© Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION 22 Reprinted from Cell, vol. 136, F. Brandt, et al., The Native 3D Organization of Bacterial Polysomes, pp. 261–271, Copyright (2009), with permission from Elsevier [http://www.sciencedirect.com/science/journal/00928674]. Photo courtesy of Wolfgang Baumeister, Max-Planck-Institute of Biochemistry. Genes Code for Proteins Edited by Esther Siegfried CHAPTER OUTLINE 2.1 Introduction • Testing whether a gene is essential requires a null mu- tation (one that completely eliminates its function). 2.2 A Gene Codes for a Single Polypeptide • Silent mutations have no effect, either because the • The one gene: one enzyme hypothesis summarizes base change does not change the sequence or amount the basis of modern genetics: that a gene is a stretch of protein, or because the change in protein sequence of DNA coding for one or more isoforms of a single has no effect. polypeptide. 2.5 A Locus May Have Many Different Mutant Alleles • Some genes do not encode polypeptides, but encode structural or regulatory RNAs. • The existence of multiple alleles allows heterozygotes that represent any pairwise combination of alleles • Most mutations damage gene function and are reces- to exist. sive to the wild-type allele. 2.6 A Locus May Have More Than One Wild-type Allele 2.3 Mutations in the Same Gene Cannot Complement • A locus may have a polymorphic distribution of alleles • A mutation in a gene affects only the product (protein with no individual allele that can be considered to be or RNA) coded by the mutant copy of the gene and the sole wild-type. does not affect the product coded by any other allele. • Failure of two mutations to complement (produce wild 2.7 Recombination Occurs by Physical Exchange of DNA phenotype) when they are present in trans configura- • Recombination is the result of crossing-over that tion in a heterozygote means that they are part of the occurs at chiasmata and involves two of the four same gene. chromatids. 2.4 Mutations May Cause Loss-of-Function • Recombination occurs by a breakage and reunion or Gain-of-Function that proceeds via an intermediate of hybrid DNA that depends on the complementarity of the two strands • Recessive mutations are due to loss-of-function by the of DNA. protein product. • Dominant mutations result from a gain-of-function. 26 66320_genesX_CH02_026_041.pdf 26 11/2/09 12:39 PM © Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION CHAPTER OUTLINE, CONTINUED • The frequency of recombination between two genes is 2.11 Several Processes Are Required to Express the proportional to their physical distance; recombination Protein Product of a Gene between genes that are very closely linked is rare. • A prokaryotic gene is expressed by transcription into • For genes that are very far apart on a single chro- mRNA and then translation of the mRNA into protein. mosome, the frequency of recombination is not proportional to their physical distance because recom- • In eukaryotes, a gene may contain internal regions bination happens so frequently. that are not represented in protein. 2.8 The Genetic Code Is Triplet • Internal regions are removed from the mRNA transcript by RNA splicing to give an mRNA that is colinear with • The genetic code is read in triplet nucleotides called the protein product. codons. • Each mRNA consists of an untranslated 5Ј region, a • The triplets are nonoverlapping and are read from a coding region, and an untranslated 3Ј trailer. fixed starting point. 2.12 Proteins Are trans-acting, but Sites on DNA Are • Mutations that insert or delete individual bases cause a shift in the triplet sets after the site of mutation. cis-acting • Combinations of mutations that together insert or de- • All gene products (RNA or proteins) are trans-acting. lete three bases (or multiples of three) insert or delete They can act on any copy of a gene in the cell. amino acids, but do not change the reading of the • cis-acting mutations identify sequences of DNA that triplets beyond the last site of mutation. are targets for recognition by trans-acting products. 2.9 Every Sequence Has Three Possible Reading Frames They are not expressed as RNA or protein and affect only the contiguous stretch of DNA. • In general, only one reading frame is translated, and 2.13 the other two are blocked by frequent termination Summary signals. 2.10 Prokaryotic Genes Are Colinear with Their Proteins • A prokaryotic gene consists of a continuous length of 3N nucleotides that encodes N amino acids. • The gene, mRNA, and protein are all colinear. mally called a genetic locus. The alleles of a gene 2.1 Introduction are the different forms that are found at its locus. The gene is the functional unit of heredity. The key to understanding the organization Each gene is a sequence within the genome that of genes into chromosomes was the discovery functions by giving rise to a discrete product of genetic linkage—the tendency for genes on (which may be a polypeptide or an RNA). The the same chromosome to remain together in basic behavior of the gene was defined by Men- the progeny instead of assorting independently del more than a century ago. Summarized in his as predicted by Mendel’s laws. Once the unit two laws (segregation and independent assort- of genetic recombination (reassortment) ment), the gene was recognized as a “particu- was introduced as the measure of linkage, the late factor” that passes largely unchanged from construction of genetic maps became possible. parent to progeny. A gene may exist in alterna- The resolution of the recombination map tive forms. These forms are called alleles. of a multicellular eukaryote is restricted by the In diploid organisms with two sets of chro- small number of progeny that can be obtained mosomes, one of each chromosome pair is from each mating. Recombination occurs so inherited from each parent. This is also true for infrequently between nearby points that it is genes. One of the two copies of each gene is the rarely observed between different mutations paternal allele (inherited from the father), the in the same gene. As a result, classical link- other is the maternal allele (inherited from age maps of eukaryotes can place the genes the mother). This common pattern of inheri- in order, but cannot determine relationships tance led to the discovery that chromosomes within a gene. By moving to a microbial system in fact carry the genes. in which a very large number of progeny can be Each chromosome consists of a linear array obtained from each genetic cross, researchers of genes. Each gene resides at a particular location could demonstrate that recombination occurs on the chromosome. The location is more for- within genes. It follows the same rules that 2.1 Introduction 27 66320_genesX_CH02_026_041.pdf 27 11/2/09 12:39 PM © Jones and Bartlett Publishers, LLC. NOT FOR SALE OR DISTRIBUTION A chromosome is a very long molecule of DNA The first systematic attempt to associate genes with enzymes, carried out by Beadle and Tatum in the 1940s, showed that each stage in a meta- bolic pathway is catalyzed by a single enzyme and can be blocked by mutation in a different gene. This led to the one gene : one enzyme hypothesis. Each metabolic step is catalyzed by a particular enzyme, whose production is The chromosome contains many genes the responsibility of a single gene. A mutation in the gene alters the activity of the protein for which it is responsible. A modification in the hypothesis is needed Each gene is part of a continuous to accommodate proteins that consist of more sequence of DNA than one subunit. If the subunits are all the same, the protein is a homomultimer and is represented by a single gene. If the subunits are Start of gene End of gene different, the protein is a heteromultimer. Stated as a more general rule applicable to any heteromultimeric protein, the one gene: one CATATAAGGTGAGGTAGGATCAGTTGCTCCTCACAATGC enzyme hypothesis becomes more precisely GTATATTCCACTCCATCCTAGTCAACGAGGAGTGTTACG expressed as the one gene : one polypeptide FIGURE 2.1 Each chromosome has a single long mol- hypothesis. Even this general rule needs to be ecule of DNA within which are the sequences of individual refined because many genes encode multiple, genes. related polypeptides through alternative splic- were previously deduced for recombination ing of the mRNA (see Chapter 21, RNA Splicing between genes. and Processing). Mutations within a gene can be arranged Identifying which protein represents a into a linear order, showing that the gene itself particular gene can be a protracted task. The has the same linear construction as the array mutation responsible for Mendel’s wrinkled- of genes on a chromosome. Thus the genetic pea mutant was identified only in 1990 as an map is linear within as well as between loci: it alteration that inactivates the gene for a starch- consists of an unbroken sequence within which branching enzyme! the genes reside. This conclusion leads naturally It is important to remember that a gene into the modern view summarized in FIGURE 2.1 does not directly generate a polypeptide. As that the genetic material of a chromosome con- shown previously in Figure 1.2, a gene codes sists of an uninterrupted length of DNA repre- for an RNA, which may in turn code for a poly- senting many genes. Having defined the gene peptide. Many genes code for polypeptides, but as an uninterrupted length of DNA, it should some genes code for RNAs that do not give rise be noted that in eukaryotes many genes are to polypeptides. These RNAs may be structural interrupted by sequences in the DNA that are components of the apparatus responsible for then excised from the mRNA (see Chapter 4, synthesizing proteins or, as has become evident The Interrupted Gene).