DOCSLIB.ORG

Genes Code for Proteins Edited by Esther Siegfried

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genes Code for Proteins Edited by Esther Siegfried © Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION 22 Reprinted from Cell, vol. 136, F. Brandt, et al., The Native 3D Organization of Bacterial Polysomes, pp. 261–271, Copyright (2009), with permission from Elsevier [http://www.sciencedirect.com/science/journal/00928674]. Photo courtesy of Wolfgang Baumeister, Max-Planck-Institute of Biochemistry. Genes Code for Proteins Edited by Esther Siegfried CHAPTER OUTLINE 2.1 Introduction • Testing whether a gene is essential requires a null mu- tation (one that completely eliminates its function). 2.2 A Gene Codes for a Single Polypeptide • Silent mutations have no effect, either because the • The one gene: one enzyme hypothesis summarizes base change does not change the sequence or amount the basis of modern genetics: that a gene is a stretch of protein, or because the change in protein sequence of DNA coding for one or more isoforms of a single has no effect. polypeptide. 2.5 A Locus May Have Many Different Mutant Alleles • Some genes do not encode polypeptides, but encode structural or regulatory RNAs. • The existence of multiple alleles allows heterozygotes that represent any pairwise combination of alleles • Most mutations damage gene function and are reces- to exist. sive to the wild-type allele. 2.6 A Locus May Have More Than One Wild-type Allele 2.3 Mutations in the Same Gene Cannot Complement • A locus may have a polymorphic distribution of alleles • A mutation in a gene affects only the product (protein with no individual allele that can be considered to be or RNA) coded by the mutant copy of the gene and the sole wild-type. does not affect the product coded by any other allele. • Failure of two mutations to complement (produce wild 2.7 Recombination Occurs by Physical Exchange of DNA phenotype) when they are present in trans configura- • Recombination is the result of crossing-over that tion in a heterozygote means that they are part of the occurs at chiasmata and involves two of the four same gene. chromatids. 2.4 Mutations May Cause Loss-of-Function • Recombination occurs by a breakage and reunion or Gain-of-Function that proceeds via an intermediate of hybrid DNA that depends on the complementarity of the two strands • Recessive mutations are due to loss-of-function by the of DNA. protein product. • Dominant mutations result from a gain-of-function. 26 66320_genesX_CH02_026_041.pdf 26 11/2/09 12:39 PM © Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION CHAPTER OUTLINE, CONTINUED • The frequency of recombination between two genes is 2.11 Several Processes Are Required to Express the proportional to their physical distance; recombination Protein Product of a Gene between genes that are very closely linked is rare. • A prokaryotic gene is expressed by transcription into • For genes that are very far apart on a single chro- mRNA and then translation of the mRNA into protein. mosome, the frequency of recombination is not proportional to their physical distance because recom- • In eukaryotes, a gene may contain internal regions bination happens so frequently. that are not represented in protein. 2.8 The Genetic Code Is Triplet • Internal regions are removed from the mRNA transcript by RNA splicing to give an mRNA that is colinear with • The genetic code is read in triplet nucleotides called the protein product. codons. • Each mRNA consists of an untranslated 5Ј region, a • The triplets are nonoverlapping and are read from a coding region, and an untranslated 3Ј trailer. fixed starting point. 2.12 Proteins Are trans-acting, but Sites on DNA Are • Mutations that insert or delete individual bases cause a shift in the triplet sets after the site of mutation. cis-acting • Combinations of mutations that together insert or de- • All gene products (RNA or proteins) are trans-acting. lete three bases (or multiples of three) insert or delete They can act on any copy of a gene in the cell. amino acids, but do not change the reading of the • cis-acting mutations identify sequences of DNA that triplets beyond the last site of mutation. are targets for recognition by trans-acting products. 2.9 Every Sequence Has Three Possible Reading Frames They are not expressed as RNA or protein and affect only the contiguous stretch of DNA. • In general, only one reading frame is translated, and 2.13 the other two are blocked by frequent termination Summary signals. 2.10 Prokaryotic Genes Are Colinear with Their Proteins • A prokaryotic gene consists of a continuous length of 3N nucleotides that encodes N amino acids. • The gene, mRNA, and protein are all colinear. mally called a genetic locus. The alleles of a gene 2.1 Introduction are the different forms that are found at its locus. The gene is the functional unit of heredity. The key to understanding the organization Each gene is a sequence within the genome that of genes into chromosomes was the discovery functions by giving rise to a discrete product of genetic linkage—the tendency for genes on (which may be a polypeptide or an RNA). The the same chromosome to remain together in basic behavior of the gene was defined by Men- the progeny instead of assorting independently del more than a century ago. Summarized in his as predicted by Mendel’s laws. Once the unit two laws (segregation and independent assort- of genetic recombination (reassortment) ment), the gene was recognized as a “particu- was introduced as the measure of linkage, the late factor” that passes largely unchanged from construction of genetic maps became possible. parent to progeny. A gene may exist in alterna- The resolution of the recombination map tive forms. These forms are called alleles. of a multicellular eukaryote is restricted by the In diploid organisms with two sets of chro- small number of progeny that can be obtained mosomes, one of each chromosome pair is from each mating. Recombination occurs so inherited from each parent. This is also true for infrequently between nearby points that it is genes. One of the two copies of each gene is the rarely observed between different mutations paternal allele (inherited from the father), the in the same gene. As a result, classical link- other is the maternal allele (inherited from age maps of eukaryotes can place the genes the mother). This common pattern of inheri- in order, but cannot determine relationships tance led to the discovery that chromosomes within a gene. By moving to a microbial system in fact carry the genes. in which a very large number of progeny can be Each chromosome consists of a linear array obtained from each genetic cross, researchers of genes. Each gene resides at a particular location could demonstrate that recombination occurs on the chromosome. The location is more for- within genes. It follows the same rules that 2.1 Introduction 27 66320_genesX_CH02_026_041.pdf 27 11/2/09 12:39 PM © Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION A chromosome is a very long molecule of DNA The first systematic attempt to associate genes with enzymes, carried out by Beadle and Tatum in the 1940s, showed that each stage in a meta- bolic pathway is catalyzed by a single enzyme and can be blocked by mutation in a different gene. This led to the one gene : one enzyme hypothesis. Each metabolic step is catalyzed by a particular enzyme, whose production is The chromosome contains many genes the responsibility of a single gene. A mutation in the gene alters the activity of the protein for which it is responsible. A modification in the hypothesis is needed Each gene is part of a continuous to accommodate proteins that consist of more sequence of DNA than one subunit. If the subunits are all the same, the protein is a homomultimer and is represented by a single gene. If the subunits are Start of gene End of gene different, the protein is a heteromultimer. Stated as a more general rule applicable to any heteromultimeric protein, the one gene: one CATATAAGGTGAGGTAGGATCAGTTGCTCCTCACAATGC enzyme hypothesis becomes more precisely GTATATTCCACTCCATCCTAGTCAACGAGGAGTGTTACG expressed as the one gene : one polypeptide FIGURE 2.1 Each chromosome has a single long mol- hypothesis. Even this general rule needs to be ecule of DNA within which are the sequences of individual refined because many genes encode multiple, genes. related polypeptides through alternative splic- were previously deduced for recombination ing of the mRNA (see Chapter 21, RNA Splicing between genes. and Processing). Mutations within a gene can be arranged Identifying which protein represents a into a linear order, showing that the gene itself particular gene can be a protracted task. The has the same linear construction as the array mutation responsible for Mendel’s wrinkled- of genes on a chromosome. Thus the genetic pea mutant was identified only in 1990 as an map is linear within as well as between loci: it alteration that inactivates the gene for a starch- consists of an unbroken sequence within which branching enzyme! the genes reside. This conclusion leads naturally It is important to remember that a gene into the modern view summarized in FIGURE 2.1 does not directly generate a polypeptide. As that the genetic material of a chromosome con- shown previously in Figure 1.2, a gene codes sists of an uninterrupted length of DNA repre- for an RNA, which may in turn code for a poly- senting many genes. Having defined the gene peptide. Many genes code for polypeptides, but as an uninterrupted length of DNA, it should some genes code for RNAs that do not give rise be noted that in eukaryotes many genes are to polypeptides. These RNAs may be structural interrupted by sequences in the DNA that are components of the apparatus responsible for then excised from the mRNA (see Chapter 4, synthesizing proteins or, as has become evident The Interrupted Gene).
Load more

Recommended publications
  • Genetic Code
    AccessScience from McGraw-Hill Education Page 1 of 9 www.accessscience.com Genetic code Contributed by: P. Schimmel, K. Ewalt Publication year: 2014 The rules by which the base sequences of deoxyribonucleic acid (DNA) are translated into the amino acid sequences of proteins. Each sequence of DNA that codes for a protein is transcribed or copied ( Fig. 1 ) into messenger ribonucleic acid (mRNA). Following the rules of the code, discrete elements in the mRNA, known as codons, specify each of the 20 different amino acids that are the constituents of proteins. In a process called translation, the cell decodes the message in mRNA. During translation ( Fig. 2 ), another class of RNAs, called transfer RNAs (tRNAs), are coupled to amino acids, bind to the mRNA, and in a step-by-step fashion provide the amino acids that are linked together in the order called for by the mRNA sequence. The specific attachment of each amino acid to the appropriate tRNA, and the precise pairing of tRNAs via their anticodons to the correct codons in the mRNA, form the basis of the genetic code. See also: DEOXYRIBONUCLEIC ACID (DNA) ; PROTEIN ; RIBONUCLEIC ACID (RNA) . Universal genetic code The genetic information in DNA is found in the sequence or order of four bases that are linked together to form each strand of the two-stranded DNA molecule. The bases of DNA are adenine, guanine, thymine, and cytosine, which are abbreviated A, G, T, and C. Chemically, A and G are purines, and C and T are pyrimidines. The two strands of DNA are wound about each other in a double helix that looks like a twisted ladder (Fig.
    [Show full text]
  • Dna the Code of Life Worksheet
    Dna The Code Of Life Worksheet blinds.Forrest Jowled titter well Giffy as misrepresentsrecapitulatory Hughvery nomadically rubberized herwhile isodomum Leonerd exhumedremains leftist forbiddenly. and sketchable. Everett clem invincibly if arithmetical Dawson reinterrogated or Rewriting the Code of Life holding for Genetics and Society. C A process look a genetic code found in DNA is copied and converted into value chain of. They may negatively impact of dna worksheet answers when published by other. Cracking the Code of saw The Biotechnology Institute. DNA lesson plans mRNA tRNA labs mutation activities protein synthesis worksheets and biotechnology experiments for open school property school biology. DNA the code for life FutureLearn. Cracked the genetic code to DNA cloning twins and Dolly the sheep. Dna are being turned into consideration the code life? DNA The Master Molecule of Life CDN. This window or use when he has been copied to a substantial role in a qualified healthcare professional journals as dna the pace that the class before scientists have learned. Explore the Human Genome Project within us Learn about DNA and genomics role in medicine and excellent at the Smithsonian National Museum of Natural. DNA The Double Helix. Most enzymes create a dna the code of life worksheet is getting the. Worksheet that describes the structure of DNA students color the model according to instructions Includes a. Biology Materials Handout MA-H2 Microarray Virtual Lab Activity Worksheet. This user has, worksheet the dna code of life, which proteins are carried on. Notes that scientists have worked 10 years to disappoint the manner human genome explains that DNA is a chemical message that began more data four billion years ago.
    [Show full text]
  • Insights Into Comparative Genomics, Codon Usage Bias, And
    plants Article Insights into Comparative Genomics, Codon Usage Bias, and Phylogenetic Relationship of Species from Biebersteiniaceae and Nitrariaceae Based on Complete Chloroplast Genomes Xiaofeng Chi 1,2 , Faqi Zhang 1,2 , Qi Dong 1,* and Shilong Chen 1,2,* 1 Key Laboratory of Adaptation and Evolution of Plateau Biota, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China; [email protected] (X.C.); [email protected] (F.Z.) 2 Qinghai Provincial Key Laboratory of Crop Molecular Breeding, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China * Correspondence: [email protected] (Q.D.); [email protected] (S.C.) Received: 29 October 2020; Accepted: 17 November 2020; Published: 18 November 2020 Abstract: Biebersteiniaceae and Nitrariaceae, two small families, were classified in Sapindales recently. Taxonomic and phylogenetic relationships within Sapindales are still poorly resolved and controversial. In current study, we compared the chloroplast genomes of five species (Biebersteinia heterostemon, Peganum harmala, Nitraria roborowskii, Nitraria sibirica, and Nitraria tangutorum) from Biebersteiniaceae and Nitrariaceae. High similarity was detected in the gene order, content and orientation of the five chloroplast genomes; 13 highly variable regions were identified among the five species. An accelerated substitution rate was found in the protein-coding genes, especially clpP. The effective number of codons (ENC), parity rule 2 (PR2), and neutrality plots together revealed that the codon usage bias is affected by mutation and selection. The phylogenetic analysis strongly supported (Nitrariaceae (Biebersteiniaceae + The Rest)) relationships in Sapindales. Our findings can provide useful information for analyzing phylogeny and molecular evolution within Biebersteiniaceae and Nitrariaceae.
    [Show full text]
  • Genetic Code: a New Understanding of Codon – Amino Acid Assignment
    GENETIC CODE: A NEW UNDERSTANDING OF CODON – AMINO ACID ASSIGNMENT Zvonimir M. Damjanović* and Miloje M. Rakočević** *Montenegrin Academy of science and arts (CANU), Podgorica, Montenegro ** Department of Chemistry, Faculty of Science, University of Niš, Serbia (E-mail: [email protected]) Abstract. In this work it is shown that 20 canonical amino acids (AAs) within genetic code appear to be a whole system with strict AAs positions; more exactly, with AAs ordinal number in three variants; first variant 00-19, second 00-21 and third 00-20. The ordinal number follows from the positions of belonging codons, i.e. their digrams (or “doublets”). The reading itself is a reading in quaternary numbering system if four bases possess the values within a specific logical square: A = 0, C = 1, G = 2, U = 3. By this, all splittings, distinctions and classifications of AAs appear to be in accordance to atom and nucleon number balance as well as to the other physico-chemical properties, such as hydrophobicity and polarity. K e y w o r d s: Genetic code, Genetic code table, Translation, Numbering system, Spiral model of Genetic code, Canonical amino acids, Logical square, Hydrophobicity, Polarity, Hydropathy, Perfect numbers, Friendly numbers. 1 INTRODUCTION Gamow was the first who attempted to resolve the problem of codon – amino acid assignment, i.e. to answer the question how 64 codons can have the possible meanings for 20 canonical amino acids (AAs). His solution was the so called “diamond code” (Gamow, 1954) in which 64 codons were classified into 20 classes, corresponding to 20 AAs (Hayes, 1998: “Symmetries of the diamond code sort the 64 codons into 20 classes ..
    [Show full text]
  • Mutation Bias Shapes Gene Evolution in Arabidopsis Thaliana ​
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.17.156752; this version posted June 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Mutation bias shapes gene evolution in Arabidopsis thaliana ​ 1,2† 1 1 3,4 Monroe, J. Grey ,​ Srikant, Thanvi ,​ Carbonell-Bejerano, Pablo ,​ Exposito-Alonso, Moises ,​ 5​ ​ 6 7 ​ 1† ​ Weng, Mao-Lun ,​ Rutter, Matthew T. ,​ Fenster, Charles B. ,​ Weigel, Detlef ​ ​ ​ ​ 1 Department​ of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tübingen, Germany 2 Department​ of Plant Sciences, University of California Davis, Davis, CA 95616, USA 3 Department​ of Plant Biology, Carnegie Institution for Science, Stanford, CA 94305, USA 4 Department​ of Biology, Stanford University, Stanford, CA 94305, USA 5 Department​ of Biology, Westfield State University, Westfield, MA 01086, USA 6 Department​ of Biology, College of Charleston, SC 29401, USA 7 Department​ of Biology and Microbiology, South Dakota State University, Brookings, SD 57007, USA † corresponding​ authors: [email protected], [email protected] ​ ​ ​ Classical evolutionary theory maintains that mutation rate variation between genes should be random with respect to fitness 1–4 and evolutionary optimization of genic 3,5 ​ mutation rates remains controversial .​ However, it has now become known that ​ cytogenetic (DNA sequence + epigenomic) features influence local mutation probabilities 6 ,​ which is predicted by more recent theory to be a prerequisite for beneficial mutation 7 rates between different classes of genes to readily evolve .​ To test this possibility, we ​ used de novo mutations in Arabidopsis thaliana to create a high resolution predictive ​ ​ ​ model of mutation rates as a function of cytogenetic features across the genome.
    [Show full text]
  • Evolution of Genomic Expression
    C H A P T E R 5 Evolution of Genomic Expression Bernardo Lemos, Christian R. Landry, Pierre Fontanillas, Susan P. Renn, Rob Kulathinal, Kyle M. Brown, and Daniel L. Hartl Introduction Genomic regulation is key to cellular differentiation, tissue morphogenesis, and development. Increasing evidence indicates that evolutionary diversity of phenotypes—from cellular to organismic—may also be, in large part, the result of variation in the regulation of genomic expression. In this chapter we explore the complexity of gene regulation from the perspective of single genes and whole genomes. The first part describes the major factors affecting gene expression levels, from rates of gene transcrip- tion—as mediated by promoter–enhancer interactions and chromatin mod- ifications—to rates of mRNA degradation. This description underscores the multiple levels at which genomic expression can be regulated as well as the complexity and variety of mechanisms used. We then briefly describe the major experimental and computational biology techniques for analyzing gene expression variation and its underlying causes. The final section reviews our understanding of the role of regulatory variation in evolution, including the molecular evolution and population genetics of noncoding DNA, as well as the inheritance and phenotypic evolution of levels of mRNA abundance. The Complex Regulation of Genomic Expression The regulation of gene expression is a complex and dynamic process. It is not a simple matter to turn a gene on and off, let alone precisely regulate its level of expression. Regulation can be accomplished through various mech- anisms at nearly every step of the process of gene expression. Furthermore, each mechanism may require a variety of elements, including DNA sequences, RNA molecules, and proteins, acting in combination to deter- 2 Chapter Five Evolution of Genomic Expression 3 mine the final amount, timing, and location of functional gene product.
    [Show full text]
  • INTRODUCTION Sirna and Rnai
    J Korean Med Sci 2003; 18: 309-18 Copyright The Korean Academy ISSN 1011-8934 of Medical Sciences RNA interference (RNAi) is the sequence-specific gene silencing induced by dou- ble-stranded RNA (dsRNA). Being a highly specific and efficient knockdown tech- nique, RNAi not only provides a powerful tool for functional genomics but also holds Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National a promise for gene therapy. The key player in RNAi is small RNA (~22-nt) termed University, Seoul, Korea siRNA. Small RNAs are involved not only in RNAi but also in basic cellular pro- cesses, such as developmental control and heterochromatin formation. The inter- Received : 19 May 2003 esting biology as well as the remarkable technical value has been drawing wide- Accepted : 23 May 2003 spread attention to this exciting new field. V. Narry Kim, D.Phil. Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National University, San 56-1, Shillim-dong, Gwanak-gu, Seoul 151-742, Korea Key Words : RNA Interference (RNAi); RNA, Small interfering (siRNA); MicroRNAs (miRNA); Small Tel : +82.2-887-8734, Fax : +82.2-875-0907 hairpin RNA (shRNA); mRNA degradation; Translation; Functional genomics; Gene therapy E-mail : [email protected] INTRODUCTION established yet, testing 3-4 candidates are usually sufficient to find effective molecules. Technical expertise accumulated The RNA interference (RNAi) pathway was originally re- in the field of antisense oligonucleotide and ribozyme is now cognized in Caenorhabditis elegans as a response to double- being quickly applied to RNAi, rapidly improving RNAi stranded RNA (dsRNA) leading to sequence-specific gene techniques.
    [Show full text]
  • Basic Genetic Terms for Teachers
    Student Name: Date: Class Period: Page | 1 Basic Genetic Terms Use the available reference resources to complete the table below. After finding out the definition of each word, rewrite the definition using your own words (middle column), and provide an example of how you may use the word (right column). Genetic Terms Definition in your own words An example Allele Different forms of a gene, which produce Different alleles produce different hair colors—brown, variations in a genetically inherited trait. blond, red, black, etc. Genes Genes are parts of DNA and carry hereditary Genes contain blue‐print for each individual for her or information passed from parents to children. his specific traits. Dominant version (allele) of a gene shows its Dominant When a child inherits dominant brown‐hair gene form specific trait even if only one parent passed (allele) from dad, the child will have brown hair. the gene to the child. When a child inherits recessive blue‐eye gene form Recessive Recessive gene shows its specific trait when (allele) from both mom and dad, the child will have blue both parents pass the gene to the child. eyes. Homozygous Two of the same form of a gene—one from Inheriting the same blue eye gene form from both mom and the other from dad. parents result in a homozygous gene. Heterozygous Two different forms of a gene—one from Inheriting different eye color gene forms from mom mom and the other from dad are different. and dad result in a heterozygous gene. Genotype Internal heredity information that contain Blue eye and brown eye have different genotypes—one genetic code.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • Actin Gene Requires Myod1, Carg-Box Binding Factor, and Spl
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Muscle-specific expression of the cardiac -actin gene requires MyoD1, CArG-box binding factor, and Spl Vittorio Sartorelli, Keith A. Webster, 1 and Larry Kedes 2 Program in Molecular Biology and Genetics, Institute for Genetic Medicine, and Departments of Biochemistry and Medicine, University of Southern California School of Medicine, Los Angeles, California 90033 USA Expression of the human cardiac ~-actin gene (HCA) depends on the interactions of multiple transcriptional regulators with promoter elements. We report here that the tissue-specific expression of this promoter is determined by the simultaneous interaction of at least three specific protein-DNA complexes. The myogenic determinant gene MyoD1 activated the transcription of transfected HCA-CAT promoter constructs in nonmuscle cells, including CV-1 and HeLa cells. Gel mobility-shift and footprinting assays revealed that MyoD1 specifically interacted with a single consensus core sequence, CANNTG, at -50. Previously characterized sites interact with a protein identical with or related to the serum response factor (SRF) at - 100 and Spl at -70. All three elements must be intact to support transcription in muscle cells: site-specific mutation within any one of these three elements eliminated transcriptional expression by the promoter. Furthermore, expression of the promoter in embryonic Drosophila melanogaster cells that lack MyoD1 and Spl is strictly dependent on all three sites remaining intact and on the presence of exogenously supplied Spl and MyoD1. These experiments suggest that the presence of three sequence-specific binding proteins, including MyoD1, and their intact target DNA sequences are minimal requirements for muscle-specific expression of the HCA gene.
    [Show full text]
  • Chapter 12 Gene Expression and Regulation
    PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all growth conditions and are called house- keeping genes. These include the genes that encode such proteins as DNA poly- merase, RNA polymerase, and DNA gyrase. Many other gene products are required under specific growth conditions. These include enzymes that synthesize amino acids, break down specific sugars, or respond to a specific environmental condition such as DNA damage. Housekeeping genes must be expressed at some level all of the time. Frequently, as the cell grows faster, more of the housekeeping gene products are needed. Even under very slow growth, some of each housekeeping gene product is made. The gene prod- ucts required for specific growth conditions are not needed all of the time. These genes are frequently expressed at extremely low levels, or not expressed at all when they are not needed and yet made when they are needed. This chapter will examine gene regulation or how bacteria regulate the expression of their genes so that the genes that are being expressed meet the needs of the cell for a specific growth condition. Gene regulation can occur at three possible places in the production of an active gene product. First, the transcription of the gene can be regulated. This is known as transcriptional regulation. When the gene is transcribed and how much it is transcribed influences the amount of gene product that is made. Second, if the gene encodes a protein, it can be regulated at the translational level.
    [Show full text]
  • DNA : TACGCGTATACCGACATT Transcription Will Make Mrna From
    Transcription and Translation Practice: Name _____________________________________ Background: • DNA controls our traits • DNA is found in the nucleus of our cells • Our traits are controlled by proteins • DNA is the instructions to make proteins • Proteins are made in ribosomes (outside the nucleus) • Proteins are made of amino acids Transcription makes RNA from DNA • RNA is complementary to DNA • RNA can leave the nucleus (DNA cannot) Translation makes proteins using RNA • Takes place at the ribosome • mRNA is “read” to put together a protein from amino acids Example: Beyonce has brown eyes. Her eyes look brown because her DNA codes for a brown pigment in the cells of her eyes. This is the gene that codes for brown eyes. DNA : T A C G C G T A T A C C G A C A T T Transcription will make mRNA from DNA mRNA: A U G C G C _________________________ Transcription will join amino acids to make the protein Rules for Transcription: Methionine - Arginine - ____________________________________ Base of DNA → Base in mRNA A → U Rules of Translation: C → G Three letters of mRNA = a codon G → C A codon “codes” for an amino acid We use the “Genetic Code” to determine the amino acids T → A RNA contains Uracil instead of Thymine The complete chain of amino acids will complete the protein that will give Beyonce her brown eyes. If you have brown eyes you have the same protein. If you have blue or green eyes your DNA sequence is a little different which will make the amino acid sequence (protein) a little different.
    [Show full text]