, Oklahoma State University, Stillwater, USA) and Lesley Bell-Sakyi (The Roslin Wellcome Trust Tick Cell Biobank, Edinburgh, UK) are thanked for their valuable suggestions which helped to improve this paper. This research was supported by the Wellcome Trust under the ‘Animal Health in the Developing World’ initiative through project 075799 entitled ‘Adapting recombinant anti-tick vaccines to livestock in Africa’.

147

126-152 - Chapter 5 17x24 220710.pdf 22 26-7-2010 22:05:41 Chapter 5

References

1. Nava S, Guglielmone AA, Mangold AJ: An overview of systematics and evolution of ticks. Front Biosci 2009, 14:2857-2877. 2. Jongejan F, Uilenberg G: The global importance of ticks. Parasitology 2004, 129 Suppl:S3-14. 3. Willadsen P: Anti-tick vaccines. Parasitology 2004, 129 Suppl:S367- 387. 4. de la Fuente J, Kocan KM, Almazan C, Blouin EF: Targeting the tick- pathogen interface for novel control strategies. Front Biosci 2008, 13:6947-6956. 5. de la Fuente J, Almazan C, Canales M, Perez de la Lastra JM, Kocan KM, Willadsen P: A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 2007, 8(1):23-28. 6. Willadsen P, McKenna RV, Riding GA: Isolation from the cattle tick, Boophilus microplus, of antigenic material capable of eliciting a protective immunological response in the bovine host. Int J Parasitol 1988, 18(2):183-189. 7. Willadsen P, Riding GA, McKenna RV, Kemp DH, Tellam RL, Nielsen JN, Lahnstein J, Cobon GS, Gough JM: Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus. J Immunol 1989, 143(4):1346-1351. 8. Gough JM, Kemp DH: Localization of a low abundance membrane protein (Bm86) on the gut cells of the cattle tick Boophilus microplus by immunogold labeling. J Parasitol 1993, 79(6):900-907. 9. Canales M, Almazan C, Naranjo V, Jongejan F, de la Fuente J: Vaccination with recombinant Boophilus annulatus Bm86 ortholog protein, Ba86, protects cattle against B. annulatus and B. microplus infestations. BMC Biotechnol 2009, 9:29. 10. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. off. Vaccine 1998, 16(20):1990-1992. 11. Pipano E, Alekceev E, Galker F, Fish L, Samish M, Shkap V: Immunity against Boophilus annulatus induced by the Bm86 (Tick-GARD) vaccine. Exp Appl Acarol 2003, 29(1-2):141-149. 12. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in

148

126-152 - Chapter 5 17x24 220710.pdf 23 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245- 261. 13. Odongo D, Kamau L, Skilton R, Mwaura S, Nitsch C, Musoke A, Taracha E, Daubenberger C, Bishop R: Vaccination of cattle with TickGARD induces cross-reactive antibodies binding to conserved linear peptides of Bm86 homologues in Boophilus decoloratus. Vaccine 2007, 25(7):1287-1296. 14. Azhahianambi P, De La Fuente J, Suryanarayana VV, Ghosh S: Cloning, expression and immunoprotective efficacy of rHaa86, the homologue of the Bm86 tick vaccine antigen, from Hyalomma anatolicum anatolicum. Parasite Immunol 2009, 31(3):111-122. 15. Liao M, Zhou J, Hatta T, Umemiya R, Miyoshi T, Tsuji N, Xuan X, Fujisaki K: Molecular characterization of Rhipicephalus (Boophilus) microplus Bm86 homologue from Haemaphysalis longicornis ticks. Vet Parasitol 2007, 146(1-2):148-157. 16. Nijhof AM, Balk JA, Postigo M, Jongejan F: Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86. BMC Mol Biol 2009, 10(1):112. 17. Schwan EV, Hutton D, Shields KJ, Townson S: Artificial feeding and successful reproduction in Ornithodoros moubata moubata (Murray, 1877) (Acarina: Argasidae). Exp Appl Acarol 1991, 13(2):107-115. 18. Pagel Van Zee J, Geraci NS, Guerrero FD, Wikel SK, Stuart JJ, Nene VM, Hill CA: Tick genomics: the Ixodes genome project and beyond. Int J Parasitol 2007, 37(12):1297-1305. 19. Campanella JJ, Bitincka L, Smalley J: MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 2003, 4:29. 20. Van de Peer Y, De Wachter R: TREECON: a software package for the construction and drawing of evolutionary trees. Comput Appl Biosci 1993, 9(2):177-182. 21. Kolaskar AS, Tongaonkar PC: A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett 1990, 276(1- 2):172-174. 22. Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F: Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int J Parasitol 2007, 37(6):653-662.

149

126-152 - Chapter 5 17x24 220710.pdf 24 26-7-2010 22:05:41 Chapter 5

23. Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, Cobon GS: Cloning and expression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci U S A 1989, 86(24):9657-9661. 24. Richardson MA, Smith DR, Kemp DH, Tellam RL: Native and baculovirus-expressed forms of the immuno-protective protein BM86 from Boophilus microplus are anchored to the cell membrane by a glycosyl-phosphatidyl inositol linkage. Insect Mol Biol 1993, 1(3):139- 147. 25. Hulpiau P, van Roy F: Molecular evolution of the cadherin superfamily. Int J Biochem Cell Biol 2009, 41(2):349-369. 26. Naghibalhossaini F, Stanners CP: Minimal mutations are required to effect a radical change in function in CEA family members of the Ig superfamily. J Cell Sci 2004, 117(Pt 5):761-769. 27. Lingwood D, Simons K: Lipid rafts as a membrane-organizing principle. Science 2010, 327(5961):46-50. 28. Paulick MG, Bertozzi CR: The glycosylphosphatidylinositol anchor: a complex membrane-anchoring structure for proteins. Biochemistry 2008, 47(27):6991-7000. 29. Tellam RL, Smith D, Kemp DH, Willadsen P: Vaccination against ticks. In: Animal Parasite Control Utilizing Biotechnology. Edited by Yong WK. Boca Raton: CRC Press; 1992: 303-331. 30. Chatterjee S, Mayor S: The GPI-anchor and protein sorting. Cell Mol Life Sci 2001, 58(14):1969-1987. 31. Singh SR, Liu W, Hou SX: The adult Drosophila malpighian tubules are maintained by multipotent stem cells. Cell Stem Cell 2007, 1(2):191-203. 32. Patarroyo JH, Portela RW, De Castro RO, Pimentel JC, Guzman F, Patarroyo ME, Vargas MI, Prates AA, Mendes MA: Immunization of cattle with synthetic peptides derived from the Boophilus microplus gut protein (Bm86). Vet Immunol Immunopathol 2002, 88(3-4):163-172. 33. Hope M, Jiang X, Gough J, Cadogan L, Josh P, Jonsson N, Willadsen P: Experimental vaccination of sheep and cattle against tick infestation using recombinant 5'-nucleotidase. Parasite Immunol 2010, 32(2):135- 142. 34. Narasimhan S, Montgomery RR, DePonte K, Tschudi C, Marcantonio N, Anderson JF, Sauer JR, Cappello M, Kantor FS, Fikrig E: Disruption of Ixodes scapularis anticoagulation by using RNA interference. Proc Natl Acad Sci U S A 2004, 101(5):1141-1146.

150

126-152 - Chapter 5 17x24 220710.pdf 25 26-7-2010 22:05:41 Bm86 orthologues and the novel ATAQ protein family

Supplementary Table 1. List of primers used for 5’-RACE and 3’-RACE.

Primer name Sequence (5’3’) Location Purpose

Av86 5’-RACE R1 CACTGACAGACGGCAGTCTTATTTC 854-878 5’-RACE cDNA synthesis Av86 Av86 5’-RACE R2 TACCAGGTGAGCAGTAAGTCCCATCT 594-619 5’-RACE Av86 - 1st PCR Av86 5’-RACE R3 GCCTTTGAACAGTCGTTTTGGTCC 564-587 5’-RACE Av86 - 2nd PCR Av86 3’-RACE F1 GAGATGCGTCATTTCATGGTGTTTG -2-22 3’-RACE Av86 complete fragment AvATAQ 5’-RACE R1 CCCTCTTCAAACACACATTCCTTTCCCA 785-812 5’-RACE cDNA synthesis AvATAQ AvATAQ 5’-RACE R2 GCAGGGTTTTTTTTCTTCATCATTGC 752-777 5’-RACE AvATAQ – 1st PCR AvATAQ 5’-RACE R3 TGAACTCAGGTGACTTCTTATCAGTG 660-685 5’-RACE AvATAQ – 2nd PCR AvATAQ 3’-RACE F1 GCTTCCTCAGTGCCGTTTCATCC 32-54 3’-RACE AvATAQ complete fragment BDRATAQ 5’-RACE R1 TTACATTCAACTCTAGC(CT)TGGCACG 758-782 5’-RACE cDNA synthesis BmA- (B & R), TAQ, DrATAQ, DvATAQ, RaATAQ 740-764 and ReeATAQ (D) BDRATAQ 5’-RACE R2 CAGCGGTTATCCTCTCTCAG(CT)TT 520-542 5’-RACE BmATAQ, DrATAQ, (B&R), DvATAQ, RaATAQ and ReeATAQ - 499-521 1st PCR (D) BDRATAQ 5’-RACE R3 GTCATGCCATGTATTCCAGAACAGTC 307-332 5’-RACE BmATAQ, DrATAQ, (B&R), DvATAQ and RaATAQ - 2nd PCR 286- 311(D) BmBaRa ATAQ-F ATG(GA)GAA(GAT)AATGAACAACGAAC 1-23 3’-RACE BaATAQ, BdATAQ, G BmATAQ, HmATAQ, RaATAQ and ReeATAQ complete fragment DrATAQ 3’-RACE F1 GCCGATGAAACTCCCGATGATA 64-85 3’-RACE DrATAQ and DvATAQ complete fragment Dr86 5’-RACE R1 TTTTCGTA(GA)ACGCATATTTGTCCC 1566- 5’-RACE cDNA synthesis Dr86 1589 Dr86 5’-RACE R2 TTCCATCCCTGACAGCAACG 562-581 5’-RACE Dr86 – 1st PCR DrRee86 5’RACE R1 CCCGAAGTCAGAGCA(AG)ACAG 110-129 5’-RACE Dr86 and Ree86 - 2nd (Dr86), PCR 140-159 (Ree86) HeATAQ 5’-RACE R1 GTTCAGGAAGATTTTGTCGTCAGGA 840-864 5’-RACE cDNA synthesis HeATAQ HeATAQ 5’-RACE R2 ATGGTTTTGTCTCTACACCTGAATACG 732-758 5’-RACE HeATAQ - 1st PCR HeATAQ 5’-RACE R3 CGTCGTAGAGTTCTTTCCCTTCCG 710-733 5’-RACE HeATAQ - 2nd PCR HeATAQ 3’-RACE F1 CACTTGTCAGCGTATTCATCCTTGT 14-38 3’-RACE HeATAQ complete fragment Hm86 5’-RACE R1 CGGCAACTTCGGATACAGCAT 1282- 5’-RACE cDNA synthesis Hm86 1302 Hm86 5’-RACE R2 CGCACTTTCCGTCCAGTAGTTGTTGAT 881-907 5’-RACE Hm86 - 1st PCR Hm86 5’-RACE R3 TTCCCCATTCACCGCAATCGCAC 414-436 5’-RACE Hm86 - 2nd PCR Ir86-2 5’-RACE R1 TTGGTCATTGGTCGTTGGGGTA 732-753 5’-RACE cDNA synthesis Ir86-2 Ir86-2 5’-RACE R2 GTACATATCCAGTGGGGCAGAACG 641-664 5’-RACE Ir86-2 - 1st PCR Ir86-2 5’-RACE R3 CTCGCAGCAACGGTCGTCCTT 577-597 5’-RACE Ir86-2 – 2nd PCR Ir86-2 3’-RACE F1 ATGCGGTCGCTATGTTTGTTTG 1-22 3’-RACE Ir86-2 complete fragment Ir86-1 5’-RACE R1 GTTCCATCCTTGACAGCAGCGGT 560-582 5’-RACE cDNA synthesis Ir86-1 Ir86-1 5’-RACE R2 GCTTCTTGGCGGGTCCACAGTCG 447-469 5’-RACE Ir86-1 - 1st PCR Ir86-1 5’-RACE R3 GTAACGGACCGCAAGACTGCCAATG 256-280 5’-RACE Ir86-1 – 2nd PCR Os86 5’-RACE R1 GTTGCCAGAGCATTGTCCATTTCTTTCC 885-912 5’-RACE cDNA synthesis Os86 Os86 5’-RACE R2 GCACTTAGCCTTCTCCTCCGGGCTGCA 736-762 5’-RACE Os86 - 1st PCR Os86 5’-RACE R3 TGTTCCCATCCTTGACAGCACC 542-563 5’-RACE Os86 - 2nd PCR Os86 3’-RACE F1 AGCGGGGACCGTTTCGGATGAACAG 51-74 3’-RACE Os86 complete fragment Ra86 5’-RACE R1 CGACCTTGACGCATTTGTT 1432- 5’-RACE cDNA synthesis Ra86 1450 and Ree86 Ra86 5’-RACE R2 GCACCGTGTAGTAATACTCATTCAG 1081- 5’-RACE Ra86 and Ree86 – 1st 1104 PCR

151

126-152 - Chapter 5 17x24 220710.pdf 26 26-7-2010 22:05:41 Chapter 5

Ra86 5’-RACE R3 AGGAGCGGCTGAACAGTTTG 563-582 5’-RACE Ra86 – 2nd PCR Supplementary Table 2. List of primers used for the quantitative real-time RT-PCRs.

Gene GenBank Ac- Forward primer Reverse primer Amplicon Efficiency Name cession number length (%) (bp)

BaATAQ, GU144589, GCCAAGAATG- GACATTTGAACGAG- 101 105 BmATAQ GU144593 and CG(TC)CTACAAAG CACTCCTC & RaA- GU144594 TAQ Av86 GU144603 ACGGATGACTT- TTTCTGTCGCGGAAC- 144 89 CAAGACAAGACTG CCTTTT

AvATAQ GU144599 CAATACAGTAAG- GTTCCTCTCCGCACT- 129 90 CAGGACCGC CAATCA

Ir86-1 GU144605 ACCGCTGCTGTCAA ATCTGCGACATTTGCCGT 127 92 GGATGGA GC Ir86-2 GU979808 TGACAGGGTGCCTA GCAG- 79 100 AACTACAG CAACGGTCGTCCTT Os86 GU979809 GGACCAAGA- TCCTTCTTCCAACACA- 108 76 ACTGGCACATCAT CACTCTT

Ree86 GU144600 CGTCCCGACTTG- AG- 101 96 ACCTGC GAGCGGCTGAACAGTTT G ELF1A EW679365, CGCAAGTCTGGCAA AT(GA)CCACCAATCTTGT 124 90 CD797149, GTCTGA AGACG AF240836, EU574868 and XM_002411102 TBP XM_002402081, GCCAAGAGTGAA- AG- 82 102 CD780134 and GAGCAGTC GAACTTGGCGTCAAA(GA CV453818 )C

152

126-152 - Chapter 5 17x24 220710.pdf 27 26-7-2010 22:05:41

EXPRESSION OF RECOMBINANT RHIPICEPHALUS (BOOPHILUS) MICROPLUS, R. ANNULATUS AND R. DECOLORATUS BM86 ORTHOLOGS AS SECRETED PROTEINS IN PICHIA PASTORIS

CANALES M, DE LA LASTRA JM, NARANJO V, NIJHOF AM, HOPE M, JONGEJAN F, DE LA FUENTE J

BMC BIOTECHNOLOGY 2008; 8:14

12 PhD thesis Nijhof - Title page chapter 6.pdf 1 26-7-2010 22:57:14 001-216 - Dissertatie Ard - Versie 1.pdf 154 21-7-2010 22:44:14 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Abstract Rhipicephalus (Boophilus) spp. ticks economically impact on cattle production in Africa and other tropical and subtropical regions of the world. Tick vaccines constitute a cost-effective and environmentally friendly alternative to tick control. The R. microplus Bm86 protective antigen has been produced by recombinant DNA technology and shown to protect cattle against tick infestations. In this study, the genes for Bm86 (R. microplus), Ba86 (R. annulatus) and Bd86 (R. decoloratus) were cloned and characterized from African or Asian tick strains and the recombinant proteins were secreted and purified from Pichia pastoris. The secretion of recombinant Bm86 ortholog proteins in P. pastoris allowed for a simple purification process rendering a final product with high recovery (35–42%) and purity (80–85%) and likely to result in a more reproducible conformation closely resembling the native protein. Rabbit immunization experiments with recombinant proteins showed immune cross-reactivity between Bm86 ortholog proteins. These experiments support the development and testing of vaccines containing recombinant Bm86, Ba86 and Bd86 secreted in P. pastoris for the control of tick infestations in Africa.

155

001-216 - Dissertatie Ard - Versie 1.pdf 155 21-7-2010 22:44:14 Chapter 6

Introduction

Rhipicephalus (Boophilus) spp. ticks are distributed in tropical and subtropical regions of the world with range expansion for some species due to changes in cli- matic conditions [1-3]. Infestations with the cattle tick, Rhipicephalus (Boophilus) microplus, economically impact cattle production by reducing weight gain and milk production, and by transmitting pathogens that cause babesiosis (Babesia bovis and B. bigemina) and anaplasmosis (Anaplasma marginale) [4]. R. annulatus and R. decoloratus also affect cattle production and vector pathogens in regions of Latin America, Africa or Asia [2].

Control of tick infestations has been difficult because ticks have few natural ene- mies. Integrated tick management strategies include the adaptation of different control methods to a geographic area. A major component of integrated tick control methods is the application of acaricides. However, use of acaricides has had limited efficacy in reducing tick infestations and is often accompanied by serious drawbacks, including the selection of acaricide-resistant ticks, environmental contamination and contamination of milk and meat products with drug residues [5]. Furthermore, development of new acaricides is a long and expensive process. All of these issues reinforce the need for alternative approaches to control tick infestations [5]. Other approaches proposed for tick control have included the use of hosts with natural resistance to ticks, pheromone-impregnated decoys for attract- ing and killing ticks, biological control agents and vaccines [6-8].

In the early 1990s, vaccines were developed that induced immunological protection of vertebrate hosts against tick infestations. These vaccines contained the recombinant R. microplus Bm86 gut antigen [8-12]. Two vaccines using recombinant Bm86 were subsequently registered in Latin American countries (Gavac) and Australia (TickGARD) during 1993–1997 [13]. These vaccines reduce the number of engorging female ticks, their weight and reproductive capacity. Thus the great- est vaccine effect was the reduction of larval infestations in subsequent generations. Vaccine controlled field trials in combination with acaricide treatments demonstrated that an integrated approach resulted in control of tick infestations while reducing the use of acaricides [9, 13, 14]. These trials demonstrated that control of ticks by vaccination has the advantages of being cost-effective, reducing environmental contamination and preventing the selection of drug resistant ticks that result from repeated acaricide application. In addition, these vaccines may also prevent or reduce transmission of pathogens by reducing tick populations and/or affecting tick vectorial capacity [13-15].

156

001-216 - Dissertatie Ard - Versie 1.pdf 156 21-7-2010 22:44:14 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Controlled immunization trials have shown that R. microplus Bm86-containing vaccines also protect against related tick species, R. annulatus and R. decoloratus [16-18]. However, R. microplus strain-to-strain variations in the susceptibility to Bm86 vaccination have been reported, which suggests that Bm86 sequence and/or tick physiological differences may influence the efficacy of the vaccine [8, 19-22]. Therefore, the cloning, expression and vaccine formulation with recombinant Bm86 from local tick strains may be required for vaccine efficacy in some geographic regions [21].

The recombinant Bm86 has been expressed in Escherichia coli [10], Aspergillus nidulans and A. niger [23] and Pichia pastoris [11, 24, 25]. Of these expression systems, P. pastoris has been shown to be the more efficient for protein secretion [26, 27]. Furthermore, production of Bm86 in P. pastoris may increase the antigenicity and immunogenicity of the recombinant antigen [28, 29]. However, the process previously reported for the production of recombinant Bm86 in P. pastoris is not based on protein secretion but on the expression of the antigen anchored to the yeast membrane, making necessary the purification under denaturing conditions followed by refolding of an antigen with high number of disulfide bonds [24, 25, 30]. Recently, R. decoloratus Bm86 orthologs were cloned, expressed in E. coli and partially characterized [31]. However, the cloning and expression of recombinant R. annulatus and R. decoloratus Bm86 orthologs in P. pastoris have not been reported.

The objectives of this study were (i) to clone and express in P. pastoris the recombinant R. microplus, R. decoloratus and R. annulatus Bm86 orthologs from African or Asian tick strains and (ii) to simplify the Bm86 production process by secreting recombinant proteins encoded by Bm86 orthologs in P. pastoris.

157

001-216 - Dissertatie Ard - Versie 1.pdf 157 21-7-2010 22:44:14 Chapter 6

Material and Methods

Media and solutions All reagents used in this work were purchased from Sigma-Aldrich (St Louis, MO, USA) or VWR International Eurolab S.L. (Mollet del Vallés, Barcelona, Spain). The compositions of the media used in this study were as follows: Minimal methanol medium (MM): 13.4 g·L-1 yeast nitrogen base with ammonium sulphate and without amino acids (YNB); 0.0004 g·L-1biotin; 15 g·L-1 agar and 0.5% methanol.

Minimal methanol medium + Histidine (MMH): 13.4 g·L-1 YNB; 0.0004 g·L-1 biotin; 15 g·L-1 agar; 0.04 g·L-1 histidine and 0.5% methanol.

Minimal dextrose medium (MD): 13.4 g·L-1 YNB; 0.0004 g·L-1 biotin; 15 g·L-1 agar and 20 g·L-1 dextrose.

Minimal dextrose medium + Histidine (MDH): 13.4 g·L-1 YNB; 0.0004 g·L-1 biotin; 15 g·L-1 agar; 20 g·L-1 dextrose and 20 g·L-1 dextrose.

Yeast Extract Peptone medium (YP): 10 g·L-1 yeast extract and 20 g·L-1 peptone.

Yeast Extract Peptone Dextrose medium (YPD): 10 g·L-1 yeast extract; 20 g·L-1 peptone and 20 g·L-1 glucose.

Yeast Extract Peptone Dextrose Sorbitol medium (YPDS): 10 g·L-1yeast extract; 20 g·L-1 peptone; 20 g·L-1 glucose; 182 g·L-1 sorbitol and 20 g·L-1 agar.

-1 -1 Trace element solution (TES): 2.0 g·L ZnSO4 × 7H2O; 0.02 g·L CuSO4 × 5H2O; -1 -1 -1 -1 0.08 g·L KI; 0.3 g·L MnSO4 × H2O; 0.19 g·L Na2MoO4 × H2O; 0.02 g·L -1 H3BO3 and 2.9 g·L FeCl3.

Vitamin solution (VT): 0.4 g·L-1 calcium pantothenate; 0.4 g·L-1 tyamine; 4 g·L-1 myo-inositol; 0.1 g·L-1 nicotinic acid; 0.4 g·L-1 pyridoxine and 0.4 g·L-1 biotin.

-1 -1 -1 Production medium (PM): 13 g·L KH2PO4; 8.75 g·L (NH4)2SO4; 4.5 g·L -1 -1 -1 - MgSO4; 0.5 g·L CaCl2 × 2H2O; 2.5 g·L yeast extract; 5 ml·L TES and 5 ml·L 1 VT.

Cloning of R. microplus, R. annulatus and R. decoloratus Bm86 orthologs and sequence analysis Tick strains were obtained from laboratory colonies maintained at the Utrecht Centre for Tick-borne Diseases, Department of Infectious Diseases and Immunol-

158

001-216 - Dissertatie Ard - Versie 1.pdf 158 21-7-2010 22:44:14 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

ogy, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Nether- lands. Originally, tick strains were collected from infested cattle in Mozambique (R. microplus), Israel (R. annulatus) and South Africa (R. decoloratus).

Total RNA was extracted from the viscera of partially fed R. annulatus and R. microplus females and from eggs of R. annulatus and R. decoloratus using TriRea- gent (Sigma-Aldrich, St Louis, MO, USA) and following manufacturer's recommendations. Bm86 (R. microplus), Ba86 (R. annulatus) and Bd86 (R. decoloratus) coding regions (nucleotides 58–1884 of the coding region of Bm86 reference sequence; GenBank accession number M29321) lacking the signal peptide and GPI anchor sequences were amplified by RT-PCR. The RT-PCR was done using 10 pmol of each primer (CZABM5: 5'-A CTC GAG AAA AGA GAG TCA TCC ATT TGC TCT GAC TTC GG and CZABM3: 5'-A TCT AGA TTA AGC ACT TGA CTT TCC AGG ATC TG; Bm86 homologous regions are underlined) in a 50-μl volume (1.5 mM MgSO4, 1 × avian myeloblastosis virus (AMV) RT/Thermus flavus (Tfl) reaction buffer, 0.2 mM each deoxynucleoside triphos- phate (dNTP), 5 u AMV RT, 5 u Tfl DNA polymerase) employing the Access RT- PCR system (Promega, Madison, WI, USA). Reactions were performed in an au- tomated DNA thermal cycler (Techne model TC-512, Cambridge, England, UK). RNA was reverse transcribed for 45 min at 45°C prior to PCR consisting of an initial step of 2 min at 94°C followed by 35 cycles of a denaturing step of 30 sec at 94°C and an annealing-extension step of 2 min at 68°C. Control reactions were done using the same procedures, but without RNA added to control contamination of the PCR. PCR products were electrophoresed on 1% agarose gels to check the size of amplified fragments by comparison to a DNA molecular weight marker (1 Kb Plus DNA Ladder, Promega). The amplicon was resin purified (Wizard, Pro- mega) and cloned into pGEM-T vector (Promega). Partial sequences of cloned Bm86 orthologs were obtained by double-stranded dye-termination cycle sequencing (Core Sequencing Facility, Department of Biochemistry and Molecular Biology, Noble Research Center, Oklahoma State University and Secugen S.L, Madrid, Spain). At least three clones from independent PCR reactions were sequenced for each gene. Multiple sequence alignment was performed using the program AlignX (Vector NTI Suite V 8.0, InforMax, Invitrogen, Carlsbad, CA, USA) with an engine based on the Clustal W algorithm [32]. Searches for sequence similarity were performed at the ncbi with the BLASTN program against the nonredundant sequence database nr. The GenBank accession numbers for Bm86 (R. microplus), Ba86 (R. annulatus) and Bd86 (R. decoloratus) are EU191620–EU191622.

159

001-216 - Dissertatie Ard - Versie 1.pdf 159 21-7-2010 22:44:14 Chapter 6

Construction of expression plasmids Bm86, Ba86 and Bd86 coding regions were excised from pGEM-T by Xho I and Xba I digestion (restriction sites introduced during PCR by CZABM5 and CZABM3 primers, respectively) and cloned into P. pastoris expression vector pPICZαA (Invitrogen) digested with Xba I and Xho I. In this way, Bm86 orthologs were cloned under the control of the alcohol oxidase (AOX1) promoter, in frame with the yeast alfa-factor secretion signal but without the C-terminal c- myc/His tag due to a translation termination site introduced by CZABM3 primer during PCR. The expression constructs were sequenced at both ends and selected constructs with correct sequences were named pPAMoz9 (Bm86), pPADec8 (Bd86) and pBaI (Ba86) and used for transformation of P. pastoris.

Pichia pastoris transformation and screening for recombinant protein expression Expression plasmids were linearized by restriction with Sac I and transformed in- to P. pastoris strains GS115, KM71H and X33 (Invitrogen) by electroporation as described [33]. Transformants were selected on YPDS plates containing 100 μg·ml-1 Zeocin and incubated at 30°C. A functional assay to directly screen for high expression recombinant clones was made by culturing the transformants in an orbital shaker at 250 rpm and 30°C. Single colonies were inoculated in 1 ml YPDS containing 100 μg·ml-1 Zeocin and grown overnight. Cultures were divided into two parts of 500 μl each. Five hundred μl were transferred to 5 ml fresh YP medium with 20 g·L-1 glycerol, grown for 24 hrs and inoculated into 250 ml fresh YP medium supplemented with 20 g·L-1 glycerol. Growth in glycerol was re- sumed after 24 hrs and then methanol was added daily to 1% (v/v) during the course of induction. After 5 days growing on methanol, supernatants were collected by centrifugation for 15 min at 15,000 × g in a Beckman Allegra™ X-22R centrifuge, rotor F2402H (Beckman-Coulter, Palo Alto, CA, USA) and dot blots were made to screen for expression of recombinant proteins. The other 500 μl were also transferred to 5 ml fresh YP medium with 20 g·L-1 glycerol, grown for 24 hrs and mixed with glycerol to 250 g·L-1. Long term stocks were prepared as 100 μl aliquots and stored frozen at -80°C.

Analysis of the Mut phenotype in P. pastoris transformed strains The high expression transformants of X33 and GS115 strains were analyzed for Mut+ or MutS phenotype using the functional assay described in the Invitrogen user's manuals K1710-01 and K1750-01 [33]. The KM71H strain always produces a MutS phenotype [33]. Briefly, 50 μl from the long term stocks of the high expression X33 and GS115 transformants were streaked in YPDS plates containing 100 μg·ml-1 Zeocin and incubated at 30°C for 24 hrs. One colony of each transformant

160

001-216 - Dissertatie Ard - Versie 1.pdf 160 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

was streaked in both MMH and MDH plates for the GS115 and X33 strains. To differentiate Mut+ from MutS, control GS115/Albumin (MutS) and GS115/pPicz/lacZ (Mut+) strains (Invitrogen) were streaked in the MMH and MDH plates. Plates were incubated at 30°C for 3 days and cell growth was observed and compared to controls.

Fermentation process Pre-inoculums and inoculums for bioreactor cultures were grown in a shaker at 30°C and 250 rpm. Two 100 μl long term stock vials were seeded in 1 ml YP medium, grown for 12 hrs and transferred into 4 × 50 ml tubes containing 5 ml of YP medium with 20 g·L-1 glycerol. After 24 hrs, cultures were mixed again and 5 ml were used to inoculate 2 L Erlenmeyer flasks containing 250 ml of YP medium -1 with 20 g·L glycerol. Cells were grown to an O.D.600 nm between 15 and 20 and then cultures were inoculated into a 5-L working volume Biostat B bioreactor (B. Braun Biotech, Melsungen, Germany) containing 3.5 L of PM with 40 g·L-1 glycerol.

During the fermentation process, temperature was kept at 30°C and dissolved oxygen was maintained at 30% saturation by regulating agitation and aeration rates. A three-phase cultivation protocol was used in the fermentation. The glycerol growth phase included a 12 to 14 hrs batch stage from the starting point followed by a 10 to 12 hrs glycerol fed-batch stage. A glycerol solution of 50% (v/v) was added to the fermentor for 4 hrs to reach an equivalent total quantity of 60 g·L-1 in the culture medium. Upon exhaustion of glycerol, indicated by a sharp increase in dissolved oxygen, methanol induction was made by adding 1% (v/v) methanol to the culture medium and 3 hrs later the fed-batch phase was started by feeding methanol according to the P. pastoris Fermentation Process Guideline [33]. The pH was allowed to drop to 3.5 during the whole glycerol phase and it was maintained in this value by the addition of NH4OH. Prior to methanol induction, pH was adjusted and maintained at 5.5 by adding NH4OH or H3PO3. Throughout the fermentation processes, supplements of 20 ml TES and VT solutions were added to the culture medium every 24 hrs. Additionally, GS115 strain cultures were supplemented with 0.04 g·L-1 L-Histidine every 24 hrs.

Biomass analysis during fermentation Time-course samples were withdrawn from the fermentor at regular intervals to check growth rate and protein concentration in the supernatant. Cell density was expressed as O.D.600 nm, either measured as grams of wet weight per litter broth -1 (O.D.600 nm = 1.39 × wet weight (g·L ) - 27.26), which was obtained by centrifu-

161

001-216 - Dissertatie Ard - Versie 1.pdf 161 21-7-2010 22:44:15 Chapter 6

gation of the samples at 15,000 × g for 15 min or measured directly in the culture medium. Total protein concentration in the culture medium was quantified using the Bradford method with BSA as standard [34].

Cells harvesting, recovery and purification of recombinant proteins Cultures from the 5-L fermentor were centrifuged at 3,900 × g for 15 min in a Beckman Allegra™ X-22R centrifuge, rotor SX4250 (Beckman-Coulter) to separate cells. Supernatants were then collected and filtered through a tandem filtration system with a 20 μm cartridge (Sartorius AG, Goettingen, Germany), 5 μm and 0.45-0.22 μm cartridges (Millipore, Billerica, MA, USA) and checked for total and recombinant protein content using the Bradford method with BSA as standard [34] and the Experion semiautomated electrophoresis system (Bio-Rad, Her- cules, CA, USA). For the Experion, 4 μl of denatured proteins were loaded into a Pro 260 Chip and protein concentration was determined following manufacturer's recommendations. Recombinant proteins were separated by size exclusion using a Sartocon® Slice 200 ultrafiltration system having a Hydrosart membrane with a molecular weight cut-off of 50 kDa (Sartorius). Finally, protein solutions were concentrated and diafiltrated against four volumes of phosphate buffer pH 8.3 using a centrifugal concentrator VIVACELL 100 (50 kDa cut-off; Sartorius) in a Beckman Allegra™ X-22R centrifuge, rotor SX4250 (Beckman-Coulter) at 3,900 × g.

Vaccine formulation and analysis Prior to adjuvation of the vaccine, protein solutions were adjusted to a concentration of 120 μg·ml-1 and filtered through 0.45 and 0.22 μm cartridges (Sartorius AG) under sterile conditions in a laminar flow to obtain a sterile antigen solution. Adjuvation was made by mixing a solution of anhydromannitoletheroctodece- noate (Montanide ISA 50 V; Seppic, Paris, France) with the recombinant protein solution in batch-by-batch processes using a high-speed mixer Heidolph DIAX 900 (Heidolph Elektro, Kelheim, Germany) at 8,000 rpm and the vaccine was filled manually under sterile conditions in glass bottles of 20 ml (Wheaton, Mill- ville, NJ, USA). Quality controls were made by testing mechanical and thermal stability of vaccine emulsions as described by Canales et al. [25].

Rabbit immunization with recombinant proteins Two New Zealand White rabbits per group was each immunized with 3 doses (weeks 0, 4 and 8) containing 50 μg/dose of purified recombinant proteins formulated as described above or Gavac (Revetmex, Mexico City, Mexico) as control. Rabbits were injected subcutaneously with 1 ml/dose using a 1 ml tuberculin syringe and a 27 1/2G needle. Two weeks after the last immunization, blood sam-

162

001-216 - Dissertatie Ard - Versie 1.pdf 162 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

ples were collected from each rabbit into sterile tubes and maintained at 4°C until arrival at the laboratory. Serum was then separated after centrifugation and stored at -20°C. Rabbits were cared for in accordance with standards specified in the Guide for Care and Use of Laboratory Animals.

SDS-PAGE, dot blot and Western blot analyses Protein samples were analyzed by denaturing SDS-PAGE with a 12% PAGEgel- SDS cassette gel (PAGE-gel Inc, San Diego, CA, USA) under reducing conditions. Protein bands were visualized by either Coomassie Brilliant Blue R250 or silver staining. Samples were treated with dithiothreitol (DTT) reducer (PAGE-gel Inc.), heated in boiling water for 5 min before loading onto the gel and electrophoresed for 80 min at 90 mA constant current.

Electrophoretic transfer of proteins from gels to nitrocellulose membranes (PRO- TRAN BA85; Schleicher and Schuell, Dassel, Germany) for Western blot analysis was carried out in a Minie-Genie Electroblotter semi-dry transfer unit (Idea Scien- tific, Corvallis, OR, USA) according to manufacture's protocol. Protein samples of 2 μl were absorbed onto nitrocellulose membrane by gravity flow to perform the dot blot analysis. A standard curve was constructed with known amounts of recombinant Bm86 extracted from Gavac (Revetmex) and was used for semi- quantitative analysis in dot-blots. The supernatant of the GS115/Albumin strain (Invitrogen) grown under the same conditions was used as a negative control in both dot- and Western-blots. Membranes for dot or Western blots were blocked with 5% skim milk for 1 hr at room temperature, washed three times in TBS (25 mmol/L Tris·HCl, 150 mmol/L NaCl, pH 7.6) and probed with sera from rabbits immunized with Gavac (Revetmex) (1:1000 dilution) or recombinant proteins (1:5000 dilution) as described above. The antisera were diluted in 3% BSA in TBS. Membranes were then washed three times with TBS and incubated with an anti-rabbit IgG horseradish peroxidase (HRP) conjugate (Sigma-Aldrich) diluted 1:1000 in TBS. After washing the membranes again, color was developed using TMB stabilized substrate for HRP (Promega).

Results and Discussion

Cloning and sequence analysis of Bm86, Bd86 and Ba86 The Bm86 orthologs were cloned by RT-PCR from Mozambique R. microplus (Bm86), Israeli R. annulatus (Ba86) and South African R. decoloratus (Bd86) tick strains. Partial sequences were obtained and used to search the NCBI nr database for sequence identity. The first four BLAST hits (E-value = 0.0) showed that

163

001-216 - Dissertatie Ard - Versie 1.pdf 163 21-7-2010 22:44:15 Chapter 6

cloned Bm86, Bd86 and Ba86 sequences were identical (90–97% identity) to previously reported Bm86 (Australian Yeerongpilly reference strain; GenBank accession number M29321), Bm95 (Argentinean A strain; AF150891) and Bd86-1 and Bd86-2 (Kenyan strain; DQ630523 and DQ630524) sequences. The only fragment of 1,107 nucleotides previously reported for Ba86 (Mexican strain; AF150897) had 99.9% identity to the Ba86 sequence reported here with a single A × G substitution at position 1,674 (position 1 corresponds to the adenine in the initiation codon of the M29321 reference sequence). The Bm86 sequence of the Mozambique R. microplus strain reported here had a deletion of 66 nucleotides between positions 554 and 619 not found in other Bm86 sequences, which suggested that this region encoding for 22 amino acids may not be important for protein function. The Bd86 sequence of the South African R. decoloratus strain had an 18 nucleotides insertion between positions 1,690 and 1,691, similar to Bd86-2 and three nucleotides longer than in Bd86-1 [31].

Pairwise nucleotide and amino acid sequence alignments were conducted between cloned Bm86, Ba86 and Bd86 sequences and those identified above to have identity to these sequences (Table 1). The results showed that sequence identity was higher between Bm86 and Ba86 than with Bd86 sequences.

Table 1. Nucleotide and amino acid sequence comparison between Bm86 orthologs. Percent identity among nucleotide (above diagonal) and percent similarity among deduced amino acid (below diagonal) sequences between Bm86 orthologs were determined. Sequences were aligned and percent identity/similarity was determined using the program AlignX. Abbreviations: Rm, R. microplus; Ra, R. annulatus; Rd, R. decoloratus. GenBank accession numbers are shown in parenthesis. The sequences reported in this study are identified wth an asterisk.

Rm Bm86 Rm Bm95 Rm Bm86 Ra Ba86 Rd Bd86-2 Rd Bd86-1 Rd Bd86 (M29321) (AF150891) (EU191620) (EU191621) (DQ630524) (DQ630523) (EU191622)

Rm Bm86 99 94 96 90 90 90 (M29321) Rm Bm95 98 94 96 90 90 90 (AF150891) Rm Bm86 93 92 92 86 87 86 (EU191620)* Ra Ba86 94 94 90 91 91 91 (EU191621)* Rd Bd86-2 85 86 82 87 96 97 (DQ630524) Rd Bd86-1 86 86 82 88 94 96 (DQ630523) Rd Bd86 86 87 82 88 96 94 (EU191622)*

164

001-216 - Dissertatie Ard - Versie 1.pdf 164 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Production and characterization of P. pastoris strains for the expression of recombinant Bm86, Bd86 and Ba86 The plasmids pPAMoz9, pPADec8 and pBaI were transformed into P. pastoris strains GS115, KM71H and X33 for expression of recombinant Bm86, Bd86 and Ba86 proteins. Single colonies of P. pastoris transformants for each gene were grown in an orbital shaker under induction conditions. Culture supernatants were spotted on a nitrocellulose membrane for dot-blot analysis of recombinant proteins. Expression of Bm86 and Bd86 was obtained in GS115 and KM71H strains while Ba86 was expressed in strain X33 only (Table 2). Expression levels varied between 1.0 and 6.0 mg·L-1, representing 1.5% to 13.2% of total proteins in the supernatant (Table 2). For recombinant Bm86 and Bd86, differences in expression levels were not observed between GS115 and KM71H strains. The highest expression levels were obtained for Ba86 in strain X33 (Table 2). The recombinant strains GS115Moz9-2, KM71HDec8-1 and X33pBaI-3 with highest expression levels of Bm86, Bd86 and Ba86, respectively, were selected for fermentation scale up in a 5-L bioreactor.

The GS115Moz9-2, KM71HDec8-1 and X33pBaI-3 high expression strains had a MutS phenotype (Table 3). It has been demonstrated that transformation of P. pastoris with plasmids using the AOX1 expression system may lead to three mutant phenotypes with regard to methanol utilization [35]. The Mut+ phenotype grows on methanol at the wild-type rate and requires high feeding rates of methanol, the MutS phenotype has a disruption in the AOX1 gene and has a slower specific growth rate in methanol and the Mut- is unable to grow in methanol. Although transformation of X-33 and GS115 strains with linearized constructs favor single crossover recombination at the AOX1 locus and generates a Mut+ phenotype, double crossover recombination that results in the disruption of the wild-type AOX1 gene and the generation of a MutS phenotype is possible. The P. pastoris strains with a MutS phenotype grow slower in methanol but may be better hosts for the secretion of recombinant proteins [36].

165

001-216 - Dissertatie Ard - Versie 1.pdf 165 21-7-2010 22:44:15 Chapter 6

Table 2. Screening for Bm86, Bd86 and Ba86 expression in the culture supernatant of P. pastoris transformants. The experiments were conducted twice with similar results.

Recombinant Parental Recombinant Total protein Recombinant pro- % of strain strain protein concentration tein concentration total pro- (mg·L-1)a (mg·L-1)b teinc

GS115Moz9-1 GS115 Bm86 66.5 3.0 4.5 GS115Moz9- GS115 Bm86 65.5 3.3 5.0 2* GS115Moz9-3 GS115 Bm86 65.3 1.0 1.5 KM71HMoz9- KM71H Bm86 66.3 1.0 1.5 1 KM71HMoz9- KM71H Bm86 66.8 3.0 4.5 2 KM71HMoz9- KM71H Bm86 64.8 1.5 2.3 3

GS115Dec8-1 GS115 Bd86 64.4 1.0 1.6 GS115Dec8-2 GS115 Bd86 66.4 1.5 2.3 GS115Dec8-3 GS115 Bd86 66.0 1.5 2.3 KM71HDec8- KM71H Bd86 66.0 2.0 3.0 1* KM71HDec8-2 KM71H Bd86 63.4 1.5 2.4 KM71HDec8-3 KM71H Bd86 63.5 1.0 1.6

X33pBaI 1 X33 Ba86 49.7 1.0 2.0 X33pBaI 2 X33 Ba86 45.5 1.0 2.2 X33pBaI 3* X33 Ba86 45.4 6.0 13.2 X33pBaII 1 X33 Ba86 55.8 5.5 9.8 X33pBaII 2 X33 Ba86 48.3 5.0 10.4 X33pBaII 3 X33 Ba86 46.9 4.0 8.5 aDetermined using the Bradford method with BSA as standard [49]. bDetermined by semi-quantitative analysis in dot-blots using a standard curve constructed with known amounts of recombinant Bm86 extracted from Gavac (Revetmex). cDetermined as the percent of recombinant protein in total preoteins. *Recombinant strains with highest Bm86, Bd86 and Ba86 concentration in the culture supernatant were selected for fermentation and protein production.

Table 3. Characterization of the fermentation process for the secretion of recombinant Bm86, Bd86 and Ba86.

166

001-216 - Dissertatie Ard - Versie 1.pdf 166 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Recombinant Mut O.D. 600 μmax in μmax in Total protein Recombinant protein strain phenotype nm before glycerol methanol concentration induction (h-1)a (h-1)b (mg·L-1)c

Concentration Purity Productivity (mg·L-1)c (%)c (mg·L-1·h-1)c

GS115Moz9- MutS 115 0.181 0.005 274 150 55 2.1 2 KM71HDec8- MutS 125 0.182 0.002 194 110 57 1.5 1 X33pBaI 3 MutS 125 0.178 0.003 170 112 66 1.6

a The maximum growth rate (μmax) was determined during the exponential growth phase on glycerol in batch and fedbatch modes. b The maximum growth rate (μmax) was determined during the exponential growth phase on methanol (first 20–24 hrs after induction). cDetermined in the culture medium 72 hrs after induction with methanol using the Bradford method with BSA as standard [49] and the Experion semiautomated electrophoresis system (Bio-Rad, Hercules, CA, USA).

Expression of recombinant Ba86, Bd86 and Bm86 proteins in P. pastoris The GS115Moz9-2, KM71HDec8-1 and X33pBaI-3 strains were used for bench- top fermentation exploiting the methanol utilization ability of P. pastoris strains in PM medium. This medium was previously used for P. pastoris fermentations to express high levels of recombinant Bm86 [25, 37].

The initial phase of the fermentation process (biomass production phase) ended after 20–24 hrs and induction of recombinant protein expression started at the on- set of methanol-adoption and utilization phases. As expected, all strains behaved similarly when growing on glycerol as the sole carbon source (Table 3). Cell densities before induction and maximum growth rates on glycerol were very similar and similar to those previously reported in P. pastoris [36, 38]. The selected fed-batch strategy to feed methanol was identical for all strains. Once glycerol used as carbon source in the initial batch and fed-batch phases was con- sumed, recombinant protein expression was induced by the addition of methanol to the culture medium. An exponential growth phase was then observed during the next 20–24 hrs with maximum growth rates of 0.005, 0.002 and 0.003 h-1 for the strains GS115Moz9-2, KM71HDec8-1 and X33pBaI-3, respectively. However, after 24 hrs growth in methanol, cells stop growing and a steady increase in pO2 levels revealed that a stationary growth phase was achieved. Nevertheless, total protein production continued to increase gradually to 274, 194 and 170 mg·L-1 for the strains GS115Moz9-2, KM71HDec8-1 and X33pBaI-3, respectively (Table 3 and Figs. 1 and 2).

167

001-216 - Dissertatie Ard - Versie 1.pdf 167 21-7-2010 22:44:15 Chapter 6

Figure 1. Characterization of the growth of P. pastoris strains during the fermentation process. Time profile of optical density measurements of P. pastoris strains GS115Moz9-2, KM71HDec8-1 and X33pBaI-3 expressing recombinant Bm86, Bd86 and Ba86, respectively.

Figure 2. Characterization of protein secretion in P. pastoris strains during the fermentation process. Time profile of total protein concentration in the culture medium of P. pastoris strains GS115Moz9-2, KM71HDec8-1 and X33pBaI-3 expressing recombinant Bm86, Bd86 and Ba86, respectively.

In this first approach to obtain recombinant Bm86, Bd86 and Ba86 secreted to the culture medium, methanol was supplied at 1 ml·h-1·L of the initial fermentation volume for the first two hrs and then methanol supply was increased in 10% in- crements every 30 min to a rate of 3 ml·h-1·L. This strategy probably did not al-

168

001-216 - Dissertatie Ard - Versie 1.pdf 168 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

low maintaining a steady concentration of methanol throughout the whole fermentation process and either starvation or accumulation of methanol could have occurred. This fact may explain lower growth rates and expression levels of recombinant Bm86, Bd86 and Ba86 when compared to the 65 g·L-1 dry weight and 1.5 g·L-1 of recombinant protein previously reported for membrane-bound Bm86 in P. pastoris [11, 25, 37]. These results suggest that recombinant Bm86, Bd86 and Ba86 protein expression levels may be increased by the optimization of the fermentation and methanol induction processes.

The presence of recombinant proteins in the culture supernatant was demonstrated at the end of the fermentation process by SDS-PAGE and Western blot (Fig. 3). Recombinant Bm86, Bd86 and Ba86 secreted in P. pastoris appeared in SDS- PAGE and Western blots as a major wide band with a size range of 100 to 110 kDa and smaller degradation fragments (Fig. 3). The recombinant Bm86 previously expressed in P. pastoris also had degradation products and a major wide band, but with a size ranging from 90 to 100 kDa [11]. These differences in estimated molecular weight of the proteins may be due to strain differences in glycosylation, which is responsible for the wide appearance of the protein band in the SDS- PAGE and Western blot [11].

Protein recovery and purification To obtain a clarified supernatant for recombinant protein purification, a primary centrifugation step was performed at 3,900 × g. Due to the fact that P. pastoris culture centrifugation at g-forces between 3,000–5,000 results in a significant product entrainment [39], a washing step of cell pellets was made for the full recovery of secreted proteins.

P. pastoris secretes few autologous proteins [40]. Therefore, heterologous protein secretion serves as the major first step in recombinant protein purification. How- ever, unclear supernatants and recombinant protein purities ranging between 55% and 66% suggested the presence of contaminants in the supernatant after cell separation (Table 4). This observation suggested that probably cell lysis occurred during the stationary phase of the fermentation process due to suboptimal growth conditions. Cell lysis during the fermentation may have contributed to protein degradation, thus affecting recombinant protein yield and reinforcing the need for optimization of the fermentation process to reduce protein degradation and increase expression levels.

169

001-216 - Dissertatie Ard - Versie 1.pdf 169 21-7-2010 22:44:15 Chapter 6

Figure 3. Secretion of recombinant Bm86, Bd86 and Ba86 by P. pastoris. Silver stained SDS-PAGE (lanes 1–5) and Western blot analysis (lanes 6–10) of the fermentation culture supernatants after 72 hrs growing in methanol. Samples of 15 μL were loaded in each well. Membranes for Western blot were probed with serum from rabbits immunized with control Bm86 (Gavac; Revetmex) diluted 1:1000. Membranes were then washed three times with TBS and incubated with an anti- rabbit IgG HRP conjugate (Sigma-Aldrich) diluted 1:1000 in TBS. After washing the membranes again, color was developed using TMB stabilized substrate for HRP (Promega). Lanes 1 and 6: molecular weight markers (MW; ColorBurst, Sigma- Aldrich). Lanes 2 and 7: culture supernatants of the P. pastoris GS115/Albumin negative control strain. Lanes 3 and 8, 4 and 9, and 5 and 10: culture supernatants of X33pBaI-3 (Ba86), GS115Moz9-2 (Bm86) and KM71HDec8-1 (Bd86) strains, respectively. The position of recombinant proteins is indicated with arrows.

It has been demonstrated in previous cell fractionation experiments of P. pastoris that a wide range of particles densities and sizes are present in a disrupted suspension of the yeast [41, 42]. Therefore, to separate particles in suspension from secreted recombinant proteins, supernatants were filtered throughout 5, 0.45 and 0.22 μm filtration systems, which resulted in 20–25% increase in recombinant protein purity (Table 4). Finally, size exclusion and diafiltration through a 50 kDa cut-off membrane resulted in 80–85% pure recombinant proteins (Table 4 and Fig. 4).

170

001-216 - Dissertatie Ard - Versie 1.pdf 170 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Table 4. Characterization of the recombinant Bm86, Bd86 and Ba86 purification process. Abbrev- iations: conc., concentration; rec., recombinant.

40 Recovery Recovery (%) --- 62

Purity (%) 66 78 85

) 1 -

Rec. Rec. protein conc. (mg·L 112 77 314

) 1 -

Ba86 Total protein conc. (mg·L 170 99 370

Recovery Recovery (%) --- 55 42

Purity (%) 57 82 75

) 1 -

Rec. Rec. protein conc. (mg·L 110 63 370

) 1 -

Bd86 Total protein conc. (mg·L 194 84 451

Recovery Recovery (%) --- 60 35

Purity (%) 55 70 80

) 1 -

Rec. Rec. protein conc. (mg·L 150 96 326

) 1 -

Bm86 Total protein conc. (mg·L 274 137 407

Purification stages Fermentation supernatant Culture and separation microfiltration Ultrafiltration and diafiltration

171

001-216 - Dissertatie Ard - Versie 1.pdf 171 21-7-2010 22:44:15 Chapter 6

Figure 4. Characterization of purified recombinant proteins. Western blot analysis of the purified recombinant Bm86 (lane 2), Bd86 (lane 3) and Ba86 (lane 4) proteins. On each well, 3.5 μg proteins were loaded. Membranes were probed with serum from rabbits immunized with control Bm86 (Gavac; Revetmex) diluted 1:1000. Membranes were then washed three times with TBS and incubated with an anti-rabbit IgG HRP conjugate (Sigma-Aldrich) diluted 1:1000 in TBS. After washing the membranes again, color was developed using TMB stabilized substrate for HRP (Promega). Lane 1: molecular weight markers (MW; ColorBurst, Sigma- Aldrich). The position of recombinant proteins is indicated with arrows.

The purity of recombinant proteins reported herein after protein secretion and a simple centrifugation-filtration purification process was higher than that obtained for membrane-bound Bm86 [25, 37]. The purification of the membrane-bound Bm86 required cell disruption, washing of cell pellet, denaturation, renaturation and protein precipitation procedures [25, 37]. In spite of the high level expression obtained during fermentation [11, 37] and the optimization of the purification process [25, 43-46] for the membrane-bound Bm86, the secretion of recombinant Bm86 in P. pastoris reported herein allowed for higher recovery and purity of recombinant protein after purification.

Additionally, an important advantage of secreting recombinant proteins in P. pastoris, particularly for proteins with complex structures and a high number of disulfide bonds such as Bm86 [47], is that the isolation of a membrane-bound form under denaturing conditions followed by refolding is very unlikely to reform all disulfide bonds correctly and reproducibly. By contrast, if disulfide bond formation occurs through the natural cell processing and secretion machinery as re-

172

001-216 - Dissertatie Ard - Versie 1.pdf 172 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

ported herein, the product is more likely to have a reproducible conformation closely resembling the native protein.

The recombinant Bm86 has been expressed in E. coli [10], A. nidulans and A. niger [23] and P. pastoris [11, 24, 25]. Other expression systems using arthropod cell lines have been considered. However, despite recent advances in the application of insect cell culture technology for the production of recombinant proteins, the process is still more expensive and difficult to scale-up when compared to proteins expressed in E. coli and P. pastoris [48]. The secretion of recombinant Bm86 ortholog proteins reported here in P. pastoris is easy to scale-up, simple, reproducible and likely to result in a product with high antigenicity and immunogenicity [28, 29].

Characterization of recombinant Bm86, Bd86 and Ba86 Although differences may exist in antigen recognition between cattle and rabbits [49], rabbits have been proven to recognize some Bm86 protective epitopes [11, 50] and were therefore considered a suitable host to evaluate immune cross- reactivity between recombinant Bm86 ortholog proteins. The purified recombinant Bm86, Bd86 and Ba86 were adjuvated and used to immunize rabbits. The sera from immune rabbits were used to evaluate by Western blot the immune cross-reactivity between Bm86 ortholog proteins. The results showed that recombinant Bm86, Bd86 and Ba86 contained cross-reactive epitopes (Fig. 5). These results are in agreement with previous reports for Bd86 [31] and may explain, at least in part, the efficacy of the Bm86-containing vaccine against R. annulatus and R. decoloratus infestations [16-18]. However, despite immune cross-reactivity between Bm86 ortholog proteins, the differences in the efficacy of Bm86-containing vaccines against different Rhipicephalus spp. may be attributed to differences in the sequence of protective epitopes and/or physiological differences between tick species. Only cattle vaccination experiments with the recombinant antigens obtained here and challenging with homologous and heterologous Rhipicephalus spp. could fully address this question.

173

001-216 - Dissertatie Ard - Versie 1.pdf 173 21-7-2010 22:44:15 Chapter 6

Figure 5. Immune cross-reactivity between Bm86 ortholog proteins. Western blot analysis of the purified recombinant Ba86 (lane 1), Bd86 (lane 2) and Bm86 (lane 3) proteins. On each well 1.5 μg proteins were loaded. Membranes were probed with serum from rabbitts immunized with recombinant Ba86 (A), Bd86 (B) and Bm86 (C) diluted 1:5000. Membranes were washed three times with TBS and incubated with an anti-rabbit IgG HRP conjugate (Sigma-Aldrich) diluted 1:1000 in TBS. After washing the membrane again, color were developed using TMB stabilized substrate for HRP (Promega). MW: molecular weight marker (ColorBurst, Sigma-Aldrich). The position of recombinant proteins is indicated with arrows.

Conclusion We have cloned and secreted in P. pastoris the recombinant R. microplus, R. decoloratus and R. annulatus Bm86 orthologs from African or Asian tick strains. To our knowledge, this is the first study of Bm86, Bd86 and Ba86 secretion in P. pastoris. The results reported herein have shown that in P. pastoris, Bm86 ortholog recombinant proteins are secreted and purified from the culture supernatant with high yield and purity. The purification process for secreted proteins was simpler than that described for membrane-bound Bm86, which suggests the possibility of simplifying the purification process for recombinant Bm86 when secreted in P. pastoris. Additionally, secretion of recombinant Bm86 ortholog proteins in P. pastoris is likely to result in a more reproducible conformation closely resembling the native protein. Finally, the preliminary immunological characterization of recombinant Bm86, Bd86 and Ba86 evidenced the presence of cross-reactive epitopes among these proteins. These results suggest that these recombinant antigens can be used for the development of vaccines for the control of tick infestations in Africa. The control of livestock Rhipicephalus spp. infestations in Africa would contribute to improve animal health and production in this region.

174

001-216 - Dissertatie Ard - Versie 1.pdf 174 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

Authors' contributions MC carried out the expression, fermentation and protein purification and characterization studies. JMPL, VN and AMN carried out the genetic studies and participated in the sequence alignment. MH participated in the design of the study and helped to draft the manuscript. JF did the sequence alignment. FJ and JF conceived the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements We thank Peter Willadsen (CSIRO Livestock Industries, Queensland, Australia) for comments and suggestions to the work presented in this paper and to Leon Fourie (ClinVet, Bloemfontein, South Africa) and Varda Shkap (Division of Para- sitology, Kimron Veterinary Institute, Bet Dagan, Israel) for providing the R. decoloratus and R. microplus and R. annulatus tick strains, respectively. This work was supported by the Wellcome Trust under the Animal Health in the Developing World initiative through project 075799 entitled "Adapting recombinant anti-tick vaccines to livestock in Africa" and the Consejería de Educación y Ciencia, JCCM, Spain (project PAI06-0046-5285) and was facilitated through the Inte- grated Consortium on Ticks and Tick-borne Diseases (ICTTD-3), financed by the International Cooperation Program of the European Union, coordination action project No. 510561. V. Naranjo was funded by Junta de Comunidades de Castilla – La Mancha (JCCM), Spain.

175

001-216 - Dissertatie Ard - Versie 1.pdf 175 21-7-2010 22:44:15 Chapter 6

References

1. Barker SC, Murrell A: Systematics and evolution of ticks with a list of valid genus and species names. Parasitology 2004, 129 Suppl:S15-36. 2. Estrada-Pena A, Bouattour A, Camicas JL, Guglielmone A, Horak I, Jon- gejan F, Latif A, Pegram R, Walker AR: The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodi- dae) in Africa and Latin America. Exp Appl Acarol 2006, 38(2-3):219- 235. 3. Olwoch JM, Van Jaarsveld AS, Scholtz CH, Horak IG: Climate change and the genus Rhipicephalus (Acari: Ixodidae) in Africa. Onderste- poort J Vet Res 2007, 74(1):45-72. 4. Peter RJ, Van den Bossche P, Penzhorn BL, Sharp B: Tick, fly, and mos- quito control--lessons from the past, solutions for the future. Vet Para- sitol 2005, 132(3-4):205-215. 5. Graf JF, Gogolewski R, Leach-Bing N, Sabatini GA, Molento MB, Bordin EL, Arantes GJ: Tick control: an industry point of view. Parasitology 2004, 129 Suppl:S427-442. 6. de la Fuente J, Kocan KM: Strategies for development of vaccines for control of ixodid tick species. Parasite Immunol 2006, 28(7):275-283. 7. Sonenshine DE, Kocan KM, de la Fuente J: Tick control: further thoughts on a research agenda. Trends Parasitol 2006, 22(12):550-551. 8. Willadsen P: Tick control: thoughts on a research agenda. Vet Parasitol 2006, 138(1-2):161-168. 9. de la Fuente J, Kocan KM: Advances in the identification and characterization of protective antigens for recombinant vaccines against tick infestations. Expert Rev Vaccines 2003, 2(4):583-593. 10. Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, Co- bon GS: Cloning and expression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci U S A 1989, 86(24):9657- 9661. 11. Rodriguez M, Rubiera R, Penichet M, Montesinos R, Cremata J, Falcon V, Sanchez G, Bringas R, Cordoves C, Valdes M et al: High level expression of the B. microplus Bm86 antigen in the yeast Pichia pastoris forming highly immunogenic particles for cattle. J Biotechnol 1994, 33(2):135-146. 12. Willadsen P, Riding GA, McKenna RV, Kemp DH, Tellam RL, Nielsen JN, Lahnstein J, Cobon GS, Gough JM: Immunologic control of a para-

176

001-216 - Dissertatie Ard - Versie 1.pdf 176 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

sitic arthropod. Identification of a protective antigen from Boophilus microplus. J Immunol 1989, 143(4):1346-1351. 13. de la Fuente J, Almazan C, Canales M, Perez de la Lastra JM, Kocan KM, Willadsen P: A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 2007, 8(1):23-28. 14. de la Fuente J, Rodriguez M, Redondo M, Montero C, Garcia-Garcia JC, Mendez L, Serrano E, Valdes M, Enriquez A, Canales M et al: Field studies and cost-effectiveness analysis of vaccination with Gavac against the cattle tick Boophilus microplus. Vaccine 1998, 16(4):366-373. 15. Rodriguez Valle M, Mendez L, Valdez M, Redondo M, Espinosa CM, Vargas M, Cruz RL, Barrios HP, Seoane G, Ramirez ES et al: Integrated control of Boophilus microplus ticks in Cuba based on vaccination with the anti-tick vaccine Gavac. Exp Appl Acarol 2004, 34(3-4):375- 382. 16. de La Fuente J, Rodriguez M, Garcia-Garcia JC: Immunological control of ticks through vaccination with Boophilus microplus gut antigens. Ann N Y Acad Sci 2000, 916:617-621. 17. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245-261. 18. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. off. Vaccine 1998, 16(20):1990-1992. 19. de la Fuente J, Garcia-Garcia JC, Gonzalez DM, Izquierdo G, Ochagavia ME: Molecular analysis of Boophilus spp. (Acari: Ixodidae) tick strains. Vet Parasitol 2000, 92(3):209-222. 20. Garcia-Garcia JC, Gonzalez IL, Gonzalez DM, Valdes M, Mendez L, Lamberti J, D'Agostino B, Citroni D, Fragoso H, Ortiz M et al: Sequence variations in the Boophilus microplus Bm86 locus and implications for immunoprotection in cattle vaccinated with this antigen. Exp Appl Acarol 1999, 23(11):883-895. 21. Garcia-Garcia JC, Montero C, Redondo M, Vargas M, Canales M, Boue O, Rodriguez M, Joglar M, Machado H, Gonzalez IL et al: Control of ticks resistant to immunization with Bm86 in cattle vaccinated with the recombinant antigen Bm95 isolated from the cattle tick, Boophilus microplus. Vaccine 2000, 18(21):2275-2287.

177

001-216 - Dissertatie Ard - Versie 1.pdf 177 21-7-2010 22:44:15 Chapter 6

22. Sossai S, Peconick AP, Sales-Junior PA, Marcelino FC, Vargas MI, Neves ES, Patarroyo JH: Polymorphism of the bm86 gene in South American strains of the cattle tick Boophilus microplus. Exp Appl Acarol 2005, 37(3-4):199-214. 23. Turnbull IF, Smith DR, Sharp PJ, Cobon GS, Hynes MJ: Expression and secretion in Aspergillus nidulans and Aspergillus niger of a cell surface glycoprotein from the cattle tick, Boophilus microplus, by using the fungal amdS promoter system. Appl Environ Microbiol 1990, 56(9):2847-2852. 24. Boue O, Farnos O, Gonzalez A, Fernandez R, Acosta JA, Valdes R, Gon- zalez LJ, Guanche Y, Izquierdo G, Suarez M et al: Production and biochemical characterization of the recombinant Boophilus microplus Bm95 antigen from Pichia pastoris. Exp Appl Acarol 2004, 32(1-2):119- 128. 25. Canales M, Enriquez A, Ramos E, Cabrera D, Dandie H, Soto A, Falcon V, Rodriguez M, de la Fuente J: Large-scale production in Pichia pastoris of the recombinant vaccine Gavac against cattle tick. Vaccine 1997, 15(4):414-422. 26. Cregg JM, Vedvick TS, Raschke WC: Recent advances in the expression of foreign genes in Pichia pastoris. Biotechnology (N Y) 1993, 11(8):905- 910. 27. Zhang W, Sinha J, Smith LA, Inan M, Meagher MM: Maximization of production of secreted recombinant proteins in Pichia pastoris fed- batch fermentation. Biotechnol Prog 2005, 21(2):386-393. 28. Garcia-Garcia JC, Montero C, Rodriguez M, Soto A, Redondo M, Valdes M, Mendez L, de la Fuente J: Effect of particulation on the immunogenic and protective properties of the recombinant Bm86 antigen expressed in Pichia pastoris. Vaccine 1998, 16(4):374-380. 29. Garcia-Garcia JC, Soto A, Nigro F, Mazza M, Joglar M, Hechevarria M, Lamberti J, de la Fuente J: Adjuvant and immunostimulating properties of the recombinant Bm86 protein expressed in Pichia pastoris. Vaccine 1998, 16(9-10):1053-1055. 30. Rodriguez Valle M, Montero C, Machado H, Joglar M, de la Fuente J, Garcia-Garcia JC: The evaluation of yeast derivatives as adjuvants for the immune response to the Bm86 antigen in cattle. BMC Biotechnol 2001, 1:2. 31. Odongo D, Kamau L, Skilton R, Mwaura S, Nitsch C, Musoke A, Taracha E, Daubenberger C, Bishop R: Vaccination of cattle with TickGARD induces cross-reactive antibodies binding to conserved linear peptides

178

001-216 - Dissertatie Ard - Versie 1.pdf 178 21-7-2010 22:44:15 Expression of recombinant Bm86 orthologs as secreted proteins in Pichia pastoris

of Bm86 homologues in Boophilus decoloratus. Vaccine 2007, 25(7):1287-1296. 32. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994, 22(22):4673-4680. 33. Invitrogen user's manuals K1710-01 and K1750-01 [http://www.invitrogen.com] 34. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976, 72:248-254. 35. Macauley-Patrick S, Fazenda ML, McNeil B, Harvey LM: Heterologous protein production using the Pichia pastoris expression system. Yeast 2005, 22(4):249-270. 36. Cos O, Resina D, Ferrer P, Montesinos JL, Valero F: Heterologous production of Rhizopus oryzae lipase in Pichia pastoris using the alcohol oxidase and formaldehyde dehydrogenase promotores in bacth and fed-batch cultures. Biochem Eng J 2005, 26:86-94. 37. Enriquez A, Canales M, Ramos E, Dandie H, Boue O, Soto A, Cabrera D: Production of a recombinant vaccine against Boophilus microplus. In: Recombinant vaccines for the control of cattle tick. Edited by de la Fuente J. La Habana: Elfos Scientiae; 1995: 79-103. 38. Zhang W, Potter KJH, Plantz BA, Schlegel VL, Smith LA, Meagher MM: Pichia pastoris fermentation with mixed-feeds of glycerol and methanol: growth kinetics and production improvement. J Ind Microbiol Bio- technol 2003, 30:210-215. 39. Thommes J, Halfar M, Gieren H, Curvers S, Takors R, Brunschier R, Kula MR: Human chymotrypsinogen B production from Pichia pastoris by integrated development of fermentation and downstream processing. Part 2. Protein recovery. Biotechnol Prog 2001, 17(3):503-512. 40. Cregg JM, Madden KR, Barringer KJ, Thill GP, Stillman CA: Functional characterization of the two alcohol oxidase genes from the yeast Pichia pastoris. Mol Cell Biol 1989, 9(3):1316-1323. 41. Liu H, Tan X, Russell KA, Veenhuis M, Cregg JM: PER3, a gene required for peroxisome biogenesis in Pichia pastoris, encodes a peroxisomal membrane protein involved in protein import. J Biol Chem 1995, 270(18):10940-10951. 42. Waterham HR, de Vries Y, Russel KA, Xie W, Veenhuis M, Cregg JM: The Pichia pastoris PER6 gene product is a peroxisomal integral

179

001-216 - Dissertatie Ard - Versie 1.pdf 179 21-7-2010 22:44:15 Chapter 6

membrane protein essential for peroxisome biogenesis and has sequence similarity to the Zellweger syndrome protein PAF-1. Mol Cell Biol 1996, 16(5):2527-2536. 43. Boue O, Sanchez G, Tamayo G, Hernandez L, Reytor E, Enriquez A: Sin- gle-step purification of recombinant Bm86 produced in Pichia pastoris by salting-out and acid precipitation of contaminants. Biotechnol Techniques 1997, 11:561-565. 44. Buxadó JA, Heynnegnezz L, Juiz AG, Tamayo G, Lima IR, Marshalleck HD, Mola EL: Scale-up of processes to isolate the misstargeted rBm86 protein from Pichia pastoris. Afr J Biotechnol 2004, 3:559-605. 45. Canales M, Buxadó JA, Heynnegnezz L, Enriquez A: Mechanical disruption of Pichia pastoris yeast to recover the recombinant glycoprotein Bm86. Enzyme Microb Technol 1998, 23:58-63. 46. Canales M, De la Fuente J: Mechanical disruption of the yeast Pichia pastoris grown in methanol. Minerva Biotechnol 2006, 18:137-144. 47. Montesino R, Cremata J, Rodriguez M, Besada V, Falcon V, de la Fuente J: Biochemical characterization of the recombinant Boophilus microplus Bm86 antigen expressed by transformed Pichia pastoris cells. Bio- technol Appl Biochem 1996, 23 ( Pt 1):23-28. 48. Agathos SN: Development of serum-free media for lepidopteran insect cell lines. Methods Mol Biol 2007, 388:155-186. 49. Garcia-Garcia JC, de la Fuente J, Kocan KM, Blouin EF, Halbur T, Onet VC, Saliki JT: Mapping of B-cell epitopes in the N-terminal repeated peptides of Anaplasma marginale major surface protein 1a and characterization of the humoral immune response of cattle immunized with recombinant and whole organism antigens. Vet Immunol Immuno- pathol 2004, 98(3-4):137-151. 50. Patarroyo JH, Portela RW, De Castro RO, Pimentel JC, Guzman F, Patar- royo ME, Vargas MI, Prates AA, Mendes MA: Immunization of cattle with synthetic peptides derived from the Boophilus microplus gut protein (Bm86). Vet Immunol Immunopathol 2002, 88(3-4):163-172.

180

001-216 - Dissertatie Ard - Versie 1.pdf 180 21-7-2010 22:44:15

SUMMARIZING DISCUSSION

14 PhD thesis Nijhof - Title page chapter 7.pdf 1 26-7-2010 22:58:48 001-216 - Dissertatie Ard - Versie 1.pdf 182 21-7-2010 22:44:15 Summarizing discussion

The veterinary and medical importance of ticks and methods for tick control are outlined in Chapter 1. Tick control on livestock worldwide relies principally on the use of acaricides, but the development of acaricide resistance and environmental pollution concerns underscore the need for alternative control methods, for instance through the use of anti-tick vaccines. Two commercial vaccines based on the recombinant Bm86 protein from Rhipicephalus (Boophilus) microplus ticks were developed, demonstrating the feasibility of tick control through vaccination. Bm86 is a glycoprotein of unknown function which is located predominantly on the surface of tick midgut digest cells. Vaccination with recombinant Bm86 typically leads to a reduction of maximal 50% in the number of R. microplus ticks engorging on vaccinated animals, lower engorgement weights and a decrease in the number of oviposited eggs. The impact of vaccination on the reproductive performance is only seen in the second and subsequent tick generations by a reduced number of larvae in the field [1]. Bm86 based vaccines give a high protection efficacy (>99% reduction on the number of engorging ticks) against Rhipicephalus (Boophilus) annulatus infestations [2-4], partial cross-protection against several other tick species, e.g. Rhipicephalus (Boophilus) decoloratus, Hyalomma anatolicum anatolicum and Hyalomma dromedarii, but do not work against Amblyom- ma variegatum and Rhipicephalus appendiculatus [5, 6]. The inefficacy of Bm86 vaccines against some tick species and absence of a direct knock-down effect are the main disadvantages of these vaccines and justify the development of improved vaccine formulations. Various issues which may contribute to the development of second generation tick vaccines were investigated in the present study, the results of which are described in the experimental Chapters 2-6. These include the development of novel strategies for RNA interference (RNAi) in the one-host tick R. microplus (Chapter 2), functional studies on the tick vaccine candidate subolesin (Chapter 3), the selection of reference genes for quantitative RT-PCR studies in R. microplus and R. appendiculatus and the role of Bm86 antigen abundance in this species’ vaccine susceptibility (Chapter 4), characterization of Bm86 homologues from argasid and ixodid tick species of veterinary and medical importance (Chapter 5) and the expression of recombinant Bm86 protein as secreted protein in Pichia pastoris (Chapter 6).

A strategy to apply RNAi in the one-host tick species Rhipicephalus (Boophilus) microplus is described in Chapter 2 and the expression of tick-protective antigens Bm86, Bm91 and subolesin was successfully silenced in feeding R. microplus females. A novel method is introduced to study gene function in embryogenesis in the same chapter. By injecting dsRNA into the hemocoel of freshly engorged female ticks through the spiracular plates, gene silencing can be established in the

183

001-216 - Dissertatie Ard - Versie 1.pdf 183 21-7-2010 22:44:15 Chapter 7

eggs. This principle of transovarial RNAi was later shown to be applicable to other ixodid tick species as well [7]. It was also used in a recent study in which the R. microplus homologues of proteins associated with cell viability in Drosophila melanogaster RNAi screens were silenced in R. microplus embryos and a R. microplus embryonic cell line (BME26). Replication of the D. melanogaster RNAi functional data was found for 9 of 10 selected homologues in the transovarial RNAi screen, whereas only genes associated with proteasomes had an effect on cell viability in vitro. These findings confirm the potential of transovarial gene silencing to study gene function in embryogenesis [8]. The method could also be used to study tick-pathogen interactions, e.g. genes involved in the transovarial transmission of Babesia spp.

Gene silencing was still observed in the larvae hatching from the eggs laid by dsRNA injected engorged females. The gene expression levels of Bm86 and Bm91 were measured at 6 days and 5 weeks after hatching and although their expression was still significantly lower compared to the control group, these differences became less and appeared to diminish over time. This process was visualized in an experiment in which tropomyosin, a protein involved in muscle contraction, was silenced by transovarial RNAi in R. microplus. Injection of tropomyosin dsRNA in engorged females resulted in uncoordinated locomotion of their larval progeny compared to the control group at first, but this phenotype became less pronounced over time (A.M. Nijhof, unpublished results). When the Bm86 and Bm91 silenced larvae were fed at the age of seven weeks and adults were collected three weeks later, gene silencing was not observed any longer. These results may be explained by the slow dilution of gene silencing factors. The possibility to silence genes in larvae by transovarial RNAi could perhaps be used to study the role of genes associated with acaricide resistance, which is measured in larvae by the Larval Packet Test [9].

Our knowledge on the mechanism of RNAi in ticks is sketchy and most of our understanding of RNAi is derived from model organisms such as D. melanogaster and Caenorhabditis elegans. A systemic RNAi silencing mechanism is active in ticks, as demonstrated by the spread of gene silencing throughout the organism and its progeny following injection of dsRNA into the body cavity. This systemic RNAi has been associated with the sid-1 protein in C. elegans. Sid-1 is a transmembrane protein which enables passive cellular uptake of dsRNA [10]. Our attempts to detect a R. microplus sid-1 homologue, following the same approach as described previously for the detection of sid-1 in the grasshopper species Schisto- cerca americana [11], were not successful. A recent comparative genomic screen

184

001-216 - Dissertatie Ard - Versie 1.pdf 184 21-7-2010 22:44:16 Summarizing discussion

for RNAi related proteins in R. microplus expressed sequence tags (EST) and I. scapularis genome reads did not identify a sid-1 homologue either [8]. It therefore seems plausible that an alternative dsRNA uptake pathway, for instance by receptor-mediated endocytosis as described for D. melanogaster [12], may be present in ticks. Putative homologues of the downstream RNAi pathway in ticks such as Dicer, responsible for processing dsRNA into small interfering RNAs (siRNAs), and components of the RNA-induced silencing complex (RISC) were recently identified by comparative genomics [8] and provide support for the presence of a conserved RNAi mechanism in ticks.

Ticks injected with dsRNA coding for the genes identified by expression library immunization (ELI) as being protective [13] and subsequently fed on naive animals showed higher mortality, lower engorgement weights and reduced reproductive capacities compared to mock-injected controls. These similarities in the results between ELI and RNAi led to the suggestion that RNAi may be used for the screening of tick protective antigens [14]. However, such an approach has its limitations as it cannot determine whether the target is accessible and susceptible to the host’s immune system, an essential requirement for any anti-tick vaccine target [15]. Furthermore, the absence of a significant phenotype in R. microplus and R. e. evertsi ticks in which the highly effective Bm86 gene was silenced (Chapter 2 and Chapter 5) demonstrates the possibility of missing potential candidates by RNAi screening. Other factors which complicate the use of RNAi in the screening for tick protective antigens are differences in the RNAi efficiency for different targets, off-target effects and fluctuations in the relative importance of proteins during the tick’s life cycle. Proteins involved in ecdysis for instance might be potential vaccine targets, but silencing of genes encoding for these proteins in adult females is unlikely to result in an aberrant phenotype. Despite these potential drawbacks on the use of RNAi as a screening tool for tick- protective antigens, the method did result in the identification of the promising tick vaccine candidate subolesin (initially called 4D8). Vaccination with recombinant subolesin confers partial protection against tick infestation [16, 17] and resulted in a decreased ability of ticks to become infected with A. phagocytophilum [18]. Subolesin is an evolutionary conserved protein and silencing its expression by RNAi resulted in a degeneration of gut, salivary gland and reproductive tissues and caused sterility in males [19, 20]. Gene silencing of subolesin in feeding adults affected the expression of Bm86 and Bm91 and injection of subolesin dsRNA in engorged females affected egg development and hatching (Chapter 2). The profound effect of subolesin knockdown in ticks and other organisms such as D. melanogaster and C. elegans led to the hypothesis that subolesin may play a

185

001-216 - Dissertatie Ard - Versie 1.pdf 185 21-7-2010 22:44:16 Chapter 7

role in gene expression, i.e. the process by which a gene gets turned on in a cell to make RNA and proteins, thus affecting multiple cellular processes. The results from a combination of methodological approaches outlined in Chapter 3 provide evidence that subolesin indeed plays a role in gene expression in ticks. A publication, which appeared after our work was submitted, renamed subolesin orthologues in insects and vertebrates as Akirins and proposed that they constitute transcription factors required for NF-κB-dependent gene expression in Drosophila and mice [21, 22].

Two genes, GI and GII, encoding for proteins which interact with subolesin were identified by yeast two-hybrid experiments. Both proteins contained domains and post-translational modification sites found in proteins with regulatory functions, with GII being an orthologue of elongation factor 1 alpha (ELF1A). Subolesin, GI or GII dsRNAs or injection buffer alone were injected into either unfed or replete R. microplus females and the GII knockdown phenotype was similar to that obtained with subolesin. Gene knockdown could not be demonstrated for GI. RNA extracted from ticks involved in a second RNAi experiment wherein subolesin was silenced in I. scapularis was used for suppression-subtractive hybridization (SSH) and microarray construction and analysis. Results from this experiment demonstrated that subolesin knockdown affected the expression of genes involved in multiple cellular pathways. Although off-target effects of subolesin knockdown could not be ruled out, evidence suggested that this was not a likely possibility to explain the effect of subolesin knockdown on tick gene expression pattern. Com- plementary sequences between subolesin and identified differentially expressed genes that could support off-target effects of subolesin silencing were not found. However, the possibility of off-target gene silencing effects cannot be excluded in any tick RNAi study due to the limited amount of sequence data available. Avail- ability of complete annotated tick genome resources will facilitate screening for potential off-target effects which can subsequently be minimized by avoiding the use of dsRNAs or siRNAs containing sequences which are present in multiple genes.

For analysis of gene expression data from the RNAi experiments by quantitative RT-PCR as described in Chapters 2 and 3, we normalized the initial amount of starting RNA and made use of a single reference gene beta-actin (ACTB) for normalization, a common strategy in tick research. However, the presumed expression stability of ACTB has never been examined and in Chapter 4 we examined the expression stability of this and eight other potential reference genes, beta-tubulin (BTUB), elongation factor 1alpha (ELF1A), glyceraldehyde 3-

186

001-216 - Dissertatie Ard - Versie 1.pdf 186 21-7-2010 22:44:16 Summarizing discussion

phosphate dehydrogenase (GAPDH), glutathione S-transferase (GST), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TATA box binding protein (TBP), by measuring their transcription levels in all life stages of R. microplus and Rhipicephalus appendiculatus ticks. The ideal reference gene should be expressed at a constant level in the tissue(s) of interest at all stages of development and be unaffected by the specific experimental treatment being examined. However, no such universal reference gene has yet been identified and probably does not exist. Normalization with multiple selected reference genes has been proposed as an alternative to overcome this problem and several tools to evaluate the expression stability of candidate reference genes have been developed. In Chapter 4, two of these tools, the geNorm [23] and Norm- finder [24] programs, were employed to evaluate the expression stability of the nine selected candidate reference genes. Although both programs have the same aim of identifying the most stably expressed reference genes, they make use of different strategies. geNorm is a software application which ranks the reference genes according to the similarity in expression profiles across the samples, whereas Normfinder is an application on a model-based approach which ranks the reference genes according to the estimated intra- and intergroup expression variation.

The outcome of the gene stability evaluation differed between the programs used, which is not surprising in light of the different algorithms they employ. Only ELF1A was consistently ranked first or second by both programs and is suitable for use as a reference gene under the conditions described in this chapter. RPL4 was consistently ranked as the most stable expressed gene together with ELF1A by geNorm, but not by Normfinder. Since both ELF1A and RPL4 play a role in protein translation, co-regulation cannot be ruled out and this may have affected the outcome of the geNorm analysis. Normfinder is less sensitive to the incorporation of co-regulated genes since it focuses on the intra- and intergroup variation in selecting the most stable expressed genes. This may altogether explain the discordance in ranking of RPL4 between the geNorm and Normfinder programs.

Six reference genes which ranked highest in the geNorm and Normfinder analysis of the combined R. microplus and R. appendiculatus samples, were used for normalization of the Bm86 expression profile in all life stages of R. appendiculatus and R. microplus. This was done to examine if variation of Bm86 expression levels may explain the lack of an effect of Bm86 vaccines in R. appendiculatus [5, 6], which has been observed despite a high degree of sequence homology between Bm86 and its orthologue Ra86 in R. appendiculatus. The relatively large number of reference genes required for optimal normalization reflects the heterogeneous

187

001-216 - Dissertatie Ard - Versie 1.pdf 187 21-7-2010 22:44:16 Chapter 7

nature of the analyzed whole tick samples which varied from eggs to feeding adults. In eggs of R. microplus, Bm86 expression was detected at low levels in eggs 4 and 10 days after initiation of the oviposition (p.o.: post oviposition) and increased by three-fold in eggs collected 15 days p.o. This was followed by a rapid increase in the expression of Bm86 in the third trimester of the embryogenesis to levels similar to those found in unfed larvae. Bm86 expression decreased with feeding and molting in the immature life stages, with the lowest expression found in the pharate life stages. The decrease of Bm86 expression levels following feeding of immatures was significantly more pronounced in the larvae and nymphs of R. appendiculatus compared to those of R. microplus wherein a more continuous expression pattern was observed during the life cycle with less dramatic variation. Bm86 expression levels in adults of both species were similar and thus the total amount of Bm86 expressed during blood feeding and exposure to the host immune system may be comparable between adults of the two species, assuming that the expression profile of Bm86 mRNA is indicative for the amount of expressed Bm86 protein.

If so, differences in Bm86 vaccination susceptibility could perhaps be sought in the prolonged exposure to imbibed blood and the host immune system of R. microplus which is adapted for continuous development on one host compared to the three-host tick R. appendiculatus. The latter has a longer 'recovery' period during molting at which time no or very little Bm86 is expressed. Hence little reaction between ingested antibodies and the Bm86 protein would be expected to occur. However, effects of vaccination with Bm86 are predominantly seen in adults of R. microplus and we must therefore conclude that the observed differences in Bm86 expression profile between the two species alone can not adequately explain the lack of a Bm86 vaccination effect in R. appendiculatus.

The characterization of Bm86 homologues was extended beyond R. appendiculatus in Chapter 5 in which the Bm86 homologues from species representing the main argasid and ixodid tick genera were identified and analyzed. A combination of bioinformatics and Rapid Amplification of cDNA Ends (RACE) strategies led to the identification of Bm86 orthologues of the metastriate Rhipicephalus e. evertsi (Ree86), Dermacentor reticulatus (Dr86), Hyalomma marginatum (Hm86) and Amblyomma variegatum (Av86) ticks as well as a Bm86-like protein from the soft tick Ornithodoros savignyi (Os86) and two Bm86 homologues from the prostriate ticks Ixodes ricinus (Ir86-1 and Ir86-2) and Ixodes scapularis (Is86-1 and Is86-2). Interestingly, this approach also led to the discovery of a second protein in metastriate ticks which is structurally related to Bm86 and is predicted to con-

188

001-216 - Dissertatie Ard - Versie 1.pdf 188 21-7-2010 22:44:16 Summarizing discussion

tain a signal peptide, a large number of cysteine residues, multiple glycosylation sites and six full and one partial Epidermal Growth Factor (EGF)-like domains. An alignment of the amino acid sequences of this protein from 10 tick species showed the presence of a signature peptide: YFNATAQRCYH. Part of this signature peptide, ATAQ, was chosen as a name for proteins from this group to distinguish them from Bm86 orthologues. Blast analysis of all identified proteins did not return significant hits other than the Bm86 homologues deposited at GenBank. The closest related proteins other than Bm86 are those with similar EGF or EGF- like domains such as latent transforming growth factor binding protein 4, fibrillin and matrilin.

The expression of the ATAQ proteins from R. appendiculatus (RaATAQ) and R. microplus (BmATAQ) was measured throughout the life cycle of these two species, using the same methodology as described in Chapter 4. BmATAQ was shown to be expressed constantly throughout the life cycle of R. microplus with limited variation. The expression of RaATAQ decreased slightly with feeding and molting of the juvenile lifestages of R. appendiculatus, but these fluctuations were less pronounced than for Ra86. The highest RaATAQ expression levels were found in unfed adults, where the expression also decreased during feeding in both females and males. On a tissue level, ATAQ proteins and the Bm86-like protein from O. savignyi were found to be expressed in midgut and Malpighian tubules (MT) of ticks, whereas Bm86 orthologues and the Bm86 homologues from I. ricinus were transcribed almost exclusively in the midgut. The expression of ATAQ proteins throughout the life cycle of ticks in both midgut and MT is of interest in the development of vaccines for the control of tick infestations. Intuitively, its structural similarity to Bm86 suggests that vaccination with a recombinant ATAQ protein may confer protection against homologous tick infestations to a similar extent as vaccination with Bm86 by damaging the midgut. If so, this may result in an increased cross-protection against heterologous Rhipicephalinae tick infestations compared to that found for Bm86-based vaccines since the ATAQ proteins of the Rhipicephalinae, which include all species of the economically important Dermacentor, Hyalomma and Rhipicephalus genera [25], are more conserved than this group’s Bm86 orthologues.

The expression of ATAQ in the MT could transform this organ into a potential second immunological attack site. Supporting data for the potential of the MT as a target tissue for an anti-tick vaccine comes from a recent vaccination trial in sheep targeting 5’-nucleotidase, an enzyme which is principally located in the MT. Vac- cination with recombinant 5’-nucleotidase resulted in an overall egg mass reduc-

189

001-216 - Dissertatie Ard - Versie 1.pdf 189 21-7-2010 22:44:16 Chapter 7

tion by a standard number of infesting R. microplus adults of 73% [26]. The potential of the described Bm86 homologues and ATAQ proteins as anti-tick vaccine candidates, alone or in combination, remains to be investigated in vaccination trials.

For such trials, the expression of recombinant protein is required for vaccine production and the expression of recombinant Bm86 orthologues from R. microplus (Bm86), Rhipicephalus (Boophilus) annulatus (Ba86) and Rhipicephalus (Boophi- lus) decoloratus (Bd86) as secreted proteins in the yeast Pichia pastoris is described in Chapter 6. Recombinant Bm86 has previously been expressed in Escherichia coli [27], Aspergillus nidulans and A. niger [28], a Spodoptera frugi- perda cell line infected with a recombinant baculovirus [29] and P. pastoris [30, 31]. The production of Bm86 in P. pastoris may increase the antigenicty and immunogenicity of the recombinant antigen [32, 33], but the process previously reported for the production of Bm86 in P. pastoris was not based on protein secretion but on the expression of the antigen anchored to the yeast membrane. This required purification under denaturing conditions followed by refolding of the antigen with a high number of disulfide bonds [34]. An important advantage of the secretion recombinant protein by P. pastoris, particularly for proteins with complex structures and a high number of disulfide bonds such as Bm86, is that the isolation of a membrane-bound form under denaturing conditions followed by refolding is very unlikely to reform all disulfide bonds correctly and reproducibly. By contrast, if disulfide bond formation occurs through the natural cell processing and secretion machinery as reported in this chapter, the product is more likely to have a reproducible conformation closely resembling the native protein. Other expression systems using arthropod cell lines have been considered, but despite recent advances in the application of insect cell culture technology for the production of recombinant proteins, the process is still more expensive and difficult to scale-up when compared to proteins expressed in E. coli and P. pastoris [35].

The purified recombinant Bm86 orthologues proteins were adjuvated and used to immunize rabbits. Sera from the immunezed rabbits were used to evaluate the immune cross-reactivity of the recombinant orthologues proteins by Western blot. The results showed that recombinant Bm86, Bd86 and Ba86 contained cross- reactive epitopes which may explain, at least in part, the efficacy of Bm86 vaccines against R. annulatus and R. decoloratus infestations. The recombinant Ba86 and Bm86 proteins produced in this study were subsequently used in a vaccination trial in cattle wherein the efficacy of Ba86 for the control of B. annulatus and B. microplus was demonstrated [2].

190

001-216 - Dissertatie Ard - Versie 1.pdf 190 21-7-2010 22:44:16 Summarizing discussion

Future perspectives

The development and commercialization of Bm86 based vaccines against the cattle tick R. microplus which has been shown to be effective in the field has laid the foundation for future development of environmentally sound tick control through vaccination in integrated control strategies. Several problems have been identified which explain the relatively small impact of these vaccines in tick control worldwide [15, 36]. Besides commercial constraints, the inefficacy of the existing vaccine against some tick species and absence of a direct knock-down effect are the most important problems. More efficacious and ideally stand-alone vaccines which can control multiple tick species in wide geographical areas are thus desirable, particularly in regions where extensive acaricide resistance has emerged in ticks.

Antigen discovery studies are required to extend the currently limited portfolio of successful tick-protective antigens. Reverse vaccinology approaches for the identification of tick-protective antigens will be facilitated by the availability of tick genome sequence data. The sequencing of the first tick genome from I. scapularis is in progress, but the assembly is hampered by its large size (~2,1 Gb) and high amount of repetitive regions [37]. Next generation sequencing technologies and decreasing sequencing costs [38] may facilitate the sequencing of more tick genomes in the near future.

It is also possible to embroider on the success of the Bm86 vaccine or other vaccine candidates with high efficacies by evaluating the vaccine potential of their homologues from other tick species. It will in particular be interesting to evaluate the effect of vaccination with recombinant ATAQ proteins which are promising vaccine candidates as outlined in chapter 5. Besides the identification and evaluation of novel vaccine candidates, the efficacy of current tick vaccines may be improved by the inclusion of an additional antigen(s) [39]. This was demonstrated by the addition of recombinant Bm91 protein to the Bm86 vaccine, resulting in an approximate doubling of its efficacy [40]. Little experimental attention has been given to the evaluation of multi-antigen or cocktail vaccines, overlooking the potential of this approach. Proper evaluation of cocktail vaccines requires an individual evaluation of each component simultaneous with evaluation of the mixture, making such trials expensive and complicating their management [39]. These trials could perhaps initially be modeled using standardized artificial feeding techniques for soft and hard ticks [41, 42]. Evalua-

191

001-216 - Dissertatie Ard - Versie 1.pdf 191 21-7-2010 22:44:16 Chapter 7

tion of the feeding and reproduction capacity of ticks fed in vitro on combinations or separate sera from immunized animals may provide indications of successful antigen mixtures which could subsequently be evaluated in in vivo vaccination trials.

192

001-216 - Dissertatie Ard - Versie 1.pdf 192 21-7-2010 22:44:16 Summarizing discussion

References

1. Willadsen P: Anti-tick vaccines. Parasitology 2004, 129 Suppl:S367- 387. 2. Canales M, Almazan C, Naranjo V, Jongejan F, de la Fuente J: Vaccina- tion with recombinant Boophilus annulatus Bm86 ortholog protein, Ba86, protects cattle against B. annulatus and B. microplus infestations. BMC Biotechnol 2009, 9:29. 3. Fragoso H, Rad PH, Ortiz M, Rodriguez M, Redondo M, Herrera L, de la Fuente J: Protection against Boophilus annulatus infestations in cattle vaccinated with the B. microplus Bm86-containing vaccine Gavac. off. Vaccine 1998, 16(20):1990-1992. 4. Pipano E, Alekceev E, Galker F, Fish L, Samish M, Shkap V: Immunity against Boophilus annulatus induced by the Bm86 (Tick-GARD) vaccine. Exp Appl Acarol 2003, 29(1-2):141-149. 5. de Vos S, Zeinstra L, Taoufik O, Willadsen P, Jongejan F: Evidence for the utility of the Bm86 antigen from Boophilus microplus in vaccination against other tick species. Exp Appl Acarol 2001, 25(3):245-261. 6. Odongo D, Kamau L, Skilton R, Mwaura S, Nitsch C, Musoke A, Taracha E, Daubenberger C, Bishop R: Vaccination of cattle with TickGARD induces cross-reactive antibodies binding to conserved linear peptides of Bm86 homologues in Boophilus decoloratus. Vaccine 2007, 25(7):1287-1296. 7. Kocan KM, Manzano-Roman R, de la Fuente J: Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA. Parasitol Res 2007, 100(6):1411- 1415. 8. Kurscheid S, Lew-Tabor AE, Rodriguez Valle M, Bruyeres AG, Doogan VJ, Munderloh UG, Guerrero FD, Barrero RA, Bellgard MI: Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophi- la. BMC Mol Biol 2009, 10:26. 9. Li AY, Davey RB, Miller RJ, George JE: Resistance to coumaphos and diazinon in Boophilus microplus (Acari: Ixodidae) and evidence for the involvement of an oxidative detoxification mechanism. J Med En- tomol 2003, 40(4):482-490. 10. Winston WM, Molodowitch C, Hunter CP: Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1. Science 2002, 295(5564):2456-2459.

193

001-216 - Dissertatie Ard - Versie 1.pdf 193 21-7-2010 22:44:16 Chapter 7

11. Dong Y, Friedrich M: Nymphal RNAi: systemic RNAi mediated gene knockdown in juvenile grasshopper. BMC Biotechnol 2005, 5:25. 12. Huvenne H, Smagghe G: Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. J Insect Physiol 2010, 56(3):227-235. 13. Almazan C, Kocan KM, Bergman DK, Garcia-Garcia JC, Blouin EF, de la Fuente J: Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine 2003, 21(13-14):1492-1501. 14. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: RNA interference screening in ticks for identification of protective antigens. Parasitol Res 2005, 96(3):137-141. 15. Willadsen P: Vaccination against ectoparasites. Parasitology 2006, 133 Suppl:S9-S25. 16. Almazan C, Kocan KM, Blouin EF, de la Fuente J: Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine 2005, 23(46-47):5294-5298. 17. Almazan C, Lagunes R, Villar M, Canales M, Rosario-Cruz R, Jongejan F, de la Fuente J: Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations. Parasitol Res 2010, 106(2):471-479. 18. de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM: Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol Res 2006, 100(1):85-91. 19. de la Fuente J, Almazan C, Blas-Machado U, Naranjo V, Mangold AJ, Blouin EF, Gortazar C, Kocan KM: The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine 2006, 24(19):4082-4095. 20. de la Fuente J, Almazan C, Naranjo V, Blouin EF, Meyer JM, Kocan KM: Autocidal control of ticks by silencing of a single gene by RNA interference. Biochem Biophys Res Commun 2006, 344(1):332-338. 21. Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Ta- keuchi O, Hoffmann JA, Akira S, Boutros M, Reichhart JM: Akirins are highly conserved nuclear proteins required for NF-kappaB-dependent gene expression in Drosophila and mice. Nat Immunol 2008, 9(1):97- 104. 22. Galindo RC, Doncel-Perez E, Zivkovic Z, Naranjo V, Gortazar C, Man- gold AJ, Martin-Hernando MP, Kocan KM, de la Fuente J: Tick subolesin

194

001-216 - Dissertatie Ard - Versie 1.pdf 194 21-7-2010 22:44:16 Summarizing discussion

is an ortholog of the akirins described in insects and vertebrates. Dev Comp Immunol 2009, 33(4):612-617. 23. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate normalization of real-time quantitative RT- PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002, 3(7):RESEARCH0034. 24. Andersen CL, Jensen JL, Orntoft TF: Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance esti- mation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004, 64(15):5245- 5250. 25. Nava S, Guglielmone AA, Mangold AJ: An overview of systematics and evolution of ticks. Front Biosci 2009, 14:2857-2877. 26. Hope M, Jiang X, Gough J, Cadogan L, Josh P, Jonsson N, Willadsen P: Experimental vaccination of sheep and cattle against tick infestation using recombinant 5'-nucleotidase. Parasite Immunol 2010, 32(2):135- 142. 27. Rand KN, Moore T, Sriskantha A, Spring K, Tellam R, Willadsen P, Co- bon GS: Cloning and expression of a protective antigen from the cattle tick Boophilus microplus. Proc Natl Acad Sci U S A 1989, 86(24):9657- 9661. 28. Turnbull IF, Smith DR, Sharp PJ, Cobon GS, Hynes MJ: Expression and secretion in Aspergillus nidulans and Aspergillus niger of a cell surface glycoprotein from the cattle tick, Boophilus microplus, by using the fungal amdS promoter system. Appl Environ Microbiol 1990, 56(9):2847-2852. 29. Tellam RL, Smith D, Kemp DH, Willadsen P: Vaccination against ticks. In: Animal Parasite Control Utilizing Biotchnology. Edited by Yong WK. Boca Raton: CRC Press; 1992: 303-331. 30. Canales M, Enriquez A, Ramos E, Cabrera D, Dandie H, Soto A, Falcon V, Rodriguez M, de la Fuente J: Large-scale production in Pichia pastoris of the recombinant vaccine Gavac against cattle tick. Vaccine 1997, 15(4):414-422. 31. Rodriguez M, Rubiera R, Penichet M, Montesinos R, Cremata J, Falcon V, Sanchez G, Bringas R, Cordoves C, Valdes M et al: High level expression of the B. microplus Bm86 antigen in the yeast Pichia pastoris forming highly immunogenic particles for cattle. J Biotechnol 1994, 33(2):135-146.

195

001-216 - Dissertatie Ard - Versie 1.pdf 195 21-7-2010 22:44:16 Chapter 7

32. Garcia-Garcia JC, Montero C, Rodriguez M, Soto A, Redondo M, Valdes M, Mendez L, de la Fuente J: Effect of particulation on the immunogenic and protective properties of the recombinant Bm86 antigen expressed in Pichia pastoris. Vaccine 1998, 16(4):374-380. 33. Garcia-Garcia JC, Soto A, Nigro F, Mazza M, Joglar M, Hechevarria M, Lamberti J, de la Fuente J: Adjuvant and immunostimulating properties of the recombinant Bm86 protein expressed in Pichia pastoris. Vaccine 1998, 16(9-10):1053-1055. 34. Boue O, Farnos O, Gonzalez A, Fernandez R, Acosta JA, Valdes R, Gon- zalez LJ, Guanche Y, Izquierdo G, Suarez M et al: Production and biochemical characterization of the recombinant Boophilus microplus Bm95 antigen from Pichia pastoris. Exp Appl Acarol 2004, 32(1-2):119- 128. 35. Agathos SN: Development of serum-free media for lepidopteran insect cell lines. Methods Mol Biol 2007, 388:155-186. 36. de la Fuente J, Almazan C, Canales M, Perez de la Lastra JM, Kocan KM, Willadsen P: A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 2007, 8(1):23-28. 37. Pagel Van Zee J, Geraci NS, Guerrero FD, Wikel SK, Stuart JJ, Nene VM, Hill CA: Tick genomics: the Ixodes genome project and beyond. Int J Parasitol 2007, 37(12):1297-1305. 38. Metzker ML: Sequencing technologies - the next generation. Nat Rev Genet 2010, 11(1):31-46. 39. Willadsen P: Antigen cocktails: valid hypothesis or unsubstantiated hope? Trends Parasitol 2008, 24(4):164-167. 40. Willadsen P, Smith D, Cobon G, McKenna RV: Comparative vaccination of cattle against Boophilus microplus with recombinant antigen Bm86 alone or in combination with recombinant Bm91. Parasite Im- munol 1996, 18(5):241-246. 41. Krober T, Guerin PM: In vitro feeding assays for hard ticks. Trends Pa- rasitol 2007, 23(9):445-449. 42. Schwan EV, Hutton D, Shields KJ, Townson S: Artificial feeding and successful reproduction in Ornithodoros moubata moubata (Murray, 1877) (Acarina: Argasidae). Exp Appl Acarol 1991, 13(2):107-115.

196

001-216 - Dissertatie Ard - Versie 1.pdf 196 21-7-2010 22:44:16

NEDERLANDSE SAMENVATTING

16 PhD thesis Nijhof - Title page chapter NL samenvatting.pdf 1 26-7-2010 22:59:48 001-216 - Dissertatie Ard - Versie 1.pdf 198 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

Teken staan in Nederland hoofdzakelijk bekend als verspreiders van Borrelia burgdorferi bacterie, veroorzaker van de ziekte van Lyme. Minder bekend is dat teken, waarvan een kleine 900 soorten beschreven zijn, een breed scala aan ziekteverwekkers op mens en dier kunnen overdragen, meer dan welk ander spinach- tige of insect dan ook. Zo worden tientallen virussen, bacteriën en protozoaire pa- rasieten door teken overgebracht. Een aantal hiervan is besmettelijk voor de mens, zoals het dodelijke Krim-Congo hemorrhagische koorts virus en verschillende vlekkenkoortsen veroorzaakt door Rickettsia bacteriën, maar het merendeel is van diergeneeskundig belang. Economisch belangrijke voorbeelden hiervan zijn ana- plasmose en babesiose, veroorzaakt door respectievelijk Anaplasma marginale en Babesia bovis en overgedragen door de runderteek Rhipicephalus (Boophilus) microplus, welke mede door het wijdverspreide voorkomen van deze teek een be- dreiging vormen voor runderen in (sub)tropische gebieden over de gehele wereld. Maar ook andere diersoorten als varkens (Afrikaanse varkenspest), kleine her- kauwers (heartwater, veroorzaakt door Ehrlichia ruminantium), paarden (piro- plasmose veroorzaakt door Theileria equi en Babesia caballi) en honden (ehrli- chiose veroorzaakt door Ehrlichia canis) kennen zo hun eigen door teken over- draagbare ziektes.

Naast overbrengers van ziekteverwekkers kan de beet van sommige teken ook verlammingsverschijnselen geven door gifstoffen welke zij in hun speeksel uit- scheiden. De verlamming verdwijnt vaak wanneer de teek verwijderd wordt. Een ander gevolg van tekenbeten kan kwaliteitsvermindering van gelooid leer zijn door de vorming van kleine gaatjes op de plaats van de beten. Tot slot kunnen teken bij vee leiden tot een vermindering in melkgift en groei door de irritatie en bloedverlies welke optreedt.

Voor de bestrijding van teken wordt wereldwijd vooral gebruik gemaakt van chemische bestrijding met acaricides. De toenemende resistentie van teken tegen veelgebruikte acaricides waardoor deze hun effectiviteit verliezen, zorgen over de gevolgen van het grootschalig gebruik van deze middelen op het milieu en residu- en in dierlijke producten en de hoge ontwikkelingskosten voor nieuwe acaricides hebben geleid tot een stijgende belangstelling in alternatieve bestrijdingsmetho- des. Voorbeelden hiervan zijn biologische controle door het verspreiden van schimmels welke specifiek teken doodden en ‘zero-grazing’ management waarbij runderen niet geweid worden. Ook kan de aangeboren resistentie van tropische runderrassen tegen teken uitgebuit worden in fokprogramma’s gericht op de selec- tie van deze eigenschap. Een andere methode van bestrijding welke de aandacht geniet is het gebruik van vaccines tegen teken, het onderwerp van dit proefschrift.

199

001-216 - Dissertatie Ard - Versie 1.pdf 199 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

Al in 1939 demonstreerde de Amerikaanse wetenschapper William Trager dat een gedeeltelijke bescherming tegen teken opgewekt kon worden door cavia’s te injecteren met larvae- of weefselextracten van teken. Wanneer teken vervolgens gevoed werden op deze cavia’s daalde het percentage wat zich met succes vol kon zuigen. Vergelijkbare resultaten werden gevonden in onderzoeken die volgden met andere tekensoorten en –extracten, tot in de jaren ’80 een groep Australische wetenschappers een eiwit uit de darmen van de R. microplus teek wisten te isole- ren welke ook alleen, dus niet als een grove mix van weefselextract, gedeeltelijke bescherming bood tegen infestaties met deze tekensoort. Dit eiwit met een onbe- kende functie, genaamd Bm86, bevind zich op de borstelzoom aan de buitenkant van de digestiecellen in de tekendarm. Wanneer een teek op een gevaccineerd rund voedt neemt het antilichamen gericht tegen het Bm86 eiwit in de bloedmaal- tijd op. Deze antilichamen binden vervolgens aan de Bm86 eiwitten op de darm- cellen van de teek wat uiteindelijk leidt tot een vernietiging van deze cellen en lekkage van het opgenomen bloed naar de hemacoel, het open circulatiesysteem van teken welke in contact staat met alle weefsels. Dit is uitwendig waarneembaar als een roodverkleuring van de teek en resulteert in een gedeeltelijke sterfte en afname in de vruchtbaarheid, waardoor er minder eitjes gelegd worden. Het resul- taat van vaccinatie is daarom vooral zichtbaar in de tweede en navolgende genera- tie teken door een vermindering van het totale aantal aanwezige teken in de om- geving en op de dieren. Een ander gevolg van de locatie van het eiwit in de teek is de noodzakelijkheid om de vaccinatie jaarlijks te herhalen, aangezien het im- muunsysteem van gevaccineerde runderen verder niet met het eiwit in aanraking komt. Een vaccin op basis van Bm86 werd midden jaren ’90 op de Australische markt gebracht als TickGARD en gelijktijdig als Gavac in Zuid-Amerika en Cu- ba. In dit laatste land, waar de veeteelt in handen is van de socialistische staat, werden bijna 600.000 runderen gevaccineerd tussen 1995 en 2003. Als gevolg hiervan daalde het aantal acaricide behandelingen met 87% en de totale acaricide consumptie voor tekenbestrijding met 82%. De effectiviteit van het Bm86 vaccin tegen andere tekensoorten varieert van volledige bescherming tegen Rhipicepha- lus (Boophilus) annulatus en gedeeltelijke bescherming tegen vele Hyalomma soorten tot de afwezigheid van een aantoonbaar effect tegen de bruine oor teek Rhipicephalus appendiculatus de tropische bonte teek Amblyomma variegatum. Hoewel het Bm86 vaccine dus een belangrijke bijdrage kan leveren binnen de bestrijding van teken zijn efficiëntere vaccines nodig om bescherming te bieden tegen meerdere tekensoorten in verschillende regio’s.

200

001-216 - Dissertatie Ard - Versie 1.pdf 200 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

Binnen de ontwikkeling van anti-teken vaccines is een sleutelrol weggelegd voor de identificatie van tekenantigenen welke bescherming tegen teken kunnen bieden. RNA interferentie (RNAi) is een techniek welke in dit identificatieproces kan helpen om de functie van genen te ontrafelen en de essentiële genen te identifice- ren welke van belang zijn voor het (over)leven van de teek. Bij RNAi wordt syn- thetisch dubbelstrengs RNA (dsRNA) coderend voor een gen naar keuze inge- bracht in een organisme. Via een aantal tussenstappen wordt door het organisme zelf de uiteindelijke expressie van dit gen stilgelegd en kan het gevolg hiervan, bij teken bijvoorbeeld een verminderde mogelijkheid tot voeden wat zich uit als een lager volgezogen lichaamsgewicht, bestudeerd worden. In hoofdstuk 2 wordt een methode beschreven om deze techniek toe te passen in de ééngastherige teek R. microplus. Met deze methode is de expressie van drie beschermende tekenantigenen, Bm86, Bm91 en subolesin succesvol stilgelegd. Het ontbreken van een merkbaar gevolg voor de teek van het stilleggen van de Bm86 expressie, terwijl dit wel een beproefd vaccinkandidaat is, geeft de beperking van het gebruik van RNAi in het opsporen van vaccinkandidaten duidelijk weer. Daarnaast wordt in dit hoofdstuk een nieuwe RNAi methode geïntroduceerd waarmee het mogelijk is de genexpressie in tekeneitjes en (in mindere mate) de hieruit voortkomende lar- ven stil te leggen door dsRNA te injecteren in volgezogen vrouwtjes via de spira- culaire plaat, de uitwendige opening van het ademhalingssysteem van de teek. Met deze methode kan onder andere de functie van genen betrokken bij de vorming van het embryo bestudeerd worden. Zo leidde het inspuiten van subolesin dsRNA in volgezogen R. microplus vrouwtjes tot een ongedifferentieerde ontwikkeling van de door hen gelegde eitjes, terwijl de eitjes van volgezogen vrouwtjes ingespoten met Bm86 of Bm91 dsRNA zich wel normaal ontwikkelden. Dit suggereert dat subolesin een rol speelt in de vorming van het embryo.

Het ingrijpende effect welke het stilleggen van de subolesin expressie in teken heeft, leidde tot de hypothese dat dit gen een rol speelt in genexpressie en hier- door meerdere cellulaire processen beïnvloed. Deze hypothese is verder onderzocht in hoofdstuk 3. Twee eiwitten, GI en GII, welke in wisselwerking staan met subolesin werden geïdentificeerd. Eiwit GI heeft geen overeenkomst met bekende eiwitten maar kent wel eigenschappen van een eiwit met een regulerende functie terwijl GII een ortholoog is van elongatie factor 1-alfa (ELF1A), een eiwit welke betrokken is bij de eiwitsynthese. Het stilleggen van de GII expressie door RNAi gaf met subolesin vergelijkbare resultaten: een verhoogd sterftecijfer en verminderde bloedopname, verminderd aantal gelegde eitjes en een lager uitkomstper- centage bij met GII dsRNA geïnjecteerde vrouwtjes in vergelijking tot de contro- legroep. De gevolgen van het stilleggen van subolesin expressie met RNAi voor

201

001-216 - Dissertatie Ard - Versie 1.pdf 201 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

de expressie van andere genen is vervolgens verder geanalyseerd met suppressie subtractieve hybridisatie (SSH) en microarray analyses. Hieruit bleek dat door het stilleggen van subolesin de expressie van genen betrokken bij meerdere cellulaire processen veranderde. Ook voorspelde een computeranalyse dat subolesin homologen hiervan geconserveerde proteïne kinase C fosforylatie plekken bezitten, wat eveneens een regulerende rol van subolesin suggereert. Tijdens het publicatiepro- ces van dit artikel verscheen een publicatie van derden waarin de subolesin orthologen van insecten en gewervelde dieren omgedoopt werden tot ‘akirins’ waarbij gesteld werd dat deze transcriptie-factoren zijn welke betrokken zijn in NF- kappaB afhankelijke genexpressie.

Binnen het onderzoek naar teken wordt in toenemende mate gebruik gemaakt van kwantitatieve reverse transcriptase (RT)-PCR en microarrays. Om de hieruit voortkomende data juist te interpreteren is normalisatie van genexpressie data noodzakelijk. Vaak worden hierbij interne referentie genen gebruikt waarvan de expressie stabiel wordt verondersteld. Net als elders wordt ook binnen onderzoek naar teken het beta-actine gen hiervoor veelvuldig gebruikt, al is de werkelijke stabiliteit van de expressie hiervan niet bekend. In hoofdstuk 4 wordt daarom de expressie van een negental veelgebruikte referentie genen (beta-actine, beta- tubuline, elongatie factor 1–alfa, glyceraldehyde 3-fosfaat dehydrogenase, glutathione S-transferase, H3 histon familie 3A, cyclophiline, ribosomaal eiwit L4 en TATA box bindend eiwit) gemeten met kwantitatieve RT-PCR in alle levensstadia van twee tekensoorten, R. microplus en R. appendiculatus. De resultaten zijn hierna geanalyseerd met behulp van twee computerprogramma’s, geNorm en Normfinder. Uit deze analyse blijkt dat elongatie factor 1-alfa in beide tekensoorten het meest- en glutathione S-transferase het minst stabiel geëxpresseerde gen is. Met de zes meest stabiel geëxpresseerde genen is vervolgens het expressieprofiel van het Bm86 gen in beide tekensoorten genormaliseerd. Hieruit bleek dat de expressie van Bm86 in de ééngastherige R. microplus teek constanter was vergele- ken met de expressie van dit gen in de driegastherige R. appendiculatus teek waar een sterkere variatie tussen de levensstadia werd waargenomen. Toch zijn deze verschillen in het Bm86-expressieprofiel onvoldoende om het ontbreken van een Bm86 vaccin effect in R. appendiculatus volledig te verklaren.

Hoewel het Bm86 vaccin, gebaseerd op het Bm86 eiwit van R. microplus, niet werkt tegen R. appendiculatus, geeft het wel geheel of gedeeltelijke bescherming tegen andere Rhipicephalus (Boophilus) en Hyalomma tekensoorten. Het is daarom aannemelijk dat de effectiviteit van het vaccin tegen tekensoort X versterkt zou kunnen worden wanneer het gebaseerd wordt op het homologe Bm86 eiwit

202

001-216 - Dissertatie Ard - Versie 1.pdf 202 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

van deze tekensoort X. In hoofdstuk 5 zijn daarom de Bm86 homologen van ver- tegenwoordigers van de belangrijkste tekengenera geïdentificeerd en nader beschreven. In de metastriate teken werd naast Bm86 orthologen een nieuw eiwit geïdentificeerd welke een structurele overeenkomst heeft met het Bm86 eiwit door de aanwezigheid van Epidermale Groei Factor (EGF)-achtige domeinen. De- ze zogenaamde ATAQ eiwitten, vernoemd naar een gedeelte van hun signatuur peptide werden niet gevonden in de onderzochte prostriate teken. In die teken, Ixodes ricinus en I. scapularis, werden daarentegen wel twee, op aminozuur sequentie sterk verschillende, Bm86 homologen gevonden. In de zachte teek Orni- thodoros savignyi werd één Bm86 homoloog geïdentificeerd. ATAQ wordt in de teek geëxpresseerd in de buizen van Malpighi, het orgaan wat onder andere zorgt voor de afvoer van afvalstoffen van het verteringsstelsel, en in de darmen. Dit in tegenstelling tot Bm86 orthologen welke uitsluitend in de darmen tot expressie komen. Intuïtief lijkt het ATAQ eiwit door de structurele overeenkomst met Bm86 en de expressie in meerdere organen een goede vaccinkandidaat te zijn. Het moet nog onderzocht worden of dit ook daadwerkelijk zo is.

Voor het maken van een dergelijk vaccin is expressie van het recombinante eiwit noodzakelijk. In hoofdstuk 6 wordt de expressie van recombinant Bm86 en de Bm86 orthologen van Rhipicephalus (Boophilus) annulatus (Ba86) en Rhipicep- halus (Boophilus) decoloratus (Bd86) in een Pichia pastoris expressie systeem beschreven. In tegenstelling tot de in het verleden gepubliceerde procedures voor de expressie van Bm86 in de P. pastoris gist, waarbij het eiwit verankerd was aan het gistmembraan, leidt de hier beschreven procedure tot de uitscheiding van het eiwit door de gist. Gevolgd door een simpele zuiveringsprocedure was de uiteindelijke opbrengst en zuiverheid van de recombinante eiwitten relatief hoog. Met de recombinante Ba86, Bd86 en Bm86 eiwitten zijn vervolgens konijnen geïm- muniseerd waarna kruisreactiviteit tussen de drie orthologe eiwitten aangetoond kon worden.

Tot slot zijn in hoofdstuk 7 de voorgaande hoofdstukken samengevat en worden deze bediscussieerd, soms naar aanleiding van naderhand verschenen publicaties. Tevens worden vooruitzichten voor toekomstig onderzoek aangestipt. Zo wordt verwacht dat de aanstaande beschikbaarheid van het eerste tekengenoom, dat van I. scapularis, de identificatie van beschermende tekeneiwitten kan bespoedigen. Door verbeterde technieken en de dalende kosten van het bepalen van DNA se- quenties zal het makkelijker worden om ook van andere tekensoorten de DNA sequentie van hun genoom te achterhalen. In relatie tot wat in dit proefschrift ge- presenteerd is zal op korte termijn vooral de bepaling van het potentieel van de

203

001-216 - Dissertatie Ard - Versie 1.pdf 203 21-7-2010 22:44:16 Summary in Dutch / Samenvatting

nieuw geïdentificeerde Bm86 homologen en ATAQ eiwitten als anti-teken vaccin interessant zijn. Een verder relatief onontgonnen gebied binnen de ontwikkeling van vaccins tegen teken is het gebruik van cocktail vaccins waarbij meerder antigenen in één vaccin gecombineerd worden. Voor een goede evaluatie van een dergelijk vaccin is het nodig om ook van elk antigeen afzonderlijk het effect te bepalen, waardoor deze proeven relatief duur worden. Mogelijk kan een eerste screening voor het vinden van de meest geschikte combinaties plaatsvinden via een model waarbij teken in vitro gevoed worden op (combinaties van) verschillende antisera, gevolgd door een evaluatie van de meest succesvolle combinatie in meer traditionele vaccinatieproeven.

204

001-216 - Dissertatie Ard - Versie 1.pdf 204 21-7-2010 22:44:16

Hovius JW, Ramamoorthi N, Van't Veer C, de Groot KA, Nijhof AM, Jongejan F, van Dam Hovius JW, Ramamoorthi N, Van't Veer C, de Groot KA, Nijhof AM, Jongejan F, van Dam AP, AP, Fikrig E: Identification of Salp15 homologues in Ixodes ricinus ticks. Vector Borne Fikrig E: Identification of Salp15 homologues in Ixodes ricinus ticks. Vector Borne Zoonotic Zoonotic Dis 2007, 7(3):296-303. Dis 2007, 7(3):296-303. Matjila PT, Penzhorn BL, Bekker CP, Nijhof AM, Jongejan F: Confirmation of occurrence Matjila PT, Penzhorn BL, Bekker CP, Nijhof AM, Jongejan F: Confirmation of occurrence of of Babesia canis vogeli in domestic dogs in South Africa. Vet Parasitol 2004, 122(2):119- Babesia canis vogeli in domestic dogs in South Africa. Vet Parasitol 2004, 122(2):119-125. ACKNOWLEDGEMENTS 125.

Matjila TP, Nijhof AM, Taoufik A, Houwers D, Teske E, Penzhorn BL, de Lange T, Jongejan F: CURRICULUM VITAE Matjila TP, Nijhof AM, Taoufik A, Houwers D, Teske E, Penzhorn BL, de Lange T, Autochthonous canine babesiosis in The Netherlands. Vet Parasitol 2005, 131(1-2):23-29. Jongejan F: Autochthonous canine babesiosis in The Netherlands. Vet Parasitol 2005, 131(1- LIST OF PUBLICATIONS 2):23-29. Nijhof AM, Balk JA, Postigo M, Rhebergen AM, Taoufik A, Jongejan F: Bm86 homologues and novel ATAQ proteins with multiple EGF-like domains from hard and soft ticks Int J Nijhof AM, Balk JA, Postigo M, Rhebergen AM, Taoufik A, Jongejan F: Bm86 homologues Parasitol 2010, in press. and novel ATAQ proteins with multiple EGF-like domains from hard and soft ticks Int J

Parasitol 2010, in press. Nijhof AM, Balk JA, Postigo M, Jongejan F: Selection of reference genes for quantitative RT- PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks Nijhof AM, Balk JA, Postigo M, Jongejan F: Selection of reference genes for quantitative and determination of the expression profile of Bm86. BMC Mol Biol 2009, 10:112. RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus

ticks and determination of the expression profile of Bm86. BMC Mol Biol 2009, 10:112. Nijhof AM, Bodaan C, Postigo M, Nieuwenhuijs H, Opsteegh M, Franssen L, Jebbink F, Jongejan F: Ticks and associated pathogens collected from domestic animals in the Netherlands. Nijhof AM, Bodaan C, Postigo M, Nieuwenhuijs H, Opsteegh M, Franssen L, Jebbink F, Vector Borne Zoonotic Dis 2007, 7(4):585-595. Jongejan F: Ticks and associated pathogens collected from domestic animals in the

Netherlands. Vector Borne Zoonotic Dis 2007, 7(4):585-595. Nijhof AM, Penzhorn BL, Lynen G, Mollel JO, Morkel P, Bekker CP, Jongejan F: Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick-borne parasites associated with mortality in Nijhof AM, Penzhorn BL, Lynen G, Mollel JO, Morkel P, Bekker CP, Jongejan F: Babesia the black rhinoceros (Diceros bicornis). J Clin Microbiol 2003, 41(5):2249-2254. bicornis sp. nov. and Theileria bicornis sp. nov.: tick-borne parasites associated with

Nijhof AM, Pillay V, Steyl J, Prozesky L, Stoltsz WH, Lawrence JA, Penzhorn BL, Jongejan F: mortality in the black rhinoceros (Diceros bicornis). J Clin Microbiol 2003, 41(5):2249- 2254. Molecular characterization of Theileria species associated with mortality in four species of African antelopes. J Clin Microbiol 2005, 43(12):5907-5911. Nijhof AM, Pillay V, Steyl J, Prozesky L, Stoltsz WH, Lawrence JA, Penzhorn BL, Jongejan

Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F: Gene silencing of the F: Molecular characterization of Theileria species associated with mortality in four species of African antelopes. J Clin Microbiol 2005, 43(12):5907-5911. tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int J Parasitol 2007, 37(6):653-662. Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F: Gene silencing of

Zivkovic Z, Nijhof AM, de la Fuente J, Kocan KM, Jongejan F: Experimental transmission of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int J Parasitol 2007, 37(6):653-662. Anaplasma marginale by male Dermacentor reticulatus. BMC Vet Res 2007, 3:32. Zivkovic Z, Torina A, Mitra R, Alongi A, Scimeca S, Kocan KM, Galindo RC, Almazan C, Zivkovic Z, Nijhof AM, de la Fuente J, Kocan KM, Jongejan F: Experimental transmission Blouin EF, Villar M, Nijhof AM, Mani R, La Barbera G, Caracappa S, Jongejan F, de la Fuente of Anaplasma marginale by male Dermacentor reticulatus. BMC Vet Res 2007, 3:32. J: Subolesin expression in response to pathogen infection in ticks. BMC Immunol 2010, 11:7. Zivkovic Z, Torina A, Mitra R, Alongi A, Scimeca S, Kocan KM, Galindo RC, Almazan C, Blouin EF, Villar M, Nijhof AM, Mani R, La Barbera G, Caracappa S, Jongejan F, de la Fuente J: Subolesin expression in response to pathogen infection in ticks. BMC Immunol 2010, 11:7.

18 PhD thesis Nijhof - Last title page.pdf 1 26-7-2010 23:00:56 206-216 - Acknowledgements & CV & LoP 020810.pdf 1 2-8-2010 20:53:44 Acknowledgements

This thesis would not have been realized without the support and cooperation from a great many people over the years and I would like to take this opportunity to thank them all.

I am very grateful to my promoters, Frans Jongejan and Jos van Putten. The amount of freedom you both have given me over the past years is unrivalled and was highly appreciated. Frans, your trust, network and vision allowed me to complete this PhD with great pleasure.

Thanks to Anton van Woerkom for organising the printing of this thesis.

I would also like to thank all partners from the Anti-Tick Vaccine (ATV) project: Prof. Mohammed Darghouth, Mourad Ben Said, Mohammed Gharbi and Youssr Galai (École Nationale de Médecine Vétérinaire, Sidi Thabet, Tunisia), Enoch Koney, Vitus Burimuah, Andy Alhassan and the late Dr. Ampem Agyei (Ghana Veterinary Service Department, Accra, Ghana). I have had the great pleasure to work for several months during this project with the BioTicknology Group in the Department of Biochemistry from the University of Pretoria. Thank you Prof. Albert Neitz, Christine Maritz-Olivier (and Nicky), Anabella Gaspar, Christian Stutzer, Annette-Christi Badenhorst, Elize Louw, Mariëtte Botha, Venisha Rag- hoonanan and Willie van Zyl for all the good times. And for organizing antibiotics when I was struck with tick-bite fever. Prof. José de la Fuente (the hardest working man in Tickbiz) and Mario Canales (Instituto de Investigación en Recursos Cinegéticos, Ciudad Real, Spain), Peter Willadsen (thanks for all the valuable discussions and encouragement), Lissa Jiang and Shelly Hope (Commonwealth Scientific and Industrial Research Organisation (CSIRO) Livestock Industries, St Lucia, Australia) and the lady with unsurpassed patience, Lesley Bell-Sakyi (The Roslin Wellcome Trust Tick Cell Biobank, University of Edinburgh, Scot- land, UK).

My interest in research was raised in a tiny village just outside of Pretoria, South Africa: Onderstepoort. It was here that I was allowed to fulfill a six-month research internship from the Dutch veterinary faculty in 2001. I still have fond memories of those days for which the complete staff of the Department of Veteri- nary Tropical Diseases, under the inspiring leadership of prof. Koos Coetzer, is responsible. I would like to thank the following persons in particular: Anna-Mari Bosman, Raksha Bhoora, prof. Ivan Horak, Akin Jenkins, Fransie Lottering, Dar- shana Morar, Lilly Mphahlele, Marinda Oosthuizen, prof. Banie Penzhorn, Visva Pillay, Kgomotso Sibeko, Hein Stoltsz, Milana Troskie, prof. Estelle Venter, prof. Moritz van Vuuren and Theo de Waal (OVI / University College of Dublin).

207

206-216 - Acknowledgements & CV & LoP 020810.pdf 2 2-8-2010 20:53:44 Acknowledgements

Very special thanks go to Tshepo ‘Big T.’ Matjila & Mmabatho Moeketsi. Your friendship and hospitality means a lot to me.

From the former Department of Parasitology and Tropical Veterinary Diseases of the Faculty of Veterinary Medicine in Utrecht I would like to thank Cornelis Bek- ker, Frits Franssen, Frans Kooyman, Harm Ploeger and Erik de Vries for their support. Prof. Uilenberg (Corsica) is thanked for his support, advice and patience when I was late again with handing in my section of the Newsletter.

From the Utrecht Centre for Tick-borne Diseases my dear (former) colleagues for all their support: Jesper Balk (great technician, pity you support the wrong foot- ball team), Ms. Tickbuster Christa Bodaan (until next time, somewhere in …?), Jona Verbeek, Catherine Butler (good luck with finishing your PhD!), Tryntsje Cuperus, Bonto Faburay, Hans Nieuwenhuijs, Milagros Postigo, Anne Marie Rhebergen, Omar Taoufik, Zorica Zivkovic (it was always a pleasure going out with you) and all the students which worked with me over the years: Arjen, Caro- lina, Chantal, Erik, Eva, Fenja, Florian, Jacqueline, Jeroen, Jos, Kirsten, Laurien, Liliane, Linda, Lobke, Marloes, Mark, Michiel, Raween, Rogier, Sabine, Sjaak, Thamar and Vincent.

All fellow WIPpers from the 3rd floor departments of Clinical Infectiology and Molecular Host Defence are also thanked for their company and support, together with my other 3rd floor colleagues from the Veterinary Microbiological Diagnostic Center and Infection Biology (in particular Herman Cremers and Rolf Nijsse). Yusuf (CSU) is thanked for the nice chats we often had in the corridor or in the lab. A further thanks is given to the anonymous buyer of the Nanodrop at the Im- munology department.

Rob Kauffeld (UU) is thanked for all the technical assistance and creativity (e.g. the tick-shock chamber) he provided. I’d furthermore like to thank Ella Bakker, Cynthia Hupsel, Maria Campos, Marco Jansen and Ricardo Fernandez Reyes for providing administrative support and Patricia Gadella and Wim van Brenk for taking good care of the experimental animals. The Office for International Coop- eration (BIC) is thanked for their (financial) support and assistance over the years.

Joppe Hovius (Boer Harms) and Tim Schuijt from the Amsterdam Medical Centre are thanked for their support and good company.

208

206-216 - Acknowledgements & CV & LoP 020810.pdf 3 2-8-2010 20:53:44 Acknowledgements

I would like to thank Prof. Chihiro Sugimoto (Research Center for Zoonosis Con- trol, Hokkaido University, Japan) for hosting me on a memorable visit to his country and institute. Ryo Nakao from the same institute is also thanked for being a great friend and drinking buddy. Kanpai!

My friends and family are thanked for their support and always reminding me that there’s really more in life than obtaining a PhD. In particular paranimfs Bart for his many refreshing questions and Bram for the many refreshing squash games.

Heartfelt thanks to the Panhuis-Amoureus family (Cor, Mieke & Kai) for their interest, encouragement and moral support.

I would like to express special gratitude to my dear mother Lidy Nijhof who has always been so supportive of my education and career and Pim Nijhof for just being a great brother.

Lotte, there has been many a day when failed experiments, a temporary writer’s block or other drawbacks clouded my sky but your smile always brought the sun back into my life. Thank you.

209

206-216 - Acknowledgements & CV & LoP 020810.pdf 4 2-8-2010 20:53:44 206-216 - Acknowledgements & CV & LoP 020810.pdf 5 2-8-2010 20:53:44 Curriculum Vitae

Ard Menzo Nijhof was born in Zeist on the 24th of March 1978. He graduated with a Doctor of Veterinary Medicine from Utrecht University, the Netherlands in 2004. During his veterinary study, he participated in research at the Department of Veterinary Tropical Diseases from the University of Pretoria, South Africa with an emphasis on tick-borne diseases of African wildlife. In 2004 he created a global species database on ticks as part of the Species2000 / Catalogue of Life project, which has the aim of indexing the world’s known species. From 2005 until 2010 he worked as a PhD student at the Utrecht Centre for Tick-borne Diseases from the Faculty of Veterinary Medicine, Utrecht University, the Netherlands on a Wellcome Trust funded project entitled ‘Adapting recombinant anti-tick vaccines to livestock in Africa’. During his PhD he was a visiting researcher at the De- partment of Biochemistry from the University of Pretoria, South Africa. The results of the research performed within the frame of this project are described in this thesis.

211

206-216 - Acknowledgements & CV & LoP 020810.pdf 6 2-8-2010 20:53:44 206-216 - Acknowledgements & CV & LoP 020810.pdf 7 2-8-2010 20:53:44 List of publications

1. Bodaan C, Nijhof AM, Postigo M, Nieuwenhuijs H, Opsteegh M, Frans- sen L, Jebbink F, Jansen S, Jongejan F: Ticks and tick-borne pathogens in companion animals in the Netherlands. Tijdschr Diergeneeskd 2007, 132(13):517-523. 2. Butler CM, Nijhof AM, Jongejan F, van der Kolk JH: Anaplasma phagocytophilum infection in horses in the Netherlands. Vet Rec 2008, 162(7):216-217. 3. Butler CM, Nijhof AM, van der Kolk JH, de Haseth OB, Taoufik A, Jon- gejan F, Houwers DJ: Repeated high dose imidocarb dipropionate treatment did not eliminate Babesia caballi from naturally infected horses as determined by PCR-reverse line blot hybridization. Vet Pa- rasitol 2008, 151(2-4):320-322. 4. Canales M, de la Lastra JM, Naranjo V, Nijhof AM, Hope M, Jongejan F, de la Fuente J: Expression of recombinant Rhipicephalus (Boophilus) microplus, R. annulatus and R. decoloratus Bm86 orthologs as secreted proteins in Pichia pastoris. BMC Biotechnol 2008, 8:14. 5. Centeno-Lima S, do Rosario V, Parreira R, Maia AJ, Freudenthal AM, Nijhof AM, Jongejan F: A fatal case of human babesiosis in Portugal: molecular and phylogenetic analysis. Trop Med Int Health 2003, 8(8):760-764. 6. de la Fuente J, Maritz-Olivier C, Naranjo V, Ayoubi P, Nijhof AM, Alma- zan C, Canales M, Perez de la Lastra JM, Galindo RC, Blouin EF, Gorta- zar C, Jongejan F, Kocan KM: Evidence of the role of tick subolesin in gene expression. BMC Genomics 2008, 9:372. 7. de Lange T, Nijhof AM, Taoufik A, Houwers D, Teske E, Jongejan F: Autochthonous babesiosis in dogs in the Netherlands associated with local Dermacentor reticulatus ticks. Tijdschr Diergeneeskd 2005, 130(8):234-238. 8. French BC, Hird DW, Romano PS, Hayes RH, Nijhof AM, Jongejan F, Mellor DJ, Singer RS, Fine AE, Gay JM, Davis RG, Conrad PA: Virtual international experiences in veterinary medicine: an evaluation of students' attitudes toward computer-based learning. J Vet Med Educ 2007, 34(4):502-509. 9. Hovius JW, Ramamoorthi N, Van't Veer C, de Groot KA, Nijhof AM, Jongejan F, van Dam AP, Fikrig E: Identification of Salp15 homologues in Ixodes ricinus ticks. Vector Borne Zoonotic Dis 2007, 7(3):296-303. 10. Matjila PT, Penzhorn BL, Bekker CP, Nijhof AM, Jongejan F: Confirma- tion of occurrence of Babesia canis vogeli in domestic dogs in South Africa. Vet Parasitol 2004, 122(2):119-125.

213

206-216 - Acknowledgements & CV & LoP 020810.pdf 8 2-8-2010 20:53:45 List of publications

11. Matjila TP, Nijhof AM, Taoufik A, Houwers D, Teske E, Penzhorn BL, de Lange T, Jongejan F: Autochthonous canine babesiosis in The Nether- lands. Vet Parasitol 2005, 131(1-2):23-29. 12. Nijhof AM, Balk JA, Postigo M, Rhebergen AM, Taoufik A, Jongejan F: Bm86 homologues and novel ATAQ proteins with multiple EGF-like domains from hard and soft ticks Int J Parasitol 2010, in press. 13. Nijhof AM, Balk JA, Postigo M, Jongejan F: Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86. BMC Mol Biol 2009, 10:112. 14. Nijhof AM, Bodaan C, Postigo M, Nieuwenhuijs H, Opsteegh M, Frans- sen L, Jebbink F, Jongejan F: Ticks and associated pathogens collected from domestic animals in the Netherlands. Vector Borne Zoonotic Dis 2007, 7(4):585-595. 15. Nijhof AM, Penzhorn BL, Lynen G, Mollel JO, Morkel P, Bekker CP, Jongejan F: Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick-borne parasites associated with mortality in the black rhinoceros (Diceros bicornis). J Clin Microbiol 2003, 41(5):2249-2254. 16. Nijhof AM, Pillay V, Steyl J, Prozesky L, Stoltsz WH, Lawrence JA, Penzhorn BL, Jongejan F: Molecular characterization of Theileria species associated with mortality in four species of African antelopes. J Clin Microbiol 2005, 43(12):5907-5911. 17. Nijhof AM, Taoufik A, de la Fuente J, Kocan KM, de Vries E, Jongejan F: Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference. Int J Parasitol 2007, 37(6):653-662. 18. Zivkovic Z, Esteves E, Almazan C, Daffre S, Nijhof AM, Kocan KM, Jongejan F, de la Fuente J: Differential expression of genes in salivary glands of male Rhipicephalus (Boophilus)microplus in response to infection with Anaplasma marginale. BMC Genomics 2010, 11:186. 19. Zivkovic Z, Nijhof AM, de la Fuente J, Kocan KM, Jongejan F: Experi- mental transmission of Anaplasma marginale by male Dermacentor reticulatus. BMC Vet Res 2007, 3:32. 20. Zivkovic Z, Torina A, Mitra R, Alongi A, Scimeca S, Kocan KM, Galindo RC, Almazan C, Blouin EF, Villar M, Nijhof AM, Mani R, La Barbera G, Caracappa S, Jongejan F, de la Fuente J: Subolesin expression in response to pathogen infection in ticks. BMC Immunol 2010, 11:7.

214

206-216 - Acknowledgements & CV & LoP 020810.pdf 9 2-8-2010 20:53:45 206-216 - Acknowledgements & CV & LoP 020810.pdf 10 2-8-2010 20:53:45 206-216 - Acknowledgements & CV & LoP 020810.pdf 11 2-8-2010 20:53:45