RP2 Phenotype and Pathogenetic Correlations in X-Linked Retinitis Pigmentosa

OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: JANEY L. WIGGS, MD, PhD RP2 Phenotype and Pathogenetic Correlations in X-Linked Retinitis Pigmentosa

Thiran Jayasundera, MD; Kari E. H. Branham, MS; Mohammad Othman, PhD; William R. Rhoades, BS; Athanasios J. Karoukis, BS; Hemant Khanna, PhD; Anand Swaroop, PhD; John R. Heckenlively, MD

Objectives: To assess the phenotype of patients with function. All 3 female carriers had macular atrophy in 1 X-linked retinitis pigmentosa (XLRP) with RP2 muta- or both eyes and were myopic (mean, −6.23 D). All 9 non- tions and to correlate the findings with their genotype. sense and frameshift and 5 of 7 missense mutations (71%) resulted in severe clinical presentations. Methods: Six hundred eleven patients with RP were screened for RP2 mutations. From this screen, 18 pa- Conclusions: Screening of the RP2 gene should be pri- tients with RP2 mutations were evaluated clinically with oritized in patients younger than 16 years characterized standardized electroretinography, Goldmann visual fields, by X-linked inheritance, decreased best-corrected vi- and ocular examinations. In addition, 7 well-docu- sual acuity (eg, Ͼ20/40), high myopia, and early-onset mented cases from the literature were used to augment macular atrophy. Patients exhibiting a choroideremia- genotype-phenotype correlations. like fundus without choroideremia gene mutations should also be screened for RP2 mutations. Results: Of 11 boys younger than 12 years, 10 (91%) had macular involvement and 9 (82%) had best- Clinical Relevance: An identifiable phenotype for corrected visual acuity worse than 20/50. Two boys from RP2-XLRP aids in clinical diagnosis and targeted genetic different families (aged 8 and 12 years) displayed a choroideremia-like fundus, and 9 boys (82%) were myopic screening. (mean error, −7.97 diopters [D]). Of 10 patients with electroretinography data, 9 demonstrated severe rod-cone dys- Arch Ophthalmol. 2010;128(7):915-923

ETINITIS PIGMENTOSA (RP) IS tor and is involved in cellular transport regu- a clinically and genetically lation mechanisms.18 Although the 30 heterogeneous group of amino-terminal residues of RP2 are criti- retinal disorders that causes cal for binding to Arl3, human disease- progressive loss of visual causing mutations Arg118His and functionR due to rod and cone photorecep- Glu138Gly also reduce the affinity of RP2 tor degeneration. The X-linked forms of to Arl3, indicating a clinically relevant as- RP (XLRP) account for 10% to 20% of all sociation elsewhere in the protein. Post- RP cases.1-3 Two genes have been cloned translational acyl modifications at the N- for XLRP: retinitis pigmentosa GTPase terminus of RP2 act to target the protein to regulator, RPGR (OMIM 312610),4 and the plasma membrane, and disruption of 5,6 Author Affiliations: RP2 (OMIM 312600), which together ac- this acylation site ultimately leads to the RP 7-10 19,20 Department of Ophthalmology count for more than 80% of XLRP. phenotype. Most pathogenic sequence and Visual Sciences, Kellogg Mutations in RP2 are reported to cause alterations found in RP2 represent truncat- Eye Center (Drs Jayasundera, 7% to 10% of XLRP.6,11-15 The RP2 gene is ing mutations.11 However, missense mu- Othman, Khanna, Swaroop, and composed of 5 exons and encodes a widely tations have been located in the cofactor Heckenlively; Ms Branham; and expressed protein of 350 amino acids.6,16 The C–like domain of RP2.17 Messrs Rhoades and Karoukis), RP2 protein consists of an amino-terminal Given the considerable phenotypic and and Department of Human domain with homology to cofactor C and genetic heterogeneity associated with Genetics (Dr Swaroop), a carboxyl-terminal domain with homol- XLRP14 and the scarcity of patients with RP2 University of Michigan, 17 Ann Arbor; and Neurobiology, ogy to nucleoside diphosphate kinase. The diagnoses, there has been insufficient in- Neurodegeneration, and Repair amino-terminal domain of RP2 binds to a formation to date to predict the clinical Laboratory, National Institutes small guanosine triphosphate–binding pro- phenotype of a patient based on the RP2 mu- of Health, Bethesda, Maryland tein, Arl3, which shows homology with tation. Although there have been stud- (Dr Swaroop). adenosine diphosphate–ribosylation fac- ies9,12,14,21 containing correlations of RP2 phe-

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 915

Family Type of Protein Severity of Associated Predicted Effect of Mutation No. Location Mutation Nucleotide Change Changea Phenotype on Protein16,17,19,20 Mutations From the University of Michigan Cohort 1090 Exon 1 Missense c.8GϾC p.Cys3Serb Less severe Mislocalization of protein 148 Exon 1 Insertion/frameshift c.77insCA p.Gln26fs11 Severe Loss of function 1015 Intron 1 Splice IVS1ϩ1GϾA Spliceb Severe Loss of function 528 Intron 1 Splice IVS1ϩ3AϾG Splice14 Severe Loss of function 951 Exon 2 Missense c.260CϾT p.Thr87Ileb Less severe Protein alteration 933 Exon 2 Missense c.352CϾT p.Arg118Cys21 Severe Protein alteration 944 Exon 2 Missense c.353GϾA p.Arg118His6 Severe Protein alteration 948 Exon 2 Missense c.353GϾA p.Arg118His6 Severe Protein alteration 652 Exon 2 Deletion c.409-411delATT p.Ile137del12 Severe Protein instability 1029 Exon 2 Nonsense c.450GϾA p.Trp150Stop27 Severe (carrier) Loss of function 971 Exon 2 Insertion/frameshift c.515_516insG p.Ser172fsTer17314 Severe Loss of function 548 Exon 2 Insertion/frameshift c.673-674insC p.R225fsTer23414 Severe Loss of function 1167 Exon 2 Missense c.758TϾC p.Leu253Prob Severe Protein instability Mutations From Published Cases in the Literature Case 122 Exon 1 Deletion c.12_18 del p.Ser6del6 Less severe Mislocalization of protein Case 222 Exon 1 Nonsense c.76CϾT p.Gln26Stop6 Severe Loss of function Case 323 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 424 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 525 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 626 Exon 2 Missense c.758TϾG p.Leu253Arg26 Severe Protein instability Case 717 Exon 2 Deletion/frameshift c.798delGACA p.Gln266fs21 Severe Loss of function

a References cited in this column denote the first mention of the change in the literature. b Novel change.

notypes with visual function data, no large study exists, to individual identification number (ie, family number-indi- our knowledge, in which clear clinical distinctions have been vidual number). identified to help make it a recognizable entity to ophthal- A comprehensive literature search was performed to iden- mologists. A recognizable phenotype would help narrow tify publications containing unambiguous and adequate de- the differential diagnosis for candidate gene mutational scriptions of clinical features (age at symptom onset, visual function, electroretinography data, and retinal appearance) of screening for RP2. We undertook the present study to care- individual patients with RP2 mutations. Data on the 7 identi- fully analyze the phenotype in a cohort of patients with RP2 fied cases were collected from the literature for inclusion and and carriers found at our institution and in previously pub- comparison to supplement the cohort from our institution to lished articles (Table 1). We correlated the severity of dis- delineate the phenotype of RP2 and make genotype to pheno- ease with the predicted effect of the mutation on the pu- type correlations (Table 1). tative function of RP2. DNA EXTRACTION METHODS DNA was extracted from the whole blood of patients. Primers for amplifying RP2 exons 2-5 were used as previously PATIENTS reported.6 The sequences for the RP2 exon 1 forward and reverse primers were 5Ј CTTTGATTGGCTCAACAGGC and Mutational analysis was performed on 611 DNA samples as part 5Ј GTTCAAGAGAGTGCGGCAG, respectively. These prim- of a larger screening study from the XLRP Repository of the ers amplified 447–base pair polymerase chain reaction (PCR) University of Michigan’s Center for Retinal and Macular De- fragments. generation (outside samples not reported). Samples from patients affected with a probable or possible diagnosis of XLRP PCR CONDITIONS AND SEQUENCING or X-linked cone-rod dystrophy (as described by Breuer et al14) were screened for variations and mutations in the RP2 gene. DNA was used at approximately 100 ng per PCR. All the ex- Mutational analysis was performed as described by Mears et ons except exon 2 were amplified with Ex Taq Polymerase al11 (n=51), by Breuer et al14 (n=234), or herein (n=326). (TaKaRa Bio Inc, Shiga, Japan). Exon 2 was amplified with Ac- Included in this genotype-phenotype correlation study are cuPrime high-fidelity polymerase (Invitrogen, Carlsbad, Cali- the 18 patients with previously identified RP2 mutations who fornia). The annealing temperature for exons 1 and 2 was 59°C; were clinically evaluated in the Retinal Dystrophy Clinic at the for exons 3, 4, and 5, it was 64°C. All PCR volumes were made University of Michigan’s Kellogg Eye Center or at the Univer- to 25 µL, and PCR products were run on 2% agarose gels to sity of California, Los Angeles’ Jules Stein Eye Institute. All the verify the sizes and quality of amplification. Before submitting patients gave informed consent, and the research was ap- the samples for sequencing, the DNA concentration was mea- proved by the institutional review board at the University of sured using a spectrophotometer (NanoDrop 1000; Thermo Sci- Michigan. Patients with only a clinical diagnosis of XLRP with- entific, Wilmington, Delaware). The PCR amplicons were then out documented RP2 mutations were excluded. Patients are iden- diluted (1-3 ng/µL in distilled water) as required by the se- tified throughout with a family identification number and an quencing core at the University of Michigan Medical School.

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 916

©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 Sequencing was performed with either forward or reverse primers for exons 1, 3, 4, and 5 and with 4 primers for exon 2. 28 p.Gly2Val Deletion of exon 1 D ∗ 9 p.Cys3Ser (Fam 1090) p.Phe5del e Myristoylation p.Ser6del6 i MUTATIONAL DATA ANALYSIS Exon 1 p.Glu18X29

6 e p.Glu26X 11

on p.Gln26fs (Fam 148) Sequences were downloaded from the sequencing core server p.Try27X14 c.IVS1 + 3 A >G14 and were analyzed using a 4.8 demo version of Sequencher (Gene c.IVS1 + 3 A >T12 15 (Fam 528) − > 30 Codes Corp, Ann Arbor). The sequences were read by 2 people c.IVS1 2 A G c.IVS1 + 1 G > A ∗ (M.O. and A.J.K.) independently, and mutations were tabu- Insertion of L1 element6 (Fam 1015) lated. The mutations were reconfirmed by running an inde- p.Cys67Tyr14 pendent PCR on the samples. p.Cys86Tyr12 Cofactor C p.Pro95Leu12 9 CLINICAL DATA p.Gly98fs p.Val300delinsAlaAlafs9 ∗ p.Thr87Ile (Fam 951) All medical records were reviewed for the following clinical fea- p.Phe102fs30 tures: age at onset of visual disturbance; best-corrected visual p.Cys105Trp9 acuity (BCVA); refractive error (spherical equivalence); macu- p.Cys110fs11 lar, pericentral, peripheral retinal, and optic disc appearance p.Phe117fs14 (color fundus photographs were also analyzed to supplement p.Arg118Leu,30 p.Arg118Cys,15 p.Arg118Cys21 (Fam 933) p.Arg118His,6 p.Arg118Gly31 p.Arg118His6 (Fam 944 the written description in the medical record); Goldmann vi- and 948) p.Arg120X11 sual field (GVF) data; and standardized electroretinography am- p.Glu128Gly30 p.IIe137del12 (Fam 652) plitudes and implicit times. The same Exon 5 information Exon 4 was Exon 3 gath- p.Leu129fs31 Exon 2 ered from previously published cases identified by the literature p.Gln134X29 search. Clinical data were recorded for each patient visit when p.IIe137del12 Binds Arl3 available; however, not all outcome measures were available p.Ser140Phe29 at every patient visit. p.Ser140_Asn142delinsTryfs9 p.Trp150X32 p.Ser172fs14 (Fam 971) p.Tyr151X6 CLINICAL SEVERITY GRADING p.Tyr151fs6 p.Asp161fs11 p.Ser181fs9 We devised a novel grading approach to subdivide patients ac- p.Glu183X32 cording to 2 severity categories: less severe and severe (no pa- p.Trp186X9 tients were mild). A patient was considered less severe if he or p.Leu188Pro14 she had relatively late onset of severe macular dysfunction. The p.Arg211His9 BCVA was used as a surrogate for macular function and was con- p.Arg225fs14 (Fam 548) sidered severe if worse than 20/50 at 20 years or younger, worse p.Lys230fs13 than 20/100 from age 21 to 30 years, worse than 20/200 from 33 age 31 to 40 years, and worse than 20/400 after age 41 years. p.Phe241fs p.Leu253Arg27 p.Leu253Pro ∗ c.IVS2–3 C>A28 (Fam 1167) > 9 RESULTS c.IVS2–1 G A p.Gln266fs21 9 p.Glu269fs Ferredoxin-like domain MUTATIONAL ANALYSIS p.Ala285fs32 p.Asp287fs14 c.IVS3–1 G>C31

Mutational screening identified 13 families with muta- Deletion of exon 4

tions in RP2 (Table 1). Of these, we previously reported p.Glu309fs11 et i the genotype of 4 individuals11,14; 5 mutations we identi- p.Val310fs13 fied have been reported by others, and 4 are novel changes. The locations of these mutations in relation to all previ- p.Lys323fs28 6 ously reported RP2 mutations are shown in Figure 1. Four c.IVS4 + 3 A >C, c.IVS4 + 3 A >G21 novel mutations were identified in these families, including 1 missense change (Cys3Ser) identified in exon 1, 2 missense changes identified in exon 2 (Thr87Ile and Leu253Pro), and 1 splice site change (IVS1ϩ1GϾA). None of these changes have previously been identified in patients or controls. The chromatograms of these muta- Figure 1. Mutations in the RP2 gene. Mutations included in this study are on the right. Mutations previously identified in other studies are on the left. Fam tions are found in Figure 2. In 3 of the families, the mu- indicates family. *Novel mutation. tation was also detected in at least 1 other affected male family member or a carrier female. CLINICAL DATA Eighteen patients from 13 families were included from our institution (Table 1). Seven additional patients with Male Cohort Results—Predominant well-identified phenotypes were added from previously Male RP2 Phenotype published articles, giving a total of 25 patients (22 affected males and 3 female carriers) for genotype-pheno- Fifteen male patients were identified during mutational type correlations. screening. We assessed these patients’ macular function

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 917

©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 available from an examination performed before age 12 A Cys3Ser mutation (family 1090) years all developed severe vision loss (worse than 20/ C A T G G G C T G C T T C T T C T C C 200) by the third to seventh decade of life. Tapetal or golden macular sheens were not seen in the patients with RP2,a finding more typical of RPGR X-linked patients. The GVF testing revealed central scotomata in 50% (5 of 10) of all male patients for whom testing was performed, including C A T G G G C T C C T T C T T C T C C 38% (3 of 8) of the patients younger than 12 years. Figure 4 shows examples of RP2-XLRP phenotypes. Measurable peripheral GVF data for boys younger than 12 years were found in 8 cases. Six of these 8 patients (75%) had constriction of the visual field when tested with the I4e target (median visual field size, 25° OD and 25° B IVS1 + 1 G>A mutation (family 1015) OS) and only mild constriction when tested with the IV4e C G C G A G A A G G T A A T G A A A G T target (median visual field size, 55° OU). When data were analyzed for patients younger than 16 years, all 8 had severe constriction of the visual field when tested with the I4e target (median visual field size, 12.5° OD and 17.5° OS) and still only mild constriction when tested with the G C G C G A G A A G A T A A T G A A A G T IV4e target (median visual field size, 50° OU). Data on refractive errors were available for 11 of 15 patients (range, plano to −14 diopters [D]; mean, −6.55 D). Nine of these 11 patients (82%) were found to be myopic (mean, −7.97 D), with most (78%, 7 of 9) of those af- C Thr87Ile mutation (family 951) fected classified as high myopes with greater than −6.00 T G A C T G T A C T A A C T G C A D (mean, −8.91 D). Electroretinography was performed on 10 of 15 patients; 90% (9 of 10) of the patients demonstrated severe rod-cone dysfunction. One patient (1167-2760) showed cone-rod dysfunction. The degree of cone dysfunction was T G A C T G T A T T A A C T G C A further represented by the delayed photopic b-wave implicit times in all 9 male patients, with mean implicit times of 47.2 milliseconds OD and 46.8 milliseconds OS (mean [SD] reference range, 32.3 [1.2] milliseconds).

D Leu253Pro mutation (family 1167) Choroideremia-like Phenotype C A G A A A A C T A A T T G A T G A Two patients (933-2420 and 971-2490) with different mutations (Arg118Cys and Ser172fs, respectively) had peripheral choroideremia-like atrophy. Both patients were tested for mutations in CHM and were found to be nega- C A G A A A A C C A A T T G A T G A tive. The clinical features of patient 971-2490 are illustrated in Figure 4B. There is significant choriocapillaris atrophy in the midperiphery and the posterior pole with no notable pigment deposition. Two male patients demonstrated characteristic superior visual field loss similar to the visual field changes attributed to retinal photo- Figure 2. Chromatograms of the 4 novel changes identified in RP2 toxicity in patients with RHO mutations. As an ex- screening. Normal sequence is on the top and mutations are on the bottom. ample, patient 1167-2760 is illustrated in Figure 4C.

based on macular appearance, BCVA, and presence of cen- Female Carrier Cohort Results tral scotoma on GVF testing (Table 2). Reported de- nominators varied slightly with data availability. Of these Two female carriers manifested a phenotype similar to that patients, 12 had adequate fundus photographs. Eleven of of the affected males, exhibiting atrophic macular changes, 12 patients (92%) had manifestations of macular involve- poor visual acuity, and central scotomata. The third fe- ment in the form of granularity, atrophy, or a bull’s eye male carrier (1015-2553) demonstrating asymmetrical dis- appearance on fundus examination (Figure 3), with 10 ease had anisometropia of approximately 8.00 D, with the of 11 patients (91%) showing macular involvement be- severely affected eye being myopic (Figure 4D), further fore age 12 years. Nine of 11 patients had a BCVA of 20/50 supporting the association of myopia with RP2 retinal dis- or worse by age 12 years. Four patients (148-2239, 528- ease. In fact, all 3 female carriers had macular atrophy in 115, 948-2743, and 1167-2760) for whom BCVA was not 1 or both eyes, and all 3 were myopic (mean, −6.23 D).

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 918

Macular Features Peripheral Features ERG Age at Onset, Refrac- Age at Visual Fundus Pericentral Optic Fundus Visual Field Photopic, Implicit Scotopic, Patient ID y tion Exam, y Acuity Appearance Scotoma Features Nerve Appearance Constriction % Time, s % University of Michigan Cohort 1090-2262 4 Plano 8 20/25 Unaffected None RPE/choroid Normal Granular I4e 25°, IV4e 55° 34 60 (D) 0 atrophy pigment ϩϩ Plano 20/20 Unaffected None RPE/choroid Normal Granular I4e 25°, IV4e 55° 36 60 (D) 0 atrophy pigment ϩϩ NA 15 20/30 Unaffected None RPE/choroid Normal Granular I4e 15° OU NA NA NA atrophy pigment ϩϩ 20/20 Unaffected None RPE/choroid Normal Granular IV4e 45° with atrophy pigment ϩϩ equatorial scotomata OU 148-2240 3 NA 3 20/70 Atrophy NA NA NA NA NA NA NA NA 20/70 Atrophy −14 14 20/100 Atrophy PCS NA NA NA Constricted NA NA NA −12 20/100 Atrophy PCS Constricted NA 41 HM 1 ft Atrophy NA Atrophy OA Atrophy, NA NA NA NA pigment ϩ CF1ft Atrophy Atrophy OA Atrophy, pigment ϩ 148-2245 3 NA 3 20/60 Atrophy NA Atrophy Pallor Posterior pole NA NA NA NA degeneration 20/70 Atrophy Atrophy Pallor Posterior pole degeneration −9 18 20/200 Atrophy NA Atrophy NA Atrophy NA 0 NR 0 −7.875 20/100 Atrophy Atrophy Atrophy 0 NR 0 NA 37 20/300 Atrophy NA Atrophy OA Atrophy NA NA NA NA 20/300 Atrophy Atrophy OA Atrophy 148-2238 7 NA 7 20/200 Atrophy NA Atrophy NA Pigmentary NA NA NA NA retinopathy 20/200 Atrophy Atrophy Pigmentary retinopathy 148-2239 13 NA 20s 20/200 NA NA NA NA NA NA NA NA NA 20/200 68 NLP OA Pigment ϩϩϩ NLP OA Pigment ϩϩϩ 1015-2554a 4 −3.75 5 20/70 G, BE None Atrophy PPA Mild RPE DP I4e 10°, IV4e 25° 13 40 (D) 3 −1.25 20/70 G, BE None Atrophy PPA Mild RPE DP I4e 10°, IV4e 45° 19 42 (D) 4 NA 7 20/70 G, BE None Atrophy PPA Mild RPE DP I4e 20°, IV4e 45° NA NA NA 20/80 G, BE None Atrophy PPA Mild RPE DP I4e 25°, IV4e 45° 1015-2553, 26 −5.25 28 20/40 NA None Atrophy, PPA Atrophy, I4e 35°, IV4e 50° 16 33 (D) 9 Carriera staphyloma pigment ϩ 2.625 20/25 None Unaffected Normal Mild granularity I4e 50°, IV4e 60° 70 29 59 41 20/40 PMA FRS Atrophy, NA Atrophy, I4e 35°, IV4e 45° staphyloma pigment ϩ 20/20 Unaffected None Unaffected Mild granularity I4e 50°, IV4e 60° 528-115 NA NA 69 LP NA NA NA OA Pigment ϩϩϩ NA NA NA NA HM OA Pigment ϩϩϩ 951-2448a 7 −0.25 11 20/25 BE None Unaffected TA Atrophy, I4e 30° NA NA NA pigment ϩϩ −0.75 20/20 BE None Unaffected TA Atrophy, I4e 30° pigment ϩϩ NA 30 20/80 BE None Atrophy TA Atrophy, IV4e Ͻ10° 2 60 (D) 0 pigment ϩϩ 20/60 BE None Atrophy TA Atrophy, IV4e Ͻ10° 2 60 (D) 0 pigment ϩϩ 933-2420 12 −5.625 12 20/50 BE CS Mild TA RPE/choroid DP, I4e 25°, IV4e 60° 8 45 (D) 0 staphyloma CHM-like −5.250 20/80 BE CS Mild TA RPE/choroid DP, I4e 25°, IV4e 60° 14 45 (D) 0 staphyloma CHM-like NA 13 20/70 BE CS Mild TA RPE/choroid DP, I4e 25°, IV4e 60° NA NA NA staphyloma CHM-like 20/200 BE CS Mild TA RPE/choroid DP, I4e 25°, IV4e 60° staphyloma CHM-like 944-2437 12 −7.125 12 20/60 PMA None Atrophy TA Atrophy, Contracted I4e, 2 49 (D) NA pigment ϩ IV4e −7.125 20/60 PMA None Atrophy TA Atrophy, Near full I4e, 2 50 (D) NA pigment ϩ IV4e NA 16 20/400 Atrophy FRS Atrophy TA Atrophy, I4e not seen, 0 pigment ϩ IV4e 20° with equatorial islands 20/200 Atrophy FRS Atrophy TA Atrophy, I4e not seen, 0 pigment ϩ IV4e 20° with equatorial islands

(continued)

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 919

©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 Table 2. Phenotypic Differences in 25 Patients With XLRP and Proven Mutations (continued)

Macular Features Peripheral Features ERG Age at Onset, Refrac- Age at Visual Fundus Pericentral Optic Fundus Visual Field Photopic, Implicit Scotopic, Patient ID y tion Exam, y Acuity Appearance Scotoma Features Nerve Appearance Constriction % Time, s % 948-2443, 2 NA 6 20/50 Unaffected None Mild Normal Granularity Near full I4e, NA NA NA Carrierb 20/60 Unaffected None staphyloma Normal Granularity IV4e Mild Near full I4e, staphyloma IV4e −6.125 17 20/30 Granularity RS Mild atrophy TA Mild atrophy I4e 30°, IV4e 50° 26 34 (D) 10 −6.25 20/400 Atrophy CS Atrophy TA Atrophy, I4e inferior 41 33 (D) 23 pigment ϩ island, IV4e 40° NA 22 20/40 Atrophy CS Mild atrophy TA Mild atrophy I4e 50°, IV4e 70° 30 37 (D) 18 20/200 Atrophy CS Atrophy TA Atrophy, I4e superior 27 40 (D) 13 pigment ϩ loss, IV4e 60° 948-2743 7 NA 31 HM NA NA NA OA Pigment ϩϩϩ NA NA NA NA HM OA Pigment ϩϩϩ 652-1694 2 −7.625 10 20/60 BE CS RPE DP Normal RPE DP I4e near full OU 18 50 (D) 0 −8.25 20/50 BE CS RPE DP Normal RPE DP IV4e near full OU 18 50 (D) 0 NA 13 20/80 Atrophy CS Atrophy NA Atrophy I4e not seen, NA NA NA 20/160 Atrophy CS Atrophy Atrophy IV4e 65° I4e not seen, IV4e 65° 1029-2585, 20s −6.00 45 4/200 Atrophy CS Atrophy PPA, Mild atrophy I4e contracted to 22 45 (D) 7 Carrier −7.50 20/400 Atrophy CS Atrophy TA Mild atrophy peripheral 30 43 (D) 15 PPA, islands OU TA IV4e 55° OU 971-2490 5 −8.750 8 20/40 G None RPE DP PPA, RPE/choroid DP, I4e 20°, IV4e 55° 10 42 (D) 4 −8.875 20/40 G None RPE DP TA CHM-like I4e 20°, IV4e 55° 7 40 (D) 0 PPA, RPE/choroid DP, TA CHM-like NA 11 20/50 G None RPE DP PPA, RPE/choroid DP, I4e 20°, IV4e 55° NA NA NA 20/60 G None RPE DP TA CHM-like I4e 20°, IV4e 55° PPA, RPE/choroid DP, TA CHM-like 548-1358 3 −7.5 9 20/70 Mild PMA CS Mild DP TA Mild DP I4e 10°, IV4e 60° 6 44 (D) 0 −7.625 20/100 Atrophy CS Mild DP TA Mild DP I4e superior 5 39 (D) 0 loss, IV4e 60° 1167-2760a 25 −8.375 28 20/70 G None Atrophy TA Unaffected Near full 27 35 (D) 131 −8.375 20/80 G None Atrophy TA Unaffected Near full 27 35 (D) 131 NA 36 20/200 Atrophy CS Atrophy TA Mild RPE DP I4e superior loss 30 36 (D) 37 20/200 Atrophy CS Atrophy TA Mild RPE DP OU 16 35 (D) 37 IV4e near full OU Literature Cohort Case 1 (IV-2, 18 −5.25 34 0.8 NA RS NA NA Preserved I4e constricted, Reduced (D) 0 00322)22, c −4.75 0.8 RPE/ IV4e Reduced (D) 0 choriocapillaris insignificant with mild constriction pigment Case 2 (IV-2, 6 −4.50 18 6/36 Atypical CS NA NA Patchy DP at NA NA NA NA 200307)22, c −2.75 6/36 central CS posterior pole reflexes 30 2/36 CCRD CS NA NA Central NA NA NA NA 2/36 CAS CS chorioretinal degeneration Case 3 7 −2.75 25 30/50 Unaffected NA Atrophy NA Pigmentϩ V4, 20°-30° 0 0 (EIII6)23, c −3.00 30/50 V4, 20°-30° 0 0 Case 424 570.4CRA NA CRA NA CRA, no pigment NA NA NA NA 0.3 17 0.2 CAS, CRA NA CRA, no NA CRA, no pigment Constricted with 0 NA 0 0.2 pigment temporal 0 0 island −2.75 24 0.08 CAS, CRA NA CRA, no Pallor, CRA, no pigment Constricted to NA NA NA −3.00 0.08 pigment TA 10° Case 5 5NA39HM NA NA NA Pallor Pigment, bone NA 0 NA 0 (II-1)25, c HM spiculelike 0 0 clumping Case 6 6 −6.5 29 20/100 Atrophy CS Atrophy OA NA Superior loss NA NA 0 (III-4)26, c −8.5 20/300 CS Superior loss 0 Case 7 Ch −12 45 5/300 Atrophy CS RPE/choroidal OA Cryotherapy Superior loss 0 D 0 (III-2)17, c −13 5/300 Atrophy CS atrophy OA scars Superior loss 0 D 0 RPE/choroidal Cryotherapy atrophy scars

Abbreviations: BE, bull’s eye; CAS, central areolar sclerosis; CCRD, choriocapillaris/retinal pigment epithelium (RPE) depigmentation; CF, count fingers; Ch, childhood; CHM, choroideremia; CRA, chorioretinal atrophy; CS, central scotoma; D, delayed photopic implicit time (Ն33 s); DP, depigmentation; ERG, electroretinography; exam, examination; FRS, full ring scotoma; G, granular macula; HM, hand motions; ID, identification number; LP, light perception only; NA, not available; NLP, no light perception; NR, nonrecordable; OA, optic nerve atrophy; PCS, pericentral scotoma; ϩ, mild pigment deposits; ϩϩ, moderate pigment deposits; ϩϩϩ heavy pigment deposits; PMA, perimacular atrophy; PPA, peripapillary atrophy; RS, ring scotoma; TA, temporal atrophy; XLRP, X-linked retinitis pigmentosa. aPatients with novel mutations being characterized for the first time. bTreated with systemic immunosuppression for secondary autoimmune retinopathy. cOriginal case report references are included in parentheses to facilitate comparisons.

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 920

©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 Correlation of Severity to Genotype A B When the severity grading criteria described previously herein was applied to all 25 patients examined, only 3 (12%) (including cases from the literature) exhibited a less severe phenotype characterized by a relatively older age at onset of macular dysfunction (patient 1090-2262, patient 951-2448, and published case 122), whereas most (88%) were considered to have a severe phenotype. Table 1 lists the disease severity and the predicted effect of the mu- 652-1 1015-1 tation on RP2 function. All the patients with premature truncations (9 of 9 patients with frameshift or nonsense C D mutations) fell into the severely affected group. Interest- ingly, 5 of 7 patients (71%) with missense mutations predicted to be hypomorphic (reduced protein function) also exhibited a relatively severe phenotype.

COMMENT

148-2 933-1 This study represents the largest comprehensive clinical analysis of patients with causative RP2 mutations (the Figure 3. Macular atrophy in 4 different patients with RP2 (A-D). cohort from our institution alone). Previous studies have been either case reports with phenotype descrip- macula is spared until late in the natural history of dis- tions22-26,34 or comparative analyses of many XLRP gene ease progression. The present results indicate that early subtypes.12,21 We gathered supplemental information from macular involvement is a distinguishing clinical feature previously published cases yielding meta-analysis–type of disease due to RP2 mutations. data on the RP2 clinical phenotype. The present article The severe degree of cone photoreceptor dysfunc- describes a recognizable phenotype consisting of early tion in RP2 mutations is further supported by the elec- onset of macular atrophy and poor visual acuity com- troretinography data demonstrating large delays in the bined with high myopia. This phenotype runs contrary photopic b-wave implicit times in all 12 patients in the to the typical forms of RP, in which the macula is often combined male and female cohorts for whom data were spared until late in the disease course. We propose that available. These data corroborate the implicit times found screening of RP2 should be prioritized in male patients by Sharon et al12 in patients with RP2 mutations. How- with an X-linked pedigree, high myopia, poor visual acu- ever, only 1 patient had a clear cone-rod dysfunction pat- ities, and early-onset macular atrophy. tern on electroretinographic testing, suggesting that rod In addition, screening for RP2 mutations is appropri- photoreceptor degeneration is still a prominent feature ate in the rare male patients who fail CHM mutation in this disease. screening. Consistent with the fundus findings in pa- Predilection for superior visual field loss (inferior reti- tient 933-2420 with an Arg118Cys mutation, Vorster et nal disease) attributed to retinal phototoxicity has been de- al25 noted a similar phenotype in a male patient with an scribed in autosomal dominant RP associated with RHO mu- Arg120Stop mutation. Patient 971-2490 also has a simi- tations.35 We encountered a similar superior field loss in 4 lar choroideremia-like phenotype, and the mutation patients, 2 evaluated at our institution and 2 in the cohort (Ser172fs) shares the same exon (2) and functional Arl3- of published cases, but the role of sunlight in the disease binding domain. These data suggest that mutations in this mechanism for RP2 mutations is currently unknown. domain (Arg118Cys, Arg120Stop, and Ser172fs) can lead The association of high myopia with RP2 mutations to a choroideremia-like phenotype. has been demonstrated in another study,17 and we con- Female patients from XLRP pedigrees who have high firmed this finding in our group of patients. The female myopia, asymmetrical retinal involvement, macular at- carrier (1015-2553) manifesting asymmetrical disease had rophy, or reduced central visual acuity may also have RP2 anisometropia of approximately 8.00 D, with the se- mutations. Mutational screening of RP2 is warranted in verely affected eye having myopia (Figure 4D), further these cases, which are exemplified by female carrier pa- supporting the concomitance of myopia and RP2. tients 1015-2553, 1029-2585, and 948-2443. Correlating the wide spectrum of clinical pheno- Although previously published studies12,21 have shown types in patients with RP2 to their genotypes has been macular atrophy atypical of classic RP34 with poor visual an intriguing puzzle. In general, missense or in-frame de- acuity in patients with RP2 mutations, a clear clinical phe- letion mutations are considered hypomorphic because notype for RP2 mutations has not been described. Most they may result in a mutant protein with reduced func- patients (10 of 11, 91%) in the cohort of male patients from tion, whereas truncation mutations in RP2 (frameshift our institution demonstrated macular atrophy starting at or splice site defects) cause severe phenotypes likely due an early age (before age 12 years). This atrophy pro- to loss of protein function. However, examination re- gressed into central scotomata in 50% of the patients and vealed that missense RP2 mutations are also associated runs counter to the typical RP presentation, in which the with a severe phenotype. Because most of the trunca-

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 921

A 944-1: 16 y, M, perimacular atrophy and pigment Control Right eye Left eye 120 105 90 75 60 120 105 90 75 60 13570 70 45 60 60 150 50 50 50 200 µV 40 40 Rod response 30 30 165 20 20 15 50 ms 10 10 Mixed 180 80 70 6050403020 20 30 40 50 60 60 50 40 30 20 20 30 40 50 60 70 80 0 10 10 response 195 20 20 345 30 30 40 40 210 50 50 330 I4e 100 µV 60 60 Photopic 225 315 70 70 III4e 50 ms 240 255 270 285 300 240 255 270 285 300 IV4e Left Right 32-Hz Flicker B 971-1: 8 y, M, CHM-like fundus appearance 120 105 90 75 60 120 105 90 75 60 200 µV 13570 70 45 Response 60 60 150 50 50 50 50 ms 40 40 30 30 165 20 20 15 Mixed 10 10 response 180 80 70 6050403020 20 30 40 50 60 60 50 40 30 20 20 30 40 50 60 70 80 0 10 10 100 µV 195 20 20 345 30 30 Photopic 40 40 210 330 50 ms 50 50 I4e 60 60 225 315 70 70 III4e 240 255 270 285 300 240 255 270 285 300 32-Hz Flicker IV4e Left Right 200 µV C 1167-1: 36 y, M, fields show light toxicity pattern Response 50 ms 120 105 90 75 60 120 105 90 75 60 13570 70 45 60 60 Mixed Blink 150 50 50 50 40 40 30 30 response 165 20 20 15 10 10 180 80 70 6050403020 20 30 40 50 60 60 50 40 30 20 20 30 40 50 60 70 80 0 100 µV 10 10 Photopic 195 20 20 345 30 30 50 ms 40 40 210 50 50 330 I4e 60 60 225 315 70 70 III4e 32-Hz Flicker 240 255 270 285 300 240 255 270 285 300 IV4e Left Right Response D 1015-2C: 41 y, F, asymmetry of lyonization

120 105 90 75 60 120 105 90 75 60 200 µV 13570 70 45 Mixed 60 60 150 50 50 50 response 50 ms 40 40 30 30 165 20 20 15 10 10 Blink 100 µV 180 80 70 6050403020 20 30 40 50 60 60 50 40 30 20 20 30 40 50 60 70 80 0 Photopic 10 10 50 ms 195 20 20 345 30 30 40 40 210 50 50 330 I4e 60 60 32-Hz Flicker 225 315 70 70 III4e 240 255 270 285 300 240 255 270 285 300 IV4e Left Right

Figure 4. Clinical phenotype variations in X-linked retinitis pigmentosa secondary to patients with RP2. CHM indicates choroideremia.

tion mutations are found in the amino-terminal domain mutations can result in a severe phenotype if they occur of RP2, the carboxyl-terminal region may be involved in early in the gene, resulting in premature truncation. providing stability to the protein or is important for main- Taken together, these data provide a platform for clini- taining a functional conformation of RP2. cal identification of patients with XLRP and RP2 muta- The Arg118His and Arg118Cys mutations are asso- tions that can assist in better disease management and ciated with a severe phenotype, although previous in vitro genetic counseling. We propose that RP2 be the first gene biochemical studies predict that mutations at Arg118 re- screened in male patients with an X-linked pedigree, high sult in residual, but not abolished, activity of RP2 and myopia, poor visual acuities, and macular atrophy in child- its affinity to Arl3. On the other hand, RP2 Cys3Ser or hood. Future therapeutic modalities for RP2-XLRP should Ser6del mutations have previously been shown to affect carefully consider the quality and character of the mu- the localization of RP2 to plasma membrane in cultured tant protein expressed in the diseased photoreceptors. cells.16,19 In fact, RP2 Ser6del mutant protein is present Resolving the crystal structure of RP2 has increased our at relatively low levels likely due to decreased stability. understanding of the role of different amino acid resi- These results demonstrate that the localization of RP2 dues in the protein’s function and the probable effect of to plasma membrane may not be critical for its function. disease-associated mutations on its 3-dimensional struc- Clinically, we successfully correlated the genotypes from ture and putative function. This genotype-phenotype a patient with a Cys3Ser mutation (1090-2262) and a pa- analysis shows that a mutant RP2 protein with reduced tient from the published literature with a Ser6del muta- activity can result in the same severe phenotype caused tion (case 122) with a less severe phenotype. It is also pos- by mutations that result in protein degradation. Be- sible that alternative localization of RP2 in the cells may cause the biochemical activity of RP2 has not been dem- be affected by some of the mutations. Because Arl3 lo- onstrated in vivo, further investigations are necessary to calizes to photoreceptor sensory cilium and the mouse carefully analyze the correlation between RP2 muta- mutant of Arl3 develops a ciliary phenotype,32 RP2 may tions and their associated phenotypes, which will aid in be involved in the targeting of Arl3 or in modulating its the design of appropriate clinical treatments. activity at the cilium. Further studies are necessary to re- solve these issues. Submitted for Publication: August 5, 2009; final revi- Splice mutations represent another level of complex- sion received October 6, 2009; accepted November 2, ity associated with the prediction of the phenotype. Such 2009.

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 922

©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 Correspondence: John R. Heckenlively, MD, Kellogg Eye short sequence stretch of exon ORF15. Invest Ophthalmol Vis Sci. 2003;44 Center, University of Michigan, 1000 Wall St, Ann Ar- (4):1458-1463. 16. Chapple JP, Hardcastle AJ, Grayson C, Spackman LA, Willison KR, Cheetham ME. bor, MI 48105 ([email protected]). Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 in- Author Contributions: Dr Jayasundera and Ms Bran- terfere with the normal targeting of the protein to the plasma membrane. Hum Mol ham contributed equally to this investigation. Genet. 2000;9(13):1919-1926. Financial Disclosure: None reported. 17. Kühnel K, Veltel S, Schlichting I, Wittinghofer A. Crystal structure of the human Funding/Support: This research was supported by grants retinitis pigmentosa 2 protein and its interaction with Arl3. Structure. 2006; 14(2):367-378. from the Foundation Fighting Blindness and the Na- 18. Nie Z, Hirsch DS, Randazzo PA. Arf and its many interactors. Curr Opin Cell Biol. tional Eye Institute Intramural Research Program (Dr 2003;15(4):396-404. Swaroop) and by grant R01 EY007961 from the National 19. Chapple JP, Hardcastle AJ, Grayson C, Willison KR, Cheetham ME. Delineation Eye Institute. of the plasma membrane targeting domain of the X-linked retinitis pigmentosa Additional Contributions: Richard Hackel, MA, assisted protein RP2. Invest Ophthalmol Vis Sci. 2002;43(6):2015-2020. with fundus photography and illustrations; Paul Sieving, 20. Veltel S, Gasper R, Eisenacher E, Wittinghofer A. The retinitis pigmentosa 2 gene product is a GTPase-activating protein for Arf-like 3. Nat Struct Mol Biol. 2008; MD, PhD, evaluated several patients; Naheed Khan, PhD, 15(4):373-380. assisted with electroretinographic illustrations; and Jill 21. Sharon D, Sandberg MA, Rabe VW, Stillberger M, Dryja TP, Berson EL. RP2 and Oversier, BS, assisted with patient coordination. RPGR mutations and clinical correlations in patients with X-linked retinitis pigmentosa. Am J Hum Genet. 2003;73(5):1131-1146. 22. Rosenberg T, Schwahn U, Feil S, Berger W. Genotype-phenotype correlation in X- REFERENCES linked retinitis pigmentosa 2 (RP2). Ophthalmic Genet. 1999;20(3):161-172. 23. Jin ZB, Liu XQ, Hayakawa M, Murakami A, Nao-i N. Mutational analysis of RPGR 1. Boughman JA, Conneally PM, Nance WE. Population genetic studies of retinitis and RP2 genes in Japanese patients with retinitis pigmentosa: identification of pigmentosa. Am J Hum Genet. 1980;32(2):223-235. four mutations. Mol Vis. 2006;12:1167-1174. 2. Fishman GA. Retinitis pigmentosa: genetic percentages. Arch Ophthalmol. 1978; 24. Mashima Y, Saga M, Hiida Y, Imamura Y, Kudoh J, Shimizu N. Novel mutation 96(5):822-826. in RP2 gene in two brothers with X-linked retinitis pigmentosa and mtDNA mu- 3. Bird AC. X-linked retinitis pigmentosa. Br J Ophthalmol. 1975;59(4):177-199. tation of Leber hereditary optic neuropathy who showed marked differences in 4. Musarella MA, Burghes A, Anson-Cartwright L, et al. Localization of the gene for clinical severity. Am J Ophthalmol. 2000;130(3):357-359. X-linked recessive type of retinitis pigmentosa (XLRP) to Xp21 by linkage analysis. 25. Vorster AA, Rebello MT, Coutts N, et al. Arg120stop nonsense mutation in the Am J Hum Genet. 1988;43(4):484-494. RP2 gene: mutational hotspot and germ line mosaicism? Clin Genet. 2004; 5. Bhattacharya SS, Wright AF, Clayton JF, et al. Close genetic linkage between X- 65(1):7-10. linked retinitis pigmentosa and a restriction fragment length polymorphism iden- 26. Wada Y, Nakazawa M, Abe T, Tamai M. A new Leu253Arg mutation in the RP2 tified by recombinant DNA probe L1.28. Nature. 1984;309(5965):253-255. gene in a Japanese family with X-linked retinitis pigmentosa. Invest Ophthalmol 6. Schwahn U, Lenzner S, Dong J, et al. Positional cloning of the gene for X-linked Vis Sci. 2000;41(1):290-293. retinitis pigmentosa 2. Nat Genet. 1998;19(4):327-332. 27. De Luca A, Torrente I, Mangino M, Danesi R, Dallapiccola B, Novelli G. Three 7. Musarella MA, Anson-Cartwright L, Leal SM, et al. Multipoint linkage analysis novel mutations causing a truncated protein within the RP2 gene in Italian fami- and heterogeneity testing in 20 X-linked retinitis pigmentosa families. Genomics. lies with X-linked retinitis pigmentosa. Mutat Res. 2001;432(3-4):79-82. 1990;8(2):286-296. 28. Neidhardt J, Glaus E, Lorenz B, et al. Identification of novel mutations in X- 8. Ott J, Bhattacharya S, Chen JD, et al. Localizing multiple X chromosome-linked linked retinitis pigmentosa families and implications for diagnostic testing. Mol retinitis pigmentosa loci using multilocus homogeneity tests. Proc Natl Acad Sci Vis. 2008;14:1081-1093. USA. 1990;87(2):701-704. 29. Garcı´a-Hoyos M, Garcia-Sandoval B, Cantalapiedra D, et al. Mutational screen- 9. Pelletier V, Jambou M, Delphin N, et al. Comprehensive survey of mutations in ing of the RP2 and RPGR genes in Spanish families with X-linked retinitis RP2 and RPGR in patients affected with distinct retinal dystrophies: genotype- phenotype correlations and impact on genetic counseling. Hum Mutat. 2007; pigmentosa. Invest Ophthalmol Vis Sci. 2006;47(9):3777-3782. 28(1):81-91. 30. Miano MG, Testa F, Filippini F, et al. Identification of novel RP2 mutations in a 10. Teague PW, Aldred MA, Jay M, et al. Heterogeneity analysis in 40 X-linked reti- subset of X-linked retinitis pigmentosa families and prediction of new domains. nitis pigmentosa families. Am J Hum Genet. 1994;55(1):105-111. Hum Mutat. 2001;18(2):109-119. 11. Mears AJ, Gieser L, Yan D, et al. Protein-truncation mutations in the RP2 gene 31. Prokisch H, Hartig M, Hellinger R, Meitinger T, Rosenberg T. A population- in a North American cohort of families with X-linked retinitis pigmentosa. Am J based epidemiological and genetic study of X-linked retinitis pigmentosa. Invest Hum Genet. 1999;64(3):897-900. Ophthalmol Vis Sci. 2007;48(9):4012-4018. 12. Sharon D, Bruns GA, McGee TL, Sandberg MA, Berson EL, Dryja TP. X-linked 32. Schrick JJ, Vogel P, Abuin A, Hampton B, Rice DS. ADP-ribosylation factor–like retinitis pigmentosa: mutation spectrum of the RPGR and RP2 genes and cor- 3 is involved in kidney and photoreceptor development. Am J Pathol. 2006; relation with visual function. Invest Ophthalmol Vis Sci. 2000;41(9):2712-2721. 168(4):1288-1298. 13. Hardcastle AJ, Thiselton DL, Van Maldergem L, et al. Mutations in the RP2 gene 33. Thiselton DL, Zito I, Plant C, et al. Novel frameshift mutations in the RP2 gene cause disease in 10% of families with familial X-linked retinitis pigmentosa as- and polymorphic variants. Hum Mutat. 2000;15(6):580. sessed in this study. Am J Hum Genet. 1999;64(4):1210-1215. 34. Dandekar SS, Ebenezer ND, Grayson C, et al. An atypical phenotype of macular 14. Breuer DK, Yashar BM, Filippova E, et al. A comprehensive mutation analysis of and peripapillary retinal atrophy caused by a mutation in the RP2 gene. Br J RP2 and RPGR in a North American cohort of families with X-linked retinitis Ophthalmol. 2004;88(4):528-532. pigmentosa. Am J Hum Genet. 2002;70(6):1545-1554. 35. Heckenlively JR, Rodriguez JA, Daiger SP. Autosomal dominant sectoral retini- 15. Bader I, Brandau O, Achatz H, et al. X-linked retinitis pigmentosa: RPGR muta- tis pigmentosa: two families with transversion mutation in codon 23 of rhodopsin. tions in most families with definite X linkage and clustering of mutations in a Arch Ophthalmol. 1991;109(1):84-91.

(REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 923