DOCSLIB.ORG

RP2 Phenotype and Pathogenetic Correlations in X-Linked Retinitis Pigmentosa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RP2 Phenotype and Pathogenetic Correlations in X-Linked Retinitis Pigmentosa OPHTHALMIC MOLECULAR GENETICS SECTION EDITOR: JANEY L. WIGGS, MD, PhD RP2 Phenotype and Pathogenetic Correlations in X-Linked Retinitis Pigmentosa Thiran Jayasundera, MD; Kari E. H. Branham, MS; Mohammad Othman, PhD; William R. Rhoades, BS; Athanasios J. Karoukis, BS; Hemant Khanna, PhD; Anand Swaroop, PhD; John R. Heckenlively, MD Objectives: To assess the phenotype of patients with function. All 3 female carriers had macular atrophy in 1 X-linked retinitis pigmentosa (XLRP) with RP2 muta- or both eyes and were myopic (mean, −6.23 D). All 9 non- tions and to correlate the findings with their genotype. sense and frameshift and 5 of 7 missense mutations (71%) resulted in severe clinical presentations. Methods: Six hundred eleven patients with RP were screened for RP2 mutations. From this screen, 18 pa- Conclusions: Screening of the RP2 gene should be pri- tients with RP2 mutations were evaluated clinically with oritized in patients younger than 16 years characterized standardized electroretinography, Goldmann visual fields, by X-linked inheritance, decreased best-corrected vi- and ocular examinations. In addition, 7 well-docu- sual acuity (eg, Ͼ20/40), high myopia, and early-onset mented cases from the literature were used to augment macular atrophy. Patients exhibiting a choroideremia- genotype-phenotype correlations. like fundus without choroideremia gene mutations should also be screened for RP2 mutations. Results: Of 11 boys younger than 12 years, 10 (91%) had macular involvement and 9 (82%) had best- Clinical Relevance: An identifiable phenotype for corrected visual acuity worse than 20/50. Two boys from RP2-XLRP aids in clinical diagnosis and targeted genetic different families (aged 8 and 12 years) displayed a cho- roideremia-like fundus, and 9 boys (82%) were myopic screening. (mean error, −7.97 diopters [D]). Of 10 patients with elec- troretinography data, 9 demonstrated severe rod-cone dys- Arch Ophthalmol. 2010;128(7):915-923 ETINITIS PIGMENTOSA (RP) IS tor and is involved in cellular transport regu- a clinically and genetically lation mechanisms.18 Although the 30 heterogeneous group of amino-terminal residues of RP2 are criti- retinal disorders that causes cal for binding to Arl3, human disease- progressive loss of visual causing mutations Arg118His and Rfunction due to rod and cone photorecep- Glu138Gly also reduce the affinity of RP2 tor degeneration. The X-linked forms of to Arl3, indicating a clinically relevant as- RP (XLRP) account for 10% to 20% of all sociation elsewhere in the protein. Post- RP cases.1-3 Two genes have been cloned translational acyl modifications at the N- for XLRP: retinitis pigmentosa GTPase terminus of RP2 act to target the protein to regulator, RPGR (OMIM 312610),4 and the plasma membrane, and disruption of 5,6 Author Affiliations: RP2 (OMIM 312600), which together ac- this acylation site ultimately leads to the RP 7-10 19,20 Department of Ophthalmology count for more than 80% of XLRP. phenotype. Most pathogenic sequence and Visual Sciences, Kellogg Mutations in RP2 are reported to cause alterations found in RP2 represent truncat- Eye Center (Drs Jayasundera, 7% to 10% of XLRP.6,11-15 The RP2 gene is ing mutations.11 However, missense mu- Othman, Khanna, Swaroop, and composed of 5 exons and encodes a widely tations have been located in the cofactor Heckenlively; Ms Branham; and expressed protein of 350 amino acids.6,16 The C–like domain of RP2.17 Messrs Rhoades and Karoukis), RP2 protein consists of an amino-terminal Given the considerable phenotypic and and Department of Human domain with homology to cofactor C and genetic heterogeneity associated with Genetics (Dr Swaroop), a carboxyl-terminal domain with homol- XLRP14 and the scarcity of patients with RP2 University of Michigan, 17 Ann Arbor; and Neurobiology, ogy to nucleoside diphosphate kinase. The diagnoses, there has been insufficient in- Neurodegeneration, and Repair amino-terminal domain of RP2 binds to a formation to date to predict the clinical Laboratory, National Institutes small guanosine triphosphate–binding pro- phenotype of a patient based on the RP2 mu- of Health, Bethesda, Maryland tein, Arl3, which shows homology with tation. Although there have been stud- (Dr Swaroop). adenosine diphosphate–ribosylation fac- ies9,12,14,21 containing correlations of RP2 phe- (REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO. 7), JULY 2010 WWW.ARCHOPHTHALMOL.COM 915 ©2010 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 Table 1. Mutations for Families Included in This Study Family Type of Protein Severity of Associated Predicted Effect of Mutation No. Location Mutation Nucleotide Change Changea Phenotype on Protein16,17,19,20 Mutations From the University of Michigan Cohort 1090 Exon 1 Missense c.8GϾC p.Cys3Serb Less severe Mislocalization of protein 148 Exon 1 Insertion/frameshift c.77insCA p.Gln26fs11 Severe Loss of function 1015 Intron 1 Splice IVS1ϩ1GϾA Spliceb Severe Loss of function 528 Intron 1 Splice IVS1ϩ3AϾG Splice14 Severe Loss of function 951 Exon 2 Missense c.260CϾT p.Thr87Ileb Less severe Protein alteration 933 Exon 2 Missense c.352CϾT p.Arg118Cys21 Severe Protein alteration 944 Exon 2 Missense c.353GϾA p.Arg118His6 Severe Protein alteration 948 Exon 2 Missense c.353GϾA p.Arg118His6 Severe Protein alteration 652 Exon 2 Deletion c.409-411delATT p.Ile137del12 Severe Protein instability 1029 Exon 2 Nonsense c.450GϾA p.Trp150Stop27 Severe (carrier) Loss of function 971 Exon 2 Insertion/frameshift c.515_516insG p.Ser172fsTer17314 Severe Loss of function 548 Exon 2 Insertion/frameshift c.673-674insC p.R225fsTer23414 Severe Loss of function 1167 Exon 2 Missense c.758TϾC p.Leu253Prob Severe Protein instability Mutations From Published Cases in the Literature Case 122 Exon 1 Deletion c.12_18 del p.Ser6del6 Less severe Mislocalization of protein Case 222 Exon 1 Nonsense c.76CϾT p.Gln26Stop6 Severe Loss of function Case 323 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 424 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 525 Exon 2 Nonsense c.358CϾT p.Arg120Stop13 Severe Loss of function Case 626 Exon 2 Missense c.758TϾG p.Leu253Arg26 Severe Protein instability Case 717 Exon 2 Deletion/frameshift c.798delGACA p.Gln266fs21 Severe Loss of function a References cited in this column denote the first mention of the change in the literature. b Novel change. notypes with visual function data, no large study exists, to individual identification number (ie, family number-indi- our knowledge, in which clear clinical distinctions have been vidual number). identified to help make it a recognizable entity to ophthal- A comprehensive literature search was performed to iden- mologists. A recognizable phenotype would help narrow tify publications containing unambiguous and adequate de- the differential diagnosis for candidate gene mutational scriptions of clinical features (age at symptom onset, visual func- tion, electroretinography data, and retinal appearance) of screening for RP2. We undertook the present study to care- individual patients with RP2 mutations. Data on the 7 identi- fully analyze the phenotype in a cohort of patients with RP2 fied cases were collected from the literature for inclusion and and carriers found at our institution and in previously pub- comparison to supplement the cohort from our institution to lished articles (Table 1). We correlated the severity of dis- delineate the phenotype of RP2 and make genotype to pheno- ease with the predicted effect of the mutation on the pu- type correlations (Table 1). tative function of RP2. DNA EXTRACTION METHODS DNA was extracted from the whole blood of patients. Primers for amplifying RP2 exons 2-5 were used as previously PATIENTS reported.6 The sequences for the RP2 exon 1 forward and reverse primers were 5Ј CTTTGATTGGCTCAACAGGC and Mutational analysis was performed on 611 DNA samples as part 5Ј GTTCAAGAGAGTGCGGCAG, respectively. These prim- of a larger screening study from the XLRP Repository of the ers amplified 447–base pair polymerase chain reaction (PCR) University of Michigan’s Center for Retinal and Macular De- fragments. generation (outside samples not reported). Samples from pa- tients affected with a probable or possible diagnosis of XLRP PCR CONDITIONS AND SEQUENCING or X-linked cone-rod dystrophy (as described by Breuer et al14) were screened for variations and mutations in the RP2 gene. DNA was used at approximately 100 ng per PCR. All the ex- Mutational analysis was performed as described by Mears et ons except exon 2 were amplified with Ex Taq Polymerase al11 (n=51), by Breuer et al14 (n=234), or herein (n=326). (TaKaRa Bio Inc, Shiga, Japan). Exon 2 was amplified with Ac- Included in this genotype-phenotype correlation study are cuPrime high-fidelity polymerase (Invitrogen, Carlsbad, Cali- the 18 patients with previously identified RP2 mutations who fornia). The annealing temperature for exons 1 and 2 was 59°C; were clinically evaluated in the Retinal Dystrophy Clinic at the for exons 3, 4, and 5, it was 64°C. All PCR volumes were made University of Michigan’s Kellogg Eye Center or at the Univer- to 25 µL, and PCR products were run on 2% agarose gels to sity of California, Los Angeles’ Jules Stein Eye Institute. All the verify the sizes and quality of amplification. Before submitting patients gave informed consent, and the research was ap- the samples for sequencing, the DNA concentration was mea- proved by the institutional review board at the University of sured using a spectrophotometer (NanoDrop 1000; Thermo Sci- Michigan. Patients with only a clinical diagnosis of XLRP with- entific, Wilmington, Delaware). The PCR amplicons were then out documented RP2 mutations were excluded. Patients are iden- diluted (1-3 ng/µL in distilled water) as required by the se- tified throughout with a family identification number and an quencing core at the University of Michigan Medical School. (REPRINTED) ARCH OPHTHALMOL / VOL 128 (NO.
Load more

Recommended publications
  • Retinal Dystrophy Panel Plus
    ANALYSIS REPORT Patient: Test, Test 1; DoB: 1989-Apr-10; Order ID: 54324 SUMMARY DIAGNOSTIC FINDING Retinal Dystrophy Panel Plus PATIENT INFORMATION NAME DOB SSN AGE GENDER ORDER ID Test, test1 1989-Apr-10 10041989-xxxx 28 Male 54324 REFERRING HEALTHCARE PROFESSIONAL NAME HOSPITAL Anna Smith Test hospital SUMMARY OF CLINICAL HISTORY Patient is a 28-year-old male with VA 20/40 OD, 20/50 OS, constricted visual fields, non-detectable rod ffERG, and a family history consistent with X-linked retinitis pigmentosa. SEQUENCE ANALYSIS RESULTS GENE NOMENCLATURE INHERITANCE ZYGOSITY CLASSIFICATION RPGR c.2655_2656del, p.(Glu886Glyfs*192) X-linked HEM LIKELY PATHOGENIC DEL/DUP (CNV) ANALYSIS RESULTS Del/Dup (CNV) analysis did not detect any known disease-causing copy number variation or novel or rare deletion/duplication that was considered deleterious. CONCLUSION We classify the identifiedRPGR c.2655_2656del, p.(Glu886Glyfs*192) as likely pathogenic and the probable cause for the patient’s disease, considering the current evidence of the variant (established association between the gene and the patient’s phenotype, rarity in control populations, identification of the variant in an individual with the same phenotype, and mutation type: frameshift). However, additional information is still needed to confirm the pathogenicity of the variant, which could allow independent risk stratification based on this mutation. Genetic counseling and family member testing is recommended. Disease caused by RPGR mutations is inherited in an X-linked manner. We recommend carrier testing of the mother. If the mother is a carrier, then each offspring has a 50% chance of inheriting the mutation. Disease caused byRPGR mutations is inherited in an X-linked manner, and thus each daughter of an affected male will inherit the mutation, while sons will remain unaffected.
    [Show full text]
  • Building the Vertebrate Codex Using the Gene Breaking Protein Trap Library
    Genetics, Development and Cell Biology Publications Genetics, Development and Cell Biology 2020 Building the vertebrate codex using the gene breaking protein trap library Noriko Ichino Mayo Clinic Gaurav K. Varshney National Institutes of Health Ying Wang Iowa State University Hsin-kai Liao Iowa State University Maura McGrail Iowa State University, [email protected] See next page for additional authors Follow this and additional works at: https://lib.dr.iastate.edu/gdcb_las_pubs Part of the Molecular Genetics Commons, and the Research Methods in Life Sciences Commons The complete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ gdcb_las_pubs/261. For information on how to cite this item, please visit http://lib.dr.iastate.edu/howtocite.html. This Article is brought to you for free and open access by the Genetics, Development and Cell Biology at Iowa State University Digital Repository. It has been accepted for inclusion in Genetics, Development and Cell Biology Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Building the vertebrate codex using the gene breaking protein trap library Abstract One key bottleneck in understanding the human genome is the relative under-characterization of 90% of protein coding regions. We report a collection of 1200 transgenic zebrafish strains made with the gene- break transposon (GBT) protein trap to simultaneously report and reversibly knockdown the tagged genes. Protein trap-associated mRFP expression shows previously undocumented expression of 35% and 90% of cloned genes at 2 and 4 days post-fertilization, respectively. Further, investigated alleles regularly show 99% gene-specific mRNA knockdown.
    [Show full text]
  • RP2 Antibody / XRP2 (RQ4671)
    RP2 Antibody / XRP2 (RQ4671) Catalog No. Formulation Size RQ4671 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human, Mouse, Rat Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Antigen affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt O75695 Applications Western blot : 0.5-1ug/ml Immunohistochemistry (FFPE) : 1-2ug/ml Immunofluorescence : 2-4ug/ml Flow cytometry : 1-3ug/million cells Direct ELISA : 0.1-0.5ug/ml (human recombinant protein) Limitations This RP2 antibody is available for research use only. Western blot testing of 1) human placenta, 2) human SGC-7901, 3) rat lung and 4) mouse lung lysate with RP2 antibody at 0.5ug/ml. Predicted molecular weight ~40 kDa. IHC staining of FFPE human placenta with RP2 antibody at 1ug/ml. HIER: boil tissue sections in pH6, 10mM citrate buffer, for 10-20 min followed by cooling at RT for 20 min. IHC staining of FFPE human placenta with RP2 antibody at 1ug/ml. HIER: boil tissue sections in pH6, 10mM citrate buffer, for 10-20 min followed by cooling at RT for 20 min. IHC staining of FFPE human lung cancer with RP2 antibody at 1ug/ml. HIER: boil tissue sections in pH6, 10mM citrate buffer, for 10-20 min followed by cooling at RT for 20 min. IHC staining of FFPE human breast cancer with RP2 antibody at 1ug/ml. HIER: boil tissue sections in pH6, 10mM citrate buffer, for 10-20 min followed by cooling at RT for 20 min.
    [Show full text]
  • Pigmentosa in a Large Kindred
    J Med Genet: first published as 10.1136/jmg.28.7.453 on 1 July 1991. Downloaded from I Med Genet 1991; 28: 453-457 453 Genetic localisation of the RP2 type of X linked retinitis pigmentosa in a large kindred A F Wright, SS Bhattacharya, M A Aldred, M Jay, A D Carothers, N S T Thomas, A C Bird, B Jay, H J Evans Abstract and usually loss of central vision before the fourth Genetic linkage and deletion studies have led to the decade. At least 14 to 15% of families and 15 to 28% of proposal that there are at least two loci on the X retinitis pigmentosa patients in the UK have the X chromosome which are responsible for X linked linked disorder' 2 so that the population prevalence is retinitis pigmentosa (XLRP). One locus (RP3) has in the region of 1 in 10 000 to 30 000. been closely defined by genetic linkage and deletion XLRP was first mapped to the proximal short arm analyses and localised to the region between the of the X chromosome by genetic linkage to DXS7, ornithine transcarbamylase (OTC) and chronic localised to Xpl l.-pll .3.3 Subsequent linkage granulomatous disease (CYBB) loci in Xp2l.1- studies have supported locations both proximal49 and pII.4. The other locus (RP2) has been assigned by distal'o'3 to the DXS7 locus. The situation was linkage analysis alone to region Xpll.4-pll.2, but clarified by a heterogeneity analysis of 62 XLRP its localisation is less weli defined. The results of a kindreds from nine centres, in which it was shown multipoint linkage analysis of a single large XLRP that the overall likelihood was 6-4x 109:1 in favour of kindred using eight informative loci provide further two loci versus a single XLRP locus.
    [Show full text]
  • Analysis of RP2 and RPGR Mutations in Five X-Linked Chinese Families
    www.nature.com/scientificreports OPEN Analysis of RP2 and RPGR Mutations in Five X-Linked Chinese Families with Retinitis Pigmentosa Received: 07 December 2016 Jingjing Jiang1,*, Xiaofei Wu2,*, Di Shen3,*, Lijin Dong4, Xiaodong Jiao5, J. Fielding Hejtmancik5 Accepted: 08 February 2017 & Ningdong Li1,2,5 Published: 15 March 2017 Mutations in RP2 and RPGR genes are responsible for the X-linked retinitis pigmentosa (XLRP). In this study, we analyzed the RP2 and RPGR gene mutations in five Han Chinese families with XLRP. An approximately 17Kb large deletion including the exon 4 and exon 5 of RP2 gene was found in an XLRP family. In addition, four frameshift mutations including three novel mutations of c.1059 + 1 G > T, c.2002dupC and c.2236_2237del CT, as well as a previously reported mutation of c.2899delG were detected in the RPGR gene in the other four families. Our study further expands the mutation spectrum of RP2 and RPGR, and will be helpful for further study molecular pathogenesis of XLRP. Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of retinal dystrophies characterized by photoreceptor cell degeneration. The prevalence of RP is about 1/4000 ~1/5000 according to studies in dif- ferent populations1. The clinical features comprise night blindness, progressive constriction of visual field with age, and fundus changes including attenuation of the retinal arterioles, bone spicule-like pigment deposits in the mid-peripheral retinal and waxy pallor of the optic disc. Affected individuals often have severely abnormal or non-detectable rod responses in the electroretinograms (ERG) recordings even in the early stage of the disease2.
    [Show full text]
  • Human Pluripotent Stem-Cell-Derived Models As a Missing Link in Drug Discovery and Development
    pharmaceuticals Review Human Pluripotent Stem-Cell-Derived Models as a Missing Link in Drug Discovery and Development Xiying Lin , Jiayu Tang and Yan-Ru Lou * Department of Clinical Pharmacy and Drug Administration, School of Pharmacy, Fudan University, Shanghai 201203, China; [email protected] (X.L.); [email protected] (J.T.) * Correspondence: [email protected] Abstract: Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) and human-induced pluripotent stem cells (hiPSCs), have the potential to accelerate the drug discovery and development process. In this review, by analyzing each stage of the drug discovery and development process, we identified the active role of hPSC-derived in vitro models in phenotypic screening, target-based screening, target validation, toxicology evaluation, precision medicine, clinical trial in a dish, and post-clinical studies. Patient-derived or genome-edited PSCs can generate valid in vitro models for dissecting disease mechanisms, discovering novel drug targets, screening drug candidates, and preclinically and post-clinically evaluating drug safety and efficacy. With the advances in modern biotechnologies and developmental biology, hPSC-derived in vitro models will hopefully improve the cost-effectiveness and the success rate of drug discovery and development. Keywords: human pluripotent stem cells; human embryonic stem cells; human-induced pluripotent stem cells; drug discovery; drug development Citation: Lin, X.; Tang, J.; Lou, Y.-R. Human Pluripotent Stem-Cell-Derived Models as a Missing Link in Drug 1. Brief Introduction to Human Pluripotent Stem Cells (hPSCs) and Discovery and Development. Their Applications Pharmaceuticals 2021, 14, 525. Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) https://doi.org/10.3390/ and human induced pluripotent stem cells (hiPSCs), are cells with the ability to self-renew ph14060525 and to develop into all cell types in a human adult body [1].
    [Show full text]
  • An ARL3–UNC119–RP2 Gtpase Cycle Targets Myristoylated NPHP3 to the Primary Cilium
    An ARL3–UNC119–RP2 GTPase cycle targets myristoylated NPHP3 to the primary cilium Kevin J. Wright,1 Lisa M. Baye,2 Anique Olivier-Mason,4 Saikat Mukhopadhyay,1 Liyun Sang,1 Mandy Kwong,1 Weiru Wang,1 Pamela R. Pretorius,2,3 Val C. Sheffield,3 Piali Sengupta,4 Diane C. Slusarski,2 and Peter K. Jackson1,5 1Genentech Inc., South San Francisco, California 94080, USA; 2Department of Biology, 3Howard Hughes Medical Institute, Department of Pediatrics, University of Iowa, Iowa City, Iowa 52242, USA; 4Department of Biology, Brandeis University, Waltham, Massachusetts 02453, USA The membrane of the primary cilium is a highly specialized compartment that organizes proteins to achieve spatially ordered signaling. Disrupting ciliary organization leads to diseases called ciliopathies, with phenotypes ranging from retinal degeneration and cystic kidneys to neural tube defects. How proteins are selectively transported to and organized in the primary cilium remains unclear. Using a proteomic approach, we identified the ARL3 effector UNC119 as a binding partner of the myristoylated ciliopathy protein nephrocystin-3 (NPHP3). We mapped UNC119 binding to the N-terminal 200 residues of NPHP3 and found the interaction requires myristoylation. Creating directed mutants predicted from a structural model of the UNC119–myristate complex, we identified highly conserved phenylalanines within a hydrophobic b sandwich to be essential for myristate binding. Furthermore, we found that binding of ARL3-GTP serves to release myristoylated cargo from UNC119. Finally, we showed that ARL3, UNC119b (but not UNC119a), and the ARL3 GAP Retinitis Pigmentosa 2 (RP2) are required for NPHP3 ciliary targeting and that targeting requires UNC119b myristoyl-binding activity.
    [Show full text]
  • Evaluation of RP2 and RP3 Genes in an X-Linked RP Family Manifesting Loss of Central Vision and Preserved Peripheral Function
    J Hum Genet (2001) 46:241–243 © Jpn Soc Hum Genet and Springer-Verlag 2001 SHORT COMMUNICATION Miki Hiraoka · Michael T. Trese · Barkur S. Shastry Evaluation of RP2 and RP3 genes in an X-linked RP family manifesting loss of central vision and preserved peripheral function Received: December 1, 2000 / Accepted: January 17, 2001 Abstract X-Linked retinitis pigmentosa is a most severe males manifest an early onset of the disorder with severe and heterogeneous disorder of the retina. Recently, genes myopia. RP is characterized by a loss of the peripheral (RP2 and RPGR) from two X-linked loci have been posi- visual field, and night blindness (Bird 1975). The disease tionally cloned and mutations have been identified in many affects both eyes, and the loss of central vision does families. To further evaluate allelic and non-allelic hetero- not usually occur until age 50, although in some X-linked geneity and the genotype — phenotype relationships, and pedigrees, it may occur much earlier. When the disease to determine the prevalence of mutations in the gene, we progresses, loss of central vision occurs with degeneration have analyzed one previously unreported X-linked retinitis of the retina, which leads to complete loss of sight. Carrier pigmentosa family, using a combination of haplotype analy- females usually have normal vision and a normal fundus. sis and DNA sequencing. Our extensive analysis of the RP2 More than 25 loci have been mapped by linkage analysis, gene failed to detect any disease — causing or polymorphic and, among these, at least two loci for XLRP have been mutations.
    [Show full text]
  • Building the Vertebrate Codex Using the Gene Breaking Protein Trap Library
    TOOLS AND RESOURCES Building the vertebrate codex using the gene breaking protein trap library Noriko Ichino1, MaKayla R Serres1, Rhianna M Urban1, Mark D Urban1, Anthony J Treichel1, Kyle J Schaefbauer1, Lauren E Greif1, Gaurav K Varshney2,3, Kimberly J Skuster1, Melissa S McNulty1, Camden L Daby1, Ying Wang4, Hsin-kai Liao4, Suzan El-Rass5, Yonghe Ding1,6, Weibin Liu1,6, Jennifer L Anderson7, Mark D Wishman1, Ankit Sabharwal1, Lisa A Schimmenti1,8,9, Sridhar Sivasubbu10, Darius Balciunas11, Matthias Hammerschmidt12, Steven Arthur Farber7, Xiao-Yan Wen5, Xiaolei Xu1,6, Maura McGrail4, Jeffrey J Essner4, Shawn M Burgess2, Karl J Clark1*, Stephen C Ekker1* 1Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, United States; 2Translational and Functional Genomics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, United States; 3Functional & Chemical Genomics Program, Oklahoma Medical Research Foundation, Oklahoma City, United States; 4Department of Genetics, Development and Cell Biology, Iowa State University, Ames, United States; 5Zebrafish Centre for Advanced Drug Discovery & Keenan Research Centre for Biomedical Science, Li Ka Shing Knowledge Institute, St. Michael’s Hospital, Unity Health Toronto & University of Toronto, Toronto, Canada; 6Department of Cardiovascular Medicine, Mayo Clinic, Rochester, United States; 7Department of Embryology, Carnegie Institution for Science, Baltimore, United States; 8Department of Clinical Genomics, Mayo Clinic, Rochester, United States; 9Department of Otorhinolaryngology, Mayo Clinic, Rochester, United States; 10Genomics and Molecular Medicine Unit, CSIR– 11 *For correspondence: Institute of Genomics and Integrative Biology, Delhi, India; Department of [email protected] (KJC); Biology, Temple University, Philadelphia, United States; 12Institute of Zoology, [email protected] (SCE) Developmental Biology Unit, University of Cologne, Cologne, Germany Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss
    cells Review Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss 1, 1, 1 1,2,3 1 Gayle B. Collin y, Navdeep Gogna y, Bo Chang , Nattaya Damkham , Jai Pinkney , Lillian F. Hyde 1, Lisa Stone 1 , Jürgen K. Naggert 1 , Patsy M. Nishina 1,* and Mark P. Krebs 1,* 1 The Jackson Laboratory, Bar Harbor, Maine, ME 04609, USA; [email protected] (G.B.C.); [email protected] (N.G.); [email protected] (B.C.); [email protected] (N.D.); [email protected] (J.P.); [email protected] (L.F.H.); [email protected] (L.S.); [email protected] (J.K.N.) 2 Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3 Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand * Correspondence: [email protected] (P.M.N.); [email protected] (M.P.K.); Tel.: +1-207-2886-383 (P.M.N.); +1-207-2886-000 (M.P.K.) These authors contributed equally to this work. y Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated.
    [Show full text]
  • Network Analysis of Micrornas, Transcription Factors, Target Genes and Host Genes in Human Anaplastic Astrocytoma
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 12: 437-444, 2016 Network analysis of microRNAs, transcription factors, target genes and host genes in human anaplastic astrocytoma LUCHEN XUE1,2, ZHIWEN XU2,3, KUNHAO WANG2,3, NING WANG2,3, XIAOXU ZHANG1,2 and SHANG WANG2,3 1Department of Software Engineering; 2Key Laboratory of Symbol Computation and Knowledge Engineering of the Ministry of Education; 3Department of Computer Science and Technology, Jilin University, Changchun, Jilin 130012, P.R. China Received December 2, 2014; Accepted January 29, 2016 DOI: 10.3892/etm.2016.3272 Abstract. Numerous studies have investigated the roles TP53. PTEN and miR-21 have been observed to form feedback played by various genes and microRNAs (miRNAs) in loops. Furthermore, by comparing and analyzing the pathway neoplasms, including anaplastic astrocytoma (AA). However, predecessors and successors of abnormally expressed genes the specific regulatory mechanisms involving these genes and miRNAs in three networks, similarities and differences and miRNAs remain unclear. In the present study, associated of regulatory pathways may be identified and proposed. In biological factors (miRNAs, transcription factors, target genes summary, the present study aids in elucidating the occurrence, and host genes) from existing studies of human AA were mechanism, prevention and treatment of AA. These results combined methodically through the interactions between may aid further investigation into therapeutic approaches for genes and miRNAs, as opposed to studying one or several. this disease. Three regulatory networks, including abnormally expressed, related and global networks were constructed with the aim Introduction of identifying significant gene and miRNA pathways. Each network is composed of three associations between miRNAs Astrocytoma is a tumor of the astrocytic glial cells and the targeted at genes, transcription factors (TFs) regulating most common type of central nervous system (CNS) neoplasm, miRNAs and miRNAs located on their host genes.
    [Show full text]
  • Mutational Screening of the RP2 and RPGR Genes in Spanish Families with X-Linked Retinitis Pigmentosa
    Mutational Screening of the RP2 and RPGR Genes in Spanish Families with X-Linked Retinitis Pigmentosa Maria Garcı´a-Hoyos,1 Blanca Garcia-Sandoval,2 Diego Cantalapiedra,1 Rosa Riveiro,1 Isabel Lorda-Sa´nchez,1 Maria Jose Trujillo-Tiebas,1 Marta Rodriguez de Alba,1 Jose Maria Millan,3 Monserrat Baiget,4 Carmen Ramos,1 and Carmen Ayuso1 PURPOSE. The X-linked form of retinitis pigmentosa (XLRP) is sph.uth.tmc.edu/RetNet/disease.htm; provided in the public the most severe type because of its early onset and rapid domain by the University of Texas Houston Health Science progression. Five XLRP loci have been mapped, although only Center, Houston, TX). The diagnosis criteria for RP were es- two genes, RPGR (for RP3) and RP2, have been cloned. In this tablished by Marmor et al.1 and are characterized by night study, 30 unrelated XLRP Spanish families were screened to blindness, progressive constriction of the visual field, and pig- determine the molecular cause of the disease. mentary retinopathy, that result from the gradual degeneration METHODS. Haplotype analysis was performed, to determine of photoreceptor cells, which begins in the periphery and whether the disease is linked to the RP3 or RP2 region. In those progresses to the central region of the retina. The X-linked form of RP accounts for approximately 12% of families in which the disease cosegregates with either locus, 2 mutational screening was performed. The RP2 gene, the first cases in Spain. It is, on average, the most severe form because 15 exons of RPGR at the cDNA level, and the open reading of its early onset and rapid progression, typically presenting in frame (ORF) 14 and 15 exons were screened at the genomic the first decade of life and progressing to partial or complete DNA level.
    [Show full text]