DOCSLIB.ORG

Molecular and Cytogenetic Description of Four Marine Fish Species from Indian Coast

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular and Cytogenetic Description of Four Marine Fish Species from Indian Coast Indian Journal of Geo-Marine Sciences Vol. 45(9), September 2016, pp. 1110-1115 Molecular and cytogenetic description of four marine fish species from Indian coast Basdeo Kushwaha1*, Ravindra Kumar1, Akhilesh Kumar Mishra1, N S Nagpure1, V S Basheer2 & M K Anil3 1Molecular Biology and Biotechnology Division, National Bureau of Fish Genetic Resources Canal Ring Road, PO: Dilkusha, Lucknow-226 002, India 2Cochin Unit of National Bureau of Fish Genetic Resources CMFRI Campus, Post Box No. 1603, PO- Ernakulam North, Kochi – 682 018, India 3Vizhinjam Research Centre of CMFRI, Post Box No. 9, PO: Vizhinjam, Thiruvananthapuram-692 521, India *[E-mail: [email protected]] Received 10 December 2013; revised 25 February 2014 In the present study, cytogenetic and molecular characterization of four ornamental marine fish species, namely Chaetodon collare, Plectorhinchus gibbosus, Scarus ghobban and Siganus canaliculatus inhabiting Arabian Sea, were carried out. Karyotype analyses of these species revealed diploid chromosome number 48 with all acrocentric, except in S. ghobban having karyotypic formula of 10m+4sm+12st+22t. Chromosomal configuration of C. collare, P. gibbosus and S. canaliculatus indicated more or less similar genetic makeup among them, than that of S. ghobban. Analyses of ITS 2 region in these species indicated phylogenetic closeness of P. gibbosus with S. ghobban and C. collare with S. canaliculatus with an average evolutionary divergence of 6.8% among them. [Keywords: Characterization; Cytogenetics; ITS 2; Marine fishes, Molecular] Introduction Marine fish Chaetodon collare, Plectorhinchus The marine ornament fish trade, started in Sri gibbosus, Scarus ghobban and Siganus canaliculatus Lanka in the 1930s, has spread over in more than 45 are some of the important ornamental species countries from the tropical Pacific, Indian and commonly occurring in Indian western coasts. P. Atlantic Ocean. This sector has grown up as multi- gibbosus, commonly known as dog faced sweetlips, billion dollar industry. Indonesia and Philippines are belongs to family: Haemulidae and order: the leading suppliers, whereas some other countries Perciformes. The body colour and stripes, which like Brazil, Maldives, Vietnam, Sri Lanka, Hawaii changes throughout their lives, make it ornamentally and India are also contributing significantly. It is important. They are generally found in groups or in estimated that more than 1,400 fish species globally pairs in coral reefs. Adults grow to a maximum are part of marine ornamental fish trade1. In India, length of 45 cm (Fig. 1A). The C. collare, commonly more than 300 fish species belonging to around 35 known as Redtail-butterfly fish, belongs to family: families are known for their attractive colors and Chaetodontidae and order: Paciformes. Colour is shapes. The wrasses (Labridae), constitute the largest brown to black, with lighter scales giving it a spotted group with 45 species followed by damsel fishes appearance. It has characteristics of vertical white (Pomacentridae; 35 species), cardinal fishes streak behind the eyes, a dark stripe over the eyes, (Apogonidae; 22 species), groupers (Serranidae; 21 and smaller white stripe in front of the eyes. Base of species), blennies (Blennidae; 20 species), surgeons the tail being bright red, followed by a black stripe or unicorn (Acanthuridae; 19 species), butterfly fish and diffused white tip make it attractive (Fig. 1B). S. (Chaetodontidae; 16 species), goat fish (Mullidae; 14 ghobban, popular as the Blue-barred parrotfish, species), gobies (Gobiidae; 14 species), scorpion fish belongs to family: Scaridae and order: Paciformes. It (Scorpaenidae; 14 species), trigger fish (Balistidae; looks very attractive due to bluish appearance of fin 10 species), squirrel fish (Holocentridae; 9 species) margins and body surface (Fig. 1C). Parrotfishes have and others fishes2. characteristic pharyngeal dentition which helps in scraping into algal covered limestone. S. KHUSHWAHA et al.: MOLECULAR AND CYTOGENETIC DESCRIPTION OF FOUR MARINE FISH SPECIES 1111 canaliculatus (order: Perciformes; family: Siganidae), were collected from the areas nearby Vizhinjam in commonly known as white-spotted spinefoot with Kerala. The average wet weight of the specimens nostrils resembling to rabbit’s nose, is very much were 51.6 g (range 50-53 g), 32.8 g (range 20-50 g), amusing (Fig. 1D). Its body is silvery grey above and 52.8 g (range 48-58 g) and 32.5 g (range 30-35 g), is generally found near the vicinity of river mouth, respectively. Specimens were in juvenile stage and especially around sea grass beds in groups of about the sex was unidentifiable by visual examination. 20 individuals. The specimens were injected 0.05% colchicine intramuscularly @ 1 ml/ 100 g body weight and the anterior kidney was dissected out after 2 h of injection for metaphase chromosome preparation using conventional hypotonic treatment – fixation (methanol: acetic acid) – flame drying technique. Metaphase chromosomes were stained with 6% Giemsa in phosphate buffer (pH 6.8). Approximately, 200 chromosome complements were analyzed for establishing the diploid chromosome number (2n) and characteristic chromosome morphology in each species. Homologous chromosomes were paired based on their morphology and centromeric position Fig. 1: Images of voucher specimens: P. gibbosus (A), C. collare (B), S. ghobban (C) and S. canaliculatus (D). and arranged in decreasing order of their size using Lieca CW4000Karyo software. Karyotypes were Developing species-specific taxonomic markers prepared from the cells exhibiting the complete for ornamental fish species is a pre-requisite for this chromosome complement and characteristic morphology using the classification proposed by trade as it helps the stakeholders in verifying the 4 identity and purity of the species for culture in Levan et al. captivity and conservation purposes. Now-a-days, the Total genomic DNA was extracted from ethanol characterization and cataloguing of fish fauna using preserved muscle/ blood samples of the subject suitable tools has colossal importance for species following the protocol of Ruzzante et al.5 safeguarding the intellectual property rights. with minor modifications ( i.e. tissue incubated in Although, India has rich diversity of ichthyofauna, incubation buffer at 37°C overnight instead of 45°C but merely around 42 species from marine for 15 min). DNA quality and quantity were ecosystems have cytogenetically been characterized3. determined by agarose gel electrophoresis and UV Cytogenetic as well as DNA sequence information spectrophotometer. Amplification of ITS 2 region are very helpful in resolving taxonomic ambiguities was carried out in a 50-µl reaction mixture, among the species, unfolding genetic identity of the containing 100 ng template DNA, 10X buffer (Tris organisms as well as in evolutionary and with 15 mM MgCl2), 10 mM dNTPs mix (2.5 mM of phylogenetic studies. Internal transcribed spacer 2 each dNTPs), 25 mM of MgCl2, 10 pmoles of each (ITS 2) of nuclear rDNA cistron is regarded as one of primers (ITS 2 F1: the candidate DNA barcode due to availability of GCAGGACACATTGATCATCGACAC and ITS 2 conserved regions and sufficient variability to R1: GGCTCTTCCCTCTTCGCT CGC), 2U Taq distinguish even closely related species. The present DNA polymerase (Chromous, India). PCR was study comprised characterization of P. gibbosus, C. performed in Eppendorf Thermal Cycler (Master collare, S. ghobban and S. canaliculatus with a view Cycler Gradient), with initial denaturation at 95ºC for to document their chromosomal as well as molecular 4 min followed by 32 cycles of denaturation at 94ºC diversity and evolutionary relationship. for 45 sec, annealing at 55ºC for 30 sec, elongation at 72ºC for 45 sec, with a final extension at 72ºC for 10 Materials and Methods min. Product was checked on agarose gel and Live specimens of C. collare (n=6), P. gibbosus sequenced using custom service. (n=6), S. ghobban (n=6) and S. canaliculatus (n=6) 1112 INDIAN J. MAR. SCI., VOL. 45, NO.9 SEPTEMBER 2016 Table 1: Details of sequences among the species studied. Species Sequence length (bp) GC% NCBI Acc. No. P. gibbosus 613 69.1 JQ766314 C. collare 588 68.2 JQ814470 S. ghobban 504 63.3 JX499020 S. canaliculatus 685 59.3 JX499021 R. rita 670 60.2 KC009840 phylogram grouping of P. gibbosus and S. ghobban in The forward and reverse sequences were aligned one cluster, while S. canaliculatus was placed with C. using online ClustalW software. Consensus collare in another cluster (Fig. 4) with good bootstrap sequences were submitted to the GenBank (Table 1). values (60 and 88, respectively) using 1000 Sequence analyses were carried out using MEGA 5.06 replications. Minimum evolutionary divergence (i.e. and DnaSP v57 softwares. ITS 2 sequence of Rita rita, 0.530±0.05) was found between sequences of P. retrieved from GenBank (Acc. No. KC009840) was gibbosus and S. ghobban, while maximum (i.e. used as out-group. 1.256±0.14) was found between S. canaliculatus and R. rita. Results In all the four studied species, the 2n was found to be Discussion 48 with all telocentric chromosomes (karyotype The presence of 2n= 48 in the undertaken species was in accordance with those observed in majority of formula, KF = 48t; Fig. 2A, B, D), except in S. 9,10,11 ghobban having KF = 10m+4sm+12st+22t (Fig. 2C). marine fish species from India . Occurrence of all 48 telocentric chromosomes seems to be a Consensus DNA sequences of P. gibbosus (613 bp), 12 C. collare (588 bp), S. canaliculatus (685 bp) and S. characteristic of majority of marine species . Among ghobban (504 bp) containing partial 5.8S, complete the Indian non-native fishes, approximately 60% of ITS 2 and partial 28S ribosomal gene regions were the perciform species, studied so far have shown to contain a karyotype characterized by 48 uni-armed obtained. Small and highly conserved 5.8S and the 13 small portion of the 28S gene regions were easy to (telocentric) chromosomes and this all uni-armed condition has been considered as primitive character align across the taxa along with the hyper variable 14,15 ITS 2 region to delineate marine fish species from the in marine fishes .
Load more

Recommended publications
  • Dedication Donald Perrin De Sylva
    Dedication The Proceedings of the First International Symposium on Mangroves as Fish Habitat are dedicated to the memory of University of Miami Professors Samuel C. Snedaker and Donald Perrin de Sylva. Samuel C. Snedaker Donald Perrin de Sylva (1938–2005) (1929–2004) Professor Samuel Curry Snedaker Our longtime collaborator and dear passed away on March 21, 2005 in friend, University of Miami Professor Yakima, Washington, after an eminent Donald P. de Sylva, passed away in career on the faculty of the University Brooksville, Florida on January 28, of Florida and the University of Miami. 2004. Over the course of his diverse A world authority on mangrove eco- and productive career, he worked systems, he authored numerous books closely with mangrove expert and and publications on topics as diverse colleague Professor Samuel Snedaker as tropical ecology, global climate on relationships between mangrove change, and wetlands and fish communities. Don pollutants made major scientific contributions in marine to this area of research close to home organisms in south and sedi- Florida ments. One and as far of his most afield as enduring Southeast contributions Asia. He to marine sci- was the ences was the world’s publication leading authority on one of the most in 1974 of ecologically important inhabitants of “The ecology coastal mangrove habitats—the great of mangroves” (coauthored with Ariel barracuda. His 1963 book Systematics Lugo), a paper that set the high stan- and Life History of the Great Barracuda dard by which contemporary mangrove continues to be an essential reference ecology continues to be measured. for those interested in the taxonomy, Sam’s studies laid the scientific bases biology, and ecology of this species.
    [Show full text]
  • Fishes of Terengganu East Coast of Malay Peninsula, Malaysia Ii Iii
    i Fishes of Terengganu East coast of Malay Peninsula, Malaysia ii iii Edited by Mizuki Matsunuma, Hiroyuki Motomura, Keiichi Matsuura, Noor Azhar M. Shazili and Mohd Azmi Ambak Photographed by Masatoshi Meguro and Mizuki Matsunuma iv Copy Right © 2011 by the National Museum of Nature and Science, Universiti Malaysia Terengganu and Kagoshima University Museum All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without prior written permission from the publisher. Copyrights of the specimen photographs are held by the Kagoshima Uni- versity Museum. For bibliographic purposes this book should be cited as follows: Matsunuma, M., H. Motomura, K. Matsuura, N. A. M. Shazili and M. A. Ambak (eds.). 2011 (Nov.). Fishes of Terengganu – east coast of Malay Peninsula, Malaysia. National Museum of Nature and Science, Universiti Malaysia Terengganu and Kagoshima University Museum, ix + 251 pages. ISBN 978-4-87803-036-9 Corresponding editor: Hiroyuki Motomura (e-mail: [email protected]) v Preface Tropical seas in Southeast Asian countries are well known for their rich fish diversity found in various environments such as beautiful coral reefs, mud flats, sandy beaches, mangroves, and estuaries around river mouths. The South China Sea is a major water body containing a large and diverse fish fauna. However, many areas of the South China Sea, particularly in Malaysia and Vietnam, have been poorly studied in terms of fish taxonomy and diversity. Local fish scientists and students have frequently faced difficulty when try- ing to identify fishes in their home countries. During the International Training Program of the Japan Society for Promotion of Science (ITP of JSPS), two graduate students of Kagoshima University, Mr.
    [Show full text]
  • Taverampe2018.Pdf
    Molecular Phylogenetics and Evolution 121 (2018) 212–223 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Multilocus phylogeny, divergence times, and a major role for the benthic-to- T pelagic axis in the diversification of grunts (Haemulidae) ⁎ Jose Taveraa,b, , Arturo Acero P.c, Peter C. Wainwrightb a Departamento de Biología, Universidad del Valle, Cali, Colombia b Department of Evolution and Ecology, University of California, Davis, CA 95616, United States c Instituto de Estudios en Ciencias del Mar, CECIMAR, Universidad Nacional de Colombia sede Caribe, El Rodadero, Santa Marta, Colombia ARTICLE INFO ABSTRACT Keywords: We present a phylogenetic analysis with divergence time estimates, and an ecomorphological assessment of the Percomorpharia role of the benthic-to-pelagic axis of diversification in the history of haemulid fishes. Phylogenetic analyses were Fish performed on 97 grunt species based on sequence data collected from seven loci. Divergence time estimation Functional traits indicates that Haemulidae originated during the mid Eocene (54.7–42.3 Ma) but that the major lineages were Morphospace formed during the mid-Oligocene 30–25 Ma. We propose a new classification that reflects the phylogenetic Macroevolution history of grunts. Overall the pattern of morphological and functional diversification in grunts appears to be Zooplanktivore strongly linked with feeding ecology. Feeding traits and the first principal component of body shape strongly separate species that feed in benthic and pelagic habitats. The benthic-to-pelagic axis has been the major axis of ecomorphological diversification in this important group of tropical shoreline fishes, with about 13 transitions between feeding habitats that have had major consequences for head and body morphology.
    [Show full text]
  • Perciformes: Haemulidae) Inferred Using Mitochondrial and Nuclear Genes
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/256288239 A molecular phylogeny of the Grunts (Perciformes: Haemulidae) inferred using mitochondrial and nuclear genes Article in Zootaxa · June 2011 DOI: 10.11646/zootaxa.2966.1.4 CITATIONS READS 35 633 3 authors, including: Millicent D Sanciangco Luiz A Rocha Old Dominion University California Academy of Sciences 26 PUBLICATIONS 1,370 CITATIONS 312 PUBLICATIONS 8,691 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Mesophotic Coral Reefs View project Vitória-Trindade Chain View project All content following this page was uploaded by Luiz A Rocha on 20 May 2014. The user has requested enhancement of the downloaded file. Zootaxa 2966: 37–50 (2011) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2011 · Magnolia Press ISSN 1175-5334 (online edition) A molecular phylogeny of the Grunts (Perciformes: Haemulidae) inferred using mitochondrial and nuclear genes MILLICENT D. SANCIANGCO1, LUIZ A. ROCHA2 & KENT E. CARPENTER1 1Department of Biological Sciences, Old Dominion University, Mills Godwin Building, Norfolk, VA 23529 USA. E-mail: [email protected], [email protected] 2Marine Science Institute, University of Texas at Austin, 750 Channel View Dr., Port Aransas, TX 78373, USA. E-mail: [email protected] Abstract We infer a phylogeny of haemulid genera using mitochondrial COI and Cyt b genes and nuclear RAG1, SH3PX3, and Plagl2 genes from 56 haemulid species representing 18 genera of the expanded haemulids (including the former inermiids) and ten outgroup species. Results from maximum parsimony, maximum likelihood, and Bayesian analyses show strong support for a monophyletic Haemulidae with the inclusion of Emmelichthyops atlanticus.
    [Show full text]
  • Annotated Checklist of the Fish Species (Pisces) of La Réunion, Including a Red List of Threatened and Declining Species
    Stuttgarter Beiträge zur Naturkunde A, Neue Serie 2: 1–168; Stuttgart, 30.IV.2009. 1 Annotated checklist of the fish species (Pisces) of La Réunion, including a Red List of threatened and declining species RONALD FR ICKE , THIE rr Y MULOCHAU , PA tr ICK DU R VILLE , PASCALE CHABANE T , Emm ANUEL TESSIE R & YVES LE T OU R NEU R Abstract An annotated checklist of the fish species of La Réunion (southwestern Indian Ocean) comprises a total of 984 species in 164 families (including 16 species which are not native). 65 species (plus 16 introduced) occur in fresh- water, with the Gobiidae as the largest freshwater fish family. 165 species (plus 16 introduced) live in transitional waters. In marine habitats, 965 species (plus two introduced) are found, with the Labridae, Serranidae and Gobiidae being the largest families; 56.7 % of these species live in shallow coral reefs, 33.7 % inside the fringing reef, 28.0 % in shallow rocky reefs, 16.8 % on sand bottoms, 14.0 % in deep reefs, 11.9 % on the reef flat, and 11.1 % in estuaries. 63 species are first records for Réunion. Zoogeographically, 65 % of the fish fauna have a widespread Indo-Pacific distribution, while only 2.6 % are Mascarene endemics, and 0.7 % Réunion endemics. The classification of the following species is changed in the present paper: Anguilla labiata (Peters, 1852) [pre- viously A. bengalensis labiata]; Microphis millepunctatus (Kaup, 1856) [previously M. brachyurus millepunctatus]; Epinephelus oceanicus (Lacepède, 1802) [previously E. fasciatus (non Forsskål in Niebuhr, 1775)]; Ostorhinchus fasciatus (White, 1790) [previously Apogon fasciatus]; Mulloidichthys auriflamma (Forsskål in Niebuhr, 1775) [previously Mulloidichthys vanicolensis (non Valenciennes in Cuvier & Valenciennes, 1831)]; Stegastes luteobrun- neus (Smith, 1960) [previously S.
    [Show full text]
  • Checklist of the Shore Fishes of New Caledonia
    Plates 15/1 & 15/2 Checklist of the shore fishes of New Caledonia Ronald FRICKE J & Michel KULBICKI 2 J Ichthyology, Staatliches Museumfiir Naturkunde, Rosenstein 1,70191 Stuttgart, Germany [email protected] 2IRD, UR128, Universite de Perpignan, 52, Avenue Paul Alduy, 66860 Perpignan Cedex, France michel.kulbicki@univ-perpJr The present checklist includes the fish species known from the upper 100 m of the New Caledonian seas. Some deep-sea fishes which are occasionally found in shallow water (e.g. Loyalty Islands), high sea species which only rarely enter coastal waters, or freshwater fish species which may be found in estuaries, are excluded from this list. The geographical distribution of the shore fishes of New Caledonia is discussed by Kulbicki (in press). A detailed annotated checklist of all New Caledonian fish species including distribution data, litera­ ture references and material lists is in preparation by R. Fricke. In the present checklist of shore fish species, all records which are verified either by museum specimens or by confirmation by revising authors, are included. Families are arranged systematically according to Nelson (2006), and species alphabetically under the family names. Doubtful records are discussed after the family name. The names which have been applied to New Caledonian shore fish species in the literature are either list­ ed as valid species, or as synonyms or misidentifications in parentheses behind the species name. In the checklist, reference is given to materials in the collections of the Australian Museum Sydney (AMS), the Museum National d'Histoire Naturelle Paris (MNHN), and the Staatliches Museum flir Naturkunde Stuttgart (SMNS), in order to document new records.
    [Show full text]
  • FIRST RECORD of HARRY HOTLIPS Plectorhinchus Gibbosus (Lacepède, 1802) (Perciformes: Haemulidae) from the IRANIAN COAST of the GULF of OMAN
    Croatian Journal of Fisheries, 2019, 77, 271-274 M. S. Alavi-Yeganeh et al. (2019): Record of Harry hotlips in Iranian coast of Oman DOI: 10.2478/cjf-2019-0021 CODEN RIBAEG ISSN 1330-061X (print) 1848-0586 (online) FIRST RECORD OF HARRY HOTLIPS Plectorhinchus gibbosus (Lacepède, 1802) (Perciformes: Haemulidae) FROM THE IRANIAN COAST OF THE GULF OF OMAN Mohammad Sadegh Alavi-Yeganeh*, Mina Khajavi Tarbiat Modares University, Faculty of Marine Sciences, Department of Marine Biology, Nur, Iran *Corresponding Author, Email: [email protected] ARTICLE INFO ABSTRACT Received: 19 July 2019 Harry hotlips (Plectorhinchus gibbosus), belonging to the fish family Accepted: 4 October 2019 Haeumulidae, is recorded for the first time off the Iranian coast of the Oman Sea, Chabahar Bay (25°18'N, 60°37'E). Identification confirmed by comparing morphological data of the collected specimen with data of reported congener species off this area. Keywords: Chabahar Bay Plectorhinchus gibbosus Grunt Haemulidae How to Cite Alavi-Yeganeh, M. S., Khajavi, M. (2019): First record of Harry hotlips Plectorhinchus gibbosus (Lacepède, 1802) (Perciformes: Haemulidae) from the Iranian coast of the Gulf of Oman. Croatian Journal of Fisheries, 77, 271-274. DOI: 10.2478/cjf-2019-0021. INTRODUCTION (Smith and McKay, 1986). Plectorhinchus gibbosus inhabit The Haemulidae with 19 genera and 134 species are coastal reefs, sandbanks and near estuaries (Sommer et marine fish (some in brackish and rarely inhabiting fresh al., 1996). Coloration in small juveniles observed along waters), distributed in the tropical and subtropical area sheltered sandy shorelines is related to their camouflage of the Atlantic, Indian and Pacific Oceans (Eschmeyer, ability by resembling a dead leaf and drifting on their 2019; Nelson et al., 2016; Froese and Pauly, 2019).
    [Show full text]
  • De Vertebrados De Moçambique Checklist of Vertebrates of Mozambique
    ‘Checklist’ de Vertebrados de Moçambique Checklist of Vertebrates of Mozambique Michael F. Schneider*, Victorino A. Buramuge, Luís Aliasse & Filipa Serfontein * autor para a correspondência – author for correspondence [email protected] Universidade Eduardo Mondlane Faculdade de Agronomia e Engenharia Florestal Departamento de Engenharia Florestal Maputo, Moçambique Abril de 2005 financiado por – funded by IUCN Mozambique Fundo Para a Gestão dos Recursos Naturais e Ambiente (FGRNA) Projecto No 17/2004/FGRNA/PES/C2CICLO2 Índice – Table of Contents Abreviaturas – Abbreviations..............................................................................2 Nomes vernáculos – vernacular names: .............................................................3 Referências bibliográficas – Bibliographic References ......................................4 Checklist de Mamíferos- Checklist of Mammals ................................................5 Checklist de Aves- Checklist of Birds ..............................................................38 Checklist de Répteis- Checklist of Reptiles ....................................................102 Checklist de Anfíbios- Checklist of Amphibians............................................124 Checklist de Peixes- Checklist of Fish............................................................130 1 Abreviaturas - Abbreviations * espécie introduzida – introduced species ? ocorrência duvidosa – occurrence uncertain end. espécie endémica (só avaliada para mamíferos, aves e répteis) – endemic species (only
    [Show full text]
  • CAESIONIDAE Species As Currently Recognised on IUCN Red List
    Red Listing Requires CAESIONIDAE species as currently Distribution (NE = not taxonomic change Taxonomic Notes recognised on IUCN Red List evaluated) to existing listing Caesio caerulaurea I-W Pacific LC Caesio cuning E. Indian Ocean - W Pacific LC Caesio lunaris I-W Pacific LC Caesio striata Red Sea LC Caesio suevica Red Sea LC Caesio teres I-W Pacific LC Caesio varilineata Indian Ocean LC Caesio xanthalytos E. Africa LC Caesio xanthonota Indian Ocean LC Dipterygonotus balteatus I-W Pacific LC Gymnocaesio gymnoptera I-W Pacific LC Pterocaesio capricornis E. Africa - Mascarene DD Pterocaesio chrysozona I-W Pacific LC Pterocaesio digramma W Pacific LC Pterocaesio flavifasciata E. Indian Ocean NE Pterocaesio lativittata E Indian Ocean - W Pacific LC Pterocaesio marri I-W Pacific LC Pterocaesio monikae Papua NE Pterocaesio pisang I-W Pacific LC Pterocaesio randalli E Indian Ocean - W Pacific NE Pterocaesio tessellata E Indian Ocean - W Pacific LC Pterocaesio tile I-W Pacific LC Pterocaesio trilineata I-W Pacific LC Red Listing Requires HAEMULIDAE species as currently Distribution (NE = not taxonomic change Taxonomic Notes recognised on IUCN Red List evaluated) to existing listing Anisotremus caesius E Pacific LC Anisotremus davidsonii E Pacific - US- Mexico (Baja) LC Anisotremus interruptus E Pacific LC Now Paranisotremus Anisotremus moricandi W Atlantic LC Yes (minor) moricandi Anisotremus scapularis E Pacific - Peru - Galapagos LC Anisotremus surinamensis W Atlantic DD Anisotremus taeniatus E Pacific LC Anisotremus virginicus W Atlantic
    [Show full text]
  • CHECKLIST of the INSHORE FISHES of the EASTERN INDONESIAN WATERS [Daftar Ikan Pantai Di Perairan Indonesia Bagian Timur]
    Jurnal Iktiologi Indonesia, Volume 6, Nomor /, Juni 2006 CHECKLIST OF THE INSHORE FISHES OF THE EASTERN INDONESIAN WATERS [Daftar ikan pantai di perairan Indonesia bagian timur] T. Peristiwady Marine Organism Consevation Station Indonesian Institute of Sciences Bitung, North Sulawesi Jl. Tandurusa, Kec. Tandurusa, Kodya Bitung, North Sulawesi Telp: (0438) 30755 E-mail: [email protected] ABSTRAK Data ikan dikumpulkan dari sejumlah penelitian lapangan dan pengumpulan dari pasar ikan dari berbagai tempat: Amfoang, Pulau Timor (Desember 2002); Biak, Papua (September 2000); Bitung, Sulawesi Utara (Juli, September dan Oktober 2000); Pulau Komodo (Juli 2001); Sungai Memberamo (Juni 1999); Riung, Pulau Flores (Juni 2001); Rote Timur, Pulau Rote (April 2003); Sorong, Papua (September 2000); Wini, Pulau Timor (Desember 2000) dan Kupang, Pulau Timor (1999-2003). Jumlah keseluruhan yang dikumpulkan ada 2007 spesimen yang tercakup dalam 88 famili, 260 genera, dan 632 spesies. Kata kunci: spesies ikan, perairan pantai Indonesia bagian timur. IN1RODUCTION fishing in demersal resources is not only cause a The eastern Indonesian waters characterized decline of resources but also extension of certain with various ecosystems that are suitable for the species. Regarding to this condition fishing activities development of the fishing activities. The ecosystems is needed to check on regular period. The present include mudflats, coral reefs, estuaries, mangrove checklist of fishes is not expected to be a complete list. swamps, coastal areas and continental shelves. As However, it contains almost a complete commercials eastern parts of Indonesian waters are situated in the species in eastern Indonesian waters. Thus, it is hope tropical Indo-Pacific, it has an extremely rich and varied that this checklist will be used as a new baseline which of fish fauna.
    [Show full text]
  • Size Structure and Reproduction of Exploited Reef Fishes Before Establishing a Management Plan at Kamiali Wildlife Management Area, Papua New Guinea
    Six-Year Baseline Information: Size Structure and Reproduction of Exploited Reef Fishes Before Establishing a Management Plan at Kamiali Wildlife Management Area, Papua New Guinea Ken Longenecker, Ross Langston, Holly Bolick, Utula Kondio, and Mara Mulrooney Honolulu, Hawai‘i December 2014 COVER Hamm Geamsa prepares his gear for hook-and-line fishing just off the fringing reef at Kamiali Wildlife Management Area. Photo: Sarah Rose. Six-Year Baseline Information: Size Structure and Reproduction of Exploited Reef Fishes Before Establishing a Management Plan at Kamiali Wildlife Management Area, Papua New Guinea Ken Longenecker1, Ross Langston1, Holly Bolick1, Utula Kondio,2 and Mara Mulrooney1 (1) Pacific Biological Survey Bishop Museum Honolulu, Hawai‘i 96817, USA (2) Kamiali Wildlife Management Area Lababia, Morobe Province, PNG Bishop Museum Technical Report 63 Honolulu, Hawai‘i December 2014 Bishop Museum Press 1525 Bernice Street Honolulu, Hawai‘i Copyright © 2014 Bishop Museum All Rights Reserved Printed in the United States of America ISSN 1085-455X Contribution No. 2014-005 to the Pacific Biological Survey Contents LIST OF TABLES.......................................................................................................................... 7 LIST OF FIGURES ........................................................................................................................ 8 EXECUTIVE SUMMARY .......................................................................................................... 12 INTRODUCTION .......................................................................................................................
    [Show full text]
  • Benthic Habitats and Biodiversity of the Dampier and Montebello Australian Marine Parks
    CSIRO OCEANS & ATMOSPHERE Benthic habitats and biodiversity of the Dampier and Montebello Australian Marine Parks Edited by: John Keesing, CSIRO Oceans and Atmosphere Research March 2019 ISBN 978-1-4863-1225-2 Print 978-1-4863-1226-9 On-line Contributors The following people contributed to this study. Affiliation is CSIRO unless otherwise stated. WAM = Western Australia Museum, MV = Museum of Victoria, DPIRD = Department of Primary Industries and Regional Development Study design and operational execution: John Keesing, Nick Mortimer, Stephen Newman (DPIRD), Roland Pitcher, Keith Sainsbury (SainsSolutions), Joanna Strzelecki, Corey Wakefield (DPIRD), John Wakeford (Fishing Untangled), Alan Williams Field work: Belinda Alvarez, Dion Boddington (DPIRD), Monika Bryce, Susan Cheers, Brett Chrisafulli (DPIRD), Frances Cooke, Frank Coman, Christopher Dowling (DPIRD), Gary Fry, Cristiano Giordani (Universidad de Antioquia, Medellín, Colombia), Alastair Graham, Mark Green, Qingxi Han (Ningbo University, China), John Keesing, Peter Karuso (Macquarie University), Matt Lansdell, Maylene Loo, Hector Lozano‐Montes, Huabin Mao (Chinese Academy of Sciences), Margaret Miller, Nick Mortimer, James McLaughlin, Amy Nau, Kate Naughton (MV), Tracee Nguyen, Camilla Novaglio, John Pogonoski, Keith Sainsbury (SainsSolutions), Craig Skepper (DPIRD), Joanna Strzelecki, Tonya Van Der Velde, Alan Williams Taxonomy and contributions to Chapter 4: Belinda Alvarez, Sharon Appleyard, Monika Bryce, Alastair Graham, Qingxi Han (Ningbo University, China), Glad Hansen (WAM),
    [Show full text]