Assessment of Genetic Variability and Development of Hybrids in Rosa Species

ASSESSMENT OF GENETIC VARIABILITY AND DEVELOPMENT OF HYBRIDS IN ROSA SPECIES

MUHAMMAD FAISAL KHAN 14-arid-980

DEPARTMENT OF HORTICULTURE FACULTY OF CROP & FOOD SCIENCES PIR MEHR ALI SHAH ARID AGRICULTURE UNIVERSITY RAWALPINDI PAKISTAN 2020

ASSESSMENT OF GENETIC VARIABILITY AND DEVELOPMENT OF HYBRIDS IN ROSA SPECIES

MUHAMMAD FAISAL KHAN (14-arid-980)

A thesis submitted in partial fulfillment of

the requirement for degree of

Doctor of Philosophy in Horticulture

DEPARTMENT OF HORTICULTURE FACULTY OF CROP & FOOD SCIENCES PIR MEHR ALI SHAH ARID AGRICULTURE UNIVERSITY RAWALPINDI PAKISTAN 2020

i ii

iii

DEDICATION

Oh, Allah Almighty open our eyes, To see what is beautiful, Our minds to know what is true, Our heart to love what is Allah

Blessing of Almighty ALLAH

Always help me to complete task positively with truth and Prayers of family Whose encouragement, spiritual inspiration, well wishes, sincere prayers and an atmosphere that initiate me to achieve high academic goals

iii

CONTENTS List of Tables X List of Figures Xi Acknowledgements Xiv Chapter 1 INTRODUCTION 1 Chapter 2 REVIEW OF LITERATURE 9 2.1 ROSA HYBRIDA CLASSIFICATION AND HISTORIC 9 BACKGROUND 2.1.1 Breeding History and Classification 10 2.1.2 Reproductive Physiology and Factors Effecting Breeding 11 Success 2.1.3 Fertility Status and Associated Factors 12 2.1.4 Rose Seeds Collection 16 2.1.5 Seed Germination Problem 17 2.1.6 Genetic Diversity Evaluation 19 2.1.7 Growth Performance 23 2.1.8 Physiological Response 24 2.1.9 Water Requirement and Transpiration 26 2.1.10 Stomatal Conductance 26 Chapter 3 MATERIALS AND METHODS 28 3.1 PLANTING MATERIAL 28 3.1.1 Field Preparation 31 3.2 DATA COLLECTION FOR CHARCTERIZATION OF ROSA 31 HYBRIDA VARIETIES 3.2.1 Morphological Characters 31 3.2.1.1 Plant height (cm) 31 3.2.1.2 Primary branches per plant 31 3.2.1.3 Number of prickles 32 3.2.1.4 Number of flowers per plant 32 3.2.1.5 Flower diameter per flower (cm) 32 3.2.1.6 Number of petals per flower 32 3.2.1.7 Flower persistency life 32 3.2.2 Physiological Response of Rosa Hybrida Varieties 32 3.2.2.1 Leaf area (cm2) 33 3.2.2.2 Photosynthesis rate (Pn) 33 3.2.2.3 Transpiration rate (E) 33 3.2.2.4 Stomatal conductance (gs) 33 3.2.3 Experimental Design for Statistical Analysis 33 3.3 NUMBER OF ANTHERS, INVITRO POLLEN VIABILITY 34 AND POLLEN GERMINATION STUDY OF ROSA HYBRIDA VARIETIES 3.3.1 Preparation of Material for Pollen Testing 34 3.3.2 Pollen Viability Test 35 3.3.3 Pollen Diameter (µm) 35 3.3.4 Germination Capacity of Pollens 35

3.3.5 Experimental Design for Statistical Analysis 36 3.4 NEW CROSS COMBINATIONS FOR CONVENTIONAL 36 BREEDING 3.4.1 Pollination Process 36 3.4.2 Data Collection for Successful Cross Combinations 37 3.4.2.1 Hip set percentage (%) 37 3.4.2.2 Days taken to maturity of hips (days) 37 3.4.2.3 Hip fresh weight (g) 38 3.4.2.4 Number of seeds per hip 38 3.4.2.5 Seed dry weight (g) 38 3.4.2.6 Seeds length and width (mm) 38 3.4.3 Experimental Design for Statistical Analysis 38 3.5 MITIGATION OF SEED DORMANCY IN NEW 38 COMBINATIONS AMONG ROSA SPECIES 3.5.1 Seed Germination Treatments 38 3.5.2 Data Collection After Seed Germination 39 3.5.2.1 Germination percentage 39 3.5.2.2 Germination days 39 3.5.2.3 Growth performance of seedlings at the time of transplantation 40 3.5.3 Experimental Design for Statistical Analysis 40 3.6 MORPHOLOGICAL DATA OF PROGENIES IN FIELD 40 3.6.1 Number of Petals per Flower 41 3.6.2 Flower Diameter (cm) 41 3.6.3 Height of Progeny Plant (cm) 41 3.6.4 Number of Prickles 41 3.6.5 Flower Persistency Life (days) 41 3.6.6 Experimental Design for Statistical Analysis 41 3.7 DETERMINATION OF GENETIC VARIABILITY AMONG 42 DEVELOPED HYBRIDS AND THEIR PARENTS 3.7.1 Collection of Leaf Samples 42 3.7.2 DNA Extraction Protocol 42 3.7.3 DNA Quantification 43 3.7.4 Microsatellite Molecular Markers for Genetic Diversity Analysis 43 3.7.5 Electrophoresis and Analysis of Ampliﬁed Samples 45 3.7.6 Experimental Design for Data Analysis 45 Chapter 4 RESULTS AND DISCUSSION 46 4.1 MORPHOLOGICAL EVALUATION OF ROSA HYBRIDA 46 VARIETIES 4.1.1 Plant Height (cm) 46 4.1.2 Number of Primary Branches per Plant 48 4.1.3 Number of Flowers per Plant 49 4.1.4 Flower Diameter (cm) 50 4.1.5 Number of Petals per Flower 51 4.1.6 Petal Length of Flowers 54 4.1.7 Number of Prickles on Stem 55

4.1.8 Flower Persistence Life 55 4.1.9 Correlation Among Morphological Character 56 4.1.10 Discussion on Morphological Attributes 57 4.2 ESTIMATION OF LEAF GAS EXCHANGE DATA OF ROSA 68 HYBRIDA VARIETIES 4.2.1 Leaf Area (cm2) of Rosa Hybrida Varieties 68 4.2.2 Photosynthesis Rate of Rosa Hybrida Varieties (Pn = μmol CO2 69 m-2s-1) -2 - 4.2.3 Transpiration Rate of Rosa Hybrida Varieties (E= mol H2O m s 70 1) 4.2.4 Stomatal Conductance of Rosa Hybrida Varieties (gs= mol m-2s- 71 1) 4.2.5 Discussion on Physiological Attributes 74 4.3 NUMBER OF ANTHERS, INVITRO POLLEN VIABILITY 75 AND POLLEN GERMINATION STUDY 4.3.1 Number of Anthers per Flower 75 4.3.2 Pollen Viability Percentage (%) 76 4.3.3 Pollen Invitro Germination Percentage (%) 77 4.3.4 Pollen Diameter (µm) 79 4.3.5 Discussion on Pollen Behavior for Success of Breeding 80 4.4 SEED SETTING SUCCESS IN NEW CROSS 82 COMBINATIONS 4.4.1 Hip Set Percentage (%) 83 4.4.2 Hip Fresh Weight (g) 83 4.4.3 Hip Size (cm) 84 4.4.4 Days to Maturity of Hips (days) 84 4.4.5 Number of Seeds per Hip 85 4.4.6 Dry Weight of Seeds (mg) 85 4.4.7 Length and Width of Seeds (mm) 85 4.4.8 Discussion on Seed Setting Among Successful Cross 86 Combinations 4.5 MITIGATION OF SEED DORMANCY IN DEVELOPED 93 NEW COMBINATIONS AMONG ROSA SPECIES 4.5.1 Control T0: Effect of Seed Storage at Room Temperature 93 4.5.2 Effect of Warm and Cold Temperature on Seed Germination 93 4.5.3 T2: Effect of Cold Stratification Combined with GA3 94 4.5.4 T3: Effect of Warm and Cold Temperature in Combination with 94 GA3 4.5.5 Seedling Germination Days 94 4.5.5.1 Seedling leaf at the time of transplantion 98 4.5.5.2 Seedling length at the time of transplantion 99 4.5.5.3 Seedling root length at the time of transplantion 99 4.5.5.4 Seedling shoot at the time of transplantion 100 4.5.5.5 Discussion on germination of rose seed 101 4.5.6 Nursery Seedling Growth Performance 103 4.5.6.1 Results of hybrid seedlings growth 104

4.5.6.2 Discussion of seedling plants 105 4.6 MORPHOLOGICAL DATA OF HYBRID PROGENY 106 POPULATION 4.6.1 Parent Varieties and Developed Progenies Description 117 4.7 EVALUATION OF GENETIC DIFFERENCES IN 118 DEVELOPED PROGNIES WITH THEIR PARENTS 4.7.1 Genetic Diversity Analysis 118 4.7.2 Genetic Diversity Analysis by Using Microsatellite SSR Markers 119 4.7.3 Discussion on Genetic Diversity Among Parents and Developed 120 Hybrid Population SUMMARY 124 LITERATURE CITED 128

vii

Abbreviations R Rosa DNA Deoxyribonucleic acid RAPD Random amplified polymorphic AFLP Amplified fragment length polymorphism UAE United Arab Emirates PHDEB Pakistan Horticulture Development and Export Board ° C Celsius ROS Reactive oxygen species RNS Reactive nitrogen species %age Percentage Μm Micrometer ABA Abscisic acid GA3 Gibberellic acid SSR Simple sequence repeats RAPD Random Amplified Polymorphic DNA SCARs Sequence characterized amplified regions ISSR Inter simple sequence repeat SCoT Start codon targeted PCA Principal component analysis HCA High-content screening Umol m- Micromole: per second and square meter 2 s-1 CO2 Carbon dioxide RCBD Randomized Complete Block Design Cm Centimeters ANOVA Analysis of variance IRGA InfraRed Gas Analyzer mm Millimeter PAR Photosynthetically active radiation Pn Photosynthesis LSD Least Significant Difference URF Universty Research Farm PMAS Pir Mehr Ali Shah AAUR Arid Agriculture University Rawalpindi CTAB Cetyltrimethylammonium bromide RNAase Ribonuclease Rpm Revolutions per minute UV Ultraviolet PCR Polymerase chain reaction ddH2O Double Distilled Water µl Microliter

viii

S Seconds Min Minutes Bp Base pair UPGMA Unweighted pair group method with arithmetic mean Cm Centimeters

List of Tables

Table No. Page 3.1 List of Rosa hybrida varieties with their parentage and characters 29 grown in Pothwar climate of Pakistan 3.2 Varieties with their cross combinations used in hybridization study 37 3.3 List of microsatellite markers (SSR) used in genetic diversity 44 among Rosa hybrida population and parents 3.4 Thirty-four hybrid population and ten parent plant DNA extraction 45 4.1 Morphological foliage characters of varieties grown in Pothwar 59 climate 4.2 Growth parameters of Rosa hybrida varieties during the years 60 2016-2017 in Pothwar climate 4.3 Correlation study among examined morphological traits by 62 principal component analysis 4.4 Correlation among examined morphological characters 62 4.5 Leaf area, photosynthesis rate, transpiration rate and stomatal 73 conductance of Rosa hybrida varieties for years 2016-2017 4.6 Rosa hybrida varieties for parentage characters 81 4.7 Detail description of collected data from successful hip set up to 87 extraction of seed of successful crosses 4.8 Seed germination percentage resulted from different treatments 95 4.9 Successful seedlings after transplantation screened for 96 morphological traits 4.10 Examined morphological characters of hybrid progenies of Rosa 107 hybrida varieties 4.11 Morphological characters of the Rosa hybrida parents used in rose 115 breeding programme in Pothwar climate 4.12 Morphological characters of the hybrid seedlings successfully 115 shifted in field

List of Figures

Figure No. Page 3.1 Rosa hybrida varieties for experiment (a), watering through 31 channels (b) 3.2 Petals of varieties Midas touch (Yellow) and Gruss an Teplitz 32 (Red) 3.3 Rosa hybrida varieties flower bud used in pollen study 34 3.4 Preparation of germination media for pollen germination study 35 3.5 Hybrid seed germination by different treatments in mix peat moss 40 media 3.6 Length of seedling, shoot length, root length and root shoot ratio 40 4.1 Average plant height (cm) from January to December months in 47 years 2016-2017 4.2 Average plant height (cm) for all varieties in years 2016-2017 47 4.3 Average number of primary branches of varieties from January to 49 December in years 2016-2017 4.4 Average number of primary branches per plant in each variety 49 4.5 Average number of flowers in different months for years 2016- 51 2017 4.6 Average number of flower per plant in each variety for years, 2016- 52 2017 4.7 Average flower diameter (cm) in different months for years 2016- 52 2017 4.8 Average flower diameter of each variety of Rosa hybrida 53 4.9 Average number of petals per flower for each variety grown in 54 pothwar climate 4.10 Description of average petal length of Rosa hybrida varieties 55 4.11 Average number of prickles present in-between 4-6 node at main 56 stem 4.12 Average flower persistance life of Rosa hybrida varieties grown in 57 pothwar climate for the years 2016-2017 4.13 Cluster analysis of Rosa hybrida parent varieties used for 61 conventional breeding 4.14 Distinguished Characters of Rosa hybrida varieties (V1 to V8) 63 utilized in breeding programme 4.15 Distinguished Characters of Rosa hybrida varieties (V9 to V16) 64 utilized in breeding program 4.16 Distinguished Characters of Rosa hybrida varieties (V17 to V21) 65 utilized in breeding programme 4.17 Average leaf area of Rosa hybrida varieties grown in pothwar 69 climate for years, 2016-2017

4.18 Average photosynthesis rate for Rosa hybrida varieties in spring 70 season for years 2016-17 4.19 Average transpiration rate of Rosa hybrida varieties in spring 71 season for years 2016-17 4.20 Average stomatal conductance for Rosa hybrida varieties for years 72 2016-17 4.21 Average number of anthers for each Rosa hybrida varieties 76 4.22 Average pollen viability percentage of each variety used in this 77 study 4.23 Average pollen germination percenatge of each variety in 78 differrent sucrose and agar (2%) media 4.24 Average pollen diameter of Rosa hybrida varieties 79 4.25 Process from emaculation upto seed harvesting after successful 84 crosses. (a) Emasculation, (b) Capping and hip formation after pollination, (h) Midas touch crosses hips, (i) Bora bora crosses hips (j) Gruss an Teplitz crosses hips at maturity 4.26 Dry weight of seeds obtained from successful cross combiantions 86 4.27 Average length and width of seeds resulted from cross 86 combinations 4.28 Day taken to seed germination under different applied treatments 97 4.29 Day taken to germinate seeds of different cross combiantions 98 4.30 Average number of leaves at the time of transplantaion of seedlings 99 4.31 Average seedling length at the time of transplantation 100 4.32 Average seedling root length per cross combination grown by 100 different seed 4.33 Average seedling shoot length per cross combiantion grown by 101 different seed treatments 4.34 One year old seedling plants in greenhouse. Picture showing hybrid 103 seedling of H106, H104 and overall seedling plants 4.35 Dendrogram grouping of parents on the basis of morphological 108 data used in conventional breeding 4.36 Tree diagram showing the grouping of Rosa hybrida varieties with 109 their hybrid progenies for morphological traits 4.37 Resulted hybrid from the cross combination of Gruss an Teplitz 110 (female parent) and Bridal pink (male parent) 4.38 Resulted hybrid from the cross combination of Gruss an teplitz 111 (female parent) and Morstylo (male parent) 4.39 Resulted hybrid from the cross combination of Gruss an Teplitz 112 (female parent) and Hot cocoa (male parent) 4.40 Resulted hybrid from the cross combination of Midas touch 113 (female parent) and Anne Marie Trechslin (male parent)

xii

4.41 Resulted hybrid from the cross combination of Bora bora (female 114 parent) and Anne Marie Trechslin (male parent) 4.42 Description of genetic variability among parents and hybrid 122 progenies in cluster grouping.

xiii

Acknowledgements

All kind of praises and thanks are to Almighty ALLAH, the most Beneficent, the most Merciful and Kind at the Day of Judgment. With trembling lips and wet eyes, I offer my humblest thanks to the highest personality of the world, the greatest social reformer, The HOLY PROPHET HAZRAT MUHAMMAD (S.A.W.W.) Who is enlightening our heart and cleaning our thoughts with the essence of faith in ALLAH and Whose (S.A.A.W.) blessings flourished my ideas and thrived my ambitions to have the cherish fruit of my modest efforts in the form of this write up. My research work was accomplished under enthusiastic guidance, systematic attitude, inexhaustible inspiration and enlightened supervision of my respected supervisor Prof. Dr. Ishfaq Ahmad Hafiz, Professor/Chairman Department of Horticulture, PMAS Arid Agriculture University Rawalpindi. I offer my heartiest gratitude to my honorable teacher Prof. Dr. Nadeem Akhtar Abbasi, Professor/ Pro VC, PMAS Arid Agriculture University, Rawalpindi for the valuable suggestions, cooperation and kind behavior during the study. Cordial thanks are also extended to Prof. Dr. Muhammad Kausar Nawaz Shah, Professor, Department of Plant Breeding and Genetics, PMAS Arid Agriculture University Rawalpindi for his constant encouragement.

I do not have words at command in acknowledgment that all credit goes to my loving Father and Mother. Especially to my brothers, Dr. Shoukat Ali Khan, Haji Fayyaz Hussain, Haji Irshad Hussain, Haji Javaid Iqbal, Dr. Fahad Ali Khan and Sisters for his guidance, support and encouragement during my studies. I am eternally greatful to my Father-in-law, Mian Mumtaz Ahmad, my Wife Sumaira Mumtaz and Cousins for the completion of this hectic and hardship work with their mellifluous affections, inspiration and well wishing. Their prayers will always be with me for my success. Special thanks to Dr. Abdul Ahad Qureshi, Rab Nawaz, Dr. Muhammad Azhar Iqbal, Ajmal Bashir, Asif Saleem, Rana Atiq-ur- Rehman, Syed Zia ul hassan, Izhar Naeem Bhatti, Mehran Mumtaz and Mr Yaqoob Tahir Izhar (Managing Director, Izhar Group of Companies) for their help and cooperation during my studies and research work.

Muhammad Faisal Khan

xiv

INTRODUCTION

Rose is the most extensively cultivated and widely adapted flowering crop among family Rosaceae. Rose (Rosa spp.) has been cultivated for at least 5,000 years (Gudin, 2000; Shepherd, 1954). The history starts with the name Rosa chinensis, which leads with the development of varieties into Europe (Zhang, Byrne, Ballard, & Rajapakse, 2006). Rose flowers are known to be romantic with beautiful color geometry and emotional attractions (Cai, Xing, Sun, Zhan, & Corke, 2005; Haviland- Jones, Rosario, Wilson, & Mcguire, 2005; Liu et al., 2013; Nadpal et al., 2016). Roses are cold-tolerant perennial shrubs that grow in almost all habitats, making them ideal crops (Macphail, 2007). Wild rose has long canes in open growth of branches, usually a single androgynous flower, producing edible hips containing achenes and single seed fruit (Kevan, Eisikowitch, Ambrose, & Kemp, 1990).

Roses (Rosa spp) have economic value in the ornamental, pharmaceutical and cosmetic trades. Mainly used to grow on beds, borders, growing walls, growing on arches and landscaping (Canli & Kazaz, 2009). The fragrance of roses has not match in food and cosmetic industry (Kaur, Sharma, Singh, & Ahuja, 2007). Roses are used for multi purposes such as cut flowers, rose oil and is also good source of vitamin C (Marchant, Power, Davey, Chartier-Hollis, & Lynch, 1992). Millions of roses are planted in gardens or pots and billions of roses are sold as cut flowers around the world (Khosh-khui & Teixeira, 2006). During this historical period, modern roses has vast diversity inherited in current genome (Cock, Scariot, Leus, Riek, & Huylenbroeck, 2007; Scariot, Akkak & Botta, 2006). The seeds are mainly used for establishing rootstock germplasm, breeding plant species and acquiring new species (Bosco et al., 2015; Pipino, Leus, Scariot, & Van Labeke, 2013). Due to interspecific hybridization, many hybrids and cultivar have been introduced with unique characteristics of flower yield and quality. In addition, widely adaptation behavior in different regions and varying ploidy level make the rose genus more complex among Rosaceae family (Agarwal et al., 2018). In Pakistan, local varieties have a significant importance due to quality characters (Leghari, Laghari & Laghari, 2016).

There are more than 100 species of roses (Rosa spp.) which are originated

1 through cross-breeding (Zhang et al., 2013). Species variability and intraspecific hybridization complexity has made heterozygous genetic relationship within Rosaceae especially for cultivars (Koopman et al., 2008). Variation in genetic material mainly depends on morphological characteristics of the plants such as spines, leaves and umbels showing phenotypic diversity which can be characterized by using molecular markers (Cheikh-Affene, Haouala & Harzallah-Skhiri, 2015). The rose (Rosa spp.) having 7 chromosomes by pollen (bivalents) and from oocytes (univalent). Flow cytometry and molecular analysis are useful for determination of ploidy, reproductive pattern and genomic compatibility of newly develop hybrid population (Nybom, Esselink, Werlemark, Leus, & Vosman, 2006). Polyploidy and hybridization are important factors in plant diversity. In natural environment, species spontaneously hybridize but the extent of natural hybridization is unclear (Herklotz & Ritz, 2016).

Most of the species are diploid and modern rose varieties are tetraploid and are usually sterile (Smulders, Esselink, Voorrips, & Vosman, 2009). Combining the varieties as diploid with tetraploid results in triploids which may brings limitation due to cause of sterility. Rose has great genomic importance, wide range of genetic and phenotypic diversity of genotype (Balaj & Zogaj, 2011). Natural hybridization and polyploidy are considered as drivers of biodiversity with-in the Mediterranean region. The geological and environmental conditions are important for species diversity inherited through hybridization, with varying level complex genome (Marques, Loureiro, Draper, Castro, & Castro, 2018). Complex phylogenetic morphological features and early initiation of flowering are demanding task to acquire new genotype (Misra & Srivastava, 2004). Sky blue rose is a historic achievement in breeding (Katsumoto et al., 2007). However, breeding strategy of roses still relies on simple methods of hybridization and asexually propagation of new varieties (Debener & Mattiesch, 1999; Rajapakse et al., 2001).

Compatibility of parents with seed yield characteristic and fertile pollen are acquired at time of selection (Anderson, 2006). As roses have wide variation in fertility level (Zlesak, 2009b). Variation in hip formation and seed setting depends on pollen fertility rather than cross compatibility (Visser, Vries, Scheurink, & Welles, 1977). Many factors hinder the fertility as they are associated with

2 compatibility of pollen transferred to the stigma. There is a linear relationship between pollen viability and germination ability of many fruits (Griggs, Forde, Iwakiri, & Asay, 1971). The ability of pollen to fertilize and germinate depends on various known and unknown factors, nutritional and environmental factors relevant to species and used varieties (Eti & Stosser, 1988). Pollen viability and germination is important which varies in most of the species (Wronska-Pilarek & Tomlik- Wyremblewska, 2010) due to different ploidy level (Ercisli, 2007b).

The success of conventional breeding relay on efficient pollen parents and maximum seed germination. Physiological dormancy issue in the achenes of hybrid tea rose, results in variable and irregular seed germination (Pipino et al., 2011a). In the rosa genus, seed dormancy is due to hard seed coat which poses considerable problems to seedlings (Haouala, Hajlaoui & Cheikh-Affene, 2013). Rose seeds also exhibit dormancy due to hormonal imbalance, surface hardening, immature seed harvesting with varying level of physiological disorders in the embryo and environmental factors (Devries & Dubois, 1983; Gudin, Arene, Chavagnat, & Bulard, 1990; Zhou, Bao & Wu, 2009). Seed germination percentage varies in commercial propagation and for breeding in the rose species. Presence of inhibitory substance in pulp and achene at maturity stage of hips effects seed germination in roses. Scarification and stratification methods are more effective in breaking the seed dormancy (Semeniuk & Stewart, 1966; Svejda, 1968; Werlemark, Carlson-Nilsson, Uggla, & Nybom, 1995; Zhou, Bao & Wu, 2009; Zhou & Bao, 2011). Therefore, optimum germination can be achieved through surface rubbering, H2SO4 dipping, growth promoting bacteria, storage environment and temperature alteration (Morpeth & Hall, 2000; Yambe & Takeno, 1992; Zhou, Wu, Bao, & Qiu, 2008). Application of gibberellin promote and enhance the germination of seed, vegetative and reproductive growth of the plants (Ogawa et al., 2003; Phillips, 1998). Gibberellins mobilizes the available energy (secreting a hydrolase in the starch endosperm) in plants and promotes the availability of hydrolases that increase the skin permeability (Peng & Harberd, 2002; Singh, Jermakow & Swain, 2002). Although the application of gibberellin in breeding seems promising as it has a positive effect on the promotion of seed germination of hybrids (Devries & Dubois, 1983).

Cut flower roses are commercially important with vast diversity, magnificent qualitative characters and maximum flower vase life (Zlesak, 2007a). Among them, modern roses (tetraploid) have large flower/bloom borne singly on stiffed pedicel (Koning-Boucoiran et al., 2012; Liorzou et al., 2016). Innovative quality trait can be enhanced through hybridization (Roberts, 2003) including fragrance, recurrent flowering habit, disease resistance, adaptability and vigorous growth (Liorzou et al., 2016; Wang, 2005). The resulted germplasm characters can be differentiated through qualitative and quantitative traits by comparing gentic relationship with their parents (Liorzou et al., 2016; Nadeem et al., 2014).

Genetic differentiation and variability among evolved population through breeding make complicated introgression (Koopman et al., 2008). Variability studies include garden roses comparison by grouping (Debener, Bartels, & Mattiesch, 1996; Vainstein, Zamir & Weiss, 2003), modern roses in hybrid tea and floribunda class related to miniature (Ben-Meir & Vainstein, 1994) and rootstock differentiation from hybrid tea (Esselink, Smulders & Vosman, 2003). The variability also analyzed on the basis of morphological characters of old rose species and ancient garden roses (Scariot, Akkak & Botta, 2006), cut flower roses (Smulders, Esselink, Voorrips, & Vosman, 2009), Damask rose germplasm differentiation on the basis of morphological and oil content (Farooq, Khan, Ali & Riaz, 2011), modern roses on the basis of quantitative and qualitative trait (Nadeem et al., 2014).

The modern trends acquired in breeding are always related with commercial market demand that includes novelty character such as colors, flower diameter, longer stem, higher yield, maximum flower persistency and disease resistance (Zieslin & Mor, 1990). Prickle free stem and low stem weight are important factor due to ease in handling and cost benefits (Devries & Dubois, 1993; Halevy, 2013). Natural and environmental influene evoke genetic differentiation and variability on morphological basis (Bashir, Awan, Khan, Khan, & Usman, 2014). The physible environmental condition in tropics can be fruitful for breeder to improve the morphological traits such as number of petals and prickles (Gitonga et al., 2014).

Microsatellite markers are highly differentiated group for cultivars differentiation. Molecular markers are efficient tool for clarification of basis of origin

4 and genomic relationship between subgenus species (Fernandez-Romero et al., 2009). In rosa species, characterization of genetic variability was done by random amplified polymorphic DNA (RAPD) markers (Azeem, Khan, Awan, Riaz, & Bahadur, 2012), inherited commercial traits were estimted by using AFLP (Baydar, Baydar & Debener, 2004; Dugo et al., 2005) and SSR microsatellites markers (Babaei et al., 2007; Powell et al., 1996; Yan et al., 2005; Zhang, Byrne, Ballard, & Rajapakse, 2006). The value of DNA markers depends on their heritability and polymorphism levels (Baydar, Baydar & Debener, 2004; Kaur, Sharma, Singh, & Ahuja, 2007; Sarkhosh, Zamani, Fatahi, & Ebadi, 2006; Staub, Serquen & Gupta, 1996).

In ancient history, cultivation and popularization was always main concern with modern reproduction system, rootstock selection and post-harvest handling (Roberts, 2003). Fluctuation in environment and involvement of biotech and abiotech stresses also fluctuate color, size and fragrance (Niu, Rodriguez & Aguiniga, 2008). Cut flowers exported from Pakistan are very negligible but climatic variation dramatically adhering export scenario (Chepeliev, Aguiar & Mensbrugghe, 2018). Lack of innovate technology (Bhutto, Rashdi & Abro, 2012) due to small farm holding make difficult for farmers to produce cut flowers according to international market standard (Ahmad, Rafiq, Dole, Abdullah, & Habib, 2017). Rose, gladiolus, tuberose, calla lilly and marigold are important cut flowers grown in Pakistan (Ahmad, Rafiq, Dole, Abdullah, & Habib, 2017; Usman, Ashfaq, Taj & Abid, 2014). The development of new varieties and their rapid marketing are major challenges in the flower trade (Beddington, 2010; Datta, 2018). Pakistan was exporter of flowers to United Arab Emirates (UAE) as well as to Egypt and Germany (Lizuka & Gebreeyesus, 2018; Zeb, Khan & Jan, 2007), with the estimated amount Rs. 35 million from an area of 16,506 acres in the 2009-10 (Taj, Khan, Abbas, & Bashir, 2013; Bashir, Awan, Khan, Khan, & Usman, 2014; Lakhani, 2016; Khan, Mahsud & Mumtaz, 2016). In eaerlier studies, scented variety improvement (Farooq et al., 2013) and heterosis breeding for qualitative and quantitative traits among seed bearing parents (Nadeem, Younis, Riaz, & Lim, 2015) was done in Faisalabad region of Pakistan but the rain-fed Pothwar Plateau in Punjab has not been studied.

Environmental conditions of Pothwar plateau is completely different from the irrigated areas of lower punjab such as rainfall, temperature, humidity and elevation (Farooq, Khan, Ali, & Riaz, 2011). Water is important factor responsible for photosynthesis and cut flower quality production (Zlatev & Lidon, 2012). For rose plants, demand for water depends on transpiration rate, which is typically correlated with plant growth (White & Holcomb, 1987). Determination of the transpiration rate is dependant on the crop, soil and atmospheric variables and evaporation rate related to plant height (Cai, Starman, Niu, Hall, & Lombardini, 2012). The rose plant has a relatively small water storage capacity, which is maintained by a balance between water flux entering and leaving the plant to prevent water stress (Raviv, Lieth, Burger, & Wallach, 2001). Stomatal activity is induced under severe stress (Blom- Zandstra, Pot, Maas, & Schapendonk, 1995) results in biochemical changes during photosynthesis activity among species and genotypes (Arve, Terfa, Gislerod, Olsen, & Torre, 2013; Sharkey, 2005). Therefore, proper photosynthesis rate is essential aspect for species survival and adaptation under native agroclimatic condition (Baille, Colomer & Gonzalez-Real, 2006; Ueda, Nishihara, Tomita, & Oda, 2000). The reduction in photosynthesis rate was attributed to change in intercellular carbon dioxide concentration and cause stunted growth and lower yield in rose plants (Pati, Rath, Sharma, Sood, & Ahuja, 2006), but it increases mesophyll resistance. Water keeps the cell expansion pressure high throughout the spring season (Razzaq & Kappe, 2010).

Pruning intensity has a vital role on growth, development and branching habbit of plant (Leus, Vanlaere, Deriek, & Vanhuylenbroeck, 2018). Prunining at dormant season (winter season) has promoted good quality flowering attributes according to the varietal aspects (Zekavati & Zadeh, 2013). Pruning at different stages of growth and development, improve the architecture, shape and flowering of the plant (Notani et al., 2014). This control the plant stature, leaves variations, flower buds depending on plant habit (Uggla, 2004; Zhang et al., 2018; Zieslin, Hurwitz & Halevy, 1975). Pruning height and time (month) are key aspectes for increment in yield, fragrance and flower characters (viable pollens) (Pal, Agnihotri & Singh, 2014; Kehajov, Zahariev & Komitov, 2016). The determination of plant morphological and associated characters is very important (Pandey & Singh, 2011). Pakistan has a very

6 diverse climate, conducive environment (subtropical to temperate region), to the development of high genetic diversity of rosa species (Farooq et al., 2013; Soujanya et al., 2018). These geographic differences may be due to mutations, genetic drift and recombinant evolution (Thiyagu et al., 2012; Xu et al., 2018).

Low range of diversity in locally adapted rose genotypes, lack of rose breeding programme, Suitable genotypes for hybridization success and lower seed germination are detrimental factors. So, the present research work was done to improve locally adapted genotypes by combining with exotic genotypes through conventional breeding approach in Pothwar climate. The magnificent characters of locally adopted genotypes include fragrance, adaptability, year around flowering and stress tolerance but the lack of diversity in flower color, flower size, suitable stem length, flower persistence life (early flower opening & early petals dropping) subjected as a hindrance in commercial quality flower. The exotic genotypes have compact flowering, Suitable cut flower with prolonged vase life as well field persisitance life, good flower size and range of diversity but have fragrance issue, delicate, adaptability issue and short flowering duration. So, new combinations were designed among locally adapted and extotic genotypes to develop new hybrid lines (F1 progenies) with in the local climate condition. This make possible for selection of high-yield rose seedlings or varieties with desired characteristics (Ahloowalia, Maluszynski & Nichterlein, 2004). Crosses between cultivars having single or double flower trait can produce new complex variants with different color ranges (Xu & Crouch, 2008). Research location has importance due to high relative humidity, in which water requirement is less due to slow rate of evaporation and transpiration (Leghari, Laghari & Laghari, 2016). The limitation in seeds production hinders the breeding of new varieties (Crespel, Lebras, Relion, Roman, & Morel, 2015), pollen maturation and cross-environment can affect success rates (Khan, 1988). Seeds show difficulty germination due to strong dormancy (Leus, Vanlaere, Deriek, & Vanhuylenbroeck, 2018). Various seed treatments were practiced for germination improvement of seeds by minimizing the mechanical resistance and dormancy. The germinated hybrids seedlings were assessed based on significant changes in their parent’s morphological traits for future breeding programs (Franks, Sim & Weis, 2007).

OBJECTIVES

Considering the importance of this crop, the research was taken with the following objectives;

1. Selection and characterization of genotypes for hybridization in Pothwar climatic condition 2. Mitigation of seed dormancy by using different treatments 3. Identification of variation and desirable traits in developed combinations 4. Assessment of morphological traits and field identification of hybrids

REVIEW OF LITERATURE

ROSA HYBRIDA CLASSIFICATION AND HISTORIC BACKGROUND

The rosa genus evolve through Rosaceae family comprises of more than 100 species and thousands of famous widely adapted varieties (Kirov, Van Laere & Khrustaleva, 2015). Among Rosa genus, rose is prominent ornamental flower with distinguish aesthetic purpose and medicinal importance. Roses are classified into different groups by the World Federation of Roses as well as by the American Rose Society (Gudin, 2000; Liorzou et al., 2016). Otagaki et al. (2015) represent the ancient history related to origin of the modern cultivated roses. Modern roses are famous as these are originated by 7 to 10 well known polyploids species (Gudin, 2000; Zhang et al., 2013). The history of roses starts with the wild species which are considered usually diploid (2n = 2x = 14). As improvement was gradually done which resulted in tetraploids (2n = 4X = 28), the commercially cultivated roses. Biological types and ploidy level varies from Noisette (2x), Tea (2x), Bourbons (3x then 4x), Bengale (4x), Portland (4x), Perpetual hybrids (4x), Tea hybrids (4x), Pernettianas (4x), Polyanthas (2x, 3x and 4x) in era of roses (Bendahmane, Dubois, Raymond, & Bris, 2013; Jacob, Teyssier, Reynders-Aloisi, & Brown, 1995).

Although, the number of chromosomes and genome size is small, little is known about the genetics of roses (Devries & Dubois, 1993; Gudin, 2000). Identification of genetic variations between cultivars and genotypes regarding high levels of oil content, flower yield and other desirable characteristics proved effective tool for rose breeders (Macnish, Leonard, Borda, & Nell, 2010). Diploid species are usually self- incompatible (Kuligowska, Lutken & Muller, 2016), while polyploids are self- pollinated (Bruun, 2005). Information on compatibility, pollen vigor, chromosome numbers and heredity are important for optimal use of roses in breeding (Nybom, Werlemark, Esselink, & Vosman, 2004). Weak homogeny among second generation of hybrid lines creates reduction in number of loci that regulate the high degree differentiation among the Rosa genus (Khaitova, Werlemark, Kovarikova, Nybom, & Kovarik, 2014).

Breeding History and Classification

Rose (Rosa spp.) includes more than 100 species, mainly adapted from Asia, native to North America, European states and Northwest Africa. The history starts with diploid which further become part of species evaluations through cross- breeding, usually produced by natural or artificial hybridization (Xu et al., 2018; Zhang, Byrne, Ballard, & Rajapakse, 2006). The basic origination of new species resulted from Synstylae (R. Moschata, R. Wichurana and R. Multiflora) on morphological basis, Gallicanae (R. Gallica) with desired characters, Indicae (R. Chinensis and R. Gigantea) for scented characters and Pimpinellifoliae (R. Foetida) for their adaptability (Darlington & Wylie, 1956). The other species contributed to smaller extent includes R. Spinosissima in Pimpinellifoliae, R. Cinnamomea and R. Rugosa in Cinnamomeae for limited involvement (Smulders, Esselink, Voorrips, & Vosman, 2009).

This series of wild species gives roses a huge diversity in shape, color and aroma. Species variability and intraspecific hybridization complicate the genetic relationship within Rosaceae especially for cultivars (Koopman et al., 2008). The number of species are discouraged such as R. Rugosa thumb in modern breeding era due to adaptability concern regarding cold tolerance and disease resistance (Kuligowska, Lutken & Muller, 2016). Therefore, modernization in roses are involvement of long history of about 200 years breeding in rose hybrids and their wild ancestors. The identification of throughout constraint helpful to get attractive double flowers (Ferrario, Immink & Angenent, 2004). Flower quality in term of flower persistence life or after harvesting of cultivated roses accompanied by flower bud abscission and premature flower senescence during field (Serek, 1993). Preharvest humidity and water stress levels during production also adhere the quality rose flower (Podwyszynska et al., 2015). Hybridization and heterozygous polyploidy occur frequently in this genus, making it difficult to classify and find relationships between species and cultivars (Debener & Linde, 2009; Frederic, Fabien, Chiraz, & Jeremy, 2018). The breeding of roses especially in hybrids become keen focus in twentieth century in which selection of new varieties with novel standards regarding thornless, reproductive and good field performance. However, the fertility of hybrid

10 tea roses is often reduced, probably due to their interspecies origin, but also due to intensive inbreeding (Debener & Linde, 2009; Devries & Dubois, 1993).

Breeding of commercial varieties in response to post harvest attributes (ethylene sensitivity) and genetic variation to get new miniature roses (Muller, Stummann & Andersen, 2001). The process includes selection of appropriate cultivar and identification of F1 breeding line based on morphological characters (Ahmadi, Mibus & Serek, 2009). The widely adapted ornamental roses includes cut flowers and rootstocks (Scariot, Akkak & Botta, 2006). Rootstock roses are usually adapted for their tolerance as wild or semi-wild genotypes (Vukosavljev, Guardo, Weg, Arens, & Smulders, 2012). Hybrid tea roses contain mostly newly developed tetraploid (Von Malek & Debener, 1998). In contrast, garden roses are a diverse, well adapted group for their flowering production and their aesthetic value (Mikanagi, Saito, Yokoi, & Tatsuzawa, 2000).

Traditionally, garden rose varieties fall into three broad categories: wild and ancient gardens and modern garden roses (Mackay et al., 2008). Hybridization and genetic drift among wild species considered arisen part of garden roses which are commonly grown (Chimonidou et al., 2007). Specific traits are introduced from wild relatives (R. Rugosa, R. Arkansana) such as winter cold resistance (Mackay et al., 2008; Vasil & Tzygankova, 2018). In general, breeders are specific to one or more types of roses and want to be identified by their breed (Debener & Linde, 2009; Gudin, 2000; Shepherd, 1954). Modern hybrid roses denoted as conventional tetraploid (2n = 4x = 28) resulted from interspecific crossing between wild species (7-10). The developed hybrids as Bourbon, Hybrid china and Hybrid tea are further grouped according to Horticultural classification (Scariot, Akkak & Botta, 2006).

Reproductive Physiology and Factors Effecting Breeding Success

Rose germplasm includes wild species, ancient and modern varieties (Macphail & Kevan, 2009). Difference among whole germplasm based on their Ploidy level (autoploidy or aneuploidy) according to their genomic sequence (Decock, 2008; Fernandez-Romero et al., 2009). Ploidy level, mode of reproduction (Koning- Boucoiran et al., 2012) and genomic sequence of seedling plants varied with

11 heteropolyploid complexes with high genomic integrity (Nybom, Werlemark, Esselink, & Vosman, 2004). There are many associated factors concluded as internal and external that are possible cause of fertility reduction (Anderson, 2006). Competitive chromosome levels and incompatible characters are inherent factors in pollination (Stephenson & Bertin, 1983), while the quantity of pollen transferred to the stigma. Environmental issues as fluctuation in temperature at the time of pollination, humidity for effective pollen vitality, rainfall, fluctuation in flowering season are external factors (Lloyd & Schoen, 1992; Qasim, Ahmad, & Ahmad, 2008). Pollen viability and pollen germination varies among rose varieties. The acceptability of the stigma was estimated by morphology and color development. Stigma exudate contain nutrition involve for adhesive compatibility, swelling and germination of pollen tube (Ngugi & Scherm, 2006). Hybridization success in roses influence by fertility of pollen at the time of crossing (Shubin et al., 2015; Macovei et al., 2016).

Fertility Status and Associated Factors

Fertile ancestors as pollen donor with their novel characteristics to produce seeds per cross always priority of breeders (Zlesak, 2009b). The condition, time and process of pollen shedding may be repeated to female parents (Gudin, Arene & Bulard, 1991). Therefore, the low fertility of males in roses can be overcome, but choosing a suitable female parent is difficult (Macovei et al., 2016; Zlesak, 2009b). Variations in hip set percentage and seed formation are due to pollen rather than incompatibility (Visser, Vries, Scheurink, & Welles, 1977). Feasibility and germination of pollen grain estimation method to test for differences between pollen vigor and germination ability. Pollen grain efficiency and viability vary among specie (Wronska-Pilarek & Tomlik-Wyremblewska, 2010). In the selection of new varieties for breeding, multiple factors are noticeably influence seed production. The factors are associated with pollen, selection of flower for pollination, pollen maturation and hybridization environments can influence success rates (Khan, 1988; Khosh-Khui, Bassiri, & Niknejad, 1976; Visser, Vries, Scheurink, & Welles, 1977).

The number of modern developed varieties has reached 25,000 and the number continues to increase (Canli & Kazaz, 2009). Many in-vitro and in-vivo studies on

12 pollen germination and pollen tube length were conducted for determination of sexual reproduction (considering the average number of seeds per hip) in roses (Devries & Dubois, 1983; Gudin, 2000; Gudin, Arene & Bulard, 1991; Zlesak, 2009b). Nadeem et al. (2014) study depict that maximum pollen germination rate of hybrid tea was at 15 % sucrose level. Visser, Vries, Scheurink, & Welles (1977) observe the best pollen germination rate of hybrids tea roses at 15 % sucrose concentration. Khan (1988) considered the concentration of sucrose for R. Rugosa Thunb to be 20%. However, higher germination rates of R. Hugonis Hemsl with 30%, 35% and 40% sucrose. Pollen quality has increased the number of seeds and ultimately seedlings obtained per hybrid by more than 200% depending on environmental impact and pollen application (Werlemark, Carlson-Nilsson, Uggla, & Nybom, 1995).

Visser, Vries, Scheurink, & Welles (1977) found that the fertile pollen of hybrid tea roses was affected by the harvesting of suitable bud and was positively correlated with seed production. According to Gudin, Arene, Chavagnat, & Bulard (1990) seasonal effect are associated factor on pollen fertility and pollen size. A temperature of 23 to 30 °C and humidity (60-65%) are optimal conditions for pollen germination and pollen tube elongation in-vitro have positive results. Pollen preservation temperature also effect it vitality and fertilization capacity for intensive use (Giovannini et al., 2017b). Characterization and selection of garden roses is important to predict the seed setting percentage and selection of male and female parent (Nadeem et al., 2014). Liang, Wu & Byrne (2017) estimate morphological performance under different seasons (spring, summer and autumn), temperature (21.7 °C, 30.0 °C and 18.1 °C respectively) and found summer heat stress effect the genotypes morphologically but selection of stable pollen size (heat resistant genotypes) has significant positive response. The presence of excessive accumulation of reactive oxygen species (ROS) and associated reactive nitrogen (RNS) inhibits rose pollen germination. Hybrid tea roses have shown that the level of freshness of pollen varies from species to species and that pollen preservation temperature depends on the variety (Macovei et al., 2016). Ploidy level of the pollen donor parent is important rather than the pollen size. High pollen fertility can lead more success in hybridization, results in more hybridization success, maximum

13 number of seeds setting and diverse offspring (Nadeem et al., 2014). High temperature can cause changes in pollen fertility status, resulting in reduced pollen vigor. Changes in pollen characteristics and pollen performance in hybridization procedures may vary and affect the fertility of pollen donor parents under adverse environmental conditions (Visser, Vries, Scheurink, & Welles, 1977). Hybridization in the month of June and July at temperature more than 45 °C reduced pollen viability potential under field condition (Gudin, Arene & Bulard, 1991). Varieties have same chromosome number (tetraploids) may vary in their fertility.

Pollen fertility estimation by using Aceto-carmine is considered as an effective method for selection of parent for quality pollen (Marks, 1954). Pollen morphology is helpful for confirmation of variation among plant species (Noor, Ahmad, Asghar, Kanwal, & Pervaiz, 2004). In vitro pollen vigor and fertility status ensure to the contribution of each cultivar as a male parent (El Mokadem, Crespel, Meynet, & Gudin, 2002). The success of cross depends on pollen germination % age and pollen tube length for each male parental variety under controlled conditions. The pollen vigor parameters indicate a large difference in pollen quality, quantity, vigor and germination % age. A comparison of the mean viability % age varies in cultivar Handel (70 %), Gruss an Teplitz (64 %) and Autumn Sunset (35 %). Comparing fertility parameters of cultivar in vitro and in vivo can be helpful for more success in the field (Nadeem et al., 2014). The correlation positive found between the pollen morphology (diameter of 30 μm) and seed development per cross (Pipino et al., 2011a; Nadeem et al., 2014). The roses (Rosa Chinensis) is used as a model genotype in rose studies because it contributes to the recurrence of flowering and hybrid tea fragrance characteristics of modern Roses (Lu, Bai, Ren, Liu, & Wang, 2017). Devries & Dubois (1983) found 22 to 26 °C temperature effective for pollination. The morphological feature of pollen size associated with several other parameters. Darwin (1999) observe the pollen diameters of rosa species and found the pollen size was positively correlated with stigma surface and germination of pollen.

Cruden (1989) observed positive correlation of pollen growth and stigma receptivity. Kermani et al. (2003) demonstrate the percentage of viable pollen grains and polyploidy in the Rosa species and observe positive correlation between

14 microspore diameter and ploidy. In roses, diploid species pollen (2n) was 1.2-1.3 times larger than basic set of (n) pollen (Darlington & Wylie, 1956). Scientists Chimonidou et al. (2007) also use this observation for differentiation diploid interspecies hybrid population. Pollen grains size ranges from 32-65 μm approximately with positive correlation and ploidy level among diploid and tetraploid varieties among rosa genus (Jacob & Ferrero, 2003). Most research on fertility is done on hybrids flowers because they are resulted from the heterozygous population. Determination of optimal developed stage of flower for pollen collection in roses varieties for maximum germination on growing media is important (Pipino et al., 2011a). Selection of pollen germination medium based on sucrose concentration, adjusted pH and pollen drying condition has prime importance for conventional rose breeding (Richer, Poulin & Rioux, 2007). Currently, breeding programs focus on new varieties with novel colors, stems, higher yields and extended post-harvest performance, but often encounter some major problems associated with seed production and poor germination (Bosco et al., 2015; Pipino et al., 2011b; Pipino, Leus, Scariot, & Van Labeke, 2013). Cultivated roses often show reduced pollen vigor due to male meiosis or post-meiotic aberrations (Jacob & Ferrero, 2003). If the grain is unprotected at room temperature, the activity of the pollen is quickly lost. However, when stored at cold temperatures, the activity of the pollen remains longer, which vary among species. Therefore, a key aspect of the breeding program is related to the conservation of pollen, the identification of pollen fertility and viability. This is critical and can help improve the overall efficiency of the breeding program (Giovannini et al., 2017a).

Pollen germination rates of 45 tetraploid species and 42 species are 20% and 30%, respectively and the normal pollen content found less than 25% (Calvino, 1951). Although pollen germination differs in various sucrose conditions, the dependency of pollen germination and pollen tube growth as Visser, Vries, Scheurink, & Welles (1977) found hybrid tea rose pollen at 15% sucrose. The parental fertility rate also depends on the morphological characteristics of the pollen, as the pollen diameter showed a significant correlation (r = 0.75) in the study by Pipino, Leus, Scariot, Giovannini, & Van Labeke (2009). The amount of pollen per anther and pollen diameter are important factors for achieving the most important

15 hybrid crosses. The variation in results observed due to species and varieties diversity. The number of anthers per flower range in 90.3 to 116.4 with the high pollen viability in Rosa Dumalis (Ercisli, 2007b). According to Gunes, Cekic & Edizer (2004), the number of anthers per flower of rose is between 81.4 (R. Villosa) to 148.1 (R. Elliptica). The positive observation regarding conversion of stamens and pistils into petals (Morey, 1959). Griggs, Forde, Iwakiri, & Asay (1971) found positive correlation between pollen viability and germination.

Rose Seeds Collection

Rose seeds have a long history of planting to get diverse population of rose genotypes adapted to local condition (Uggla, 2004). Most shrubs are designated as open-pollinated seedlings of the wild genotype that vary greatly in performance and growth characteristics, flower size, shape of plant, color of flower and nutritional importance (Ercisli, 2004a). Several studies have been conducted on the population diversity of the rose seed bearing genotype (Celik, Kazankaya, & Ercisli, 2009; Ercisli & Guleryuz, 2006; Kara & Gercekcioglu, 1992; Sen & Gunes, 1996). The rose hip baring genotype population is large, diverse and a selection study is needed to assess variation to explore wild populations with most promising rosehip genotypes for breeding and to determine their ideal fruit and shrub characteristics. Nadeem, Khan, Riaz, & Ahmad (2011) studied the response newly adapted garden cultivars for morphological characters under the climatic conditions of Faisalabad. With the increased in temperature (above 32 °C), the humidity decreased to 29%, the growth and flowering of shrubs showed a downward trend (The number of flowers, diameter of the flower decrease as humidity decreases). The varieties Autumn Sunset and Gruss an Teplitz performed better. The performance changes of all varieties can be attributed to fluctuations in temperature, humidity and low rainfall. As temperature increased, humidity decreased and almost every trait was observed to decline (Khattak, Munir & Baloch, 1995; Tabassum, Ghaffoor, Waseem, & Nadeem, 2002).

Many countries have initiated conventional breeding programs for rose seed production namely Czechoslovakia, Bulgaria, Germany, Russia and Sweden (Jicinska, Koncalova & Sykorova, 1976; Uggla, 2004; Uggla & Nybom, 1996). Rose

16 breeding programs have a long history (Cock, Scariot, Leus, Riek, & Huylenbroeck, 2007; Scariot, Akkak & Botta, 2006). Polyploid evolution have complex genomic integrity due to meiosis (Yambe & Takeno, 1992). Natural selection may also have evolved in hybrids in cultivated population (Liu & Wendel, 2003). In the large part of the Rosa Caninae section form a well-defined polyploid taxonomic group (x = 7). All diploid species have a unique meiosis pattern (Blackburn & Harrison, 1921; Nybom, Esselink, Werlemark, Leus, & Vosman, 2006). Pentaploid are the not common but tetraploid and hexaploid mostly evolved through history (Wissemann, 2002). There is also problem of apomixis exhibited in many species (Werlemark, Carlson-Nilsson, Uggla & Nybom, 1995). The occurrence of apomixis in seedlings was confirmed by morphometric analysis and pollen viability (Werlemark, 2000; Werlemark & Nybom, 2001). Production of seedlings that contain more ploidy than parental plants can be due to apomixis in breeding. The seedling includes 49 hybrids and 5 % apomixis on genetic diversity evaluation by Random amplified polymorphic DNA (Nybom, Esselink, Werlemark, Leus, & Vosman, 2006).

Seed Germination Problem

The seed extracted from matured hips of roses need moist condition as drying of achene may reduce germination success (Zlesak, 2007a). Seed germination may be influence by genotypic heredity variation and can be improved by warm stratification followed by cold stratification (Alp, Celik, Turkoglu, & Karagoz, 2009). In the rose breeding program, a ploidy knowledge is needed to predict the fertility of the hybrids, which attempt to combine the characteristics of wild species and repeatedly seeded varieties (Gudin, 2000; Roberts, Gladis & Brumme, 2009). Rose seeds have germination difficulties due to various dormancy factor and premature germination (Jackson & Blundell, 1963). Germination of rose seeds can be enhanced by effective seed treatment method for future breeding programs to get new specie (Gudin, Arene, Chavagnat, & Bulard, 1990). Therefore, seed propagation may be a more appropriate breeding method to get variable new emergent offspring than the asexual method. Rose seeds show difficulty in germination due to strong dormancy (Hosafcı, Arslan & Sarıhan, 2004).

Planting roses from seeds is the oldest form of reproduction as it takes more time.

The seed produces from hybridization needs to germinate as it is resulted from crossing of two desired characters parents (Zlesak, 2007a). To obtain a good seed germination percentage, breaking the seed dormancy remain priority. Seed dormancy leads to complexities in peel, seed coat and embryo development (Nadeem et al., 2014; Zhou, Bao & Wu, 2009). Many treatments can improve the germination of rose achenes, including scratching with H2SO4, dry storage, cold stratification and warm stratification (Morpeth & Hall, 2000; Yambe & Takeno, 1992; Zhou, Wu, Bao, & Qiu, 2008) and Invitro germination (Canli & Kazaz, 2009; Khosh-Khui & Teixeira, 2006). The main drawback of dormancy is delayed germination of rose seed or minimum germination percentage (Bhanuprakash, Tejaswini, Yogeesha, & Naik, 2004; Bo, Huiru & Xiaohan, 1993) and physiological disorders in embryos (Zhou, Bao & Wu, 2009).

The selection of appropriate rose seed germination methods can promote germination percentage. Genotypes influenced by temperature factors during seed development, maturity levels at harvest and different seed treatment, different genotypes of rose-achenes have sprouted (Anderson & Byrne, 2005; Zlesak, 2007a). Many germination factors can mainly affect seed germination, embryonic development but cold treatment induces germination (Gudin, Arene, Chavagnat, & Bulard, 1990; Tillberg, 1984). ABA content in achenes can be reduced by stratification followed by cold stratification (Alp, Çelik, Turkoglu & Karagoz, 2009; Werlemark, Carlson-Nilsson, Uggla, & Nybom, 1995). By overcoming the dormancy, mechanical barriers eliminated (limits the growth of the embryo) and maturity period completes results in successful germination (Zhou, Bao & Wu, 2009). Seed dormancy and resistance of hard seed coat of wild roses can be overcome by thermal stratification (25 °C) and cold (5 °C) for 12 weeks resulted in maximum germination (30.6) in approximately 85 days (Haouala, Hajlaoui & Cheikh-Affene, 2013). Reliable and optimized germination plan of hybrid seed constituted with chemical and microbial, seeds before delamination, rinsing with sodium hypochlorite (NaOCl) favored successful germination and increased the germination success from 49.2% to 65.9%. Gibberellic acid (GA3) significantly increased germination rate (77.6%) within mean germination time (26.0 days) as compared to control 32.8 days germination time (Pipino et al., 2011a).

Breeders naturally carry out manual hybridization and hope to set higher seed setting. The number of seeds produce after successful crosses results in new hybrid seedlings. Hip production with maximum seed setting and maximum seed germination consider main priority of breeders (Gudin, Arene, Chavagnat, & Bulard, 1990). Hybrid roses has unique genetic characteristics in the plant kingdom for a uniform spread of seeds in plant material. Therefore, seed multiplication of these species may be the easiest method (Ercisli, 2007b). However, seed propagation inhibit difficulties results in low germination rate due to prolonged seed dormancy (Bo, Huiru & Xiaohan, 1993; Werlemark, Carlson-Nilsson, Uggla, & Nybom, 1995). Achenes dormancy and seed germination may be due to physical barriers of shell, peel, integument and growth of the embryo (Bhanuprakash, Tejaswini, Yogeesha, & Naik, 2004; Devries & Dubois, 2013; Zhou, Bao & Wu, 2009). The cleavage of achenes cannot break dormancy may involve growth inhibitors (Svejda, 1968). Embryos are fully developed in some varieties, but cold layers can overcome skin thickness, create physiological barriers (Zhou, Bao & Wu, 2009).

Presence of physiological dormancy and different hormones in pulp and seed, but the higher degree of inhibitors presence in extracts of pulp rather than seeds. The most effective treatment to break dormancy scarification followed by warm plus cold stratification (at 20 oC for 4 weeks and at 5 oC for 8 weeks). Physiological dormancy and the pattern of dormancy strength varies in species (Zhou, Bao & Wu, 2009). According to Devries & Dubois (2013), Ratio of abscisic acid and gibberellic acid (ABA: GA) controls the state of germination. Absorption of cold-stratified hybrid seed in GA3 increased seedling emergence rate and germination rate. Germination polymorphism is caused by temperature changes during maturation, favored by prolonged pollination, changes in the effects of dormancy and thus irregular seeding of hybrid seeds.

Genetic Diversity Evaluation

The use of markers as a reference tool for assessment of diversity among varieties and cultivated species or Rosa hybrida predominately securing the plant breeder right (Esselink, Smulders & Vosman, 2003). This is mainly due to high heterozygosity, different ploidy levels between species, cross compatibility among

19 parents, seed structure and seed germination issue. However, advancement in technology, fulfil the genetic gaps by understanding the gene of desired characters (Crespel, Chirollet, Durel, Zhang, Meynet, & Gudin, 2002; Rajapakse et al., 2001; Von Malek & Debener, 1998). In addition, this technology proved reliable for identification of newly evolved trait and their basic selection through markers assist the breeding for modern introgression (Rajapakse et al., 2001). Genetic diversity is a feature of individuals with different genetic characteristics. Due to the large number of natural and spontaneous mutations, it is difficult to understand the genetic diversity of the rosa genus (Baydar, Baydar & Debener, 2004). Patented rose varieties are typically worth thousands of dollars and need to be protected from infringement. With the advent of molecular biology, molecular marker analyses are most effective to understand genetics and relationship. The known molecular markers include simple sequence repeats (SSR) markers (Jabbarzadeh, Khosh-Khui, Salehi, & Saberivand, 2009), Restriction Fragment Length Polymorphism (RFLP) markers (Xu, Wen & Deng, 2004), Random Amplified Polymorphic DNA (RAPD) markers (Debener, Bartels & Mattiesch, 1996) and species-specific sequence- characterized amplified region (SCAR) primers (Bashir, Awan, Khan, Khan, & Usman, 2014) provides a scientific approach for identification and genetic diversity as these are difficult to identified by morphological features. RAPD makers are simple and can create error in annealing results in lack of bands (William et al., 1990) while SCARs used as extensive marker-assisted selections by detecting single locus (Bashir, Awan, Khan, Khan, & Usman, 2014).

Repetitive sequence of repeats-poly (CA), Poly (GT) were named simple sequence repeats (SSR). Estimates from RAPD are very similar to other methods (AFLP and ISSR) and can be directly compared (Nybom, Werlemark, Esselink, & Vosman, 2004). RAPD has been widely used to study the taxonomic group of Rosaceae (Farooq et al., 2013; Tabaei, Sahebi, Jafari, & Rezaei, 2004). Genetic diversity was estimated using AFLP (Baydar, Baydar & Debener, 2004) and microsatellites markers (Babaei et al., 2007). The molecular technology lack high level of polymorphism with complex pattern of data (Cubero, Millan, Osuna, Torres, & Cobos, 1995; Martin, Piola, Chessel, Jay, & Heizmann, 2001) whereas microsatellite markers provide simple banding patterns. These can be used for main

20 objective analysis as a highly polymorphic codominant marker (Esselink, Smulders & Vosman, 2003).

Microsatellite markers and flow cytometry can record the frequency of derivation of tested parent species and evolved new hybrids (Herklotz & Ritz, 2016). Genetic determination of flower traits and flowering features of rose ornamental plants with highest financial impact (Roman et al., 2015). Khaitova, Werlemark, Kovarikova, Nybom, & Kovarik (2014) investigate open pollination of two independent hybrid plants (Rosa Rubiginosa and Garden rose) and estimated frequency of genetic variations among new offspring. The second generation of hybrid lines analyzed by molecular methods shows heterogeneity with reduction in number of locus as compared to parents. Interspecific hybridization among wild species (mainly diploid) and cultivated (mainly tetraploid) to restore the novel hybrid obtained by crossing sought by breeder (Crespel, Lebras, Relion, Roman, & Morel, 2015). Many interspecific crosses have been made between tetraploid rose varieties and wild diploid species, but the resulting triploids are usually sterile, making it difficult to produce more generations (Wylie, 1955).

Commercial grown rose cultivars are well known tetraploid and contain high level of heterozygosity. So, it makes the genetics complex to create genetic model for quantitative traits. Phenotypic characteristics includes production of branches, attractive flower color or other related economic parameters are of great economic importance to both conventional breeders and growers (Debener & Linde, 2009; Smulders, Esselink, Voorrips, & Vosman, 2009), which requires a better understanding of genetic factors. Rose has a consensus genetic map. Marker assisted selection is applied in the breeding program (Spiller et al., 2011). Difference among diverse parent selected for breeding has an important aspect as resulted hybrids attains maximum differentiation (Datta, 2018; Ramanujam, Tiwari & Mehra, 1974). The resulted traits may be the possible of dominant evolved in hybrid populations may show double phenotypes (Debener, 1999). Low temperatures may be the reason to increase the number of petals and reduction in the number of stamens, leading to attractive rose phenotype (Zieslin, 1992). The rose variety exhibits repeated flowering, producing dual characteristics consider as valuable modern rose breeding

(Dubois et al., 2012). The number of stamens in rose flower varies widely, ranging from 83-260 stamens. The flower diameter of the species studied ranged from 5.5 to 11.0 cm (Zuraw, Sulborska, Stawiarz, & Chmielewska, 2015). Estimation of difference to identify populations with in similar genotypes is important for the conservation and selection for further use of genetic resources. Furthermore, use of independent markers are essential as these were considered as reliable tool for identification. Morphological evaluation as well as genetic analysis are also considered but the value of DNA markers depends on their heritability and polymorphism levels (Sarkhosh, Zamani, Fatahi, & Ebadi, 2006). Therefore, selection or evaluation of rosa species by observing genetic relationship considered as appropriate solution for taxonomic categorization. Molecular assisted markers have been used in various studies to observe genetic relationships in roses (Baydar, Baydar & Debener, 2004; Kaur, Sharma, Singh, & Ahuja, 2007).

Hindrance in growth and reproduction process greatly affect harvesting time which vary among varieties. Cultivars with excellent shelf life for future breeding are selected, thus demonstrating the potential of genetic diversity assessment breeding programs for novel hybrids with extended post-harvest shelf life (Muller, Stummann & Serek, 2000). Genetic modification for nutrient management, pruning practices, weed management, propagation methods, growth regulators and planting materials with Specific hybridization protocols should be initiated (Pal, 2013). Description of genotypic and phenotypic variations in parent line, cultivated, wild rose varieties and dog roses specie can be differentiated by cluster analysis (Debener, Bartels & Mattiesch, 1996; Werlemark, 2000). Molecular markers were used to demonstrate flower and yield components. Rosa Alba selection from diploid rose specie, resulted from cross among canine and Gallicane parts. Therefore, these markers have the potential to recognize groups and characterize genetic variation within the species and can described by cluster analysis (Mohapatra & Rout, 2005). Agarwal et al. (2018) identify and characterize the genetic variation in rose germplasms by codon-directed polymorphism initiation marker (SCoT). Dickinson, Lo & Talent (2007) study depicted that the relationship between polyploid and reproductive systems is critical that is involved in evolution and improvement in the classification of rose (Rosa species). Accurate identification of clones, cultivars,

22 varieties and understanding their genetic relationships are essential for breeding, breed control and registration, stock management and the protection of plant breeder’s rights. Thus, molecular markers are involved in modern breeding to observe genetic relationships (Baydar, Baydar & Debener, 2004; Debener, Bartels & Mattiesch, 1996; Hubbard, Kelly, Rajapakse, Abbott, & Ballard, 1992; Torres, Millan & Cubero, 1993). Cheikh-Affene, Haouala & Harzallah-Skhiri (2015) describe the morphological variation among Synstylae and caninae by using Principal component and hierarchical component analysis (PCA and HCA) and resulted two distinct group and eight subgroups.

Growth Performance

Variety growth and performance and the number of each flower, the number of thorns, the persistent life, color of the flower, the shape of the shrub and the overall change in performance varies relative to climatic conditions (Nadeem, Khan, Riaz, & Ahmad, 2011). Color and aroma are the most desirable characteristics of roses and consumer needs vary by color and aroma. Two scented parents can produce odorless or unpleasant scent offspring and it is important to know the color of the parents by breeding new color offspring (Cherri-Martin, Jullien, Heizmann & Baudino, 2007). Cut flower for market, decorative flower for home, industrial landscape, ornamental value enhancer, for food and medicinal aspects are main associated factors for commercial growers but a set of morphological variables of the germplasm or cultivar or specie is determined to provide information to the breeder (Mehraj, Ahsan, Mahmud, Hussain, & Uddin, 2014). In ornamental plants, floral traits interm of productivity are key features involves in artificial selection during early domestication and subsequent breeding. Modern tetraploid hybrids may possibly originate after recurrent backcrossing (Kuligowska, Lutken & Muller, 2016; Martin, Piola, Chessel, Jay, & Heizmann, 2001). The genetic variation appears in garden roses in morphological, developmental and phenological stage of plant growth (Khan, 1988). Variation may be in the form of color, flower, leaves, fruits or overall morphological appearance (Winkel-Shirley, 2001). There may also variation in presence of thorn or thornless (Rosu et al., 2011). Color variation and flowering may be due to genetics differentiation, agronomic practices and environment of the

23 surrounding (Gudin, 2000). Production of flowering at average temperature of 18 °C resulted in high yield as it boosts lateral shoot growth while lower temperature below 12 °C produce blind shoots (Moe & Kristoffersen, 1968).

Physiological Response

The physiological variability of photosynthetic efficiency, respiration rate and chlorophyll contents are one of the greatest challenges in assessing the primary production of quality cut rose (Ibrahim, Agarwal, Hardy, Abdul hussein, & Ren, 2017b; Matloobi, 2012). Morphological feature of rose (Rosa sp.) are dependent on growing condition, light intensity and variety (Djennane et al., 2014). At low light, higher will be the photosynthetic rate with higher quality productivity (Sevelius, Hyttinen & Somersalo, 2000). Consideration of available light intensity of 1200 µmol m-2 s-1, most effective for the photosynthetic rate but at 1500 µmol m-2 s-1 light intensity resulted in high yield of hybrid tea and Floribunda rose (Ibrahim, Agarwal, Hardy, Hussein, & Ren, 2017b). The decorative effect of roses depends on the duration of the flowering period, which is regulated by many factors such as variety, environment and growth management. Species and breeds have specific genetic backgrounds that affect flowering time, flower type, repeated flowering, resistance and tolerance to abiotic stresses (Muller, Stummann & Serek, 2000; Serek & Andersen, 1993).

Temperature response mechanisms involved in petals production, which may be related to the breeding of new rose varieties with enhanced traits (Han et al., 2018). Post-harvest stage and shelf life of the product also depends on the agroclimatic conditions during the growth process, related with the stomatal function, regulation of water loss and carbohydrate status (Fanourakis et al., 2013). Plant yield depends on environmental factors such as light (strength, mass and integral), carbon dioxide levels, temperature and relative air humidity (Zeiger, Talbott, Frechilla, Srivastava, & Zhu, 2002). The opening and shelf life main determining factor of cut roses depends to a large extent on the time when the petals fall off (Kumar, Srivastava & Dixit, 2008). The opening of the rose is divided into six stages: the first stage, part of the open bud; the second stage, the fully open bud; the third and fourth stage, part of the open pilot; the fifth stage, the fully opened pollen with visible anthers: In stage

6, the fully opened petals have fallen petals (In, Inamoto & Doi, 2009).

The CO2 concentration in the matrix (µmol/mol), conductance of the stomata mesophyll (Long & Bernacchi, 2003) along with photosynthetic activity are detrimental factor for growth of roses and mechanism for controlling environment (Kim & Lieth, 2003). In addition to its commercial importance as a flower, resistance varieties tolerate environmental stress and variation in growth habits due to change in ecological situation (Wang, Yang, Li, Liu, & Jin, 2017). Plant height, number of leaves and stage of flower bud are detrimental factors in production contexts. Precise estimation of leaf area of cut rose stem during different developmental stage consider important (Costa, Pocas & Cunha, 2016). High temperatures (35 °C) increased the rate of transpiration and the photosynthetic rate in Rosa hybrida (Jiao, Tsujita & Grodzinski, 1991). There is a relationship between photosynthetic rate and chlorophyll content, as plants tend to respond to ambient light by regulating their chlorophyll content and composition (Walters, 2005).

Regarding the response of rose plants to evaporative cooling, a significant increase in the quality of the leaves under evaporative cooling conditions was observed by Plaut & Zieslin (1977). Nutritional conditions and the photosynthetic capacity of roses dependant on the growth temperature. Photosynthetic capacity prolonged growth at low temperatures enhances potential of plant, resulted in Rubisco and nitrogen content increment in the leaves (Ushio, Mae & Makino, 2008). Fanourakis et al. (2013) analyzed cut rose varieties (Frisco and Prophyta) under long term high relative humidity conditions and found significant difference in stomatal physiology. Plants grown at high humidity exhibited lower response stimuli when subjected to dryness (Fordham, Harrison‐Murray, Knight & Evered, 2001; Nejad & Van Meeteren, 2005; Torre & Fjeld, 2001). The role of ABA in controlling stomatal function under drought stress. However, the reason behind the stomata of the leaves appear to fail under high humidity is still unclear (Torre & Fjeld, 2001). In addition, lifespan of cut rose vases is strongly dependent on varieties, but these surprising differences in varieties for humidity response are still poorly understood (Mortensen & Gislerod, 1999, 2005).

Water Requirement and Transpiration

The transpiration rate depends on plant and atmospheric variables such as solar radiation, relative humidity, wind speed and temperature. For rose plants, the requirement of water depends first on the transpiration response, which is typically correlated with plant growth (White & Holcomb, 1987). The water requirement of rose plants grown in media ranges in 2.5 to 3.6 mm during hot days and 1.0 to 2.5 mm dormant period. During harsh environment, young leaves show symptoms of water stress, leading to improper marketing of flowers (Caballero et al., 1995). So, crop water requirement prediction is important, especially in limited water resources areas such as arid and semi-arid regions (Alves & Klar, 2018). Different irrigation frequencies increased fresh and dry weight, leaf area, flower yield and ultimately quality of rose crops (Kittas, Dimokas, Lykas, & Katsoulas, 2004). The leaf area index also important factor in production of roses under different irrigation (Katsoulas, Kittas, Dimokas, & Lykas, 2006). Therefore, crop water application rates and frequency depend on soil moisture (Deleon, Ferrer, Sanchez, & Molina, 2010). Rose plant require high moisture depending on environmental conditions to get constant quality cut flower production (Arevalo, Velez, Enrique, & Intrigliolo, 2014).

Stomatal Conductance

Stomatal opening plays a key role in regulating the gas exchange and nutrient uptake required for photosynthesis and the transpiration loss required for cooling. Since the flow of water through the pores is balanced with the need to ingest carbon dioxide, the pores are constantly regulated throughout the day (Tallman, 2004). Rose plants development under high relative humidity have higher transpiration during growth and during dry stress and have no stomatal response to darkness. According to Niu & Rodriguez (2008), Rosa hybrida grown on rootstock under salt stress conditions respond differently in chloride or sulfated salinity. Rootstocks have the most severe leaf salt damage, indicating that the rootstock has a lower Cl- tolerance threshold concentration. The role of water is one of the most important factors in the photosynthesis and productivity of cut flowers. Stomatal limitation after photosynthesis reactions (Nirit et al., 2006) resulted in biochemical changes induced under severe stress. According to Borch, Williams & Hoyer (1995), significant

26 differences between species and genotypes due to different photosynthesis under water stress. Under reduced water status, photosynthesis rate decreased resulted in swelling growth but variation in intercellular carbon dioxide concentration, increase the mesophyll resistance. Availability of moisture keeps the cell expansion pressure in spring high results in higher productivity of horticultural crops (Bolla, Voyiatzis, Petridou, & Chimonidou, 2010).

Pruning is one of the most important agronomic practices of different rose varieties (Younis et al. 2013) which can increase the size, quality and color of pollen (Kim, Lee, Yoo, Lee, & Kim, 2006). The pruning operation changes the growth stage and physiological activities that promote the sprouting of new axillary buds (Zarina, Munir, Qasim, Jamil, & Baloch, 2004; Zekavati, 2014). In the pruned stems, flowering begins shortly after the development of axillary buds (Chimonidou- Pavlidou, 1998). In addition, a trimming operation is performed to improve the shape of the plant to facilitate cultural manipulation and harvesting. Pruning operation promotes photosynthesis photoreaction, increases metabolic sinks and increases plant inflation pressure (Calatayud, Roca, Gorbe, & Martinez, 2007). Pruning also affects nutrient cycling. However, roses require different types trim levels, time, depending on their species, variety and ecological conditions (Pal, Agnihotri & Singh, 2014).

MATERIALS AND METHODS

The research work related to morphological characterization and hybridization among Rosa hybrida varieties was performed at University Research Farm Koont (URF), PMAS-Arid Agriculture University Rawalpindi for two years, 2016-17. The Islamic Republic of Pakistan (under-developed South Asian country) is located at latitude and longitude of 30° 00' N, 70° 00' E on world map. The latitude and longitude of experimental location are 33° 11' N, 73° 01' E respectively. The climatic condition of country falls in subtropical and semi-arid type of weather with average annual rainfall (250 mm). Temperature extremes in Pakistan exceeds 50 0C. The research trial was conducted in Pothwar climate of Rawalpindi, Pakistan, which is totally dependent on rainfall. The ground water is not fit for irrigation. However, temperature is much suitable for growing of crops with low water requirement (Khan, Hafiz, Abbasi, & Shah, 2019). The detail methodology of each experiment and its associated parameters are described.

PLANTING MATERIAL

The plant material for hybridization is collected from different localites including University of Agriculture, Faisalabad, Horticultural Research Institute for Floriculture & Landscaping, Rawalpindi, Research Sub-Station for Floriculture & Landscaping, Multan, Pattoki Nurseries (District Kasur, Punjab), Pakistan. Overall, forty-eight (48) Rosa hybrida genotypes were collected at initial as germplasm material. All these varieties were planted in field at University Research Farm Koont, PMAS Arid Agriculture University Rawalpindi in the year 2014-15.

Among all of these, twenty-one varieties of rose (Rosa spp.) were selected for research trial are described in Table 3. 1 (Austin, 1999; Horibe & Yamada, 2017). The selected varieties of roses (Rosa spp.) were grafted at Rosa Centifolia rootstock, prunning was done at 25 december each year and evaluated for their morphological traits. Randomized Complete Block Design with three replications was used for plantation (Khan, Hafiz, Abbasi, & Shah, 2019).

Table 3. 1: List of Rosa hybrida varieties with their parentage and characters grown in Pothwar climate of Pakistan

Varieties Parentage and Year Overall characters Doreen Johnson ‘Great Venture × Fort Vancouver’ White, hybrid tea, double flowered/ solitary with mild fragrance × Memoriam. 1977. Helen naude Unknown. 1996. Off white, pink, hybrid tea, solitary/centered bloom form slight fragrance Mr Waqar Local selection Light pink, hybrid tea, solitary bloom with strong fragrance Eye paint MACyeleve × Picasso. 1969. Modern, cluster-Flowered/Floribunda, Red Blend white centered, Repeat- Flowering with mild fragrance Fragrant plum Shocking Blue × [Blue Nile × Modern, large flower/Grandiflora, MAUVE, repeat flowering with strong (Ivory Tower x Angel face)]. fruity fragrance 1990. Midas touch Brandy × Freisensohne. 1992. Modern, Large-Flowered/ Hybrid Tea, Deep Yellow, Repeat-Flowering with strong fragrance Elina Nana mouskouri × Lolita. 1984. Modern, large flower/hybrid tea, light yellow (lemon white), repeat flowering with slight fragrance. Jude-the-Obscure Abraham darby × Windrush. modern, solitary clustered flowered, medium yellow, repeat flowering with 1989. strong fragrance Anne Marie Sutter’s Gold × (Demain x Peace). Modern, Large-Flowered/ Hybrid Tea, Deep orange Pink, Repeat-Flowering Trechslin 1968. Magic lantern Sport of Gold medal. 1993. Modern, Grandiflora/hybrid tea, solitary in small cluster with orange gold, apricot blend reflexed bloom form, repeat flowering with strong fragrance First prize Seedling of enchantment × hybrid tea, large flowered/solitary, cluster form, pink, repeat flowering with seedling of Golden masterpiece. moderate fragrance 1967. Bridal pink Seedling of Summertime × Modern Floribunda, Medium pink, repeat flowering with strong fragrance Seedling of Spartan. 1967.

Morstylo Local selection. Modern Floribunda, solitary bloom, red and creamy white blend, repeat flowering Bora bora Unknown. 1998. Hybrid Tea, double flower, Mild-fruity fragrance, high-centered bloom form, repeat flowering with mild fruity fragrance Pat austin Graham thomas × Abraham Modern, Hybrid tea shrub, solitary, orange red, repeat flowering with sharp darby. 1995. fruity fragrance Angel face (Circus x Lavender pinocchio) × Floribunda, cluster flowered, heat tolerant, deep mauve purple blend, repeat Sterling silver. 1968. flowering with strong fragrance Hot cocoa (Playboy × Altissimo) × Livin Floribunda, medium to large/cluster flower, rain tolerant, Smokey chocolate- easy. 2002. orange, repeat flowering with fruity fragrance Candy stripe Sport of Pink peace. 1962. Hybrid tea, solitary flower with pink blend stripe, repeat flowering with strong fragrance Broceliande Unknown. 2000. Hybrid Tea, large/solitary bloom, red and white stripe, repeat flowering with strong fragrance Scentimental Playboy × peppermint Twist. Modern, cluster flowered/Floribunda, bushy free flowering, burgundy red 1996. striped-cream white, sweet fragrance Gruss an Teplitz (Sir Joseph Paxton × Fellenberg) Bourbon/china, old garden rose, Crimson red, loosely double flowered, × Papa Gontier. 1897. repeat flowering with moderate sweet fragrance

Field Preparation

Field was prepared by plugging and hoeing followed by planking. The plants of each variety were planted at the distance of 3 feet by using square system. Plants were properly irrigated, weeds eradication by manual ploughing, proper application of insecticides and pesticides were done to maintain uniformity among all varieties as shown in Figure 3. 1 (Butt, Atif, Abbasi, & Chaudhari, 2014). The irrigation was done in experimental field with harvested rain water.

Figure 3. 1: Rosa hybrida varieties for experiment (a), watering through channels (b)

DATA COLLECTION FOR CHARCTERIZATION OF ROSA HYBRIDA VARIETIES

Morphological Characters

Morphological characters were examined for the selection of varieties for hybridization experiments in years, 2016-17. The detail of growth and morphological paramters is described below.

Plant height (cm)

All varieties were grown in open field. The plant height of all varieties with their three replications was taken on monthly basis by using meter rod. The data was recorded in excel sheets and their average was computed for statistical analysis.

Primary branches per plant

The number of primary branches for each variety in each replication was calculated manually on monthly basis and their average was computed for statistical analysis.

Number of prickles

The number of prickles in 10 cm length was calculated by using ordinary scale. Prickle number on main branches between 4 to 6 nodes was observed (Koning- Boucoiran et al., 2012).

Number of flowers per plant

The number of flowers were counted in three replications on monthly basis for each variety and their average was counted for statistical analysis.

Flower diameter per flower (cm)

Flower diameter (cm) was computed on monthly basis with three replications. The collected data average was further used in statistical analysis.

Number of petals per flower

The number of petals of each variety were counted in three replicates as shown in Figure 3.2 and their average was computed for statistical analysis.

Figure 3. 2: Petals of varieties Midas touch (Yellow) and Gruss an Teplitz (Red)

Flower persistency life

Flower persistency life was calculated from the flowering opening up to senescence of petals with three replications during the month of April (Van Doorin & Van Meeteren, 2003).

Physiological Response of Rosa Hybrida Varieties

The selected twenty-one Rosa hybrida varieties were analyzed for two years 2016-17 for their leaf gas exchange response for growth and flowering at developed stage. The research work related to leaf area of varieties was done by using LI-COR

32 leaf Area Meters (LI-3100 C) in laboratory of Department of Environmental Sciences, PMAS- Arid Agriculture University Rawalpindi. The physiological data was observed by using a CIRAS-2 portable photosynthesis system (manufactured by PPS systems) known as an infra-red gas analyzer (IRGA). The basic raw data was 2 1 estimated for leaf photosynthesis rate (Pn=μmol CO2 m- s- ), Transpiration rate 2 1 2 1 (E=mol H2O m- s- ), Stomatal conductance (gs= mol m- s- ) (Long & Bernacchi, 2003). Physiological activity was measurd for 3 plants in each treatment (each variety). The CIRAS-2 was set at photosynthetically active radion (PAR) level of 1000 µmol photons m-2s-1 for field performance.

Leaf area (cm2)

Twenty-one rose varieties well developed leaves were collected from experimental field. Leaves were selected randomly from different branches, during the spring growing season in years 2016-2017. Immediately after cutting, leaves were placed in plastic bags and transported on ice to the laboratory for data collection. The area of each leaf (LA) was measured using an area meter (LI-3100; LICOR, Lincoln, NE, USA).

Photosynthesis rate (Pn)

2 1 Photosynthetic rate (μmol CO2 m- s- ) was recorded from randomly selected green top leaf in three replications per plant during spring season.

Transpiration rate (E)

2 1 Transpiration rate (mol H2O m- s- ) was recorded from randomly selected green top leaf in three replications per plant during spring season.

Stomatal conductance (gs)

Stomatal conductance (mol m-2s-1) was recorded from randomly selected green top leaf in three replications per plant during spring season.

Experimental Design for Statistical Analysis

The experiment was laid out according to Randomized Complete Block Design selected plants of twenty-one rose varieties with three replications shown in Table

3.1. Data was analyzed by using standard ANOVA technique in statistics 8.1. The resulted mean values for each variety were differentiated by significance level of LSD = 0.05 (Steel & Torrie, 1986).

NUMBER OF ANTHERS, INVITRO POLLEN VIABILITY AND POLLEN GERMINATION STUDY OF ROSA HYBRIDA VARIETIES

Pollen viability and pollen germination study of selected Rosa hybrida varieties was done for pollen donor parent selection.

Preparation of Material for Pollen Testing

All selected varieties used in this study were evaluated to get potential pollen donor parents for hybridization programme. Pollen of each parent was evaluated before making the parental crosses scheme. The main purpose of the evaluation is to assess the pollen for their viability and germination capacity for further field trials. The desired flower buds were harvested in the morning for anther collection for this study. Anthers were kept in laboratory until pollen shedding starts. Each sample was mixed to homogenize. Anthers from each variety were collected in separate petri dishes and placed in laboratory. Five flowers from each variety were collected and labeled accordingly (Figure 3.3). In the laboratory, anthers were selected and collected in petri plates at room temperature (25 °C ± 2 °C) and left over for short time until the anther fully dehiscence occurred and then pollens were used for viability and germination capacity study (Figure 3.4). The purpose of this work is to evaluate all varieties as potential male parent for success of hybridization.

Figure 3. 3: Rosa hybrida varieties flower bud used in pollen study

Figure 3. 4: Preparation of germination media for pollen germination study

Pollen Viability Test

After the dehiscence of anther, pollens were placed at slides by dropping 2 % aceto-carmine stain solution (Marks, 1954; Vasil, 2009). This process was repeated in five replications for each variety. Then pollens were evaluated under electron microscope Swift 7000D. Viability was determined by differentiating stained and unstained pollens observed in each slide and their means were computed for statistical analysis.

Pollen Diameter (µm)

The pollen diameter of varieties (µm) was also measured by using micrometer adjusted under microscope Nikon SMZ 1500. The pollen grain developed a pollen tube equal to or greater than pollen diameter (Pipino, Leus, Scariot, Giovannini, & Van Labeke, 2009).

Germination Capacity of Pollens

Pollen study was performed in active growth season in month of April, 2016-17. The pollens of all varieties were collected from the flowers at developmental stage (Marchant, Power, Davey, Chartier-Hollis, & Lynch, 1992). The anthers of flowers were collected at flower reflex stage, when sepals open as shown in Figure 3.3 (Pearson & Harney, 1984). Three different germination media were used for pollen grain germination experiment. Three different levels of sucrose 10%, 15%, 20% and agar 2% for each treatment was used in germination media. The germination media were placed on the petri dishes and pollens were dusted on germination media. Three petri dishes per treatment were prepared. The pollen placed on germination media were kept in hatch at the temperature of 25 0C for 24 hours. The germinated pollens

35 were counted under microscope Nikon SMZ 1500. When the pollen grain developed a pollen tube equal to or greater than pollen diameter, then germination was recorded (Pipino, Leus, Scariot, Giovannini, & Van Labeke, 2009).

Experimental Design for Statistical Analysis

All collected data was entered in excel sheet with their replications and figures were assigned to their mean after statistical analysis. The collected data was analyzed by comparing their mean values using ANOVA technique by using Statistica software, 8.1. Significant differences were correlated by CRD design with LSD test at 5% probability level. (Steel & Torrie, 1986).

NEW CROSS COMBINATIONS FOR CONVENTIONAL BREEDING

The hybridization study was conducted at selective varieties evaluated on basis of morphological performance at University Research Farm Koont (URF), PMAS- Arid Agriculture University Rawalpindi. Conventional breeding approach was done among seed bearing parents and effective pollen parents to develop new hybrid lines (Abdolmohammadi, Kermani, Zakizadeh, & Hamidoghli, 2014). The seeds bearing parents included Midas touch, Bora bora and Gruss an Teplitz. The pollen donor parents included Eye paint, Fragrant plum, Elina, Anne Marie Trechslin, Bridal pink, Morstylo, Pat austin, Hot cocoa, Broceliande and Scentimental (Table 3.2).

Pollination Process

The crosses among seed bearing and pollen donor parents were performed by the conventional method (Emasculation process). The emasculation of seed bearing parents was done at evening time at full tight bud stage to avoid cross pollination (Chimonidou et al., 2007). In this process, only anthers of selected flower buds were removed by using sterile forceps with careful handling as shown in Figure 3.5 (Dhyani, Karthigeyan & Ahuja, 2004). First the petals were detached to get clear view of anther around the stigma. The anthers were collected from the male parents (Table 3.2) in petri dishes and labeled them accordingly and placed them to release the pollen. After this the remaining female part ‘stigma’ was covered with butter paper bag. The pollen shedding on stigma was done at morning time (8- 10 am).

Table 3. 2: Varieties with their cross combinations used in hybridization study Female parents Male parents Midas touch Bora bora Gruss an Teplitz (V6) (V14) (V21) Eye paint (V4) V6 x V4 V14 x V4 V21 x V4 Fragrant plum (V5) V6 x V5 V14 x V5 V21 x V5 Elina (V7) V6 x V7 V14 x V7 V21 x V7 Anne Marie Trechslin(V9) V6 x V9 V14 x V9 V21 x V9 Bridal pink (V12) V6 x V12 V14 x V12 V21 x V12 Morstylo (V13) V6 x V13 V14 x V13 V21 x V13 Pat austin (V15) V6 x V15 V14 x V15 V21 x V15 Hot cocoa (V17) V6 x V17 V14 x V17 V21 x V17 Broceliande (V19) V6 x V19 V14 x V19 V21 x V19 Scentimental (V20) V6 x V20 V14 x V20 V21 x V20

The successful pollination is achieved when pollen shedding is done at proper stigma receptivity stage. The pollens were shed on emasculated flowers with the help of brush very carefully and then covered. The proper tagging was done containing name of female parent, pollen parent and date of pollination. The process of pollination was repeated twice. The pollinated flowering plants were irrigated regularly. This proper procedure proved helpful for getting maximum hip set percentage, maximum number of seeds and weight of seed (Chimonidou et al., 2007). After successful pollination, the tagged flowers were visualized weekly to observe hip setting (El Mokadem, Crespel, Meynet, & Gudin, 2002).

Data Collection for Successful Cross Combinations

The following parameters data was recorded after the success of new cross combination.

Hip set percentage (%)

After the cross pollination, hip set percentage was observed as shown in Figure 3.5. Number of hips produced after successful crosses were observed until maturity. Total matured hips were counted for each cross combination and percentage was obtained by multiplying 100.

Days taken to maturity of hips (days)

Hips were regularly monitored upto maturity after successful hybridization. The

37 data was calculated regarding maturity of hips upto month of august. Days taken to hips mature were counted from the day of pollination up to harvesting. Their average was statistically analyzed.

Hip fresh weight (g)

Hip fresh weight was calculated just after harvesting of hips at maturity with the help of electric balance (Mayer & Poljakoff-Mayber, 1982).

Number of seeds per hip

Seeds from matured hips were extracted manually and total number of seeds per cross combination were counted in three repeats.

Seed dry weight (g)

Extracted seed weight (100 seeds) was taken in three repeats with the help of electric balance. 100 seed per repeats were weighted and their average was computed for statistical analysis.

Seeds length and width (mm)

Length and width of seed of each cross combination in three repeats was taken by using vernier caliper.

Experimental Design for Statistical Analysis

All the collected data regarding crosses of varieties was analyzed by performing analysis of variance and their means were computed for comparison test at 5 % probability (Steel & Torrie, 1986). Resulted means were correlated by Principle component analysis for their comparison test.

MITIGATION OF SEED DORMANCY IN NEW COMBINATIONS AMONG ROSA SPECIES

Different seed treatments wer applied for enhancement in germiantion.

Seed Germination Treatments

After successful hip harvesting at maturity, data was collected for seed setting.

The collected seeds were further processed for germination test in different treatments. The whole seeds after extraction was washed with autoclaved water to remove all sticky substance. Whole extracted seeds were kept at room temperature (24±2 0C). The four treatments were used for seed germination. First treatment (To) used as a control, in which seeds were kept at room temperature (24±2 0C). In second 0 treatment (T1), seeds were placed at room temperature (24±2 C) for 30 days and cold temperature (5±1 0C) for 60 days combined with the NaOCl @ 5 % w/v for 10 0 minutes. In third treatment (T2) cold stratification (5±1 C) combined with GA3 was given. In this treatment, the seeds were extracted from rose hips and rinsed with NaOCl @ 5 % w/v for 10 minutes and stratified for 90 days at (5±1 0C). 3.00 ml of ethanol (95% v/v) was used to dissolve the GA3 to make final solution. The seed were dipped in GA3 solution @ 1g per liter for 16 hours and then immediately sown in peat moss. In fourth treatment (T3), freshly harvested achenes were kept at dry Dstorage (24±2 0C) for 30 days and then stratified at (5 ±1 0C) for 60 days. After these, seeds were soaked in GA3 solution @ 1g per liter for 16 hours before sowing. After the seed treatments, all seeds were sown in mix peat moss media for germination in controlled condition with regular application of water.

Data Collection After Seed Germination

The seeds were treated with four treatments (one control and three different treatments) and then sown in peat moss germination media. For all treatment, growing media was same. Irrigation water was applied regulary according to requirement. Data was collected regularly until the germination almost ceased in all treatments. Germination of seedlings was determined by growth of cotyledon and hypocotyl (0.5 cm) above media (Nadeem et al., 2014).

Germination percentage

The germination percentage was determined as number of seeds germinated and total seeds sown for each cross combination in all treatments as shown in Figure 3.5.

Germination days

The days taken to germinate were counted for each treatment and seeds were

39 regularly observed from the day of sowing up to end of germination of seed in all treatments of each cross combination.

Figure 3. 5: Hybrid seed germination by different treatments in mix peat moss media

Growth performance of seedlings at the time of transplantation

When the seeds were germinated, the data was taken regarding morphological attributes at the time of transplantation. The overall observation was made regarding the seedling length, the appearance of root with length and number of leaves at transplantation stage in three replication per cross seedling as shown in Figure 3.6.

Figure 3. 6: Length of seedling, shoot length, root length and root shoot ratio

Experimental Design for Statistical Analysis

Collected data regarding morphologicaltraits and seed germination was analyzed by calculating variance by ANOVA technique and means were computed for significance at 5 % probability for all treatments (Steel & Torre, 1986).

MORPHOLOGICAL DATA OF PROGENIES IN FIELD

Germinated seedlings were transplanted in pots in peat moss growing media. These seedlings were placed in greenhouse for adaptability. The germinated

40 progenies from two parents have a chance of genetic variation due to success of conventional crossing. The resulted progenies were morphologically characterized and further analyzed for genetic variation in relevance to their parents. Most progenies of hybrid seedling were dead at initial stage of their growth after transplantation. All the remaining progenies were compared with each other and with their parents with reference to following parameters.

Number of Petals per Flower

After the growth of plants during the spring season, developed progenies were evaluated for their flower petal numbers as some plants give flowering. The number of petals were counted when the flower was at full bloom.

Flower Diameter (cm)

The flowers diameter of progenies was calculated by using vernier caliper. Flower diameter of each flowering progeny plant was taken at the time of full bloom.

Height of Progeny Plant (cm)

Height of progeny plant (cm) was observed from the main stem base up to the tip of top leaf. The height was taken from the base of plant (rim of pot) to the end of apical bud (Gitonga et al., 2014).

Number of Prickles

The number of prickles in 10 cm length was calculated by using ordinary scale. The prickle presence on the main stem calculated by meter rod with in the length between 4 to 6 nodes on main stem (Koning- Boucoiran et al., 2012).

Flower Persistency Life (days)

The flower of progenies seems to be delicate at early stage of plant growth. The days were counted from tight bud up-to deterioration of petals for each flower.

Experimental Design for Statistical Analysis

The successful grown progenies data was collected and analyzed for their

41 variance to check the significant difference by using LSD test (0.05 probability level). The analyzed data was further used for cluster analysis to observe the difference among progenies (Steel & Torre, 1986).

DETERMINATION OF GENETIC VARIABILITY AMONG DEVELOPED HYBRIDS AND THEIR PARENTS

The developed progeny plants obtained from new combinations were analyzed for their genetic diversity. The research work related to genetic variability by using molecular markers was performed in Plant Tissue Culture Laboratory, Department of Horticulture, PMAS Arid Agriculture University Rawalpindi. The procedure is described below in detail.

Collection of Leaf Samples

Young fresh leaves of selected progenies and parents were collected during active growth period (Table 3.4). The collected leaves just after harvesting were stored at -70 °C until DNA extraction and further analysis. DNA extraction of samples was carried out by using modified CTAB (Cationic-hexadecyl Trimethyl Ammonium Bromide) procedure (Doyle & Doyle, 1990). The extraction of DNA was done to analyze the basic genetic variability among all developed progenies and their parents. After extraction of DNA, RNAase procedure was done to purify the samples to remove all precipitations.

DNA Extraction Protocol

Collected leaf sample stored at -70 0C were used for DNA analysis. Leaf sample (200 mg) was washed, dried, then grinded by using a pestle and mortar in liquid nitrogen. Powder was poured in extraction buffer by using modified CTAB method (Xu, Wen & Deng, 2004). CTAB (2%) with B-mercaptoethanol (0.5%) added in sample just before use. Samples were shaken for 10 seconds and incubated in water bath for 40 minutes at 60 0C. Samples were agitated after every 5 minutes. After this samples were placed on bench to cool down. Then suspension buffer containing, Chloroform: isoamyl alcohol (24:1) mixture were added in eppendorf tube and inverted gently for 10 seconds. The samples were spin at 13000 rpm for 10 min in

42 lab condition (room temperature) to resuspend the samples to get pure DNA threads in upper layer. DNA was collected in new eppendorf tubes (300 μl). A 500 μl of chilled isopropanol was added to precipitate the DNA. The tubes were inverted several times and left on ice for 10 minutes. The samples were spin at 13000 rpm for 10 min to get pure pellet of desired DNA. Care was taken during pellet separation and washing of pellet was done by using 500 μl of 70 % ethanol. The samples were centrifuged to collect the pellet at base of eppendorf tubes. Then ethanol was dropped down and resulted DNA pellet was dried for 20 minutes on the bench with lid open. DNA was further dissolved in 100 μl ddH2O and stored for further use at -20 0C.

DNA Quantification

DNA quantification was done at UV-Vis Spectrophotometer Q 5000 (Quawell) by adding 2 μl DNA sample at tip. All DNA samples were analyzed to confirm DNA concentration. Working Stock DNA was prepared by diluting nuclease free water. The remaining DNA samples were stored for further use.

Microsatellite Molecular Markers for Genetic Diversity Analysis

For the confirmation and identification of F1 population of crosses obtained from Rosa hybrida parents, Simple sequence Repeats (SSR) markers (Table 3.3) were used to assess the genetic difference among parents and F1 progenies (Biber et al., 2010). After extraction of DNA of 43 established genotypes including 9 parents (only successful cross combinations) and 34 hybrids were screened for their genetic variation with SSR markers (Zhang, Byrne, Ballard, & Rajapakse, 2006; EI-Assal, El-Awady, El-Tarras, & Shehab, 2014). Each 20 μl PCR mixture contained 10 μl 2XTaq Master Mix (containing dye), 1 μl 40 ng/μl DNA template, 1.0 μl primer

(forward and reverse) and 4 μl ddH2O. To protect evaporation during PCR reaction, one drop of mineral oil was added in the PCR tube to cover the reactants. Three thermal profiles for optimization of PCR were evaluated but thermal profile 94 oC for 3 min, followed by 35 cycles of 94 oC for 30 s, 54 oC for 40 s and 72 oC for 1 minute and a final extension at 72oC for 4 min was applied during whole procedure for all samples. PCR amplification was conducted in 0.2 ml 12-strip tubes by using Mycycler Themal Cycler (BIO-RAD, USA).

Table 3. 3: List of microsatellite markers (SSR) used in genetic diversity among Rosa hybrida population and parents

S. Locus Primer Sequence 5’-3’ New Reference No. Name Name RA003a F:CAGAATTGGGTGTCCGTATG Kimura, Nishitani, Iketani, Ban, & Yamamoto, 1 RA0023 AB231934 R:CAATTTTCAAAGGATAATTTGG 2006 RA023b F:CATCCTCGGTGTTGCGTTGA Kimura, Nishitani, Iketani, Ban, & Yamamoto, 2 RA0221 AB211284 R:TGTCTCCAGCAACCTTTTTTTCCC 2006 RA032b F:CGGCATCAAAGATATAGCTTCC Kimura, Nishitani, Iketani, Ban, & Yamamoto, 3 RA0321 AB211286 R:AGAAATGCAAAACGCCCCTATGA 2006 RA043a F:GCAACGTACTTCAATTTCCAC Kimura, Nishitani, Iketani, Ban, & Yamamoto, 4 RA0421 AB211290 R:CAAGCTCAGAACTGAGACAC 2006 F:CAATTCAAAACCACCGCTCT 5 H10D03 HD13 Biber et al., 2010 R:CGCAGAGTCAACGAACCATA F:TAATGTAGGCAGATATAAAGGAGT 6 RMS015 RMS15 Oyant, Crespel, Zhang, & Foucher, 2008 R:GCAGCTGCACAACAAGGAA F:CTCAACTTCCCCGCCTTATC 7 Rw54N22 RWN22 Oyant, Crespel, Zhang, & Foucher, 2008 R:CTCGGCAGCTCCACTATCTC F:GGAAGGTGCGTATGCAAAAT 8 Rw59A12 RWA12 Oyant, Crespel, Zhang, & Foucher, 2008 R:GAGAGGCTCATGCGCTTTAT F:GCGAGTTGACGACGAGTT 9 Rw10J19 RWJ19 Zhang, Byrne, Ballard, & Rajapakse, 2006 R: GGGTGGGCTTCCTTAGTTA F: ATGGGAGACAGAGGTGTAAG 10 Rw4E22 R: TCCTAACTCTCGGTGGAGAT RWE22 Zhang, Byrne, Ballard, & Rajapakse, 2006

The PCR product was separated by capillary electrophoresis on QIAxcel DNA Analyzer (QIAGEN, USA) using a 25-bp DNA step ladder to allow consistent allele size for all loci and samples tested. The primers with less allele numbers (<=4) were used in this study. There are multiple amplicons for most of loci as roses have varying level of polyploidy ranges from 2x to 8x (Canli & Kazaz, 2009).

Electrophoresis and Analysis of Ampliﬁed Samples

The PCR samples were size-fractionated by electrophoresis on 2% agarose gel at 80 V for 40 minutes. DNA was loaded in soaking agarose gel in an ethidium bromide solution and examined under UV light to observe the resulting amplified products.

Experimental Design for Data Analysis

PCR reactions were repeated three times and only reproducible bands were scored. A data set was created from the collected SSR data in Microsoft Excel with the Alleles as the rows and accessions as the columns, by using “1” for presence of allele and “0” for absence. Similarity coefficients and clustering analysis UPGMA was done to constrct dendrogram (Saitou & Nei, 1987; Khan, Hafiz, Abbasi, & Shah, 2020).

Table 3. 4: Thirty-four hybrid population and ten parent plant DNA extraction Assig. No. Variety name Hybrid no Parentage Hybrid no Parentage V4 Eye paint H101 v21 x v5 H118 v21 x v5 V5 Fragrant plum H102 v14 x v9 H119 v21 x v9 V6 Midas touch H103 v21 x v12 H120 v21 x v9 V7 Elina H104 v14 x v9 H121 v21 x v5 V9 Anne Marie Trechslin H105 v6 x v12 H122 v21 x v12 V12 Bridal pink H106 v21 x v12 H123 v14 x v9 V13 Morstylo H107 v6 x v5 H124 v21 x v9 V14 Bora bora H108 v21 x v4 H125 v21 x v4 V15 Pat austin H109 v21 x v5 H126 v21 x v5 V21 Gruss an Teplitz H110 v6 x v15 H127 v14 x v5 H111 v21 x v12 H128 v21 x v5 H112 v21 x v7 H129 v21 x v9 H113 v21 x v7 H130 v21 x v4 H114 v21 x v4 H131 v6 x v7 H115 v6 x v15 H132 v21 x v5 H116 v21 xv12 H133 v21 x v12 H117 v6 x v5 H134 v6 x v5

RESULTS AND DISCUSSION

This chapter includes the description of results obtained after the statistical analysis of data of selected rose (Rosa hybrida) varieties. All the varieties were analyzed on morphological, physiological and genetic basis. All the results are described with discussion in detail.

MORPHOLOGICAL EVALUATION OF ROSA HYBRIDA VARIETIES

The research work related to morphological characteristics of roses (Rosa spp.) was conducted for the selection of varieties to initiate conventional breeding.

Plant Height (cm)

The plant height of rose varieties was observed on monthly basis for two years 2016-2017. The adaptability of varieties varies according to new growing condition. Data analysis showed that maximum plant height (109.58 cm) was observed in month of December 2017 as shown in Figure 4.1. The height of plants varied among varieties with respect to month in both years. The significant per plant height (91.15 cm) was observed in variety Midas touch (V6) closely followed by height (89.87 cm) of variety Fragrant plum (V5) as shown in Figure 4.2. The lowest per plant height (75.24 cm) was found in variety First prize (V11). Overall, varieties Gruss an Teplitz (V21), Helen naude (V2), Anne Marie Trechslin (V9) and Doreen johnson (V1) remained at par with each other in plant height (84.42 cm, 84.42 cm, 84.33 cm and 84.25 cm respectively). The growth performance of varieties, First prize (V11), Candy stripe (V18) and Jude-the-obscure (V8) in respect to plant height and related parameters was not satisfactory in the Pothwar condition as shown in Table 4.2. Similar kind of variation in plant height was reported in earlier studies (Hussain & Khan, 2004; Ramzan, Hanif & Tariq, 2014). The cultivars with maximum plant height resulted longer flower stalk length (Shafique, Maqbool, Nawaz, & Ahmed, 2011). Resulted variations among cultivars depends upon genetically associated factors, environmental consensus, varying management level and cultural practices. Environmental factors and light intensity (irradiance) physiologically control

46 flowering attributes (Zieslin, 1992).

Plant Height 120

100

40 Plant height cm 20

Jan Aug Feb Mar Apri May June July Sept Oct Nov Dec

2016 2017

Figure 4. 1: Average plant height (cm) from January to December months in years 2016-2017

Plant Height 100 90 80 70 60 50 40

Length(cm) 30 20 10 0

Varieties Figure 4. 2: Average plant height (cm) for all varieties in years 2016-2017

Both vegetative and reproductive growth is dependant on environmenta factors, amount and quantity of an area. In current findings, the variation in plant height of several varieties could be the response of all factors as each variety has its own requirement. Our results also correlate with the findings of Khan, Shaukat, Shahzad, Ahmed (2011) in which number of flowers, size of flowers, number of petals per

47 flower and height of plant increases with the effluent amount of treated water instead of fresh water. The observed variation regarding plant height fall in between the observations collected by Tabassum, Ghaffoor, Waseem, & Nadeem, (2002). According to the results, the hybrid roses performance regarding plant height vary in-between 87.1 cm to 139 cm length in the open climate of Pakistan. Their production may be affected by genetic factors regarding each variety and overall their management during growth season as described by Bernier, Havelange, Houssa, Petitjean, & Lejeune (1993). Their study findings depicted that the agroclimatic factors such as sunlight availability, growing locality, temperature, humidity, water application mainly influences rose crop growth and transition of vegetative growth into reproductive growth of plants.

Number of Primary Branches per Plant

The primary branches per plant for each variety with their replication were calculated manually on monthly basis. The results of analysis regarding number of primary branches per plant indicated that varieties showed significant difference among each other. The interaction effect of month and year varied significantly. The maximum number of primary branches per plant (14.86) were observed in December 2016 as shown in Figure 4.3. The variety Gruss an Teplitz (V21) possessed maximum number of primary branches (14.82) closely followed by the varieties Bora bora (V14) and Anne Marie Trechslin (V9) as shown in Figure 4.4. The minimum number of primary branches (9.98) were observed in variety First prize (V11).

The growth of the pruned plant started in first week of February in Pothwar climate. Vegetative growth remained active up to month of May until temperature remained below 32 oC. But the growth and flowering was influenced by the increase in temperature in the month of May as shown in Figure 4.4. Our findings also correlate with the findings of Bhattacharjee, Singh & Saxena (1993), as they found significant number of stems in hybrid tea rose Cv. Eiffel Tower. The initiation of growth in each genotype varied as genetic behvaiour also differs. At the early stage of growth, only vegetative sprouts appeared which ultimately resulted in flowering during the spring season. The rose genotype produced primary shoots first time

48 during 6–8 weeks after prunning as it correlates with the findings of Shubin et al. (2015). Qasim, Ahmad, & Ahmad (2008) reported that the cultivar Anjeleeq was with plant height (65.16 cm) and number of branches per plant (6.55) as compared to Amalia.

Number of Primary Branches 18 16 14 12 10 8

6 No branchesof 4 2 0

2016 2017

Figure 4. 3: Average number of primary branches of varieties from January to December in years 2016-2017

Number of Primary Branches

18 16 14 12 10 8 6 4 2

Number Number branches/Plantof 0

Varieties Figure 4. 4: Average number of primary branches per plant in each variety

Number of Flowers per Plant

The results for number of flowers of collected data on monthly basis for each

49 variety varied significantly. The interaction effect of number of flowers with respect to month and year varied significantly. The maximum average number of flowers (29.06) were obtained in the month of April 2017 as shown in Figure 4.5. The maximum number of flowers (12.37) were obtained by variety Angel Face (V16) closely followed by the varieties Bora bora (V14) and Gruss an Teplitz (V21) as shown in Figure 4.6. The minimum number of flowers (5.58) were obtained by variety Candy stripe (V18). Semeniuk (1971) study proposed that blooming is controlled genetically by a single recessive gene to differentiate into recurrent blooming and perpetual blooming. The variation in number of flowers per plant is related to recurrent blooming habit due to their genetic makeup (Ramzan, Hanif & Tariq, 2014). Our findings corelates with the findings of Khattak, Munir, & Baloch (1995), as in the month of July, flower number decreased. Highest number of flowers were appeared in months of April as compared to June and July. Production of flowers may vary in late autumn or early spring depending upon favorable temperature (Devries & Dubois, 1983). Productivity might be attributed to increase in plant height, leaves and leaf area. Higher the leaf area, more the photosynthetic rate results in excessive dry matter accumulation (significant number of flowers per plant). As these finding may corelate with the findings of Mantur, Bagali, Patil (2005) regarding number of flowers per plant. The favorable growing environment and climatic factors have also contributed for the maximum yield potential in high yielding varieties (Praneetha, Jawaharlal & Vijayakumar, 2002; Sindhu & Kumar, 2004; Talia, Cristiano & Forleo, 2003).

Flower Diameter (cm)

The flower diameter (cm) was computed on monthly basis showed non- significant variation throughout the flowering season. On statistical analysis of collected data, interaction effect of flower diameter (cm) of varieties varied significantly in respect to year. Interaction effect of flower diameter in comparison to month varied non-significantly as shown in Figure 4.7. The maximum flower diameter (7.59 cm) was observed in month of April. Statistical analysis of the collected data showed that comparison of flower diameter in respect to varieties varied significantly among each other as shown in Table 4.1. The significant flower

50 diameter (7.97 cm) was observed in Midas touch (V6) variety followed by Anne Marie Trechslin (V9) and Bora bora (V14) varieties with the values of 7.95 cm and 7.91 cm, respectively. The lowest diameter (4.72 cm) per flower was observed in variety Gruss an Teplitz (V21). The flower diameter of varieties Mr Waqar (V3), Broceliande (V19) and Hot cocoa (V17) was statistically at par with each other (6.24 cm, 6.18 cm and 6.17 cm) as shown in Figure 4.8. The variation in diameter per flower may correlate with the findings Akhtar et al. (2016). The flower diameter may vary in each cultivar depending on agroclimatic condition provided for growth. The data was graphically represented in Figure 4.8.

Number of Petals per Flower

Data regarding number of flower petals for each variety varied significantly. The maximum number of petals (48.40) per flower were observed in variety Pat austin (V15) (Table 4.1). The number of petals in varieties Angel face (V16) and Hot cocoa (V17) were same (25.74) as shown in Figure 4.9. The minimum number of petals (16.90) were observed in variety Fragrant plum (V5) closely followed by the number of petals (17.24) in variety Eye paint (V4).

Number of Flowers per Month 35

15 No flowersof 10

2016 2017

Figure 4. 5: Average number of flowers in different months for years 2016-2017

Number of Flowers per Plant

Number Number flowersof 4

Varieties

Figure 4. 6: Average number of flower per plant in each variety for years, 2016-2017

Flower Diameter per Month 8 7 6 5 4

3 Diamter Diamter cm 2 1 0

2016 2017

Figure 4. 7: Average flower diameter (cm) in different months for years 2016-2017

Flower Diameter

9 8 7 6 5 4

3 Diameter Diameter (cm) 2 1 0

Varieties Figure 4. 8: Average flower diameter of each variety of Rosa hybrida

The similar kind of observation were observed in the study of Rauf, Khan & Khan (2006). The increased number of petals/flower can also be attributed to the availability of high organic matter percentage, which ultimately improve structure and availability of nutrients (Bruun, 2005). Number of petals may be associated with recessive gene (secondary-effect gene) (Oyant, Crespel, Zhang, & Foucher, 2008; Morey, 1959). This may be due to genetic or environmental factors. The number of petals also varies with respect to variety and specie (Chmelnitsky, Colauzzi, Algom, & Zieslin, 2001; Garrod & Harris, 1974).

These results also correlate with Zieslin (1992), as number of petals may increase at low temperature (stamen number decreases) forming bullhead attractive rose flower. The increase in number of petals especially occuring from stamen may involve complex mechanism. The formation of double petal whorl by stamens or flower organ associated with the balance between AP2 and AG (Wollmann, Mica, Todesco, Long, & Weigel, 2010). The findings in our study may correlate with the Bhattacharjee, Singh & Saxena (1993) in which they observed significant number of petals (47.80) in Singh of Nalagarh. Tabassum, Ghaffoor, Waseem, & Nadeem (2002) also conducted an experiment for economic analysis of varieties of hybrid

53 roses and found similar kind of variation in number of petals per flower. The significant variations in number of petals per flower were also depicted by Zlesak (2007a) who argued that number of petals in case of double flower also seems to be positively correlated with flower initiation in spring season. The number of flowers significantly depends on primary branches. It may produce cluster or solitary flowers that are mainly dependent on flower initiation period during early or late spring blooms. Variation in bloom (number of petals per flower) may be controlled by genetic factors which is due to presence of dominant gene regarding number of petals (Nadeem, Khan, Riaz, & Ahmad, 2011; Ramzan, Hanif & Tariq, 2014).

Number of Petals Per Flower 60 50 40 30 20

Number Number petalsof 10 0

Varieties

Figure 4. 9: Average number of petals per flower for each variety grown in pothwar climate

Petal Length of Flowers

The data analysis regarding length of petals (mm) among each variety vary significantly as shown in Figure 4.10. The length of petals among varieties varies between 34.43 mm to 56.12 mm. The distinguish petal length (56.12 mm) was observed in variety First prize (V11) closely followed (54.46 mm) by Midas touch (V6) as shown in Figure 4.10. The petal length in varieties Pat austin (V15), Anne Marie Trechslin (V9), Magic lantern (V10), Bridal pink (V12) were at par with each other with the petal length ranging from 45.15 mm to 44.30 mm. The middle position regarding petal length was observed in varieties Broceliande (V19), Fragrant plum

(V5), Bora bora (V14), Gruss an Teplitz (V21) with the ranging values 43.74 mm to 41.76 mm.

Petal Length of Flower

70 60 50 40 30

Length (mm) Length(mm) 20 10 0

Varieties

Figure 4. 10: Description of average petal length of Rosa hybrida varieties

Number of Prickles on Stem

Highly significant difference in number of prickles per 10 cm area among varieties was observed as shown in Figure 4.11. The data showed that maximum number of prickles (47.83) were found in variety Hot cocoa (V17) and minimum number of prickles (6.72) were found in variety Gruss an Teplitz (V21). Presence of prickles considered as dominant trait resulted from monogenic mode of inheritance (Shupert, Bryne & Brent Pemberton, 2005).

Flower Persistence Life

Flower persistence life was calculated from the flower bud opening to senescence of petals with three replications during the month of April. The statistical analysis of data showed that flower persistence life in the field varied significantly among all varieties as shown in Figure 4.12. The significant difference in flower field persistence life (13.50 days) was found in variety Elina (V7). The minimum flower persistence life (6.16 days) was observed in variety in Candy stripe (V18).

Prickles per 10 cm Area

20 Number Number prickles of 10

Varieties

Figure 4. 11: Average number of prickles present in-between 4-6 node at main stem

The cut flowers with tight bud open slowly and uniformly have appealing effect due to their longer vase life and fresh appearance. These variations could be because of varietal characters or may be dependant upon time taken from bud initiation to full bloom stage in rose (Bhattacharjee, Singh & Saxena, 1993). Our findings were in-between the observation of Tabassum, Ghafoor, Waseem, & Nadeem (2002), as their study findings regarding flower persistence of hybrid tea roses in field was significantly 17.17 days. The variation in flower persistence, acceleration of flower senescence is controlled by gene as reported earlier (Buanong, Mibus, Sisler, & Serek, 2005; Muller, Stummann & Andersen, 2001). It relates with the chlorophyll deterioration and accumulation of coloring substance in genotype (Cuquel, Drefahl & Dronk, 2007; Mibus, Buanong, Sisler, & Serek, 2007; Serek, 1993). Results of data also confirmed that ethylene is the major precursor of senescence as it enhances color substance leads to yellowing of petals (Ahmadi, Mibus & Serek, 2015).

Correlation Among Morphological Character

The correlation among examined traits was described by cluster analysis among all varieties as shown in Figure 4.13. In this dendrogram, the varieties were analyzed

56 by using Euclidean distance test expressed in cluster analysis. In first cluster, V17, V9, V4 and V11 varieties were correlated with each in studied morphological characters. The cluster two comprises of V13 and V7. The cluster three comprises of V6 and V5. The cluster four comprises of V21 x V16. The cluster five comprises of V20, V19, V14. The cluster six comprises of V3, V1, V12, V2, V10, V18 and V8. The variety V15 performance was different from all other studied varieties and form cluster 6. Morphological diversity was analyzed by using principal components analysis (PCA) and with the Eigenvalue value 133.44 and % variance was 64.74. The principal components analysis of varieties showing the correlation of each studied parameter with each other. However, all traits differ in each genotype and no similar correlation was observed.

Flower Persistance Life

16 14 12 10 8 Days 6 4 2 0

Varieties

Figure 4. 12: Average flower persistance life of Rosa hybrida varieties grown in pothwar climate for the years 2016-2017

Discussion on Morphological Attributes

Morphological description of all varieties in growth period of each month showed variation in growth. The variation in height of plants may be due to mitosis as observed earlier in R. Roxburghii and R. Multiflora (Feng, Wang, Cong, & Dai, 2017). These findings also corelate with the Podwyszynska et al. (2015), as variation may also occur in Daylilies due to mitosis as promote mutation in chromosomal

57 gene. This variation in each cultivar may be attributed in genetic makeup (Ramzan, Hanif & Tariq, 2014). Hybrid roses difference may be attributed to inherit character and ployploidy. The favourable growing environment and climatic factors have also contributed for expressing their maximum yield potential in high yielding varieties (Gowthami, Nageswararao, Umajyothi, & Umakrishna, 2017; Praneetha, Jawaharlal & Vijayakumar, 2002; Talia, Cristiano & Forleo, 2003). Studies on adaptability of cut flower roses also performed earlier (Khattak, Munir & Baloch, 1995). Performance of genotypes for commercialy important traits such as number of flowers was also evaluated by Ramzan, Hanif & Tariq (2014). Variation in height per plant and primary branches per plant may be due to climatic fluctuation, genetic and nutritional aspects (Bernier, Havelange, Houssa, Petitjean, & Lejeune, 1993). Photoperiodism may also have role in plants stature and production (Zieslin & Mor, 1990). Light intensity may also involve from bud break to flowering (Bredmose, 1993; Carpenter & Anderson, 1972; Moe & Kristoffersen, 1968; Zieslin & Mor, 1990). In our results, increase in height per plant and initiation of growth regarding primary branches initiated in February and shifting in vegetative phase in April were according to Bhattacharjee, Singh & Saxena (1993), as they found significant flower diameter just after initiation of growth in spring. Flower initiation in early can be in more cluster then later blooming (Zlesak, Zuzek & Hokanson, 2007). Reproductive physiology in term of flower production and size of flowers revealed variations (Zhang et al., 2013). The maximum number of flowers ranged in cultivars 22.0 to 10.0 in month of April and decreased in other months due to increase in temperature and decrease in humidity (Anderson, Serek & Johnson, 1992). Increase in number of flowers per variety may attribute to photoperiod (Pettersen, Mortensen, Moe & Gislerod, 2006). This may be due to stimulation or triggering effect of growth hormones involved in the process of photosynthesis (Halevy, 1985). Growth can also be influenced by nutrients level and water application (Vandersart & Devisser, 2004). Pruning practices can also influence number of flowers as time and pruning percentage remarkably alter plant growth (Adhikari, Baral, Gautam, & Pun, 2014). Fragrant hybrid tea roses can produce maximum flower (58.8) with significant flower diameter of 9.3 cm (Mulla, Patil, Singh, & Bhujbal, 1994; Singh, Patil, Patil, & Bhujabal, 1994).

Table 4. 1: Morphological foliage characters of varieties grown in Pothwar climate Varieties Flower color Inflorescence Leaf Fragrance type hairiness Doreen johnson (V1) White Solitary Serrated Mild fragrance Helen naude (V2) Half white Solitary Serrated Slight fragrance Mr waqar (V3) Light pink Cluster Serrated Fragrance Eye paint (V4) Red blend, white centered Solitary Serrated Mild fragrance Fragrant plum (V5) Mauve, purple blend Solitary Serrated Strong fruity fragrance Midas touch (V6) Deep yellow Cluster Serrated Strong fragrance Elina (V7) Light yellow Solitary Serrated Slight fragrance Jude-the-obscure (V8) Medium yellow Solitary Serrated Strong fragrance Anne Marie Trechslin (V9) Deep orange pink Solitary Unserrated Slight fragrance Magic lantern (V10) Orange gold, apricot blend Solitary Serrated Strong fragrance First prize (V11) Pink Solitary Unserrated Moderate fragrance Bridal pink (V12) Medium pink Solitary Serrated Strong fragrance Morstylo (V13) Red and white with yellowish base Cluster Unserrated Slight fragrance Bora bora (V14) Orange Solitary Unserrated Mild fruity fragrance Pat austin (V15) Orange with yellow base Cluster Unserrated Sharp fruity fragrance Angel face (V16) Deep mauve, purple blend Solitary Unserrated Strong fragrance Hot cocoa (V17) Smokey chocolate-orange Cluster Serrated Fruity fragrance Candy stripe (V18) Pink blend, blush white Cluster Unserrated Strong fragrance Broceliande (V19) Red and white blend Solitary Serrated Strong fragrance Scentimental (V20) Burgundy red striped and cream white Cluster Serrated Sweet fragrance Gruss an Teplitz (V21) Crimson red Cluster Serrated Fragrance

Table 4. 2: Growth parameters of Rosa hybrida varieties during the years 2016-2017 in Pothwar climate

Varieties Plant Primary No. of Flower No. of petals Prickles Flower height (cm) branches flowers diameter(cm) persistence life Doreen Johnson 84.25±1.3fg 11.65±0.5h 7.27±0.8ij 7.65±0.2cd 28.40±0.6e-h 15.50±0.5 h 8.16±0.3hij Helen naude 84.42±1.6fg 11.21±0.5hij 8.62±1.2fgh 7.67±0.5cd 26.20±0.2fgh 13.94±0.4ijk 9.16±0.3fg Mr waqar 84.65±1.3f 11.07±1.04ij 6.89±1.1j 6.24±0.2h 25.96±0.2fgh 21.33±0.4f 9.16±0.3fg Eye paint 89.08±0.9bc 12.32±0.5fg 9.43±0.8def 5.77±0.5j 17.24±0.2i 40.50±1.2b 8.83±0.5fgh Fragrant plum 89.87±1.3ab 11.56±0.5h 8.04±0.8g-j 7.74±0.5abc 16.90±0.1i 11.33±0.5m 8.83±0.5fgh Midas touch 91.15±1.3a 13.36±0.6c 10.33±0.7cde 7.97±0.5a 19.57±0.1i 11.05±0.1m 9.50±0.6ef Elina 80.06±1.0i 11.57±0.6h 10.47±1.5cd 7.73±0.4bc 36.85±0.1b 21.00±0.5f 13.50±0.3a Jude-the-obscure 79.91±0.7i 10.79±0.6jk 8.97±0.5fg 6.08±0.4hi 29.87±0.1def 18.05±0.2g 7.83±0.5ij Anne Marie Trechslin 84.33±2.8fg 14.41±0.4ab 10.83±0.7bc 7.95±0.3ab 24.25±0.1h 33.44±0.2c 12.16±0.3b Magic lantern 85.22±1.9ef 10.21±0.7lm 8.06±1.3g-j 7.35±0.3ef 29.51±0.3d-g 10.33±0.4m 7.33±0.2j First prize 75.24±2.5j 9.98±0.6m 7.12±0.6ij 7.18±0.5f 18.11±0.1i 29.11±1.0d 10.1±0.3de Bridal pink 84.94±3.5ef 13.11±0.5cd 8.70±1.2fgh 7.27±0.3ef 24.98±0.0gh 14.50±0.9hij 8.50±0.3ghi Morstylo 85.16±1.3ef 12.74±0.3def 9.54±1.3def 5.90±0.3ij 35.55±0.2bc 26.11± 0.9e 8.83±0.5fgh Bora bora 87.81±1.9cd 14.61±0.4ab 12.31±1.1a 7.91±0.3ab 34.53±0.3bc 8.00±0.4n 10.8±0.5cd Pat austin 83.8±1.8fgh 12.17±0.4g 9.14±0.8efg 6.18±0.3h 48.40±0.2a 12.83±0.3kl 7.50±0.3j Angel face 86.73±1.1de 14.34±0.6b 12.37±1.59a 5.43±0.4k 25.57±0.2fgh 8.38±0.1n 10.1±0.8de Hot cocoa 82.30±2.1 h 13.0±0.3cde 8.14±0.7g-j 6.17±0.3h 25.57±0.1fgh 47.83±0.6a 9.16±0.3fg Candy stripe 79.33±1.1i 10.45±0.3kl 5.58±1.2k 7.46±0.4de 31.4±0.4cde 14.94±0.4hi 6.16±0.3k Broceliande 87.36±1.3cd 12.65±0.5ef 7.66±0.5hij 6.60±0.3g 34.77±0.3bc 12.66±0.4l 11.5±0.3bc Scentimental 82.77±1.2gh 11.33±0.5hi 8.31±0.7f-i 5.35±0.2k 33.2±0.6bcd 13.38±0.3jkl 10.1±0.3de Gruss an Teplitz 84.42±1.0fg 14.82±0.5a 11.89±1.9ab 4.72±0.2 l 28.55±0.2e-h 6.72±0.5o 8.50±0.3ghi

Figure 4. 13: Cluster analysis of Rosa hybrida parent varieties used for conventional breeding

Table 4. 3: Correlation study among examined morphological traits by principal component analysis

Varieties traits PC 1 PC 2 PC 3 PC 4 PC 5 PC 6 PC 7 Plant height -0.069 -0.229 0.880 -0.369 0.148 -0.071 -0.073 Vegetative bud -0.010 -0.014 0.286 0.356 -0.337 0.233 0.789 No of flower -0.032 -0.013 0.282 0.611 -0.389 0.187 -0.600 Flower size -0.003 -0.030 -0.024 -0.011 0.466 0.883 -0.048 No of petals -0.311 0.929 0.181 -0.075 0.033 0.017 -0.010 Prickles 0.947 0.288 0.133 -0.041 -0.009 0.020 -0.023 Flower persistence 0.021 0.015 0.117 0.597 0.703 -0.355 0.094

Table 4. 4: Correlation among examined morphological characters

Varieties traits Plant height Vegetative bud No of flower Flower size No of petals Prickles Flower persistence Plant height 1.00 Vegetative bud 0.51035 1.00 No of flower 0.37566 0.80496 1.00 Flower size 0.056952 -0.17736 -0.17142 1.00 No of petals -0.20321 0.023507 0.08312 -0.17319 1.00 Prickles -0.24785 -0.059919 -0.18467 -0.07941 -0.29686 1.00 Flower persistence 0.032281 0.3446 0.44043 0.18957 -0.0025169 0.15643 1.00

Figure 4. 14: Distinguished Characters of Rosa hybrida varieties (V1 to V8) utilized in breeding programme

Figure 4. 15: Distinguished Characters of Rosa hybrida varieties (V9 to V16) utilized in breeding program

Figure 4. 16: Distinguished Characters of Rosa hybrida varieties (V17 to V21) utilized in breeding programme

Morphological parameters were strongly correlated with start of vegetative growth up to flowering and yield. The maximum marketable number of flowers (4.00) were produced in First prize (Gowda, Sulladmath & Elengovan, 1979). Variation in number of flowers in roses was also found earlier (Khattak, Munir & Baloch, 1995; Tabassum, Ghafoor, Waseem, & Nadeem, 2002). The flower size may range from 4.8 cm to 6.7 cm depending on genotype (Kaul et al., 2009). The number

65 of stamens may positively correlate with number of petals (Tabaei-aghdaei, Sahebi, Jafari, & Rezaee, 2004). Variation in number of petals may be due to dominance gene or conversion of pistil (petal) and stamen (petaloid) or may be due to rootstock effect (Morey, 1959). Senescence or discoloration leads to petal falling is related to gene of senescence due to ethylene sensitivity at developed flowers which leads to abscisic acid (ABA) and calcium accumulation (Adhikari, Baral, Gautam, & Pun, 2014). Accumulation of ethylene varies from specie to specie and among varieties (Van Doorn & Kamdee, 2014). Relative humidity, temperature, light, physiological activities are also claimed to be the cause of senescence (Adhikari, Baral, Gautam, & Pun, 2014; Dela, Ovadia, Nissim-Levi, Weiss, & Oren-Shamir, 2003; Plaut, Zieslin, Grawa, & Gazit, 1979). This can be minimized by controlling temperature in low light which control enzymatic biosynthesis (Gonzalez, 2009).

Number of prickles also involved in quality of cut flower are controlled by single recessive gene (Debener, 1999), but variations may be found due to ploidy and heterozygosity in tetraploids (Rajapakse et al., 2001). Fragrance is also important in commercial cultivars controlled by complex scent producing pathway may vary according to environment (Guterman et al., 2002; Verhoeven, Blaas & Brandenburg, 2016). In earlier study, it was declared as quantitative trait but in recent study gene is responsible for it (Cherri-Martin, Jullien, Heizmann, & Baudino, 2007). Role of enzyme may involve in synthesis of scent components (Vainstein, Zamir & Weiss, 2003). In roses (Rosa Spp.), many volatile compounds are responsible for scent (Tabaei-aghdaei, Sahebi, Jafari, & Rezaee, 2004). Leaf area was also measured for quality assessment of roses (Shupert, Byrne, Pemberton, 2005), But quality may vary in stem as temperature reaches at 18 °C (Shin, Lieth & Kim, 2000). Maximum availability of light directly boosts up the growth by increasing the process of photosynthesis (Mor & Halevy, 1980). This may increase the production of roses in gardens (Mulla, Patil, Singh, & Bhujbal, 1994).

Pruning severity in roses (Rosa spp.) may also depend on flowering and quality of flowers (Hassanein, 2010). Flowering mechanism also involved in buds formation to blooming (Horibe & Yamada, 2017). Hormones are involved in flowering opening (Van Doorn & Kamdee, 2014). In cut flowers, external characters are much

66 important in traditional varieties. Numerous studies were conducted earlier regarding increase in flower persistence by vase life methods (Burdett, 1970; De Stigter, 1980; Durkin, 1979; Macnish, Leonard, Borda, & Nell, 2010; Reid, Dodge, Mor, & Evans, 1988; Ichimura, Kawabata, Kishimoto, Goto, & Yamada, 2003; Van Doorn, 1997), controlling of phytohormone (Ichimura & Shimizu-Yumoto, 2007) and flower opening attributes (Ma et al., 2006; Ma et al., 2008; Tan et al., 2006) with hormonal imbalance (Van Doorn & Kamdee, 2014). From bud to flower opening is irreversible process which involves cell expansion with increase in fresh and dry weight (Faragher, Mayak, Tirosh, & Halevy, 1984).

Rose petals remain fresh until these remained covered with calyx (Yamada, Norikoshi, Suzuki, Imanishi, & Ichimura, 2009). Early petal senescence positively correlates with the available amount of soluble carbohydrate (Ichimura, Kawabata, Kishimoto, Goto, & Yamada, 2003; Van Doorn, Groenewegen, Vandepol, & Berkholst, 1991). These finding correlate with the results of Van Doorn & Van Meeteren (2003). Flowering starch varies in each variety (Berkholst, 1989; Gorin & Berkholst, 1982; Hammond, 1982; Ho & Nichols, 1977; Van Doorn, Groenewegen, Vandepol, & Berkholst, 1991; Van Doorn & Van Meeteren, 2003). Early picking of flowers leads to bending due to fluctuation in sucrose and fructose, photosynthetic activity, osmotic activity, cell wall retardation and flower opening factor (Bieleski, 1993; Cram, 1976; Gorin & Berkholst, 1982; Ichimura et al., 1997; Ichimura et al., 1999; Kuiper, Ribot, Vanreenen, & Marissen, 1995; Leigh & Tomos, 1993; Vergauwen, Ende & Laere, 2000; Yamada, Norikoshi, Suzuki, Imanishi, & Ichimura, 2009). Our findings correlate with Yamada, Norikoshi, Suzuki, Imanishi, & Ichimura (2009), as flower opening starts, osmotic activity increase which ultimately affects flower persistence life. This may be due to imbalance in phloem (Roitsch & Gonzalez, 2004).

As expansion of flowering petals occure, it starts weaken the synthase activity, which is associated with flower senescence (Gonzalez & Cejudo, 2007; Kumar, Srivastava & Dixit, 2008; Miyamoto, Ueda & Kamisaka, 1992; Tang, Luscher & Sturm, 1999; Trouverie, Chateau-Joubert, Thevenot, Jacquemot, & Prioul, 2004). Controlling the acid invertase activity can reduce the flower opening in vase (Horibe,

Yamaki & Yamada, 2013). Several studies were conducted earlier focuing on opening and senescence of flowers in ornamentals through involvement of gene (Harada et al. 2010), XTH activity, RhXTH1–RhXTH4 factor petal expansion (Takahashi, Fujitani, Yamaki, & Yamada, 2007; Yamada, Norikoshi, Suzuki, Imanishi, & Ichimura, 2009) and Dehydration factor RhEXPA4 (Dai et al., 2012). Rhythmic flower opening was observed more in open instead of controlled conditions which varied in day blooming and night blooming species (Jones & Mansfield, 1975; Van Doorn & Van Meeteren, 2003) due to changes of sunlight availability (Bieleski, 1993; Jones & Mansfield, 1975). Some chemical reactions vary in rose cultivar (Doi, Miyagawa, Inamoto, & Imanishi, 1999; Hendel- Rahmanim, Masci, Vainstein, & Weiss, 2007). Rhythmic flower opening always remain minimum due to volatile emission (Evans & Reid, 1988; Hendel-Rahmanim, Masci, Vainstein, & Weiss, 2007; Kaihara & Takimoto, 1980). The variations observed in examined morphological traits may be possibly due to genotype × environment interactions as studied ealier by Gitonga et al. (2014).

ESTIMATION OF LEAF GAS EXCHANGE DATA OF ROSA HYBRIDA VARIETIES

Leaf Area (cm2) of Rosa Hybrida Varieties

The statistical analysis of data for leaf area (cm2) showed significant differences among each variety. Overall in comparison of all varietities for both years, the average maximum leaf area was observed in variety Fragrant plum (V5) with the highest value 8.88 cm2 and ranked first while the varieties Angel face (V16) and Magic lantern (V10) were at par with each other (8.63 cm2, 7.89 cm2) respectively. There was non-significant difference observed in varieties Broceliande (V19) (7.61 cm2), Midas touch (V6) (7.61 cm2) while Doreen Johnson (V1) (7.31 cm2) and Elina (V7) (7.18 cm2) at par with those just below the top ranking. The varieties Candy stripe (V18) (4.41 cm2) and Pat austin (V15) (4.40 cm2) ranked in center respectively. The ranking order of statically analyzed data showed that the examined varieties leaf area vary from 3.43 cm2 to 8.88 cm2. The lowest leaf area observed in variety Eye paint (V4) with the value 3.43 cm2. The interaction effect of leaf area showed significant difference for two years but difference varies among each variety. There

68 was no-significant difference observed in varieties Fragrant plum (V5), Angel face (V16), Broceliande (V19), Doreen johnson (V1), Elina (V7), Morstylo (V13), Helen naude (V2), Scentimental (V20), Bridal pink (V12) and Jude-the-obscure (V8) in comparison with both years. The minimum difference in leaf area value was observed in all remaining varieties.

Leaf Area 10 9 8 7

2 6 5

LA=cm 4 3 2 1 0

Figure 4. 17: Average leaf area of Rosa hybrida varieties grown in pothwar climate for years, 2016-2017

2 1 Photosynthesis Rate of Rosa Hybrida Varieties (Pn = μmol CO2 m- s- )

The photosynthetic rate expressed in data showed significant difference in each variety for both years. The highest photosynthetic response was expressed in 2 1 varieties Bridal pink (V12) (22.05 μmol CO2 m- s- ) and First prize (V11) (21.08 2 1 2 1 μmol CO2 m- s- ). The variety Candy stripe (V18) (14.10 μmol CO2 m- s- ) and 2 1 rd th variety Gruss an Teplitz (V21) (13.48 μmol CO2 m- s- ) were placed in 3 and 4 ranking, respectively. The lower photosynthetic rate was observed in variety Helen naude (V2) closely followed by varieties Pat austin (V15) and Doreen johnson (V1) as shown in Figure 4.18.

Interaction effect of both years as compared with varieties showed significant

69 difference. However, the varieties Candy stripe (V18), Gruss an Teplitz (V21), Elina (V7) showed non-significant result for both years as the average photosynthesis rate remained same. Other varieties Bridal pink (V12), First prize (V11), Fragrant plum (V5), Anne Marie Trechslin (V9), Eye paint (V4) and Magic lantern (V10) showed significant difference but remain at top for photosynthetic rate in both years.

Photosynthetic Rate 25

1 20

- m

2 15

Pn= μmol Pn= μmol CO 5

Figure 4. 18: Average photosynthesis rate for Rosa hybrida varieties in spring season for years, 2016-17

2 1 Transpiration Rate of Rosa Hybrida Varieties (E= mol H2O m- s- )

The statistical analysis of data showed significant difference among each variety 2 1 for both years. The average transpiration rate (5.59 mol H2O m- s- ) was positively maximum in year 2016 as compared to year 2017 with the value (4.91 mol H2O m- 2s-1). The variety First prize (V11) carried transpiration rate 6.30 followed by variety 2 1 Candy stripe (V18) (5.86 mol H2O m- s- ) and variety Morstylo (V13) (5.83 mol H2O m-2s-1). The least transpiration rate was attained by variety Anna-maritharsline (V9) 2 1 (4.58 mol H2O m- s- ) which was statically at par with variety Eye paint (v4) (4.65 2 1 2 1 mol H2O m- s- ), variety Helen naude (V2) (4.70 mol H2O m- s- ) and variety Pat 2 1 austin (V15) (4.83 mol H2O m- s- ).

The non-significant difference was observed in varieties Candy stripe (V18), Morstylo (V13) in top ranking and Angel face (V16), Broceliande (V19), Scentimental (V20), Midas touch (V6), Bora bora (V14) in center but at par with varieties Doreen johnson (V1), Gruss an Teplitz (V21), Magic lantern (V10), Elina (V7), Hot cocoa (V17) in center ranking order. Helen naude (V2) and Eye paint (V4) at lower not least ranking order.

Transpirate Rate 8

1 6

s 2

- 5 O m O 2 4

E=mol E=mol H 2

Figure 4. 19: Average transpiration rate of Rosa hybrida varieties in spring season for years 2016-17

Stomatal Conductance of Rosa Hybrida Varieties (gs= mol m-2s-1)

The statistical analysis of stomatal conductance (gs) data showed significant difference among each variety. Stomatal conductance (gs) was maximum in year 2016 (168.17 mol m-2s-1) as compared to year 2017 (157.07 mol m-2s-1). Under the open field condition, the highest stomatal conductance was observed in variety Broceliande (V19) followed by varieties Morstylo (V13) (201.92 mol m-2s-1) and Gruss an Teplitz (V21) (201.38 mol m-2s-1) while the least position was held by Mr Waqar (V3) (115.00 mol m-2s-1). The average of both years, stomatal conductance value observed maximum (211.30 mol m-2s-1) in variety Broceliande (V19). The

71 non-significant difference was observed in varieties Morstylo (V13), Gruss an Teplitz (V21), Midas touch (V6), Eye paint (V4), Anne Marie Trechslin (V9), First prize (V11), Pat austin (V15), Bora bora (V14), Bridal pink (V12), Jude the obscure (V8) as these ranked in same order. The significant difference was observed in varieties Helen naude (V2), Angel face (V16), Scentimental (V20), Magic lantern (V10), Fragrant plum (V5), Doreen johnson (V1), Candy stripe (V18), Hot cocoa (V17), Elina (V7) and Mr waqar (V3).

The interaction effect of varieties for both years showed significant difference among each other for stomatal conductance. The varieties Broceliande (V19) and Gruss an Teplitz (V21) showed non-significant results in both years as least difference was observed in stomatal conductance. Overall all varieties showed significant difference among each other for both years. The minimum stomatal conductance was observed in varieties Elina (V7), Mr waqar (V3), Hot cocoa (V17), Pat austin (V15) and Bridal pink (V12) as they ranked at lower position in statistical analysis.

Stomatal Conductance 250

200

s 2 - 150

100 gs= mol mol gs= m

Figure 4. 20: Average stomatal conductance for Rosa hybrida varieties for years 2016-17

Table 4. 5: Leaf area, photosynthesis rate, transpiration rate and stomatal conductance of Rosa hybrida varieties for years 2016-2017

Varieties Leaf area (cm2) Photosynthesis Rate Stomatal Conductance Transpiration Rate 2 1 2 1 2 1 (μmol CO2 m- s- ) (mol m- s- ) (mol H2O m- s - ) 2016 2017 2016 2017 2016 2017 2016 2017 Dr Johnson 7.36±0.3f-i 7.26±0.1 ghi 4.60±0.3x 3.93±0.1yz 163.47±1.3 jk 148.43±1.2 l-n 5.36± 0.1d-i 5.16±0.0 g-m Helen Naude 6.46±0.2l 6.6±0.2kl 3.73±0.1z 2.50±0.1 bb 195.20±1.2 cde 182.53±1.3 fg 4.90± 0.2k-n 4.50 ±0.0op Mr Waqar 5.23± 0.2n 5.33 ±0.2mn 9.70 ±0.0l 9.40± 0.0lm 119.10 ±1.3qrs 110.90± 0.9s 5.70± 0.2cd 5.13 ±0.4gm Eye Paint 3.30± 0.1s 3.56± 0.3rs 11.03± 0.1ij 10.30± 0.2k 204.67± 1.0abc 191.67± 0.2def 4.80± 0.3m-o 4.50 ±0.2op Fragrant Plum 9.03± 0.3a 8.73 ±0.1ab 12.33 ± 0.3g 11.26± 0.1hi 166.10± 0.7j 148.23± 1.1lmn 5.76± 0.1c 5.30± 0.1e-j Midas touch 7.73± 0.1de 7.50 ±0.2e-h 6.13 ± 0.1u 5.46± 0.2vw 204.80± 2.4abc 194.00± 0.9cde 5.46± 0.0c-h 5.16 ±0.0g-m Elina 7.23± 0.1hi 7.13±0.2 i 9.30± 0.2 mn 8.90± 0.1no 121.93± 1.4qrs 110.67 ±1.8s 5.26 ±0.1f-k 5.20± 0.2g-l Jude the obscure 3.7 ±0.0qr 3.80± 0.1qr 8.10± 0.1qr 7.30± 0.2s 137.90± 1.8nop 126.33± 2.1pqr 5.33± 0.0d-j 4.36±0.1 p Anne martharsline 3.56± 0.2rs 3.53 ±0.2rs 11.43± 0.0h 10.80± 0.3j 184.70± 2.2efg 170.23± 2.0hij 4.86± 0.1l-o 4.30±0.4 p Magic Lantern 8.06± 0.4c 7.72± 0.3de 10.83± 0.1j 8.40± 0.1pq 169.13± 1.8ij 158.90± 0.5jkl 5.40± 0.1c-i 5.06± 0.2i-m First Prize 4.70± 0.5o 4.46± 0.2op 22.36 ±0.3b 19.80± 0.0c 181.13 ±1.9fgh 169.80± 1.8hij 7.36 ±0.2a 5.23± 0.3f-l Bridal Pink 3.80± 0.3qr 3.90±0.2 q 24.30± 0.1a 19.80± 0.1c 138.37± 0.5no 126.00± 1.7qr 5.60± 0.3c-f 4.53± 0.3nop Morstylo 7.10± 0.3ij 6.80± 0.2jk 6.73± 0.0t 5.70± 0.2v 208.83 ±1.8ab 195.00± 0.4cde 7.16± 0.1a 4.50± 0.1op Bora Bora 5.30± 0.2n 5.43±0.1 mn 5.70 ±0.3v 5.20± 0.4w 139.20± 2.0no 129.97± 2.4o-r 5.43 ±0.2c-i 5.13± 0.3g-m Pat austin 4.46± 0.1op 4.33± 0.3p 4.00± 0.1yz 3.10± 0.4aa 144.77 ±1.6mn 123.77± 2.5qr 5.10± 0.3h-m 4.56 ± 0.02nop Angel Face 8.70± 0.3b 8.56± 0.2b 8.80 ±0.1op 8.33± 0.2q 185.57± 0.9efg 178.43± 1.6ghi 5.50 ±0.1c-g 5.13± 0.2g-m Hot Cocoa 4.36 ±0.1p 4.26± 0.1p 10.16±0.2 k 9.43±0.2 lm 129.00 ±1.3opq 117.23 ±2.1rs 5.33± 0.2d-j 5.10± 0.3h-m Candy Stripe 4.53± 0.2op 4.30 ±0.2p 14.30 ±0.1d 13.90± 0.2de 154.23± 1.3klm 142.90± 1.6mn 6.63± 0.3b 5.10± 0.2h-m Broceliande 7.66 ±0.0d-f 7.56± 0.3e-g 8.36± 0.1q 7.86± 0.3r 212.17± 1.2a 210.43± 1.8ab 5.66± 0.2cde 4.96± 0.1j-m Scentimental 5.53 ±0.2mn 5.63±0.2 m 5.06± 0.1w 4.26± 0.2xy 168.37± 2.3ij 165.10± 3.2jk 5.50 ±0.1c-g 5.13 ±0.2g-m Gruss an Teplitz 7.93± 0.1cd 7.70 ±0.1de 13.80± 0.1e 13.16± 0.1f 202.87±1.3 a-d 199.90± 2.2bcd 5.40± 0.2c-i 5.13±0.1 g-m The leaf area, photosynthesis rate, stomatal conductance and transpiration rate were observed during the month of April to check the response of varitites in Pothwar climate and their influence on growth and flowering. The data was correlated to select varieties best suitable in rose breeding programme.

Discussion on Physiological Attributes

The physiological activity varies among varieties along with the leaf area. Leaf exposure to light, increases photosynthetic activity in plant (Warmenhoven, Eveleens-Clark, Van Mourik, Marissen, & Dehoog, 2000). The spaces between the plants (Kool & Lenssen, 1997) and their leaf area variation (Warner & Erwin, 2000) were found reliable tools for positive increase in quality production with modification of plant architecture (Mascarini, Lorenzo & Vilella, 2006). The varieties Fragrant plum (V5), Angel face (V16), Magic lantern (V10) and Gruss an Teplitz (V21) significantly found with prominent leaf area at upper rank level respectively. The growth of varieties Angel face and Gruss an Teplitz was also significantly better in available water and other supplied resources.

Photosynthetic response of varieties Bridal pink (V12), First prize (V11), Candy stripe (V18) and Gruss an Teplitz (V21) expressed at higher level as compared to other varieties. The transpiration rate of varieties First prize (V11), Candy stripe (V18), Morstylo (V13), Fragrant plum (V5) was maximum as observed in this study. The stomatal conductance behavior of varieties Broceliande (V19), Morstylo (V13) and Gruss an Teplitz (V21) were significantly ranked top. Our findings may also correlate with the findings of Quero et al. (2008) as the leaf area of the plant during growth and development phase correlated with the photosynthesis in open environment condition. Leaf area may also correlate with vegetative growth (Sims & Gamon, 2003). Prediction of transpiration according to climatic factors, leaf characters are also important. Higher leaf area, more will be the transpiration rate (Janoudi, Widders & Flore, 1993). Our finding may correlate with the findings of Duchein, Baille & Baille (1993) as temperature increases, stomatal conductance induces as well as transpiration also reduced.

According to Souza, Martarello, Rosolem, & Oosterhuis (2007), the varieties with lower growth tends more compact stature however have smaller leaves. The leaf area and thickness of leaf may regulate the efficiency in availability of light and nutrients (Vendramini et al., 2002). Smaller the leaf area may allow to maintain higher transpiration rate as temperature increase or during dry environment (Liu, Cohen, Fuchs, Plaut, & Grava, 2006). The plant morphological traits may be more

74 specific or stable Quantitative Trait Loci (QTL) for different environments in directly measured traits (Carvalho-Zanao, Grossi, Junior, Ventrella, & Pereira, 2017). The potential of this “gene-to-phenotype” variation also observed earlier (Chenu et al., 2009). Rosa hybrida varieties growth and flowering differentiate under drought with reduced root growth. Lower gas exchange probably may reduce the flower number as show the less drought tolerant behavior as compared to well irrigated plants of Rosa hybrida varieties (Cai, Starman, Niu, Hall, & Lombardini, 2012).

NUMBER OF ANTHERS, INVITRO POLLEN VIABILITY AND POLLEN GERMINATION STUDY

For the selection of suitable parent as pollen donor, pollen of each genotype was evaluated in laboratory condition at initial selection for hybridization study. In this regard present study was performed for pollen viability and pollen germination capacity in different growing media. The study regarding pollen is important for hybridization and selection of suitable male parent for successful conventional breeding.

Number of Anthers per Flower

On statistical analysis of data, significant variation was observed in number of anthers per flower in all varieties as shown in Figure 4.21. Significant number of anthers per flower (136.30) were in variety Helen naude closely followed by variety Angel face anthers per flower (129.90). Lowest number of anthers per flower (25.57) were exhibited by the Gruss an Teplitz variety. Number of anthers per flower varied significantly among other varieties examined in this study. The number of anthers in varieties Bora bora (103.10), Elina (102.80), Fragrant plum (70.00), Broceliande (68.87) at par with each other and not varied significantly. Similar kind of variations regarding number of anthers (83-260) were also observed by Zuraw, Sulborska, Stawiarz, & Chmielewska (2015). The number of anthers varies in specie, R. Villosa (81.4), R. Elliptica (148.1) of modern roses (Gunes, Cekic & Edizer, 2004). The variation in number of anthers per flower is also observed in hybrid tea and floribunda roses (Ercisli, 2007b; Zlesak, 2007a).

Number of Anthers 140 120 100 80 60 40

Number Number anthersof 20 0

Varieties

Figure 4. 21: Average number of anthers for each Rosa hybrida varieties

Pollen Viability Percentage (%)

For the selection of best pollen parent, pollen viability was considered. Statistical analysis of collected data depicted that viability percentage varied significantly among all varieties as shown in Figure 4.22. The pollen viability percentage was significantly higher in variety Gruss an Teplitz (67.40 %). The lowest pollen viability was recorded in variety Candy stripe (28.60 %) followed by Jude-the-obscure (30.20 %). The pollen viability in varieties Helen naude (56.80 %), Midas touch (56.80 %), Magic lantern (55.60 %), Pat austin (54.80 %), Morstylo (54.60 %) and Mr Waqar (53.60 %) were at par with each. Variation on pollen viability percentage was 31.88 to 48.6 % in rosa species (Ercisli, 2007b) and hybrid tea (27 to 61 %) observed earlier.

Pollen grain viability percentage also depends on varieties ploidy level and pollen efficiency can decrease (Visser, Vries, Scheurink, & Welles, 1977) according to collection time (Gudin, Arene & Bulard, 1991). Quantity of pollen per anther may vary in roses depending on variety, specie, age, nutrition application, environment of surrounding (Ercisli, 2007b). Pollen germination in species (29-51 to 52-82 µm) and hybrid tea roses (32.31 to 52.99 µm) may helpful in success of hybridization (Ueda & Akimoto, 2001).

Pollen viability 70 60 50 40 30

Viability % 20 10 0

Varieties

Figure 4. 22: Average pollen viability percentage of each variety used in this study

Pollen Invitro Germination Percentage (%)

After pollen viability test, pollen germination percentage was observed for each pollen donor parent selected for hybridization by conventional method. Rose pollen shows different behavior regarding pollen germination as it is considered important for estimation of pollen vigor for getting high success rate after pollination. Rose pollens were placed in three different media of sucrose concentration (10 %, 15% and 20% with 2% agar respectively) in the controlled condition. After incubation for 24 hours, significant difference in pollen germination percentage was observed. Statistical analysis of collected data showed that the highest pollen gemination percentage was found in 15 % sucrose media in the variety Gruss an Teplitz (54.23 %) followed by Midas touch (42.60 %) and Fragrant plum (42.43 %) at same invitro germination media as shown in Figure 4.23. Minimum germination percentage was shown by Jude-the-obscure (6.90 %) followed by Elina (7.70 %), First prize (8.30 %) and Candy stripe (8.66 %), respectively. Overall 15 % sucrose germination media proved efficient in this experiment. Germination capacity may vary in each variety depending on growing environment. Our results may correlate with the findings of Richer, Poulin & Rioux (2007) study, in which pollen germination percentage may ranges in 16.00-38.00 % for species of roses under different concentration of sucrose. Visser, Vries, Scheurink, & Welles (1977) observed pollen germination percentage (14-47%) in hybrid tea to find the suitable parent for hybridization.

60 Pollen Germination

30 Germination Germination % 20

Sucrose 10 Sucrose 15 Sucrose 20

Figure 4. 23: Average pollen germination percenatge of each variety in differrent sucrose and agar (2%) media

Pollen Diameter (µm)

The pollen diameter of varieties varies significantly as analyzed statistically shown in Figure 4.24. The pollen diameter in all varieties was significantly varied as observed in Angel face (32.33 µm), Gruss an Teplitz (32.26 µm) and Bora bora (31.86 µm). The pollen diameter in different concentration of sucrose varies but these varieties overall performance was good with nominated number of hips after crosses in Pothwar condition. This performance may be varied as limited supply of water and nutrient. The commercially adapted varieties may vary their morphological attributes in changing climate. Candy stripe is one of the most attractive variety in commercial flower market as compared to First prize and Jude-the-obscure. In experimental area, these varieties performance was very low as compared to all the other varieties. These varieties considered good in Faisalabad and Pattoki district for their flower attractiveness, mix color geometry and scented petals. The varieties Hot cocoa, Bridal pink and Morstylo were at par with each other with the pollen diameter of size 23.46 µm, 23.40 µm and 23.26 µm respectively.

35 Pollen Diameter 30 25 20 15 10

Diameter Diameter size µm 5 0

Figure 4. 24: Average pollen diameter of Rosa hybrida varieties

The varieties Magic lantern and Broceliande pollen diameter were considered maximum, but the flower of variety Broceliande were attractive and regular bloom in growing season. Pollens of this variety were also used for breeding programme due to its attractive and mixing color blooming. The variety Midas touch and Anne Marie Trechslin also produce fertile pollen with pollen diameter 27.53 µm and 25.80

µm. These varieties performance was excellent in Pothwar region. Due to attractive flower, Midas touch used as seed bearing parent and Anne Marie Trechslin used as pollen donor parent for conventional breeding of roses. These varieties produced consistant flowering through out the year. Pollen diameter may consider as fertility predictor. Variation was observed in pollen diameter of species and hybrid teas (21.3 μm-40.8 μm) for adapting successful crosses (Pipino et al., 2011b; Ueda & Akimoto, 2001).

Discussion on Pollen Behavior for Success of Breeding

Determination of varieties as seed bearing parent and pollen donor parent was done earlier in different species (Crespel et al., 2002; Devries & Dubois, 1983; Visser, Vries, Scheurink, & Welles, 1977) as different varieties in different species has varying level of fertility status (Zlesak, 2009b). In the present experiment, pollen viability of all varieties was evaluated to check the fertility rate and then further selection for breeding procedure. The maximum pollen viability was observed in Gruss an Teplitz (67.4%) and Angel face (64.6%). The pollen viability percentage of all varieties used in the study remained in between 28.6% (Candy stripe) to 67.4% (Gruss an Teplitz). This pollen viability status makes the selection of parents easy. The variation may be due ploidy level, heterozygosity due to interspecific hybridization and prominent behavior of recessive allele (Visser, Vries, Scheurink, & Welles, 1977). Pollen germination test of these varieties done to check the pollen tube growth so that fertilization may occur easily. The pollen germination in all varieties showed different behavior at different medium of sucrose. The maximum pollen germination was observed in 54.23% in germination medium of sucrose 15%. As sucrose level increased, germination of pollen was decreased at 20% sucrose level. Pollen germination ranges in 54.23 to 6.99 % in all varieties. Pollen germination percentage range was 43.18 to 5.17 % in Rosa Majalis and Rosa Canina. The pollen tube length (184.2 µm at 220x magnification) and pollen viability was observed in different species 23% and 45% (Werlemark, 2000; Ueda and Akimoto, 2001). Pollen viability decreases as temperature increases (Visser, Vries, Scheurink, & Welles, 1977) and fertility of gametes also alters as physiological changes occurs in plant growth (Calvino, 1951; Gudin, Arene & Bulard, 1991).

Table 4. 6: Rosa hybrida varieties for parentage characters

Varieties No of anther Pollen diameter (µm) Character Seed setting Doreen johnson (V1) 95.00±0.89gh 18±0.88h Father No Helen naude (V2) 136.00±2.31a 24.73±0.87def Mother Yes Mr waqar (V3) 104.00 ± 0.11ef 24.4±0.50d-g Mother, Father Yes Eye paint (V4) 72.00±0.62kl 28.73±0.43b Mother, Father Yes Fragrant plum (V5) 70.00±1.35 l 22.93±0.08fg Father No Midas touch (V6) 130.00±1.46b 27.53±0.40bc Mother Yes Elina (V7) 103.00±3.30f 22.86±0.37fg Father No Jude-the-obscure (V8) 78.67±1.45j 13.2±0.12i Father No Anne Marie Trechslin (V9) 112.33±0.91d 25.8±0.27cd Father No Magic lantern (V10) 81.67±0.29ij 22.4±0.23g Mother, Father Yes First prize (V11) 107.67±0.59e 7.86±0.60j Mother No Bridal pink (V12) 83.33±0.88i 23.4±0.12efg Father No Morstylo (V13) 98.00±2.06g 23.26±0.20efg Mother, Father No Bora bora (V14) 103.00±0.59f 31.86±0.19a Mother Yes Pat austin (V15) 53.33±0.99n 22.73±0.77fg Mother, Father No Angel face (V16) 117.00±2.06c 32.33±0.20a Mother Yes Hot cocoa (V17) 93.00±0.59h 23.46±0.40efg Father No Candy stripe (V18) 64.33±0.22m 3.53±0.21k Father No Broceliande (V19) 68.67±1.24l 22.26±0.10g Father No Scentimental (V20) 74.33±2.33k 25.33±0.50de Father No Gruss an Teplitz (V21) 25.67±1.06o 32.26±0.28a Mother, Father Yes

Mean ± showing standard deviation. Represented values given same letters differ non-significantly (P>0.05)

Pollen germination and pollen tube growth of hybrid tea at 15% concentration of sucrose performed well (Visser, Vries, Scheurink, & Welles, 1977) and has positive correlation with pollen diameter (Pipino et al., 2010). Shriveled pollen was also observed in tetraploid as compared to diploid (2n gametes), ploidy information may also be important for success of hybridization in conventional crossing (Zlesak, 2009b). Difference in genomic size may make ploidy identification difficult through flow cytometry because diploid and tetraploid DNA content variation may occur due to triploids (Yokoya, Roberts, Mottley, Lewis, & Brandham, 2000). In different studies, variation in result was found for hip set and seed germination in crossing of triploid, diploid as compared to tetraploid respectively but triploid as a female parent performance was low 14% hip set (Huylenbroeck et al., 2005). When sucrose percentage was 10%, then germination was less as observed in this study, but at 20 % sucrose, pollen germination was decreased as compared to 15 % sucrose in Rosa hybrida varieties. Pollen grains germination in scented roses, R. damascena (57.6 %) as compared to R. centifolia and R. indica at 20% sucrose level (Farooq et al., 2013) with agar (Khan, 1987). Concentration of sucrose with agar varies in different studies (Jicinska, Koncalova & Sykorova, 1976; Calvino, 1951; Koncalova, 1975; Johri & Vasil, 1961; Rao & Low, 1973). In this study, maximum pollen grain germination was observed in 15 % sucrose level with 2% agar. Pollen germination ranges from 32.16 % to 11.21 % in two genotypes of Rosa species (Ercisli, 2007b).

Sucrose with the combination of agar always showed positive results in roses (Pearson & Harney, 1984; Marchant, Power, Davey, Chartier-Hollis, & Lynch, 1992). R. bouboniana and Gruss an Teplitz give significant result in 1% agar and 15 % sucrose media got pollen germination upto 60.8 and 52.2 µm respectively (Farooq et al., 2013). The study on pollen tube growth (Al-Jibouri, Kgazal & Al Saadawi, 1987; Soliman, Al-Ani, Al-Salih, & Saadawi, 1976) and pollen viability (Pearson & Harney, 1984) give different results. This may be due to genetic differences (Ali, Bacha & Farahat, 1998).

SEED SETTING SUCCESS IN NEW CROSS COMBINATIONS

The hybrid roses are generally developed for the beautification and commercial production of flowers. The improvement of existing germplasm has increased

82 distinct fascination with respect to shading geometry, quality and extended persistence life supportability because of change in climate scenario. The following parameters were recorded after conventional hybridization in designed crosses shown in Table 4.7.

Hip Set Percentage (%)

After the conventional hybridization through manual pollination, hip set percentage was observed for each successful cross. On statistical analysis, significant variation was observed for each designed cross between seed setting and pollen donor parents. The maximum hip set percentage (67%) was observed in cross of Gruss an Teplitz x Pat austin (V21 x V15). Overall maximum hip set percentage (67- 44 %) was observed in crosses of Gruss an Teplitz (V21) closely followed by crosses of Bora bora (V14= 56-44 %) and Midas touch (V6= 56-33 %). Our results correlate with the findings of Zlesak (2007a) as crossing among fertile parents considerably favour the breeder to get significant crossing success. Possible hindrance in success may be due to pollination hindrance (Gudin, Arene & Bulard, 1991), pollen parent constraint, ploidy, amount and time of pollen application in environment and the physiological changes during growing season (Qasim, Ahmad & Ahmad, 2008; Richer, Poulin & Rioux, 2007). The hip set percentage was zero in crosses of Gruss an Teplitz with Hot cocoa, Broceliande and Scentimental varieties.

Hip Fresh Weight (g)

Hip fresh weight calculated just after harvesting at maturity with the help of electric balance (Mayer & Poljakoff-Mayber, 1982). The maximum hip fresh weight (5.63 g) was observed in cross of Midas touch x Anne Marie Trechslin (V6 xV9). The hip fresh weight of crosses Bora bora (V14) was remain second (4.48-4.31 g) among other female parents. The lowest value of hip fresh weight (2.01 g) was observed in cross of Gruss an Teplitz x Bridal pink (V21 x V12). Our findings regarding hip fresh weight may be in accordance with Celik, Kazankaya & Ercisli (2009) in which hip fresh weight ranges in 1.78 g to 4.90 g among species of roses. Zhou, Bao & Wu (2009) found mean seed weight of 100 achenes with the value of 20.01mg.

Hip Size (cm)

Hip size of each successful cross varied among each parent. In this study, overall maximum size of hip (2.16 cm) was observed in cross of Midas touch x Eye paint (V6 x V4). The minimum hips size (1.44 cm) was observed in cross of Gruss an Teplitz x Morstylo (V21 x V13). The hip size in crosses of Bora bora (V14) remain intermediate (1.86- 1.84 cm), diameter was less (2.16-2.09 cm) then crosses of Midas touch (V6) and more (1.49-1.44 cm) then crosses of Gruss an Teplitz (V21).

Figure 4. 25: Process from emaculation upto seed harvesting after successful crosses. (a) Emasculation, (b) Capping and hip formation after pollination, (h) Midas touch crosses hips, (i) Bora bora crosses hips (j) Gruss an Teplitz crosses hips at maturity

Days to Maturity of Hips (days)

The days taken by hip to mature after successful pollination, may also be considered important for hybridization. Statistical analysis of data showed that the days required to hip maturity give non-significant values (90.77-53.66 days) among all crosses. The maximum days were taken to maturity (90.77 days) in cross of Gruss an Teplitz x Eye paint (V21 x V4). The minimum days for maturity (52.66 days) were observed in cross of Gruss an Teplitz x Anne Marie Trechslin (V21 xV9). Hip

84 development started after 3 weeks of pollination. The seeds formation started just after fertilization. The findings relate with the Ueda & Akimoto (2001) in which hip development occur after 3-4 weeks and rapidly increase in size up to 8 weeks and maturity of hips may take 2-4 months.

Number of Seeds per Hip

Seed were extracted manually from hips and total number of seeds per cross combination were counted in three repeats. The maximum number of seeds per hip (15.00) were observed in cross of Bora bora x Bridal pink (V14 x V12) closely followed by the cross of Midas touch X Bridal pink (V6 x V12 = 14.33). The minimum number of seed (7.33) were observed in cross of Gruss an Teplitz x Elina (V21 x V7) closely followed (8.00) by the cross of Gruss an Teplitz x Fragrant plum (V21 x V5). The number of seeds per hip variation was observed in all cross of rose varieties. Pollination success may be varied due to open environment of field. The number of seeds per hip in modern roses may varies from 1-30 (Crespel & Gudin, 2003).

Dry Weight of Seeds (mg)

The dry weight of seed per hip obtained from each successful crossing vary significantly among each other. The maximum dry weight of seeds (52.70 mg) was observed in cross between Gruss an Teplitz (V21 x V9) closely followed by Midas touch x Eye paint (V6 x V4) as shown in Table 4.7.

Length and Width of Seeds (mm)

The data regarding length and width of seeds of each cross combination varies significantly. The variety Gruss an Teplitz seed length was 5.90 mm as compared to Midas touch (5.33 mm) and Bora bora (5.23 mm). There was variation in seed length (5.33 – 4.93 mm and 5.23 – 4.96 mm) of varieties of Midas touch and Bora bora. The variation in seed length of Gruss an Teplitz varies from 5.90 to 5.56 mm. the maximum seed width (3.70 mm) was observed in variety Midas touch. The variety Bora bora seed width ranges from 3.4 to 3.13 mm as compared to variety Gruss an Teplitz seed width ranges in 3.00 - 2.63 mm. Our results also correlate with the Zhou,

Bao & Wu (2009) as the roses (Rosa spp.) seed length and width may vary according to variety with the length 5.15 mm and width 2.89 mm.

Midas touch (V6) Bora bora (V14) Gruss an Teplitz (V21)

Figure 4. 26: Dry weight of seeds obtained from successful cross combiantions

Length and Width of Seed 6

seed seed size mm 2

Figure 4. 27: Average length and width of seeds resulted from cross combinations

Discussion on Seed Setting Among Successful Cross Combinations

The successful mature hips were harvested in month of august. Ripening of rose hips varied according to specie, variety and local adapted climate (Buchwald, Zielinski, Mscisz, Adamczak, & Mrozikiewicz, 2007). Hip maturity time may be varied from August to September. The length and width of rose hips ranges from 1.10 to 1.97%. The rose hips size may vary depending on the variety (Demir & Kalyoncu, 2003; Wronska-Pilarek & Tomlik-Wyremblewska, 2010).

Table 4. 7: Detail description of collected data from successful hip set up to extraction of seed of successful crosses Cross Hip set % Days to hip maturity Diameter of hip (cm) Hip fresh weight (g) No of seeds /hip Seed weight (mg) v6 x v4 33% 90.77±0.6a 2.16±0.0a 5.57±0.1ab 14.00±0.2ab 51.5±1.32 v6 x v5 44% 78.33±1.0ab 2.12±0.1ab 5.54±0.2ab 11.33±0.2a-c 50.70±0.90 v6 x v7 0% 0±0d 0±0f 0±0f 0±0d 0 v6 x v9 44% 77.22±1.8ab 2.12±0.2ab 5.63±0.1a 9.667±0.2a-c 39.33±0.88 v6 x v12 56% 80.11±1.2ab 2.10±0.1b 5.39±0.1b 14.33±0.3ab 46.26±2.15 v6 x v13 0% 0±0d 0±0f 0±0f 0±0d 0 v6 x v15 33% 79.99±0.3ab 2.10±0.1b 5.50±0.2ab 12.66±0.2a-c 42.07±1.73 v6 x v17 0% 0±0d 0±0f 0±0f 0±0d 0 v6 x v19 0% 0±0d 0±0f 0±0f 0±0d 0 v6 x v20 33% 89.22±2.1ab 2.09±0.2b 5.49±0.0ab 11.33±0.2a-c 40.93±1.79 v14 x v4 0% 0±0d 0±0f 0±0 f 0±0d 0 v14 x v5 44% 78.11±1.7ab 1.84±0.1c 4.44±0.1c 11.66±0.2a-c 39.96±0.6 v14 x v7 56% 80.11±1.4ab 1.86±0.1c 4.36±0.0c 14.00±0.2ab 46.89±0.58 v14 x v9 44% 76.11±0.1b 1.84±0.0c 4.41±0.1c 12.33±0.1a-c 41.37±0.87 v14 x v12 56% 79.33± 1.1ab 1.85±0.1c 4.45±0.1c 15.00±0.2a 48.33±1.45 v14 x v13 44% 78.11±1.7ab 1.84±0.2c 4.31±0.1c 11.00±0.2a-c 41.89±3.30 v14 x v15 44% 78.99±0.9ab 1.84±0.1c 4.48±0.1c 11.66±0.2a-c 40.96±1.18 v14 x v17 0% 0±0d 0±0f 0±0f 0±0d 0 v14 x v19 0% 0±0d 0±0f 0±0f 0±0d 0 v14 x v20 0% 0±0d 0±0f 0± 0 f 0±0d 0 v21 x v4 56% 90.77±2.4a 1.46±0.2de 2.13± 0.0de 9.667±0.1a-c 50.07±1.03 v21 x v5 56% 78.66±2.5ab 1.49±0.1d 2.31±0.1d 8.00±0.2c 48.70±0.90 v21 x v7 44% 80.66±2.5ab 1.44±0.2e 2.08±0.0de 7.333±0.2c 50.77±0.95 v21 x v9 56% 53.66±1.2 c 1.49±0.3d 2.28±0.1d 9.333±0.2bc 52.70±1.23 v21 x v12 56% 80.66±2.5ab 1.47±0.2de 2.01±0.1e 9.000±0.2bc 50.63±0.91 v21 x v13 56% 78.89±3.5ab 1.44±0.2e 2.09±0.0de 9.000±0.1bc 51.43±0.97 v21 x v15 67% 80.55±0.8 ab 1.46±0.3de 2.16±0.0de 11.33±0.3abc 49.60±0.94 v21 x v17 0% 0 ± 0d 0 ± 0 f 0 ± 0 f 0 ± 0 d 0 v21 x v19 0% 0 ± 0d 0 ± 0 f 0 ± 0 f 0 ± 0 d 0 v21 x v20 0% 0 ± 0d 0 ± 0 f 0 ± 0 f 0 ± 0 d 0 Mean ± showing standard deviation. Represented values given same letters differ non-significantly (P>0.05)

In the present study, hip fresh weight was maximum in Midas touch crosses (5.57 g) followed by Bora bora crosses (4.48 g) and Gruss an Teplitz crosses (2.31 g). The variation in fresh weight and number of seeds depend on variety among species. The fresh weight of hips may be low or high. The fresh weight vary according to variety as R. Villosa plants produces hips with average weight of 1.03 g (Kazaz, Baydar & Erbas, 2009; Mabellini et al., 2011). The fresh weight may vary from 0.95 to 3.27 g depending on specie variety and location of growing plants (Buchwald, Zielinski, Mscisz, Adamczak, & Mrozikiewicz, 2007) with various climates may give large size hips (Ercisli & Guleryuz 2006; Mabellini et al., 2011). Rose hips are also source of many healthy ingredients such as polyphenols and ascorbic acid (Gao, Uggla & Rumpunen, 2004; Razungles, Oszmianski & Sapis, 1989; Rous et al., 2011). Instead of budding and grafting, conventional breeding is considered as a desirable tool to get long lasting valued plants (Rout, Mohapatra & Jain, 2006). Breeding according to demand and novelties has gained attention as a result of different studies were conducted on biotic (Debener and Byrne, 2014; Moghaddam, Leus, Deriek, Van Huylenbroeck & Van Bockstaele, 2012) and abiotic stresses (Cabrera, Solis-Perez, & Sloan, 2009; Genhua & Rodriguez, 2009; Liang, Wu & Byrne, 2017; Li et al., 2003; Welling, Kaikuranta & Rinne, 1997; Zhang et al., 2016). Change in topography and environment can influence survival, productivity and commercial aspects of rose variety. Breeding target can emphasize the key objective as selection of environmentally resistance, propagation aspects, response and testing of genetic variation in field trials (Anderson,1991; Zlesak, Zuzek & Hokanson, 2007). As concern about cultivated tetraploid roses, considered as a valuable for conventional breeding resulted from modern cultivated cut roses (Bourke et al., 2018; Gar et al., 2011; Smulders, Esselink, Voorrips, & Vosman, 2009).

Maturity of hips as fully mature hips incase of Rosa rugosa has difference in days and single achene can mature up to 46 weeks (Jessen, 1958). The seed mass varies among Rosa specie but average seed yield was 4.5 achene per rose hip (Kovacs, Toth & Facsar, 2004). Hybrid origin mainly depend on diversity of pollination ways that resulted in low yield. This may be due to associated factors of Rosa specie such as autogamy, geitonogamy and xenogamy (Mayland‐Quellhorst, Foller & Wissemann, 2012). Seed yield variation also depicted in wild and nursery varieties 10-15 and 2-

3 achene per rose hip and seed mass ranges 18-50 mg and 35.5 mg (Kovacs, Toth & Facsar, 2004). Seed yield and origin of hybrid population is considered as undefined. Low seed yield in Rosa specie due to ontogenesis factor as occurred by cross pollination (Schanzer & Vagina, 2007) or may be high yield with combination of cross pollination and apomixis (Werlemark, 2000). The first step is to understand seed ecology (Lv, Zhang, Liu, & Deng, 2012) rather than seed mass and seed yield in Rosa specie which may be further helpful for seed germination (Anatoliy, 2016). Crossing and selection of varieties for future development has endeavors the history and resulted in 10 to 20 species got potential to be part of modern rose varieties breeding (Devries & Dubois, 1995). Selection of species should be done on the basis of color geometry, attractiveness, appealing forms, resistance to biotic and abiotic stresses. That all can be achieved through potential use of biotechnology and proper pollination at suitable time. Selection of female flower to accept male pollen and time of pollination are considered main factors (Crespel et al., 2002). As the temperature increases 32 oC with decrease in humidity below 29%, flower production decreases, quality of flowers is also affected. Selection of optimal time for breeding is important (Devries & Dubois, 1995). Successful crossing is possible in the month of April (Nadeem et al., 2014). Pollen germination is also influenced by temperature (23-30 °C), humidity fluctuation (60-65%) and stigma receptivity of female parent (low pH) at the time of pollination (Chimonidou et al., 2007).

In the present study, maximum hip set success was observed in cross of Gruss an Teplitz (67- 44 %) followed by Bora bora crosses (56- 44 %) and Midas touch crosses (56-33 %). In the results, there was significant difference among crosses of varieties. This uncertainty in success of crosses may be due to genetics and certain physiological factors but inter-specie crosses may give good result as compared to intraspecific crosses (Lata, 1983). There may be various factors in fertility of female parent, fruit setting, embryo death and uneven seedling germination (Svejda, 1968) or due to agamospermy with in Rosa specie (Cole & Melton, 1986). Agamospermy may happen during the seed development after pollination success in few section of rosaceae family (Crespel et al., 2002; Macphail & Kevan 2009; Nybom, Esselink, Werlemark, Leus, & Vosman, 2006; Werlemark 2009; Werlemark & Nybom 2001).

Constraint during anther removal may occur or due to damage of stigma or hormones involves in endosperm, embryo germination and hip seed setting (Cruden, 1989; Stone, Thomson & Dent‐Acosta, 1995). There are also reports of crossing (accidental selfing) just at emasculation stage (Werlemark, Uggla, & Nybom, 1999; Macphail, 2007; Nybom, Esselink, Werlemark, Leus, & Vosman, 2006). The process starts from emasculation (removal of female anther before anthesis) to pollination (spreading of pollen at receptive stigma, germination of pollen into ovary, gamete unite the egg to form zygotic embryo, mitotic division occur, embryo formation and seed formation occur in hips) among selected varieties (Gudin, 2000). Success of pollination may also be affected by physiological and associated environmental factors. These factors may vary in specie to specie or variety that prevent fertilization. The thickness of endocarp, embryo development is greatly influenced by the temperature (Gudin, Arene, Chavagnat, & Bulard, 1990; Vonabrams & Hand, 1956). Maximum seed per hip were observed in crosses of Bora bora (11.66 to 15), Midas touch (9.66 to 14) and Gruss an Teplitz (7.33 to 11.33). These results also correlate with findings of Farooq et al. (2016) as scented varieties were crossed to get new variants of scented roses. Maximum number of seed per hips produced were in range of 10.44 -12.55 seeds. These variations in seed production may be due to environmental or associated factors in pollination (Abdolmohammadi, Kermani, Zakizadeh, & Hamidoghli, 2014).

The experiment was conducted in open field of pothwar region. In the month of April, split of rains inhibited the pollination success. Overall weather and climate remained suitable for crossing of roses in Pothwar condition. In the present experiment, the purpose of breeding was to get new offspring among local cultivated roses as garden or landscape or commercial importance. The hip set percentage was less among all crosses. Mostly crosses failed to produced hips. Some hips also dead just after their formation. This may be due to biotic or abiotic factor of the locality. Most important factor could be the temperature as it increased up to 32 oC. The irrigation was also less due to unavailability of water. These findings corelates with the Devries & Dubois (1983) study. The maturation of hips mostly occurs successfully with the temperature range of 18 oC to 22 oC. The temperature increase may possibly cause the drying of pedicel due to formation of abscission layer

(Nadeem et al., 2014). Pollen shedding, environment for pollen germination and gamete formation is also affected by high temperature (Visser, Vries, Scheurink, & Welles, 1977). Physiological changes and variation in fertility were also observed in earlier study (Gudin, Arene & Bulard, 1991). This may be due to heterozygosity of tetraploid which hinder the compatibility results in low fertility (low hip set percentage) and less number of seeds (Rajapakse et al., 2001).

The variety Hot cocoa was not successful as a pollen parent in all crosses. The variety Hot cocoa contains average number of anthers (93) with pollen diameter 23.46 µm. The pollen viability percentage was 52.2 % with the pollen germination invitro 10.43 % but cross success was zero in the field. These varieties collection based on recurrent flowering with attractive plant growth. Seeds per cross may vary in each cross. It may or may not depend on viable pollen. Repeated pollination may be adopted to get success percentage for significant seed setting (Devries & Dubois, 1983), abnormalities lead to failure in pollen germination and incompatibility among hybrids due to high ploidy level (Bendahmane, Dubois, Raymond, & Bris, 2013). In the present study, hips started drying in month of June that may be due to increase in temperature above 33 oC with humidity (52 %) and less availability of water or may be due to inbreeding depression (Devries & Dubois, 1995; Nadeem et al., 2014). The germinated seedlings were transplanted in pots. The new population of hybrids successfully survived under green house. Seedling completed the juvenile phase after 75 days of transplantation. The results also corelates with the Devries & Dubois (1983) in which seedling take four to five weeks to produce flowers. Vegetative growth of plants, shifting into reproductive phase, initiation of flowering, reproductive success, plant adaptation in the local environmental condition are considered important factor for newly developed hybrid population (Wang et al., 2011). In roses, continuous flowering is a biological trait which is commercially economical which guarantees constant cut flower supply (Bendahmane, Dubois, Raymond, & Bris, 2013). Usually normal flowering occurs in spring when photoperiodism, temperature and juvenility phases are completed. While in seedling, juvenile phase is short as seedling produces flower early with only 6-8 weeks of seedling germination (Devries & Dubois, 1983).

Ploidy level of roses reached up to now at polyploid (Roberts, Gladis & Brumme,

2009). Diploid roses make the genome sequencing feasible with the help of molecular markers but frequent heterozygosity at genomic level is always considered drawback in breeding (Foucher et al., 2013; Shuleav et al., 2011). Development in genetic and genomic resources make the genetic mechanism clear whether it is created from specie or variety in a studied population (Linde, Hattendorf, Kaufmann, & Debener, 2006; Longhi et al., 2014; Moghaddam, Leus, Deriek, Van Huylenbroeck, & Van Bockstaele, 2012). Genetic linkage map is also cleared in tetraploid (Yu et al., 2015). RoKSN involves in continuous flowering which is created in diploid R. Chinensis and R. Wichurana population of six contrasting traits (Kawamura, Oyant, Thouroude, Jeauffre, & Foucher, 2015). In general, roses have two species, botanical species (wild) and hybrid species in which natural species are improved by conventional breeding methods. Stringent selection procedure takes 10 years for creation of new cultivar with innovate and interesting traits (Riffault, Destandau, Pasquier, Andre, & Elfakir, 2014). Variation in adaptability of roses may be differentiate into four groups; exotic varieties, indigenously evolved varieties, native rose species and exotic species. Propagation of roses is mostly done by grafting, by growing rootstock, through cutting and limited number through seed (Maurya, Yadav, Godara, & Beniwal, 2013; Park & Jeong, 2012). Most of the population of hybrids did not produce flowers. This may be due to gene factor (Devries & Dubois, 1983). The selection of parents was on color basis, color with attractive appearance and commercial importance. Either it is fragrant or mix color geometry. Selection of varieties on color basis may not give good interaction. Forkmann (1991) considered that varieties selection based on pigments and colors (flavonoids and anthocyanins) may interact with each other. Color expression may be suppressed by physiological inhibitors (metals ion) and recessive genes (Schieber, Mihalev, Berardini, Mollov, & Carle, 2005). These finding also correlates with Rosati et al. (2003) as flower coloration visuality may be due to unknown genetics involvement, environments flaws and growing condition (Gudin, 2000; Ferrante, Trivellini & Serra, 2010).

Number of prickles vary among each variety in this collected Rosa specie. The presence or absence of prickles may be due dominant and recessive alleles respectively (Baydar, Baydar & Debener, 2004; Rajapakse et al., 2001). The number

92 of flowers are decreased as temperature is increased and color of flowers is also changed. These finding correlates with the results of Moe & Kristofferson (1968). Effective pruning at right time also affects flower size by altering the growth in spring and size of flowers may also be affected due to additive genes. The new offspring may be intermediate of both parents (Baydar, Baydar & Debener, 2004; Ritzinger & Lyrene, 1999). Formation of double flower with intermediate color and prickles may be due dominant gene resulted from diploid parents (R. Multiflora), or conversion of stamen into petals (Morey, 1959). Crosses among polyploids may results in 98% interploidy (Vanbockstaele, Vanhuylenbroeck & Leus, 2004). Morphological markers may assist the variation resulted from the crosses of polyploids when there is always dominant allele involved in color, flowering and prickles characters (Devries & Dubois, 1983).

MITIGATION OF SEED DORMANCY IN DEVELOPED NEW COMBINATIONS AMONG ROSA SPECIES

Data was collected for germinated seedling resulted from the seed of successful crosses (Table 4.7) used in this study. Seed germination percentage after applied treatments is described below.

Control T0: Effect of Seed Storage at Room Temperature

In first treatment (T0), germination percentage was minimum ranged from 0 to 25 % among all cross combinations. All seeds were noted as dormant and failed to germinate except variety Bora bora crossed seed showed germination but died at cotyledon stage. This may be due to early seed ripening of Bora bora variety. Dry storage cannot enhance the seed germination of Rosa hybrida.

T1: Effect of Warm and Cold Temperature on Seed Germination

In second treatment (T1), germination percentage was ranging from 25 to 50 %. The minimum germination percentage was observed in seeds of Gruss an Teplitz variety. Although treatment was comprised of dry and cold stratification combined with the NaOCl significantly enhance the germination rate. The purpose of this treatment was to check the rose seed growth with cheap and economical practice.

Regardless, this treatment has enhanced germination percentage as compared to dry storage.

T2: Effect of Cold Stratification Combined with GA3

In third treatment (T2), germination percentage was ranging from 25 to 58%. The maximum seeds were germinated in this treatment. This treatment showed significant difference in percentage and rate of germination as compared to all other treatments. seeds extracted from rose hips were rinsed with NaOCl and stratified for

90 days. Seeds were soaked in GA3 solution before sowing in growing media. This treatment proved effective for enhancing germination percentage in all hybrid crosses.

T3: Effect of Warm and Cold Temperature in Combination with GA3

In fourth treatment (T3), germination percentage was ranging from 8 to 42% among all crosses as described in Table 4.8. Freshly harvested achenes were dry stored for 30 days and 60 days stratified. After these, seed were soaked in GA3 solution before sowing. These seeds were germinated but less then second (T1) and third treatment (T2). These seeds grown from this treatment were abnormal and mostly germinated seeds cannot survive.

In this study, the maximum germination percentage was observed in third treatment (T2) in Bora bora variety cross (Bora bora x Morstylo = 58%) while minimum seed germination percentage (8%) was observed in Gruss an Teplitz cross (Gruss an Teplitz x Bridal pink). By comparing all treatments, maximum seed germination percentage was observed in Bora bora cross followed by Midas touch and Gruss an Teplitz.

Seedling Germination Days

The results of all seed treatments are described below in detail as shown in

Figure 4.28. The third treatment (T2), seed germination was early as compared to other treatments. The difference in seedling germination days was also observed which are shown in Figure 4.29. The maximum early seed germination was observed in variety Bora bora crosses (V14) as compared to Midas touch (V6) and Gruss an

Teplitz (V21) crosses. The seed germination percentage obtained by different treatments represented in Table 4.8. In first treatment (T0), the seedlings germination showed non-significant variations with a minute germination percentage as compared to other treatments. Mostly seeds remained dormant and were not germinated. The seeds germination percentage was not good and few numbers of seeds were germinated by second treatment (T1). In this treatment, the seed of crosses started germination (28.14) days after sowing. The third treatment (T2) showed significant results regarding germination days and germination percentage.

Maximum seed germination time was counted 24.85 days. In fourth treatment (T3), the average germination period of rose seeds was recorded 26.41 days by showing less number of seedlings as compared to T2 and T1 treatments. Detail description of collected data from successful hip set up to number of plants survived after successful germination is given in Table 4.9.

Table 4. 8: Seed germination percentage resulted from different treatments Cross Name Cross T0 % T1 % T2 % T3 % Midas touch x Eye paint v6 x v4 8% 25% 42% 25% Midas touch x Fragrant plum v6 x v5 8% 42% 33% 33% Midas touch x Elina v6 x v7 0 0 0 0 Midas touch x Anne Marie Trechslin v6 x v9 0 0 0 0 Midas touch x Bridal pink v6 x v12 8% 25% 42% 25% Midas touch x Morstylo v6 x v13 0 0 0 0 Midas touch x Pat austin v6 x v15 8% 25% 50% 25% Midas touch x Hot cocoa v6 x v17 0 0 0 0 Midas touch x Broceliande v6 x v19 0 0 0 0 Midas touch x Scentimental v6 x v20 17% 42% 42% 25% Bora bora x Eye paint v14 x v4 17% 50% 42% 33% Bora bora x Fragrant plum v14 x v5 8% 33% 42% 33% Bora bora x Elina v14 x v7 8% 25% 42% 25% Bora bora x Anne Marie Trechslin v14 x v9 17% 42% 50% 33% Bora bora x Bridal pink v14 x v12 25% 50% 42% 42% Bora bora x Morstylo v14 x v13 17% 42% 58% 33% Bora bora x Pat austin v14 x v15 17% 50% 33% 42% Bora bora x Hot cocoa v14 x v17 0 0 0 0 Bora bora x Broceliande v14 x v19 0 0 0 0 Bora bora x Scentimental v14 x v20 0 0 0 0 Gruss an Teplitz x Eye paint v21 x v4 0 0 0 0 Gruss an Teplitz x Fragrant plum v21 x v5 0 0 0 0 Gruss an Teplitz x Elina v21 x v7 0 0 0 0 Gruss an Teplitz x Anne Marie Trechslin v21 x v9 8% 0% 33% 17% Gruss an Teplitz x Bridal pink v21 x v12 0% 8% 8% 0% Gruss an Teplitz x Morstylo v21 x v13 8% 17% 25% 8% Gruss an Teplitz x Pat austin v21 x v15 17% 0% 25% 8%

Gruss an Teplitz x Hot cocoa v21 x v17 0 0 0 0 Gruss an Teplitz x Broceliande v21 x v19 0 0 0 0 Gruss an Teplitz x Scentimental v21 x v20 0 0 0 0 To = Control= 90 days at room temperature (24± 2°C), T1= NaOCl= NaOCl (5% w/v) for 10 minutes plus 30 days at warm (24± 2°C) and 60 days at 5 ± 1°C, T2= NaOCl + GA3= NaOCl @ 5% -1 w/v for 10 minutes and 90 days at 5 ± 1°C and 1 g l GA3 for 16 hours before sowing, T3= Combined -1 statification+ GA3= 30 days warm (24± 2°C) and 60 days at 5 ± 1°C and 1 g l GA3 for 16 hours before sowing

Table 4. 9. Successful seedlings after transplantation screened for morphological traits Cross Hip Seeds /hip Seeds Germinated Selected set % sown seedlings plants* Midas touch x Eye paint 33% 14.00±0.2ab 32 12 0 Midas touch x Fragrant plum 44% 11.33±0.2a-c 29 8 3 Midas touch x Elina 0% 0±0d 0 0 0 Midas touch x Anne Marie 44% 9.667±0.2a-c 26 7 4 Trechslin Midas touch x Bridal pink 56% 14.33±0.3ab 36 12 3 Midas touch x Morstylo 0% 0±0d 0 0 0 Midas touch x Pat austin 33% 12.66±0.2a-c 24 7 4 Midas touch x Hot cocoa 0% 0±0d 0 0 0 Midas touch x Broceliande 0% 0±0d 0 0 0 Midas touch x Scentimental 33% 11.33±0.2a-c 30 9 0 Bora bora x Eye paint 0% 0±0d 0 0 0 Bora bora x Fragrant plum 44% 11.66±0.2a-c 31 11 3 Bora bora x Elina 56% 14.00±0.2ab 35 12 0 Bora bora x Anne Marie Trechslin 44% 12.33±0.1a-c 37 17 3 Bora bora x Bridal pink 56% 15.00±0.2a 32 17 1 Bora bora x Morstylo 44% 11.00±0.2a-c 24 18 0 Bora bora x Pat austin 44% 11.66±0.2a-c 25 17 2 Bora bora x Hot cocoa 0% 0±0d 0 0 0 Bora bora x Broceliande 0% 0±0d 0 0 0 Bora bora x Scentimental 0% 0±0d 0 0 0 Gruss an Teplitz x Eye paint 56% 9.667±0.1a-c 29 8 3 Gruss an Teplitz x Fragrant plum 56% 8.00±0.2c 28 2 0 Gruss an Teplitz x Elina 44% 7.333±0.2c 21 0 0 Gruss an Teplitz x Anne Marie 56% 9.333±0.2bc 22 6 4 Trechslin Gruss an Teplitz x Bridal pink 56% 9.000±0.2bc 27 9 3 Gruss an Teplitz x Morstylo 56% 9.000±0.1bc 27 8 2 Gruss an Teplitz x Pat austin 67% 11.33±0.3abc 22 7 2 Gruss an Teplitz x Hot cocoa 0 0±0d 0 0 0 Gruss an Teplitz x Broceliande 0 0±0d 0 0 0 Gruss an Teplitz x Scentimental 0 0±0d 0 0 0 Data are presented in means (±SD), *Selected plants= The plants used in genetic diversity study after their morphological trait assessment

Data regarding germination of seeds varies among all treatments. The seeds resulted from crosses were germinated within different days among different treatments. In case of control treatment (T0) was given to seeds, the seeds germination starts after 39.34 days of sowing. The germination percentage was too low (nearly zero). The germinated seedling could not survive after imbibition days. This may be due to various factors regarding embryo immaturity and seed hormones imbalance. In the treatment T1, seed germination was observed after 29.91 days of sowing. In the treatment T2, results were significantly different from other treatments as 26.68 days which were minimum days than other treatments. The variations ranged from 26.68 days to 39.34 days. The treatments T3 seedling germination was observed after 28.50 days of sowing. The germination of seed varies among each cross significantly. The early seedling germination (29.37 days) was observed in variety Bora bora cross (V14 x V15). The variety Midas touch crosses seed germinated after 32.33 days of sowing. The variety Gruss an Teplitz crosses seed germination was observed after 29.83 to 31.04 days. The seed resulted from different crosses showed different germination percentage with varying level of success in growth as described in Figure 4.29.

45 Seed Germination Days 40

20 Germination Germination days

0 T0 T1 T2 T3 Treatments

Figure 4. 28: Day taken to seed germination under different applied treatments

Our findings may also correlate with the results Vasil (2009), germination of rose

97 seeds followed by chemical treatment and low temperature storage respond better up to 50 % germination. Scratching of pericarp of seed did not prove fruitful seed germination improvement. Storage of rose seed at room temperature and cold temperature also effective in germination as it also decreases rose dormancy (Werlemark et al., 1995; Zhou, Bao & Wu, 2009). Rose seed dormancy may correlate with seed morphological characters and seedling behavior after germination (Oni & Bada, 1992). The purpose of different treatments was to promote seed germination with rapid growth for establishment of hybrid seedling nursery as developed by Okunlola, Adebayo & Orimogunje (2011).

33 Germination Days

30 Days

Cross combinatios

Figure 4. 29: Day taken to germinate seeds of different cross combiantions

Seedling leaf at the time of transplantion

The germination days of seedlings vary among each hybrid cross population. The seedling after germination were transplanted with a specific interval of days (60 days of germination). The maximum seedling of variety Gruss an Teplitz cross were transplanted at 4.50 to 5.50 leaf stage. The variety Bora bora seedlings were

98 transplanted at 4.1 to 5.00 leaf stage. The variety Midas touch cross seedling were transplanted 4.25 to 4.91 leaf stage.

6 Seedling Leaf

Number Number leafof 2

Figure 4. 30: Average number of leaves at the time of transplantaion of seedlings

Seedling length at the time of transplantion

At the time of transplantation, data regarding morphological attributes was taken for new hybrid population. The variation in seedlings was observed in all crosses at the time of transplantation. The maximum seedling length was measured at the time of transplantation in variety Gruss an Teplitz cross ranging from 7.05 to 8.41 cm. The seedling length was measured in variety Bora bora cross ranging from 6.71 cm to 7.96 cm. The seedling length of the variety Midas touch cross ranging from 6.23 cm to 7.28 cm was measured at the time of transplantation.

Seedling root length at the time of transplantion

The root length of hybrid seedling was observed at the time of transplantation. The variation among all hybrid population was observed. The root length of variety Gruss an Teplitz cross was observed ranging from 1.20 cm to 2.17 cm. The root length of variety bora bora cross was observed ranging from 1.27 cm to 1.91 cm. The root length of variety Midas touch cross ranging from 1.15 cm to 1.55 cm was

99 observed. The data regarding seedling root was randomly collected at the time of transplantation.

9 Seedling Length 8 7 6 5 4

Lengthcm 3 2 1 0

Crosses of varieties

Figure 4. 31: Average seedling length at the time of transplantation

2.5 Seedling Root Length

1.5

1 Rootlengthcm 0.5

Crosses combinations

Figure 4. 32: Average seedling root length per cross combination grown by different seed

Seedling shoot at the time of transplantion

The significant variations were observed among all seedling shoot length. The seedling shoot length in variety Gruss an Teplitz cross observed ranging from 5.00

100 cm to 11.15 cm. The seedling shoot length in variety cross Bora bora observed ranging from 5.39 cm t 6.89 cm. The seedling shoot length in variety Midas touch cross was observed ranging from 5.05 cm to 6.12 cm at the time of transplantation.

Seedling Shoot Length 12

4 Shoot lengthcm 2

Cross combinations

Figure 4. 33: Average seedling shoot length per cross combiantion grown by different seed treatments

Discussion on germination of rose seed

In this experiment, effective seed germination treatments were applied on seed. The main emphasis of work was to enhance the seed germination percentage to establish seedling rapidly and uniformly under suitable environment. The quantity of hybrid seed was less and always considered as valuable assets. Production of seed is a phenotypic character which depends on the genetic seed potential factor and adoptability environment of plant (Finch-Savage & Bassel, 2015.). Roses seed germination mainly inhibited by hard seed coat and stubborn dormancy due to hormonal imbalance (Alp, Ipek & Arslan, 2008; Werlemark, 2009). Dormancy can be minimized by keeping seeds at dry and proper storage conditions (Crocker & Barton, 1931). Dormancy may vary in varieties, modern roses and seeds of one bush (Nadeem et al., 2014). In this study, dry and cold stratification combined with the NaOCl significantly enhance the germination percentage (25 to 50%). Use of disinfectant also prove suitable for seed treatment. But, rinsing with NaOCl, kept at

101 lower temperature for 90 days and Dipping in GA3 solution before sowing showed maximum germination success percentage (25 to 58%) in all crosses seed among all treatment. In earlier studies, lower temperature (5 oC) suppresses abscisic acid contents, promotes embryo growth and chemical treatments are used to loosen the hard seed coat (Nadeem et al., 2014; Younis, Riaz, Ahmed, & Raza, 2007; Zlesak, 2007). Stratification and scarification treatment in Rosa genus may give up to 50 percent success rate in germination (Vasil’eva, 2009). Seed setting success can be improved by using fertile pollen donor parent but seed maturity varies at the time of harvesting (Bo, Huiru & Xiaohan, 1993). Seed germination success rate was 16.7 % to 18.5 %. The lower success rate may be due to dead embryo or abortion of embryo and shriveled seeds (MacPhail, 2007), or it may be reason of seedling early wilting leads to death (Svejda, 1968). Maximum survival of seedling is an important aspect after germination to get new hybrid. Clor, Crafts & Yamaguchi (1963) study depicts that variation in humidity during growth of seedlings may be the reason of early seedling death as it blocks the plant physiological activities. This cause leads to the bacterial and fungal diseases. The appearance of browning edges on fresh leaves or leaflets may be due to the variation in humidity. This may be helpful for disease spreading on the damaged cuticle of leaf at seedling stage (Bhattacharjee, Singh & Saxena, 1993). The increase in humidity also shows different drawbacks which boosts mildew disease. The most important factor regarding seedling growth and development is bacterial wilt at early stage due to Agrobacterium tumefaciens (Phillips, 1998; Smith, Zukel, Stone, & Riddell, 1959).

In this experiment, seedling germination was occured, but some seedling does not give flowering. In this experiment, seed treatment followed by NaOCl followed by cold stratification give significant results. The seed treatment with warm stratification and cold stratification also give significant result when GA3 was applied before sowing. The results were nearly zero when no treatment was given to seed before sowing. The seed without application of NaOCl also germinated but seedling did not survive. These finding correlate with the findings of Werlemark, Carlson-Nilsson, Uggla, & Nybom (1995) and Zhou, Bao & Wu (2009), cold stratification in combination with warm stratification can also break seed dormancy as a result seed germination can be possible. The early germinated seedlings were

102 healthy. These finding correlate with Oni & Beda (1992), as the study reveals that germination can also increase seedling vigor. Seedlings can possibly be used for rapid and vigorous nursery establishment for desired specie (Okunlola, Adebayo & Orimogunje, 2011). Seed treatment evently boosts the seed growth by inhibiting the growth hormone such as ABA and it resulted in germination of embryo. Embryo may be mature or weak depending on seed maturity at the time of harvesting. In seed of rose, ABA present and works as inhibitor (Vanoverbeck, 1966). As inhibitor is removed by stratification and scarification, GA3 application increases the growth (Lipe & Crane, 1966).

Nursery Seedling Growth Performance

Rose seeds have germination problem due to associated factor of hard seed coat and hormonal factors. However, germinated seedling root performance assessment before transplantation avoiding heat shock is critical to ensure performance after shifting. In this experiment, roots of seedling were assessed at the time of transplantation. Maximum number of roots development may be helpful for successful propagation after transplanting. Data was analyzed by using factorial design to assess the root length of hybrid seedling of different crosses. Four different treatment (one control and three other treatments) were applied just after seed extraction to increase the seed germination percentage. After different treatments, all seeds were sown in peat moss germination media. Irrigation water was applied regularly according to requirement. Germination started after 26.28 days of sowing.

Figure 4. 34: One year old seedling plants in greenhouse. Picture showing hybrid seedling of H106, H104 and overall seedling plants

103

Data was collected from germination up to transplantation to get the best treatment results. Germination of seedling was determined by growth of cotyledon and hypocotyl above media (0.5 cm) as collected by Nadeem et al. (2014).

Results of hybrid seedlings growth

The maximum root length (1.60 cm) was observed in treatment T4 closely followed by treatment T3 with the root length of 1.50 cm. The maximum root length (2.17 cm) was observed in cross of V21 x V15. The shoot length of seedlings varied significantly in all treatments. Growth and accumulation of more biomass after the seed germination can vary in every seedling. In this study seed germination percentage varied from 50 % to 8 % in all crosses. The maximum seed germination was observed in crosses of Bora bora followed by Midas touch and Gruss an Teplitz. Among all crosses germination percentage ranges in average among 42 % to 25 % in all treatments. These findings may also corelate with the finding of Gudin (2000) as success of crosses was minimum (22.5 %) and minimum germination success (18 %) in hybrid rose seeds. Fluctuation in cross success and germination success was also explained earlier (Fagerlind, 1951; Gudin, Arene, Chavagnat, & Bulard, 1990; Werlemark, Carlson-Nilsson, Uggla, & Nybom, 1995).

Success rate of hip formation does not mean the germination of all produced seed. Seeds may have germination hindrance due to light, temperature, embryo abortion, hard seed coat and hormonal imbalance (Bo, Huiru & Xiaohan, 1993; Zhou, Bao & Wu, 2009). Natural and artificial crosses in hybrid roses may reflex variation in hybridization (Bendahmane, Dubois, Raymond, & Bris, 2013). It may be due to different ploidy level or it may generate non-viable seeds (Rout, Mohapatra & Jain, 2006). The developed progenies can be differentiated by bloom habit, color variation, prickles presence on stem (Shupert, Byrne & Pemberton, 2005) and Intercellular spaces confirmation through electron microscopy (Panteris, Apostolakos & Galatis, 1993; Wernicke, Gunther & Jung, 1993; Yamada, Norikoshi, Suzuki, Imanishi, & Ichimura, 2009). Plant photosynthetic activity for growth may be differentiated (Hellmann & Wernicke, 1998; Schroder, Stenger & Wernicke, 2001; Uehara & Hogetsu, 1993). The quality growth and productivity of cut rose flower may correlate with availability of sunlight (Horibe & Yamada, 2017).

104

Discussion of seedling plants

In this study, the germinated seedlings behave differentials as compared to parent in growth habit and morphological traits including leaf color. The findings also corelate with the Zlesak (2007a) as growth, color and size of hybrid tea roses vary greatly. The results may also correlate with the Torres, Millan & Cubero (1993) that hybrid tea may vary in number of leaflets in contrast to other rose species as hybrid have 5-7 leaflets. The variants in progeny related to their parents can exhibit heterosis as this is control by various dominant gene (Noguchi, Muro & Morishita, 2008). There may also be variation in size, color, foliage of interspecific hybrid and parents of Rosa specie (Nadeem, Younis, Riaz, & Lim, 2015) as these variations may occur in qualitative and quantitative traits. In our study, leaf color variation was also observed between parents from dull, thick and shiny foliage. The foliage may be dull, long lasting, red to purple mix or shinny appearance is mostly attractive and is dominant trait that may appear in progeny of hybrid crosses. The qualitative traits of inheritance for leaf margin and leaf hairiness may vary variety to variety in species (Shupert, Byrne & Pemberton, 2005). The variation in environmental condition are different from the other area of Punjab, as this area is only irrigated through rain rather than canal system. The variation in environmental condition, availability of light and influence of temperature may also affect flowering traits (Ferrante, Trivellini & Serra, 2010).

Dark color of foliage may be under cooler condition and may be due to anthocyanin accumulation (Plaut, Zieslin, Grawa, & Gazit, 1979). When the temperature increases above 39 °C, color of petals may faint due to reduction in synthesis of anthocyanin or this may be due to gene dominant action (Dela et al., 2003; Devries & Dubois, 1983). There was variation in developed population in early stage of growth and make difficult to describe. These variations were also observed in growth, foliage, color, pigment composition in developed population may be due to heterozygous nature of parents in accordance with Shupert, Byrne & Pemberton (2005). New hybrid population was compared with parents on the basis of morphological traits. The growth habit and plant stature may be climbing or non climbing, dwarf to semi dwarf controlled by same genetic factor or locus (Dubois &

105

Devries, 1983; Zlesak, 2007a). In our study, single to spreading type plant were observed. The observation correlate with the finding of Rajapakse et al. (2001) that variation in growth habit may result in intermediate growth in new population. This is dominant type of behavior as it can be segregate in F2 population. Number of characters that are inherited and bush growth habit may be due to enormous complex genes present on locus (Lal, Seth, Yadav, & Danu, 1982) as these are controlled by major codominant gene (Rajapakse et al., 2001).

In our study, fragrance characters were also observed in Rosa hybrida parents. The fragrance characters may be controlled by major dominant gene in tetraploid roses (Cherri-Martin, Jullien, Heizmann, & Baudino, 2007). Fragrance is due to monoterpene alcohols and aldehyde pathways (Lammerts, 1945). The number of prickles variation was observed in progenies and parents. By comparing the parents and progenies, cluster was developed to check the combination of characters and relationship of parents in relevant to their progenies. The variation in number of prickles in progenies and parents may be due to difference in genetic makeup as hybrids are heterozygous. The presence of prickles determines the presence of dominant gene in the genetic makeup of each variety (Debener, 1999). Prickles may be desired character as it is introduced in other Rosa specie (Debener & Mattiesch, 1999; Rajapakse et al., 2001). The performance of plant of any genotype is mixture of complex phylogenetic traits and can alter the vigor of any cultivar and genotypes while being transmitted to next generation. Growth performance and yield can also be altered by environmental influence (Yan et al., 2005).

MORPHOLOGICAL DATA OF HYBRID PROGENY POPULATION

Germinated seedlings were transplanted in pots in peat moss growing media. These seedlings were placed in green house for adaptability. The data was collected to check the variants in these seedlings. Plant height was measured during growth from stem base of plant (rim of pot) to the end of apical bud (Gitonga et al., 2014). The significant variation was observed in all hybrids plant height. The plant height among all hybrid varies from 78.76 cm to 83.15 cm. The flower persistence life among hybrid population of different crosses varies from 7.43 to 13.46 days and flower persistence life of parents varies from 7.66 days to 13.33 days.

106

Table 4. 10: Examined morphological characters of hybrid progenies of Rosa hybrida varieties Hybrid no Parentage Height (cm) Flower persistence life (days) Flower diameter (cm) No of Petals Prickles 101 v21 x v5 71.13 h-l 10.23 j-n 4.50 n 23.23 j-n 6.76 rs 102 v14 x v9 71.53 g-l 12.10 cd 6.50 gh 20.76 op 12.23 h-l 103 v21 x v12 75.00 c-i 10.00 mno 4.86 lmn 23.76 i-m 10.66 k-o 104 v14 x v9 78.76 abc 8.90 p-t 6.30 hi 22.00 mno 10.66 k-o 105 v6 x v12 76.56 b-f 8.66 q-t 7.36 cde 21.56 no 11.43 i-m 106 v21 x v12 76.03 b-g 9.56 nop 4.83 lmn 22.90 lmn 11.10 j-n 107 v6 x v5 67.26 lm 13.23 ab 6.90 fg 23.10 j-n 11.36 i-m 108 v21 x v4 70.63 i-l 7.43 v 4.80 lmn 25.80 e-i 10.90 j-n 109 v21 x v5 67.33 l-m 12.10 cd 4.96 lm 23.56 j-n 6.46 rs 110 v6 x v15 76.63 b-e 12.56 bc 7.36 cde 22.13 mno 12.20 h-l 111 v21 x v12 64.03 m 10.33 i-m 5.16 l 25.13 f-j 6.90 rs 112 v21 x v7 72.06 f-k 8.33 stu 4.93 lmn 23.86 h-m 5.86 s 113 v21 x v7 69.23 jkl 8.90 p-t 4.93 lmn 23.00 k-n 7.76 qrs 114 v21 x v4 74.16 d-i 11.00 fghi 4.96 lm 26.20 efg 7.90 qrs 115 v6 x v15 71.16 h-l 8.23 tu 7.36 cde 24.00 h-m 13.03 h-k 116 v21 xv12 70.60 i-l 10.10 k-n 4.73 lmn 24.00 h-m 10.66 k-o 117 v6 x v5 72.00 g-k 9.10 pqr 7.50 bcd 24.43 g-l 13.80 hi 118 v21 xv5 68.20 klm 10.10 k-n 4.73 lmn 23.00 k-n 6.66 rs 119 v21 x v9 74.20 d-i 11.56 def 4.90 lmn 25.90 e-h 12.90 h-l 120 v21 x v9 71.93 g-k 9.30 opq 4.90 lmn 27.63 e 13.36 hij 121 v21 x v5 67.60 klm 8.46 rst 5.03 lm 26.23 efg 5.90 s 122 v21 x v12 64.03 m 11.10 fgh 4.66 mn 26.10 efg 8.76 n-r 123 v14 x v9 72.06 f-k 10.76 g-l 6.36 hi 24.80 g-l 8.10 p-s 124 v21 x v9 69.23 jkl 10.03 l-o 6.00 ijk 23.56 j-n 7.10 rs 125 v21 x v4 74.16 d-i 10.33 i-m 4.83 lmn 25.00 g-k 6.53 rs 126 v21 x v5 71.16 h-l 10.80 g-k 4.90 lmn 24.80 g-l 6.70 m-q 127 v14 x v5 70.60 i-l 13.43 a 4.90 lmn 25.90 e-h 10.46 l-p 128 v21 x v5 71.13 h-l 10.86 f-j 4.63 mn 25.90 e-h 12.46 h-l 129 v21 x v9 71.53 g-l 11.23 fgh 4.80 lmn 25.76 e-i 10.66 k-o 130 v21 x v4 75.00 c-i 10.86 f-j 4.63 mn 25.76 e-i 10.66 k-o 131 v6 x v7 78.76 abc 13.46 a 7.43 cde 27.10 ef 11.13 j-n 132 v21 x v5 76.56 b-f 11.43 defg 4.86 lmn 25.70 e-i 11.90 j-m 133 v21 x v12 76.03 b-g 12.90 ab 4.83 lmn 25.00 g-k 8.33 o-s 134 v6 x v5 67.26 lm 12.90 ab 5.63 jk 25.10 f-j 12.66 h-l

107

Figure 4. 35: Dendrogram grouping of parents on the basis of morphological data used in conventional breeding

108

Figure 4. 36: Tree diagram showing the grouping of Rosa hybrida varieties with their hybrid progenies for morphological traits

109

Figure 4. 37: Resulted hybrid from the cross combination of Gruss an Teplitz (female parent) and Bridal pink (male parent)

110

Figure 4. 38: Resulted hybrid from the cross combination of Gruss an teplitz (female parent) and Morstylo (male parent)

111

Figure 4. 39: Resulted hybrid from the cross combination of Gruss an Teplitz (female parent) and Hot cocoa (male parent)

112

Figure 4. 40: Resulted hybrid from the cross combination of Midas touch (female parent) and Anne Marie Trechslin (male parent)

113

Figure 4. 41: Resulted hybrid from the cross combination of Bora bora (female parent) and Anne Marie Trechslin (male parent)

114

Table 4. 11: Morphological characters of the Rosa hybrida parents used in rose breeding programme in Pothwar climate Varieties Color Flowering Seed Parent Inflorescence Leaf Flowers Fragrance character setting character type hairiness pedicel prickles Eye paint (V4) Red blend, white centered Repeat Yes Mother, Father Solitary Serrated Absent Mild fragrance flowering Fragrant plum (V5) Mauve, purple blend Repeat No Father Solitary Serrated Absent Strong fruity flowering fragrance Midas touch (V6) Deep yellow Repeat Yes Mother Cluster Serrated Present Strong flowering fragrance Anne Marie Trechslin Deep orange pink Repeat No Father Solitary Unserrated Absent Slight (V9) flowering fragrance Bridal pink (V12) Medium pink Repeat No Father Solitary Serrated Present Strong flowering fragrance Morstylo (V13) Orange Repeat No Mother, Father Cluster Unserrated Present Slight flowering fragrance Bora bora (V14) Orange red Repeat Yes Mother Cluster Unserrated Present Mild fruity flowering fragrance Pat austin (V15) Smokey chocolate-orange Repeat No Mother, Father Cluster Unserrated Present Sharp fruity flowering fragrance Hot cocoa (V17) Pink blend, blush white Repeat No Father Solitary Serrated Present Fruity flowering fragrance Gruss an Teplitz (V21) Crimson red Repeat Yes Mother, Father Cluster Serrated Present Fragrance flowering

Table 4. 12: Morphological characters of the hybrid seedlings successfully shifted in field Cross Cross combinations Flowering Petals Prickles Leaf Leaflet Special Color hairiness size characters v21 x v12 Gruss an Teplitz x Bridal pink Solitary 9 9 Serrated 7.4 cm Spreading Crimson red v21 x v12 Gruss an Teplitz x Bridal pink Solitary 11 6 Serrated 8.4 cm Spreading Crimson red v21 x v4 Gruss an Teplitz x Eye paint Solitary 19 16 Serrated 8.6 cm Bushy Crimson red v21 x v17 Gruss an Teplitz x Hot cocoa Solitary 13 4 Serrated 4.7 cm Climber Crimson red v21 x v15 Gruss an Teplitz x Pat austin Cluster 34 23 Serrated 6.6 cm Bushy, compact Crimson red

115

v21 x v5 Gruss an Teplitz x Fragrant plum Cluster 14 10 Serrated 9.6 cm Spreading Crimson red v21 x v9 Gruss an Teplitz x Anne Marie Trechslin Solitary 29 10 Serrated 7.3 cm Bushy Bright red blend v6 x v13 Midas touch x Morstylo Solitary 10 14 Serrated 11.9 cm Spreading Yellow v14 x v9 Bora bora x Anne Marie Trechslin Solitary 39 6 Serrated 11.7 cm Bushy Orange and red v6 x v4 Midas touch x Eye paint Solitary 18 11 Serrated 6.5 cm Spreading Red and white blend v6 x v4 Midas touch x Eye paint Solitary 9 19 Serrated 7 cm Spreading Yellow Prickles: the number of prickles at 10 cm area after 2-4 nodes from base after complete crop emrgance

116

The flower diameter of hybrid population varies from 4.5 to 7.5 cm and parents varies from 5.62 cm to 7.98 cm. The number of prickles of hybrid population varies from 5.86 to 13.80 and number of prickles in parents varies from 10.46 to 44.11 among all varieties used in breeding. The number of flower petals among hybrid population varied from 20.76 to 27.63 among the flower bearing progenies. The number of petals per flower in parents varies from 18.92 to 52.70 petals per flower. The results of hybrid population may correlate with findings of Zeinali, Tabaei- Aghdaei & Arzani (2009) in which morphological data of rose genotypes were collected and height of plant varies from 64 cm to 84 cm. Variation in plant height was also observed in various hybrid tea cultivars ranged in 87 cm to 139 cm (Tabassum, Ghaffoor, Waseem, & Nadeem, 2002).

Plant height may be controlled by dominant gene (Dubois & Devries, 1983). The flower petals always counted in numbers and number of petals vary among varieties and controlled by dominant gene. Dominance nature of allele may also be appeared in developed progenies (Shupert, Byrne & Pemberton, 2005). Our results also correlate with the results of Tabassum, Ghaffoor, Waseem, & Nadeem (2002) that the hybrid tea roses flower diameter varies from 5.17 cm to 7.93 cm. The performance of hybrid rose cultivars was also recorded to confirm the variation in different flowering characters. The genetic makeup can adhere the variation due to cultivars and adapted climate (Ramzan, Hanif & Tariq, 2014). Introduction of double flower characters in crosses of old garden and modern roses by involvement of Rosa multiflora (Debener & Mattiesch, 1999). Lamerts (1945) and Lal, Seth, Yadav, & Danu (1982) study depicts that length of petals varies as it is controlled by dominant gene.

Parent Varieties and Developed Progenies Description

The collected data regarding morphological parameters was described by cluster analysis. The parents used in crosses and developed progenies were analyzed by creating dendrogram. All the understudy parameters were statistically analyzed to check their relationship with one another according to collected data in the field. The PCA examination of data indicates 184.04 eigenvalue and 68.37 % variance while the grouping of data was done to check the relationship of Rosa species with their

117 hybrid population and parents used in hybridization programme. The cluster analysis based on analyzed data is shown in Figure 4.36. The cluster one is combination of Hot cocoa (V17), Eye paint (V4) and Anne Marie Trechslin (V9). The second cluster comprised of Morstylo (V13), Elina (V7) and Pat austin (V15). The third cluster consisted of group of Gruss an Teplitz (V21), Scentimental (V19), Broceliande (V20) and Bora bora (V14). The fourth cluster consisted of Midas touch (V6), Fragrant plum (V5) and Bridal pink (V12) as shown in Figure 4.35.

The data regarding varieties and crosses were statistically analyzed to check the relationship between new progeny and parents. The PCA examination of data represents 28.00 equivalence and 53.19 % variance. The cluster analysis based on examined data showed the relationship with their parentage. The cluster one depicts that variety V21 positively correlate with the hybrid H124, H101, H118, H113, H125, H111 and H109. The cluster two contain all the hybrid seedlings. The cluster three variety V6 and V5 correlate with each other and their character correlate with the cluster one and cluster two. The cluster four comprises of hybrid seedling H110, H102, V14, H122 and H121. The cluster five comprises of H129, V9, V7, H133, H123, H114, H108 and V4. The cluster 6 only comprises of V15 which behave differently among all hybrids and parents. The clustering shows the relationship of crosses of successful combination. Cluster is based on phenotypic description as variation may occur in morphological traits of the resulted progenies. It shows the significant differences regarding each traits by grouping the parent plant with their associated progenies. Comparison of genotypes with significant difference was also done earlier (Tabaei-aghdaei, Sahebi, Jafari, & Rezaee, 2004; Zeinali, Tabaei- Aghdaei & Arzani, 2009).

EVALUATION OF GENETIC DIFFERENCES IN DEVELOPED PROGNIES WITH THEIR PARENTS

Genetic Diversity Analysis

The purpose of this study was to determine the genetic variability in hybrid population of progenies regarding to their parentage. The DNA was isolated from fresh sample leaf including 34 hybrid population and 9 parent’s population by using

118

CTAB extraction method with minor modification (Ibrahim, 2011). Leaf of roses are more readily available than roots because roses commercial propagation mainly done through budding technique on resistant rootstock for desired varieties. The DNA quantification was done by Quawell UV-Vis Spectrophotometer Q5000 by loading 2 μl DNA sample while ultra-pure water was used as a reference before loading each sample. The DNA quantity was enough to run the PCR procedure but the amount of A260/280 ratio was lower. All DNA samples were positive to use for amplification but variation in the amplification was observed. On comparison of data, the large difference was observed. The PCRs reaction were performed according to procedure by using primer pairs of microsatellite SSR markers (Biber et al., 2010; Ibrahim, 2011; Oyant, Crespel, Zhang, & Foucher, 2008). A total set of 10 primer pairs were used to examine the genetic variability. Out of these, 7 primers show significant polymorphism among hybrids progenies and parents. Average polymorphism information content (PIC) range was observed. Cluster analysis of genetic diversity among parents and progenies was constructed to identify genetically variant plant. Hybrid roses have long history of cultivation for commercial production (Widrlechner, 1981). The analysis of 10 SSR markers showed that genetic variability was present in hybrid progenies relevant to their parents. On analysis of reproducible bands after PCR, genetic diversity for each sample varies among each locus. On cluster analysis, most of the hybrid fell in major grouping. Difference with in the progenies was found (Nadeem, Younis, Riaz, & Lim, 2015). Locus RMS15 (Ho= 0.772) and RA0421 (Ho= 0.676) showed the significant variation. The highest genetic variability was seen among parents and hybrid population. The genetic similarity of hybrid population as compared to parents depicts that most of parents show heterozygosity (HE). But observation after all loci, difference seems to be in- between. In contrast, locus HD13 (Ho=0.625), RWJ19 (Ho= 0.588) exhibited least heterozygosity and fewer number of obtained allele with intermediate polymorphism. Overall clustering among parents and offspring sample was generated to differentiate the hybrid population and parents against all primers. One group of cluster conatined majority of hybrids.

Genetic Diversity Analysis by Using Microsatellite SSR Markers

The observation of genetic variability among hybrid population and their

119 associated parents with the help of genetic markers has great advantage. For this purpose, microsatellite SSR markers proved efficient to amplify polymorphism across parents and hybrids (Nadeem, Younis, Riaz, & Lim, 2015). SSR markers proved effective bus in few samples. The hybrid progeny H127, H128, H133 and H118 on genetic diversity analysis by using locus RA0221 (0.455), RWN22 (0.411) reproduce less allele it may be failure of PCR or effectiveness of markers. Overall resulted data was enough to compare the average genetic variability of samples. The presence of polymorphism in all primers may be due to heterozygosity in genetics or recombination through meiosis (Zhang, Byrne, Ballard, & Rajapakse, 2006). Some of SSR markers have specific gene coding for specific plant function (Rusanov et al., 2005; Yan et al., 2005b).

In present experiment, tetraploid parents were used and have same numer of chromosomes. So, alleles per locus exhibit little variation. These variations may be more as polyploidy level increase or decrease (Esselink, Smulders, & Vosman, 2003; Oliveira, Padua, Zucchi, Vencovsky, & Vieira, 2006). The high level of allele was observed by locus RMS15 and RA0421. Outcrossing may be exhibited or may be due to heterozygous polyploidy nature of parent rose varieties. This produced high level of allele as compared to other selected markers. This result may correlate with the findings of Devries & Dubois (1995), as hybrid varieties mostly resulted from a limited gene pool therefore have less genetic variation. Less genetic variation may be due to contribution of closely related parents. Common alleles show narrow genetic variations (Hegarty & Hiscock, 2005). Contribution of complementary bands between hybrids and parents easily show variant hybrid population. Sharing of common allele may be possible through mutation in meiosis by hybridization process (Spiller, Berger & Debener, 2010). SSR markers found valuable for genetic variability and diversity analysis in oil bearing roses (Babaei et al., 2007; Rusanov et al., 2005). High genetic variability was also observed in Pakistani and Iranian oil roses (Baydar, Baydar & Debener, 2004; Farooq et al., 2013).

Discussion on Genetic Diversity Among Parents and Developed Hybrid Population

Genetic diversity in roses is performed by many researchers using various

120 molecular markers based on their objectives. Moghaddam, Leus, Deriek, Van Huylenbroeck, & Van Bockstaele (2012) sought disease resistant trait selection for breeding of rose population. Microsattlite markers are used for detection of genetic variations for various biological phenomenon with in wild and hybrid population (Agarwal, Shrivastava & Padh, 2008). Interaction of susceptibility and resistant in parent was determined with in their hybrid population (Allum, Bringloe, & Roberts, 2010). All the hybrid population developed from the crosses of two parent showed variation in associated morphological traits. The variations were also observed in the growth performance. The variation may be attributed to their heterozygous genetic variability. The main aim of this study was to determine the genetic basis in hybrid population. Bourke et al. (2018) examined the rose morphological traits (prickles and petals number) variations in different growing environment. Variation in morphological basis were also observed in many studies in diploid varieties. The variation in genetic basis in plant growth, prickles and number of petals variation are predominately influence in varying environment (Crespel et al., 2002; Debener & Mattiesch, 1999; Oyant, Crespel, Zhang, & Foucher, 2008; Li-Marchetti et al., 2017; Roman et al., 2015; Shupert, Byrne & Pemberton, 2005; Yan et al., 2005a). Due to heterozygosity in tetraploid roses, less work was done on genetic variability. In presented research work, tetraploid parents were used for hybridization. Many factors are involved including increase in ploidy among new varieties (Smulders, Esselink, Voorrips, & Vosman, 2009) and conventional or biotechnological approaches are used to identify the most problem. Breeding trend increased in tetraploids (Vukosavljev, Diguardo, Vande Weg, Arens, & Smulders, 2012) rather than diploid population (Debener & Linde, 2009). Rose (Rosa spp.) is most favorite and widely adaptable commercial, landscape and as garden plant throughout the world (Gudin, 2000). Varieties adaptation vary accordingly environment as vigor and growth may be influenced by biotic and abiotic stresses. Therefore, varieties modification inaccordingly climate change always preferred. A breeding programme was initiated based on locally adapted exotic varieties and evaluation of genetic variability through molecular markers is essential tool. Molecular markers are consistent source to observe genetic diversity in both offspring and parents (Powell et al., 1996).

121

Figure 4. 42: Description of genetic variability among parents and hybrid progenies in cluster grouping.

122

The selection of varieties was based on morphological description and widely used as garden or commercial production. DNA evaluation is most scientific, reliable tool and widely used to analyze polymorphism for genetic variations between parents and offspring (Rusanov et al., 2005). Fresh leaf sample has less cell division which contain enough amount of DNA (Kenis, Silvente & Trippi, 1985). Previously considerable efforts were enormously used to assess genetic similarities by using molecular markers such as SSR (Nadeem et al., 2014; Saidi, Eghbalnegad & Hajibarat, 2017; Samiei et al., 2010; Zhang et al., 2013). SSR markers has a sequence information regarding quantitative traits and can be used in a specie (Haque, Miah, Hossain, & Alam, 2013). Quantitative trait loci can be easily elaborated by using molecular markers (Oyant, Crespel, Zhang, & Foucher, 2008). Microsatellites, Simple Sequence Repeats (SSR), widely known genome sequence especially for dominant characters dtermination (Perez-Jimenez, Besnard, Dorado, & Hernandez, 2013; Phumichai, Phumichai & Wongkaew, 2015). SSRs classification based on unique sequences (Polymorphic) and repetitive dispersed elements (less polymorphic) for genetic diversity evaluation (Li, Rossnagel & Scoles, 2000; Ramsay et al., 1999).

123

SUMMARY

The adaptability of new varieties with variable change in humidity and temperature shows a lot of variation in growth and productivity. Pakistan environment, especially Pothwar area has a most conducive prospects for hybridization. Locally adapted genotypes have low range of diversity in flower color, size of flower, suitable stem length and lack of quality flower (early flower opening & early petals dropping), but having magnificent characters like, fragrance, adaptability, year around flowering and stress tolerance throughout the growing season. The exotic genotypes have compact flowering, Suitable cut flower with prolonged vase life as well field persisitance life, good flower size and range of diversity but have fragrance issue, delicate, adaptability issue and short flowering duration. So, the present research work was done to improve locally adapted genotypes by combining with exotic genotypes through conventional breeding approach in Pothwar climate.

The Rosa hybrida varieties including Doreen johnson, Helen naude, Mr waqar, Eye Paint, Fragrant plum, Midas touch, Elina, Jude-the-obscure, Anne Marie Trechslin, Magic lantern, First prize, Bridal pink, Morstylo, Bora bora, Pat austin, Angel face, Hot cocoa, Candy stripe, Broceliande, Scentimental and Gruss an Teplitz were grown at University Research Farm Koont, Pir Mehar Ali Shah, Arid Agriculture University Rawalpindi. Data was collected for plant height (cm), number of primary branches, number of flowers per stem, flower diameter (cm), number of flowers petals, number of prickles per 10 cm area and flower persistence life (days). Physiological parameters including leaf characters, photosynthetic rates, stomatal conductance, transpiration rates and water-use efficiency were assessed. Pollen fertility of selected varieties was assessed for initiation of conventional breeding program. Results indicated that growth and flowering in each variety increased up to month of May but decreasing trend was observed as temperature increased. The decreasing trend in vegetative growth and morphological aspects of varieties was observed with the decrease in rainfall and humidity. The average plant height also consistently increased with the number of primary branches. The overall performance of varieties Midas touch, Fragrant plum, Gruss an Teplitz, Helen naude

124 and Anne Marie Trechslin remained at top in all aspects. The interaction effect of number of flowers and number of petals per flower with respect to month varies significantly among each variety. Variation was also observed in petal length, flower stem length, number of prickles and flower persistence life in each variety. The correlation determination of experimental variety was constructed by cluster analysis. Varieties were grouped into six clusters on the basis of their traits. All traits significantly differ with in the varieties, but no significant correlation was observed among all these traits.

The highest photosynthetic response was expressed in Bridal pink (22.05 μmol 2 1 2 1 CO2 m- s- ) and First prize (21.08 μmol CO2 m- s- ). Candy stripe (14.10 μmol CO2 2 1 2 1 rd th m- s- ) and Gruss an Teplitz (13.48 μmol CO2 m- s- ) were placed in 3 and 4 ranking order respectively. Angel face and Gruss an Teplitz reflected maximum vegetative growth as these varieties leaf area and photosynthetic activity was prominent in open environment. Transpiration rate was at a maximum in First Prize -2 -1 -2 -1 (6.30 mol H2O m s ) followed by Candy Stripe (5.86 mol H2O m s ) and Morstylo -2 -1 (5.83 mol H2O m s ). The highest stomatal conductance was observed in Broceliande followed by Morstylo (201.92 mol m-2s-1) and Gruss an Teplitz (201.38 mol m-2s-1). The non-significant difference was observed in Morstylo, Gruss an Teplitz, Midas touch, Eye paint, Anne Marie Trechslin, First prize, Pat austin, Bora bora, Bridal pink and Jude the obscure as these ranked in same order. The non- significant difference was observed in Candy stripe and Morstylo in top ranking. Angel face, Broceliande, Scentimental, Midas touch and Bora bora ranked in center but at par with varieties Doreen johnson, Gruss an Teplitz, Magic lantern, Elina and Hot cocoa in center ranking order. Varieties Helen naude and Eye paint were at lower not least ranking order.

For hybridization success, pollen fertility status is also distinguished factor. The significant variation was observed in each variety for pollen viability percentage. The maximum pollen viability percentage was observed in Gruss an Teplitz (67.40 %), Midas touch (56.80 %) followed by Magic lantern (55.60 %) and Pat austin (54. 80 %). The maximum pollen germination percentage was observed in Gruss an Teplitz and Midas touch at 15 % sucrose germination media. The performance of

125 varieties First prize and Candy stripe was not satisfactory. The varieties Angel face, Gruss an Teplitz and Bora bora were considered fertile with nominated distinguishing results. Success of hybridization also depends on hip production. The varieties Gruss an Teplitz, Midas touch, Bora bora and Angel face were observed with maximum seed setting rate among all other varieties. Different cross combinatiions were performed in field among selected varieties. Ten varieties were selected as pollen donor parents and three were selected as seed bearing parents. Overall thirty cross combinations were made among pollen donor and hip bearing parents. The maximum successful crosses were observed in variety Gruss an Teplitz (67-44 %) followed by Bora bora (56-44 %) and Midas touch (56.33 %) while hip fresh weight and hip size was considerably different in each cross. In Midas touch crosses, hip fresh weight (5.63 g) and hip size (2.16 cm) was maximum. Some cross combinations failed in hybridization as they showed no positive results after pollination. Hip development was observed after three weeks showing the success of pollination. Ripened hips were harvested at the end of August and processed further for germination treatments. The seeds from hips were manualy extracted and stored for futher designed treatments. Four different treatments including control were applied to improve the germination of hybrid cross seeds.

Seed treatment with NaOCl just after extraction and warm combination with cold stratification proved helpful for promoting seed germination but use of GA3 can improve earliness and rapid growth for establishment of new population. Overall dry storage cannot improve germination but in-combination with cold temperature enhanced germination. The seed germination days varied in all treatment ranges from 26.68 days to 39.34 days. The seedling germination was observed in Bora bora crosses at first within 29.37 days after sowing followed by Gruss an Teplitz seedling growth. The length of storage can vary among varieties depending on their ploidy level and associated environmental factors from hip formation to seed ripening. Although, the NaOCl soaking and rinsing proved effective in-combination with dry and cold storage treatment. In this experiment, NaOCl rinsing and GA3 application on cold scarified seed improved germination percentage significantly. The resulted seedlings were also evaluated for number of leaves, length, root length and shoot length at the time of transplantation. Significant variation was observed in all

126 treatments and varieties seedlings.

Morphological data was analyzed by clustering to observe the variations in hybrid population. The grouping of data showed 68.37 % variance among examined data of parentage varieties, while comparing parents with seedling, 53.19 % variance was observed. Overall six clusters were observed and cluster number two only contained hybrid seedling. It showed that variation also arised in hybrid seedling in this study. The hybrid seedling population was also differentiated by using microsatellite molecular markers. The purpose of using SSR markers was to observe the extent of diversity for traits in hybrid population. Seven primer pairs significantly showed polymorphism among parents and progenies. Locus RMS15 (Ho= 0.772) and RA0421 (Ho= 0.676) showed the significant variation with maximum number of alleles. In contrast, locus HD13 (Ho=0.625) and RWJ19 (Ho= 0.588) exhibited least heterozygosity and fewer number of alleles were obtained with intermediate polymorphism. SSR markers proved effective in few samples H127, H128, H133 and H118. Locus RA0221 and RWN22 reproduce less allele, it may be due to failure of PCR or effectiveness of markers. From the microsatellite observation, difference appeared in genetic background as variation was observed in hybrid population and parents. The difference at initial growth seems to be narrow inheritance.

Overall, morphological variation was observed in F1 hybrids population. The plant height among all hybrid was varied from 78.76 cm to 83.15 cm. The flower persistence life among hybrid population was varied in-between 7.43 to 13.46 days as compared to their parents (7.66 days to 13.33 days). The flower diameter of hybrid population was less (4.5 to 7.5 cm) as compared to their parents (5.62 cm to 7.98 cm). The number of flower petals among hybrid population was varied from 20.76 to 27.63 as well as in parents (18.92 to 52.70). Number of prickles of hybrid population was significantly less on mature branch (5.86 to 13.80 per 10 cm area) as compared to parents (10.46 to 44.11 per 10 cm area). Overall gentic diversity in hybrid population was observed. So, collection of F1 seed for germination and resulted seedling will be valueable assest for future selection of new variants.

127

LITERATURE CITED

Abdolmohammadi, M., Kermani, M. J., Zakizadeh, H., & Hamidoghli, Y. (2014). In vitro embryo germination and interploidy hybridization of rose (Rosa sp). Euphytica, 198(2), 255-264.

Adhikari, D. R., Baral, D. R., Gautam, D. M., & Pun, U. K. (2014). Influence of time and intensity of pruning on growth and flowering behaviour of cut rose. Nepal Journal of Science and Technology, 15(1), 7-12.

Agarwal, A., Gupta, V., Haq, S. U., Jatav, P. K., Kothari, S. L., & Kachhwaha, S. (2018). Assessment of genetic diversity in 29 rose germplasms using SCoT marker. Journal of King Saud University-Science (In press).

Agarwal, M., Shrivastava, N., & Padh, H. (2008). Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports, 27(4), 617-631.

Ahloowalia, B. S., Maluszynski, M., & Nichterlein, K. (2004). Global impact of mutation-derived varieties. Euphytica, 135(2), 187-204.

Ahmad, I., Rafiq, M. B., Dole, J. M., Abdullah, B., & Habib, K. (2017). Production and postharvest evaluation of selected exotic specialty annual cut flower species in Punjab, Pakistan. HortTechnology, 27(6), 878-883.

Ahmadi, N., Mibus, H., & Serek, M. (2009a). Characterization of ethylene-induced organ abscission in F1 breeding lines of miniature roses (Rosa hybrida L.). Postharvest Biology and Technology, 52(3), 260-266.

Ahmadi, N., Mibus, H., & Serek, M. (2015b). Response of F1 breeding lines of Rosa hybrida to exogenous ethylene treatment evaluated at physiological and molecular levels. In III International Conference on Quality Management in Supply Chains of Ornamentals, 1131 (pp. 139-146).

Akhtar, G., Akram, A., Sajjad, Y., Farooq, A., Balal, R. M., Younis, A., ... others. (2016). Improving flower yield of two essential oil bearing rosa species through pruning severity. Pakistan Journal of Nutrition, 15(4), 328.

128

Ali, M. A., Bacha, M. A., & Farahat, F. A. (1998). Pollen viability, germination and rates of pollen tube growth in some pomegranate cultivars (Punica granatum L.). Journal of King Saud University, 10(1), 73-81.

Al-Jibouri, A. A. M., Kgazal, M., & Al Saadawi, I. S. (1987). Effect of gamma irradiation on pollen germination and pollen-tube growth of four male cultivars of date palm (Phoenix dactylifera). Date Palm Journal, 5(1), 9-18.

Allum, J. F., Bringloe, D. H., & Roberts, A. V. (2010). Interactions of four pathotypes of Diplocarpon rosae with species and hybrids of Rosa. Plant Pathology, 59(3), 516-522.

Alp, S., Celik, F., Turkoglu, N., & Karagoz, S. (2009). The effects of different warm stratification periods on the seed germination of some Rosa taxa. African Journal of Biotechnology, 8(21), 5838-5841.

Alp, S., Ipek, A., & Arslan, N. (2008). The effect of gibberellic acid on germination of rosehip seeds (Rosa canina L.). In I International Symposium on Woody Ornamentals of the Temperate Zone, 885 (pp. 33-37).

Alves, D. R. B., & Klar, A. E. (2018). Comparacao de metodos para estimar evapotranspiracao de referencia em tunel de plastico. Irrigation, 1(2), 26.

Anatoliy, A. (2016). Seed mass and seed yield of six roses from central Russia (Republic of Mordovia). Plant Breeding and Seed Science, 71 (1), 13-22.

Andersen, A. S., Serek, M., & Johansen, P. (1992). Holdbarhet af potteroser (Durability of potted roses). Nordisk Jordbruksforskning, 74, 83.

Anderson, G. A. (1991). Characteristics of english roses during their first year of establishment. Special Circular Ohio Agricultural Research and Development Center, 137, 28-29.

Anderson, N. O. (2006). Flower breeding and genetics: issues, challenge and opportunity for the century. Springer Science & Business Media (pp. 695- 738.

Anderson, N., & Byrne, D. H. (2005). Methods for Rosa germination. In IV

129

International Symposium on Rose Research and Cultivation, 751, 503-507.

Arevalo, J. J., Velez, S., Enrique, J., & Intrigliolo, D. S. (2014). Determination of an efficient irrigation schedule for the cultivation of rose cv. Freedom under greenhouse conditions in Colombia. Agronomia Colombiana, 32(1), 95-102.

Arve, L. E., Terfa, M. T., Gislerod, H. R., Olsen, J. E., & Torre, S. (2013). High relative air humidity and continuous light reduce stomata functionality by affecting the ABA regulation in rose leaves. Plant, Cell & Environment, 36(2), 382-392.

Austin, D. (1999). Botanica's Roses: The Encyclopedia of Roses. Welcome Rain Publishers (pp. 134-138).

Azeem, S., Khan, A. I., Awan, F. S., Riaz, A., & Bahadur, S. (2012). Genetic diversity of rose germplasm in Pakistan characterized by random amplified polymorphic DNA (RAPD) markers. African Journal of Biotechnology, 11(47), 10650-10654.

Babaei, A., Tabaei-Aghdaei, S. R., Khosh-Khui, M., Omidbaigi, R., Naghavi, M. R., Esselink, G. D., … others. (2007). Microsatellite analysis of Damask rose (Rosa damascena Mill.) accessions from various regions in Iran reveals multiple genotypes. BMC Plant Biology, 7(1), 12-19.

Baille, A., Colomer, R. G., & Gonzalez-Real, M. M. (2006). Analysis of intercepted radiation and dry matter accumulation in rose flower shoots. Agricultural and Forest Meteorology, 137(2), 68-80.

Balaj, N. X., & Zogaj, R. (2011). Production seedlings of roses by grafting with bud for hybrid teas and climbing roses cultivars. Research Journal of Agricultural Science, 43(2), 155-160.

Bashir, K. M. I., Awan, F. S., Khan, I. A., Khan, A. I., & Usman, M. (2014). Identification and authentication of Roses through development of species- specific SCAR marker. Genetics and Molecular Research, 13(2), 4130-4139.

Baydar, N. G., Baydar, H., & Debener, T. (2004). Analysis of genetic relationships

130

among Rosa damascena plants grown in Turkey by using AFLP and microsatellite markers. Journal of Biotechnology, 111(3), 263-267.

Beddington, J. (2010). Food security: contributions from science to a new and greener revolution. Philosophical Transactions of the Royal Society Biological Sciences, 36(37), 61-71.

Bendahmane, M., Dubois, A., Raymond, O., & Bris, M. L. (2013). Genetics and genomics of flower initiation and development in roses. Journal of Experimental Botany, 64(4), 847-857.

Ben-Meir, H., & Vainstein, A. (1994). Assessment of genetic relatedness in roses by DNA fingerprint analysis. Scientia Horticulturae, 58(2), 115-121.

Berkholst, C. E. (1989). High starch content in 'Sonia' rose corollas at picking may add quality to vase life. Gartenbauwissenschaft, 85-90.

Bernier, G., Havelange, A., Houssa, C., Petitjean, A., & Lejeune, P. (1993). Physiological signals that induce flowering. The Plant Cell, 5(10), 1147.

Betonio, G. L. (1995). Germplasm collection and evaluation of different anthurium cultivars. Philippine Journal of Crop Science, 14-32.

Bhanuprakash, K., Tejaswini, Y., Yogeesha, H. S., & Naik, L. B. (2004). Effect of scarification and gibberellic acid on breaking dormancy of rose seeds. Seed Research, 32(1), 105-107.

Bhattacharjee, S. K., Singh, V., & Saxena, N. K. (1993). Studies on vegetative growth, flowering, flower quality and vase life of roses. Singapore Journal of Primary Industries, 21(2), 67-71.

Bhutto, A., Rashdi, P. I., & Abro, Q. M. (2012). Indicators for science and technology policy in Pakistan: Entering the science, technology and innovation paradigm. Science and Public Policy, 39(1), 1-12.

Biber, A., Kaufmann, H., Linde, M., Spiller, M., Terefe, D., & Debener, T. (2010). Molecular markers from a BAC contig spanning the Rdr1 locus: a tool for

131

marker-assisted selection in roses. Theoretical and Applied Genetics, 120(4), 765-773.

Bieleski, R. L. (1993). Fructan hydrolysis drives petal expansion in the ephemeral daylily flower. Plant Physiology, 103(1), 213-219.

Blackburn, K. B., & Harrison, J. H. (1921). The status of the British rose forms as determined by their cytological behaviour. Annals of Botany, 35(138), 159- 188.

Blom-Zandstra, M., Pot, C. S., Maas, F. M., & Schapendonk, A. H. (1995). Effects of different light treatments on the nocturnal transpiration and dynamics of stomatal closure of two rose cultivars. Scientia Horticulturae, 61(4), 251- 262.

Bo, J., Huiru, D., & Xiaohan, Y. (1993). Shortening hybridization breeding cycle of rose- study on mechanisms controlling achene dormancy. In International Symposium on Cultivar Improvement of Horticultural Crops, 404 (pp. 40- 47).

Bolla, A., Voyiatzis, D., Petridou, K. M., & Chimonidou, D. (2010). Photosynthetic parameters and cut-flower yield of rose ‘Eurored’ (HT) are adversely affected by mild water stress irrespective of substrate composition. Scientia Horticulturae, 126(3), 390-394.

Borch, K., Williams, M. H., & Hoyer, L. (1995). Influence of simulated transport on postharvest longevity of three cultivars of miniature potted rose. In II International Rose Symposium, 424 (pp. 175-180).

Bosco, R., Caser, M., Ghione, G. G., Mansuino, A., Giovannini, A., & Scariot, V. (2015). Dynamics of abscisic acid and indole-3-acetic acid during the early- middle stage of seed development in Rosa hybrida. Plant Growth Regulation, 75(1), 265-270.

Bourke, P. M., Gitonga, V. W., Voorrips, R. E., Visser, R. G., Krens, F. A., & Maliepaard, C. (2018). Multi-environment QTL analysis of plant and flower morphological traits in tetraploid rose. Theoretical and Applied Genetics,

132

131(10), 2055-2069.

Bredmose, N. (1993). Effects of year-round supplementary lighting on shoot development, flowering and quality of two glasshouse rose cultivars. Scientia Horticulturae, 54(1), 69-85.

Bruun, H. H. (2005). Rosa rugosa Thunb. ex Murray. Journal of Ecology, 93(2), 441-470.

Buanong, M., Mibus, H., Sisler, E. C., & Serek, M. (2005). Efficacy of new inhibitors of ethylene perception in improvement of display quality of miniature potted roses (Rosa hybrida L.). Plant Growth Regulation, 47(1), 29-38.

Buchwald, W., Zielinski, J., Mscisz, A., Adamczak, A., & Mrozikiewicz, P. M. (2007). Aktualny stan i perspektywy badan roz owocowych. Herba Polon, 53(1), 85-92.

Burdett, A. N. (1970). The cause of bent neck in cut roses. Journal of the American Society of Horticultural Science, 95, 427-31.

Butt, S. J., Atif, S., Abbasi, N. A., & Chaudhari, S. K. (2014). Performance of in vitro Rosa mutant lines developed by the application of gamma irradiation and colchicine. International Journal of Biosciences, 5(1), 256-264.

Caballero, M., Mansito, P., Zieslin, N., Rodrigo, J., Melian, J., & Renz, O. (1995). Water use and crop productivity of roses growing on volcanic lapilli in canary island. In II International Rose Symposium, 424 (pp. 41-44).

Cabrera, R. I., Solis-Perez, A. R., & Sloan, J. J. (2009). Greenhouse rose yield and ion accumulation responses to salt stress as modulated by rootstock selection. Horticultural Science, 44(7), 2000-2008.

Cai, X., Starman, T., Niu, G., Hall, C., & Lombardini, L. (2012). Response of selected garden roses to drought stress. Horticultural Science, 47(8), 1050- 1055.

Cai, Y. Z., Xing, J., Sun, M., Zhan, Z. Q., & Corke, H. (2005). Phenolic antioxidants

133

(hydrolyzable tannins, flavonols, and anthocyanins) identified by LC-ESI- MS and Maldi-Qit-Tof MS from Rosa chinensis flowers. Journal of Agricultural and Food Chemistry, 53(26), 9940-9948.

Calatayud, A., Roca, D., Gorbe, E., & Martinez, P. F. (2007). Light acclimation in rose (Rosa hybrida cv. Grand Gala) leaves after pruning: effects on chlorophyll a fluorescence, nitrate reductase, ammonium and carbohydrates. Scientia Horticulturae, 111(2), 152-159.

Calvino, G. E. M. (1951). Ricerche sul polline del genere Rosa. 5, 377-410.

Canli, F. A., & Kazaz, S. (2009). Biotechnology of roses: progress and future prospect. Turkish Journal of Forestry, 1, 167-183.

Carpenter, W. J., & Anderson, G. A. (1972). High intensity supplementary lighting increases yields of greenhouse roses. American Society for Horticulture Sciences, 97, 135-138.

Carvalho-Zanao, M. P., Grossi, J. A. S., Junior, L. A. Z., Ventrella, M. C., & Pereira, N. (2017). Production and leaf plasticity of rose plants sprayed with paclobutrazol and daminozide. Semina Ciencias Agrarias, 38(6), 3481-3490.

Celik, F., Kazankaya, A., & Ercisli, S. (2009). Fruit characteristics of some selected promising rose hip genotypes from Van region of Turkey. African Journal of Agricultural Research, 4(3), 236-240.

Cheikh-Affene, Z. B., Haouala, F., & Harzallah-Skhiri, F. (2015). Morphometric variation and taxonomic identification of thirteen wild rose populations from Tunisia. Acta Botanica Croatica, 74(1), 1-17.

Chenu, K., Chapman, S. C., Tardieu, F., Mclean, G., Welcker, C., & Hammer, G. L. (2009). Simulating the yield impacts of organ level quantitative trait loci associated with drought response in maize-A 'Gene-to-Phenotype' modeling approach. Genetics, 183(4), 1507-1523.

Chepeliev, M., Aguiar, A., & Mensbrugghe, V.D. (2018). Climate change impacts on agriculture using improved multi-region input-output framework: a report.

134

1-37.

Cherri-Martin, M., Jullien, F., Heizmann, P., & Baudino, S. (2007). Fragrance heritability in hybrid tea roses. Scientia Horticulturae, 113(2), 177-181.

Chimonidou, D., Bolla, A., Pitta, C., Vassiliou, L., Kyriakou, G., & Put, H. M. C. (2007). Is it Possible to Transfer Aroma from Rosa damascena to Hybrid Tea Rose Cultivars by Hybridisation?. Acta Horticulturae, 751, 299.

Chimonidou-Pavlidou, D. (1998). Correlation between internal and external stages of rose development. In XXV International Horticultural Congress, 515(pp. 233-244).

Chmelnitsky, I., Colauzzi, M., Algom, R., & Zieslin, N. (2001). Effects of temperature on phyllody expression and cytokinin content in floral organs of rose flowers. Plant Growth Regulation, 35(3), 207-214.

Clor, M. A., Crafts, A. S., & Yamaguchi, S. (1963). Effects of high humidity on translocation of foliar-applied labeled compounds in plants, Translocation from starved leaves. Plant Physiology, 38(5), 501.

Cock, K. D., Scariot, V., Leus, L., Riek, J. D., & Huylenbroeck, J. V. (2007). Understanding genetic relationships of wild and cultivated roses and the use of species in breeding. CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources, 2(052), 34.

Cole, P., & Melton, B. (1986). Self-and cross-compatibility relationships among genotypes and between ploidy of the rose. Journal of the American Society for Horticultural Science, 111(1), 122-125.

Costa, A. P., Pocas, I., & Cunha, M. (2016). Estimating the leaf area of cut roses in different growth stages using image processing and allometrics. Horticulturae, 2(3), 6.

Cram, W. J. (1976). Negative feedback regulation of transport in cells. The maintenance of turgor, volume and nutrient supply. Transport in Plants, 284- 316).

135

Crespel, L., & Gudin, S. (2003). Evidence for the production of unreduced gametes by tetraploid Rosa hybrida L. Euphytica, 133(1), 65-69.

Crespel, L., Chirollet, M., Durel, C., Zhang, D., Meynet, J., & Gudin, S. (2002). Mapping of qualitative and quantitative phenotypic traits in Rosa using AFLP markers. Theoretical and Applied Genetics, 105(8), 1207-1214.

Crespel, L., Le Bras, C., Relion, D., Roman, H., & Morel, P. (2015). Effect of high temperature on the production of 2n pollen grains in diploid roses and obtaining tetraploids via unilateral polyploidization. Plant Breeding, 134(3), 356-364.

Crocker, W., & Barton, L. V. (1931). After-ripening, germination, and storage of certain rosaceous seeds. Contribution Boyce Thompson Institute, 3(3), 385- 404.

Cruden, R. W. (1989). Facultative xenogamy: examination of a mixed mating system. The Evolutionary Ecology of Plants, 171-207.

Cubero, J. I., Millan, T., Osuna, F., Torres, A. M., & Cobos, S. (1995). Varietal identification in Rosa by using isozyme and RAPD markers. In II International Rose Symposium, 424 (pp. 261-264).

Cuquel, F. L., Drefahl, A., & Dronk, A. G. (2007). Enhancing vase life of rose with 1-MCP. Acta Horticulturae, 751, 455.

Dai, F., Zhang, C., Jiang, X., Kang, M., Yin, X., Lu, P., ... others. (2012). RhNAC2 and RhEXPA4 are involved in regulation of dehydration tolerance during the expansion of rose petals. Plant Physiology, 112-116.

Darlington, C. D., & Wylie, A. P. (1956). Chromosome atlas of flowering plants. Chromosome Atlas of Flowering Plants,134-139.

Darwin, C. (1999). The origin of species: by means of natural selection or the preservation of favoured races in the struggle for life. Bantam Classics, 14- 22.

Datta, S. K. (2018). Breeding of new ornamental varieties: Rose. Current Science,

136

114(6), 1194.

De Stigter, H. (1980). Water balance of cut and intact (Sonia) rose plants. Zeitschrift Fur Pflanzenphysiologie, 99(2), 131-140.

Debener, T. (1999). Genetic analysis of horticulturally important morphological and physiological characters in diploid roses. Gartenbauwissenschaft, 64(1), 14- 19.

Debener, T., & Byrne, D. H. (2014). Disease resistance breeding in rose: current status and potential of biotechnological tools. Plant Science, 228, 107-117.

Debener, T., & Linde, M. (2009). Exploring complex ornamental genomes: the rose as a model plant. Critical Reviews in Plant Sciences, 28(4), 267-280.

Debener, T., & Mattiesch, L. (1999). Construction of a genetic linkage map for roses using RAPD and AFLP markers. Theoretical and Applied Genetics, 99(5), 891-899.

Debener, T., Bartels, C., & Mattiesch, L. (1996). RAPD analysis of genetic variation between a group of rose cultivars and selected wild rose species. Molecular Breeding, 2(4), 321-327.

Decock, K. (2008). Genetic diversity of wild roses (Rosa spp.) in Europe, with an in-depth morphological study of Flemish populations. Acta Horticulturae, 51, 55.

Dela, G., Or, E., Ovadia, R., Nissim-Levi, A., Weiss, D., & Oren-Shamir, M. (2003). Changes in anthocyanin concentration and composition in ‘Jaguar’ rose flowers due to transient high-temperature conditions. Plant Science, 164(3), 333-340.

Deleon, L. B. P., Ferrer, P., Sanchez, J. R. C., & Molina, D. S. I. (2010). Soil capacitance sensors and stem dendrometers: useful tools for irrigation scheduling of commercial orchards?. Spanish Journal of Agricultural Research, (2), 52-65.

Demir, F., & Kalyoncu, I. H. (2003). Some nutritional, pomological and physical

137

properties of cornelian cherry (Cornus mas L.). Journal of Food Engineering, 60(3), 335-341.

Devries, D. P. (1976). Juvenility in hybrid Tea-roses. Euphytica, 25(1), 321-328.

Devries, D. P., & Dubois, L. A. (1983). Pollen and pollination experiments. The effect of repeated pollination on fruit-and seed set in crosses between the hybrid tea-rose cvs. Sonia and Ilona. Euphytica, 32(3), 685-689.

Devries, D. P., & Dubois, L. A. (1987). The effect of temperature on fruit set, seed set and seed germination in ‘Sonia’ × ‘Hadley’ hybrid Tea-rose crosses. Euphytica, 36(1), 117-120.

Devries, D. P., & Dubois, L. A. (1995). Rose breeding: past, present, prospects. In II International Rose Symposium, 424 (pp. 241-248).

Devries, D. P., & Dubois, L. A. M. (2013). Factors affecting the germination of Hybrid rose achenes: a review. In VI International Symposium on Rose Research and Cultivation, 1064 (pp. 151-164).

Dhyani, D., Karthigeyan, S., & Ahuja, P. S. (2004). An efficient round cut method (RCM) for emasculation of rose flowers. In I International Rose Hip Conference, 690 (pp. 125-130).

Dickinson, T. A., Lo, E., & Talent, N. (2007). Polyploidy, reproductive biology in Rosaceae: understanding evolution and making classifications. Plant Systematics and Evolution, 266(2), 59-78.

Djennane, S., Oyant, H. L., Kawamura, K., Lalanne, D., Laffaire, M., Thouroude, T., ... others, (2014). Impacts of light and temperature on shoot branching gradient and expression of strigolactone synthesis and signalling genes in rose. Plant, Cell and Environment, 37(3), 742-757.

Doi, M., Miyagawa, M., Inamoto, K., & Imanishi, H. (1999). Rhythmic changes in water uptake, transpiration and water potential of cut roses as affected by photoperiods. Journal of the Japanese Society for Horticultural Science, 68(4), 861-867.

138

Doyle, J. J., & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus, 12(13), 39-40.

Dubois, A., Carrere, S., Raymond, O., Pouvreau, B., Cottret, L., Roccia, A., … others. (2012). Transcriptome database resource and gene expression atlas for the rose. BMC Genomics, 13(1), 638.

Duchein, M., Baille, M., & Baille, A. (1993). Water use efficiency and nutrient consumption of a greenhouse rose crop grown in rockwool. In International Seminar on Soilless Culture Technology Protected Crops Mild Winter Climates, 408 (pp. 129-136).

Dugo, M. L., Satovic, Z., Millan, T., Cubero, J. I., Rubiales, D., Cabrera, A., … others. (2005). Genetic mapping of QTLs controlling horticultural traits in diploid roses. Theoretical and Applied Genetics, 111(3), 511-520.

Durkin, D. J. (1979). Effect of milipore filtration, citric acid, and sucrose on peduncle water potential of cut rose flower. Journal of the American Society for Horticultural Science, 104, 860-863.

EI-Assal, S.E., El-Awady, M.A., El-Tarras, A., & Shehab, S. (2014). Assessing the genetic relationship of Taif rose with some rose genotypes (Rosa spp.) based on random amplified polymorphic DNA, inter simple sequence repeat and simple sequence repeat markers. American Journal of Biochemistry and Biotechnology, 10(1), 88-98.

El Mokadem, H., Crespel, L., Meynet, J., & Gudin, S. (2002). The occurrence of 2n- pollen and the origin of sexual polyploids in dihaploid roses (Rosa hybrida L.). Euphytica, 125(2), 169-177.

Ercisli, S. (2004a). A short review of the fruit germplasm resources of Turkey. Genetic Resources and Crop Evolution, 51(4), 419-435.

Ercisli, S. (2007b). Determination of pollen viability and in vitro pollen germination of Rosa dumalis and Rosa villosa. Bangladesh Journal of Botany, 36(2), 185- 187.

139

Ercisli, S., & Guleryuz, M. (2006). Fruit properties of promising rose hips (Rosa spp.) from the North-eastern Anatolia Region of Turkey. Asian Journal of Chemistry, 18(1), 239.

Esselink, G., Smulders, M., & Vosman, B. (2003). Identification of cut rose (Rosa hybrida) and rootstock varieties using robust sequence tagged microsatellite site markers. Theoretical and Applied Genetics, 106(2), 277-286.

Eti, S., & Stosser, R. (1988). Fertility of the mandarin variety 'Clementine' (Citrus reticulata blanco), pollen quality and pollen tube growth. Gartenbauwissenschaft, 160-166.

Evans, R. Y., & Reid, M. S. (1988). Changes in carbohydrates and osmotic potential. Journal of American Society of Horticulture Sciences, 113(6), 884-888.

Fagerlind, F. (1951). Influence of the pollen-giver on the production of hips, achenes and seeds in the "Camina roses". Acta Horticultural Bergiani, 16, 121-168.

Fanourakis, D., Pieruschka, R., Savvides, A., Macnish, A. J., Sarlikioti, V., & Woltering, E. J. (2013). Sources of vase life variation in cut roses: a review. Postharvest Biology and Technology, 78, 1-15.

Faragher, J. D., Mayak, S., Tirosh, T., & Halevy, A. H. (1984). Cold storage of rose flowers: Effects of cold storage and water loss on opening and vase life of ‘Mercedes’ roses. Scientia Horticulturae, 24(4), 369-378.

Farooq, A., Khan, M. A., Ali, A., & Riaz, A. (2011). Diversity of morphology and oil content of Rosa damascena landraces and related Rosa species from Pakistan. Pakistan Journal of Agriculture Sciences, 48(3), 177-183.

Farooq, A., Kiani, M., Khan, M. A., Riaz, A., Khan, A. A., Anderson, N., … others (2013). Microsatellite analysis of Rosa damascena from Pakistan and Iran. Horticulture, Environment and Biotechnology, 54(2), 141-147.

Farooq, A., Lei, S., Nadeem, M., Asif, M., Akhtar, G., & Butt, S. J. (2016). Cross compatibility in various scented rosa species breeding. Pakistan Journal of Agricultural Sciences, 53(4), 863-869.

140

Feng, H., Wang, M. L., Cong, R. C., & Dai, S. L. (2017). Colchicine and trifluralin- mediated polyploidization of Rosa multiflora and Rosa roxburghii. The Journal of Horticultural Science and Biotechnology, 92(3), 279-287.

Fernandez-Romero, M. D., Espin, A., Trujillo, I., Torres, A. M., Millan, T., & Cabrera, A. (2009). Cytological and molecular characterization of a collection of wild and cultivated roses. Floriculture and Ornamental Biotechnology, 3, 28-39.

Ferrante, A., Trivellini, A., & Serra, G. (2010). Colors intensity and flower longevity of garden roses. Research Journal of Biological Sciences, 5(1), 125-130.

Ferrante, A., Trivellini, A., & Serra, G. (2010). Colours intensity and flower longevity of garden roses. Research Journal of Biosciences, 5, 125-130.

Ferrario, S., Immink, R. G., & Angenent, G. C. (2004). Conservation and diversity in flower land. Current Opinion in Plant Biology, 7(1), 84-91.

Finch-Savage, W. E. & Bassel, G. W. (2015). Seed vigour and crop establishment: extending performance beyond adaptation. Journal of Experimental Botany, 67(3), 567-591.

Fordham, M. C., Harrison‐Murray, R. S., Knight, L., & Evered, C. E. (2001). Effects of leaf wetting and high humidity on stomatal function in leafy cuttings and intact plants of Corylus maxima. Physiologia Plantarum, 113(2), 233-240.

Forkmann, G. (1991). Flavonoids as flower pigments: the formation of the natural spectrum and its extension by genetic engineering. Plant Breeding, 106(1), 1-26.

Foucher, F., Oyant, H.L., Hamama, L., Sakr, S., Nybom, H., Baudino, S., ... others. (2013). Towards the rose genome sequence and its use in research and breeding. In VI International Symposium on Rose Research and Cultivation, 1064 (pp. 167-175).

Franks, S. J., Sim, S., & Weis, A. E. (2007). Rapid evolution of flowering time by an annual plant in response to a climate fluctuation. Proceedings of the

141

National Academy of Sciences, 104(4), 1278-1282.

Frederic, P., Fabien, P., Chiraz, T., & Jeremy, C. (2018). Probabilistic reconstruction of genealogies for polyploid plant species. Journal of Theoretical Biology, 14-21.

Gao, X., Uggla, M., & Rumpunen, K. (2004). Antioxidant activity of dried and boiled rose hips. In I International Rose Hip Conference, 690 (pp. 239-244).

Gar, O., Sargent, D. J., Tsai, C. J., Pleban, T., Shalev, G., Byrne, D. H., … others. (2011). An autotetraploid linkage map of rose (Rosa hybrida) validated using the strawberry (Fragaria vesca) genome sequence. Plos One, 6(5), 20463.

Garrod, J. F., & Harris, G. P. (1974). Studies on the glasshouse carnation: Effects of temperature and growth substances on petal number. Annals of Botany, 38(5), 1025-1031.

Giovannini, A., Macovei, A., Caser, M., Mansuino, A., Ghione, G. G., Savona, M., … others. (2017a). Pollen grain preservation and fertility in valuable commercial rose cultivars. Plants, 6(2), 17.

Giovannini, A., Scariot, V., Caser, M., Buttafava, A., Mansuino, A., Ghione, G. G., … others. (2015). Mutation breeding using gamma rays to increase seed germination in Rosa hybrida. Acta Horticulturae, 1087, 373-378.

Gitonga, V. W., Koning-Boucoiran, C. F., Verlinden, K., Dolstra, O., Visser, R. G., Maliepaard, C., … others. (2014). Genetic variation, heritability and genotype by environment interaction of morphological traits in a tetraploid rose population. BMC Genetics, 15(1), 146.

Gonzalez, A. (2009). Pigment loss in response to the environment: a new role for the anthocyanin regulatory complex. New Phytologist, 182(1), 1-3.

Gonzalez, M. C., & Cejudo, F. J. (2007). Gibberellin-regulated expression of neutral and vacuolar invertase genes in petioles of sugar beet plants. Plant Science, 172(4), 839-846.

Gorin, N., & Berkholst, C. E. (1982). Starch in petals of cut roses, cv. Sonia, as a

142

probable criterion of picking. Gartenbauwissenschaft, 75-77.

Gowda, J. V. N., Sulladmath & Elengovan, U.V. (1979). Evaluation of eight hybrid tea roses for cut flower. Mysore Journal of Agriculture. Sciences, 13(3), 275- 277.

Gowthami, L., Nageswararao, M. B., Umajyothi, K., & Umakrishna, K. (2017). Studies on the effect of nitrogen and potassium on flowering in Crossandra (Crossandra Infundibuluformis L.). International journal of Current Microbiology Application Sciences, 6(7), 2537-2541.

Griggs, W. H., Forde, H. I., Iwakiri, B. T., & Asay, R. N. (1971). Effect of subfreezing temperature on the viability of Persian walnut pollen. Horticultural Science, 6, 235-237.

Gudin, S. (2000). Rose: genetics and breeding. Plant Breeding Reviews, 17, 159- 190.

Gudin, S., Arene, L., & Bulard, C. (1991). Influence of season on rose pollen quality. Sexual Plant Reproduction, 4(2), 113-117.

Gudin, S., Arene, L., Chavagnat, A., & Bulard, C. (1990). Influence of endocarp thickness on rose achene germination: genetic and environmental factors. Horticultural Science, 25(7), 786-788.

Gunes, M., Cekic, C., & Edizer, Y. (2004). Determination of pollen quantity, pollen viability and pollen germination in some dogrose species (Rosa section Caninae). In International Rose Hip Conference, 690 (pp. 211-216).

Guterman, I., Shalit, M., Menda, N., Piestun, D., Dafny-Yelin, M., Shalev, G., ... others. (2002). Rose scent: genomics approach to discovering novel floral fragrance related genes. The Plant Cell, 14(10), 2325-2338.

Halevy, A. H. (1985). Rose research-current situation and future needs. In I International Symposium of the Research and Cultivation of Roses, 189 (pp. 11-20).

Halevy, A. H. (2013). Assimilate allocation and flower development. Manipulation

143

of Flowering: Proceedings of Previous Easter Schools in Agricultural Science, (pp. 363-378).

Hammond, J. B. (1982). Changes in amylase activity during rose bud opening. Scientia Horticulturae, 16(3), 283-289.

Han, Y., Tang, A., Wan, H., Zhang, T., Cheng, T., Wang, J., … others. (2018). An Petal A2 homolog, RcAP2, regulates the number of rose petals derived from stamens and response to temperature fluctuations. Frontiers in Plant Science, 9, 481-489.

Haouala, F., Hajlaoui, N., & Cheikh-Affene, Z. B. (2013). Enhancing seed Germination in rose (Rosa rubiginosa L.). Medicinal Aromatic Plants, 2(6), 139-142.

Haque, M. A., Miah, M. M., Hossain, S., & Alam, M. (2013). Profitability of rose cultivation in some selected areas of Jessore district. Bangladesh Journal of Agricultural Research, 38(1), 165-174.

Harada, T., Torii, Y., Morita, S., Onodera, R., Hara, Y., Yokoyama, R., ... others. (2010). Cloning, characterization and expression of xyloglucan endotransglucosylase/hydrolase and expansin genes associated with petal growth and development during carnation flower opening. Journal of Experimental Botany, 62(2), 815-823.

Hassanein, A. M. (2010). Improved quality and quantity of winter flowering in rose (Rosa spp.) by controlling the timing and type of pruning applied in autumn. World Journal of Agriculture Sciences, 6, 260-267.

Haviland-Jones, J., Rosario, H. H., Wilson, P., & Mcguire, T. R. (2005). An environmental approach to positive emotion: Flowers. Evolutionary Psychology, 3(1), 104-132.

Hegarty, M. J., & Hiscock, S. J. (2005). Hybrid speciation in plants: new insights from molecular studies. New Phytologist, 165(2), 411-423.

Hellmann, A., & Wernicke, W. (1998). Changes in tubulin protein expression

144

accompany reorganization of microtubular arrays during cell shaping in barley leaves. Planta, 204(2), 220-225.

Hendel-Rahmanim, K., Masci, T., Vainstein, A., & Weiss, D. (2007). Diurnal regulation of scent emission in rose flowers. Planta, 226(6), 1491-1499.

Herklotz, V., & Ritz, C. M. (2016). Multiple and asymmetrical origin of polyploid dog rose hybrids (Rosa L.) involving unreduced gametes. Annals of Botany, 120(2), 209-220.

Ho, L. C., & Nichols, R. (1977). Translocation of 14 C-sucrose in relation to changes in carbohydrate content in rose corollas cut at different stages of development. Annals of Botany, 41(1), 227-242.

Horibe, T., & Yamada, K. (2017). Petal growth physiology of cut rose flowers: Progress and future prospects. Journal of Horticultural Research, 25(1), 5- 18.

Horibe, T., Yamaki, S., & Yamada, K. (2013). Effects of auxin and methyl jasmonate on cut rose petal growth through activation of acid invertase. Postharvest Biology and Technology, 86, 195-200.

Hosafcı, H., Arslan, N., & Sarıhan, E. O. (2004). Propagation of dog roses (Rosa canina L.) by seed. In I International Rose Hip Conference, 42 (pp. 159-164).

Hubbard, M., Kelly, J., Rajapakse, S., Abbott, A., & Ballard, R. (1992). Restriction fragment length polymorphisms in rose and their use for cultivar identification. Horticultural Science, 27(2), 172-173.

Hussain, A., & Khan, M. A. (2004). Effect of growth regulators on stem cutting of Rosa bourboniana and Rosa Gruss an Teplitz. International Journal of Agriculture and Biology, 6(5), 931-932.

Ibrahim, M., Agarwal, M., Hardy, G. S. J., & Ren, Y. (2017a). Optimized method to analyze rose plant volatile organic compounds by HS-SPME-GC-FID/MSD. Journal of Biosciences and Medicines, 5(03), 13-31.

Ibrahim, M., Agarwal, M., Hardy, G., Hussein, M., & Ren, Y. (2017b). Optimization

145

of environmental factors to measure physiological parameters of two rose varieties. Open Journal of Applied Sciences, 7(10), 585.

Ibrahim, R. I. H. (2011). A modified CTAB protocol for DNA extraction from young flower petals of some medicinal plant species. Gene Conserve, 10(40), 165- 182.

Ichimura, K., & Shimizu-Yumoto, H. (2007). Extension of the vase life of cut roses by treatment with sucrose before and during simulated transport. Bulletin of the National Institute of Floricultural Science, 7, 17-27.

Ichimura, K., Kawabata, Y., Kishimoto, M., Goto, R., & Yamada, K. (2003). Shortage of soluble carbohydrates is largely responsible for short vase life of cut 'Sonia' rose flowers. Journal of the Japanese Society for Horticultural Science, 72(4), 292-298.

Ichimura, K., Kohata, K., Koketsu, M., Yamaguchi, Y., Yamaguchi, H., & Suto, K. (1997). Identification of methyl β-glucopyranoside and xylose as soluble sugar constituents in roses (Rosa hybrida L.). Bioscience, Biotechnology and Biochemistry, 61(10), 1734-1735.

Ichimura, K., Mukasa, Y., Fujiwara, T., Kohata, k., Goto, R., & Suto, K. (1999). Possible roles of methyl glucoside and myo-inositol in the opening of cut rose flowers. Annals of Botany, 83(5), 551-557.

In, B. C., Inamoto, K., & Doi, M. (2009). An analysis of the causes of the seasonal fluctuations in vase life of cut roses. Horticulture Environment and Biotechnology, 50(5), 446-450.

Jabbarzadeh, Z., Khosh-Khui, M., Salehi, H., & Saberivand, A. (2009). Optimization of DNA extraction for SSR studies in seven important rose species of Iran. American-Eurasian Journal of Sustainable Agriculture, 3(4), 639-642.

Jackson, G. A. D., & Blundell, J. B. (1963). Germination in Rosa. Journal of Horticultural Science, 38(4), 310-320.

Jacob, Y., & Ferrero, F. (2003). Morphology, anatomy, pollen grains and tubes.

146

International Journal of Biosciences, 9, 14-22.

Jacob, Y., Teyssier, C., Reynders-Aloisi, S., & Brown, S. C. (1995). Use of flow cytometry for the rapid determination of ploidy level in the genus Rosa. In II International Rose Symposium, 424 (pp. 273-278).

Janoudi, A. K., Widders, I. E., & Flore, J. A. (1993). Water deficits environmental factors affect photosynthesis in leaves of cucumber (Cucumis sativus). Journal of the American Society for Horticultural Science, 118(3), 366-370.

Jessen, K. (1958). Om vandspredning af Rosa rugosa og andre arter af slaegten. Botanisk Tidsskrift, 54(3), 353-366.

Jiao, J., Tsujita, M. J., & Grodzinski, B. (1991). Influence of temperature on net CO2 exchange in roses. Canadian journal of Plant Science, 71(1), 235-243.

Jicinska, D., Koncalova, M. N., & Sykorova, O. (1976). Studies in rose pollen, pollen viability and germinability in eight Rosa species. Preslia, 48, 347-353.

Johri, B.M. & Vasil, I.K. (1961). Physiology of pollen. Botanical Review, 27, 326- 361.

Jones, M. B., & Mansfield, T. A. (1975). Circadian rhythms in plants. Science Progress, 1933, 103-125.

Kaihara, S., & Takimoto, A. (1980). Studies on the light controlling the time of flower-opening in Pharbitis nil. Plant and Cell Physiology, 21(1), 21-26.

Kara, Z., & Gercekcioglu, R. (1992). Pomological and phenological properties of rose hips naturally grown in Tokat provinces. In Proceedings of the Ist National Horticulture Congress, 4 (pp. 13-16).

Katsoulas, N., Kittas, C., Dimokas, G., & Lykas, C. (2006). Effect of irrigation frequency on rose flower production and quality. Biosystems Engineering, 93(2), 237-244.

Katsumoto, Y., Fukuchi-Mizutani, M., Fukui, Y., Brugliera, F., Holton, T. A., Karan, M., ... others. (2007). Engineering of the rose flavonoid biosynthetic pathway

147

successfully generated blue-hued flowers accumulating delphinidin. Plant and Cell Physiology, 48(11), 1589-1600.

Kaul, K., Karthigeyan, S., Dhyani, D., Kaur, N., Sharma, R. K., & Ahuja, P. S. (2009). Morphological and molecular analyses of Rosa damascena × Rosa bourboniana interspecific hybrids. Scientia Horticulturae, 122(2), 258-263.

Kaur, N. R. K., Sharma, Singh, M.S.V. & Ahuja. P.S. 2007. Molecular markets evaluatiaon and micropropagation of filed selected elites of Rosa damacana. General and Applied Plant Physiology, 33, 171-186.

Kawamura, K., Oyant, H.L., Thouroude, T., Jeauffre, J., & Foucher, F. (2015). Inheritance of garden rose architecture and its association with flowering behaviour. Tree Genetics and Genomes, 11(2), 22.

Kazaz, S., Baydar, H., & Erbas, S. (2009). Variations in chemical compositions of Rosa damascena Mill. and Rosa canina L. fruits. Czech Journal of Food Sciences, 27(3), 178-184.

Kehajov, D., Zahariev, I., & Komitov, G. (2016). Development of machine for removing rose rods from area between rows. European Journal of Technical and Natural Sciences, (4), 27-29.

Kenis, J. D., Silvente, S. T., & Trippi, V. S. (1985). Nitrogen metabolism and senescence‐associated changes during growth of carnation flowers. Physiologia Plantarum, 65(4), 455-459.

Kermani, M. J., Sarasan, V., Roberts, A. V., Yokoya, K., Wentworth, J., & Sieber, V. K. (2003). Oryzalin-induced chromosome doubling in Rosa, its effect on plant morphology and pollen viability. Theoretical and Applied Genetics, 107(7), 1195-1200.

Kevan, P. G., Eisikowitch, D., Ambrose, J. D., & Kemp, J. R. (1990). Cryptic dioecy and insect pollination in Rosa setigera (Rosaceae), a rare plant of Carolinian Canada. Biological Journal of the Linnean Society, 40(3), 229-243.

Khaitova, L. C., Werlemark, G., Kovarikova, A., Nybom, H., & Kovarik, A. (2014).

148

High penetrance of a pan-canina type rDNA family in intersection Rosa hybrids suggests strong selection of bivalent chromosomes in the section Caninae. Cytogenetic and Genome Research, 143(3), 104-113.

Khan, M. A. (1988). Studies on the compatibility of six hybrid tea roses. Pakistan Journal of Agriculture Sciences, 23, 73-78.

Khan, M. A., Shaukat, S. S., Shahzad, A., & Ahmed, W. (2011). Application of waste stabilization pond’s effluent on cultivation of roses (Rosa damascena Mill). Pakistan Journal of Botany, 43(4), 1919-1923.

Khan, M. F., Hafiz, I. A., Abbasi, N. A., & Shah, M. K. N. (2019). Performance comparison of Rosa hybrida varieties under Pothwar climate. International Journal of Biosciences,14 (1), 101-111.

Khan, M. F., Hafiz, I. A., Abbasi, N. A., & Shah, M. K. N. (2020). Mitigation of seed dormancy and microsatellite analysis of hybrid population of Garden roses (Rosa hybrida). Scientia Horticulturae, 262, 109044.

Khan, N. A., Mahsud, A. S. S., & Mumtaz, S. (2016). Flowering Quality of Polianthus tuberosa var. Fancy white as Affected by Planting Dates in Agro Metrological Conditions of Islamabad. Horticultural Research Institute, National Agricultural Research Centre, Islamabad, Pakistan. Science, 35(1) 14-15.

Khattak, A. M., Munir, M. & Baloch, J. U. D. (1995). Environmental response of some exotic rose cultivars to DI Khan conditions. Pakistan Journal of Botany, 27(2), 399-403.

Khosh-Khui, M., & Teixeira, J. A. (2006). In vitro culture of the Rosa species. Floriculture, Ornamental and Plant Biotechnology, 2, 514-526.

Khosh-Khui, M., Bassiri, A., & Niknejad, M. (1976). Effects of temperature and humidity on pollen viability of six rose species. Canadian Journal of Plant Science, 56(3), 517-523.

Kim, S. H., & Lieth, J. H. (2003). A coupled model of photosynthesis, stomatal

149

conductance and transpiration for a rose leaf (Rosa hybrida L.). Annals of Botany, 91(7), 771-781.

Kim, W. H., Lee, E. K., Yoo, B. S., Lee, J. S., & Kim, Y. A. (2006). Establishment of trait selection standards related to cut rose qualities for rose breeding. Korea Horticultural Society, 147-147.

Kimura, T., Nishitani, C., Iketani, H., Ban, Y., & Yamamoto, T. (2006). Development of microsatellite markers in rose. Molecular Ecology Notes, 6(3), 810-812.

Kirov, I. V., Laere, K., & Khrustaleva, L. I. (2015). High resolution physical mapping of single gene fragments on pachytene chromosome 4 and 7 of Rosa. BMC Genetics, 16(1), 74.

Kittas, C., Dimokas, G., Lykas, C., & Katsoulas, N. (2004). Effect of irrigation frequencies on rose flower production and quality. In International Conference on Sustainable Greenhouse Systems-Greensys, 691 (pp. 333- 340).

Koncalova, M. N. (1975). Studies in rose pollen, in vitro germination of pollen grains of Rosa hugonis. Preslia, 47(1), 22-25.

Koning-Boucoiran, C. F. S., Gitonga, V. W., Yan, Z., Dolstra, O. V., Linden, C. G., Schoot, J., … others. (2012). The mode of inheritance in tetraploid cut roses. Theoretical and Applied Genetics, 125(3), 591-607.

Kool, M. T. N., & Lenssen, E. F. A. (1997). Basal-shoot formation in young rose plants: effects of bending practices and plant density. Journal of Horticultural Science, 72(4), 635-644.

Koopman, W. J., Wissemann, V., Decock, K., Vanhuylenbroeck, J., Deriek, J., Sabatino, G. J., ... others. (2008). AFLP markers as a tool to reconstruct complex relationships: a case study in Rosa (Rosaceae). American Journal of Botany, 95(3), 353-366.

Kovacs, S., Toth, M. G., & Facsar, G. (2004). Evaluation of fruit quality parameters

150

of Rosa taxa from the Carpathian basin. International Journal of Horticultural Science, 10(3), 81-87.

Kuiper, D., Ribot, S., Vanreenen, H. S., & Marissen, N. (1995). The effect of sucrose on the flower bud opening of ‘Madelon’ cut roses. Scientia Horticulturae, 60(4), 325-336.

Kuligowska, K., Lutken, H., & Muller, R. (2016). Towards development of new ornamental plants: status and progress in wide hybridization. Planta, 244(1), 1-17.

Kumar, N., Srivastava, G. C., & Dixit, K. (2008). Flower bud opening and senescence in roses (Rosa hybrida L.). Plant Growth Regulation, 55(2), 81.

Lakhani, S. (2016). The China-Pakistan economic corridor: Regional effects and recommendations for sustainable development and trade. International Journal of Social Sciences and Economic Research, 2(11), 5059-5068.

Lal, S. D., Seth, J. N., Yadav, J. P., & Danu, N. S. (1982). Genetic variability and correlation studies in rose phenotypic variability, heritability and genetic advance. Progressive Horticulture, 14, 234-236.

Lata, P. (1983). Inheritance in triploid hybrids of Rosa. Environmental and Experimental Botany, 23(1), 85-92.

Leghari, A. J., Laghari, U. A., & Laghari, A. H. (2016). Cultivation of rose (Rosa indica L.). Journal of Floriculture and Landscaping, 2, 1-4.

Leigh, R. A., & Tomos, A. D. (1993). Ion distribution in cereal leaves: pathways and mechanisms. Philosophical Transactions: Biological Sciences, 341(1295), 75-86.

Leus, L., Van Laere, K., De Riek, J., & Van Huylenbroeck, J. (2018). Rose. In Ornamental Crops (pp. 719-767).

Li, C. D., Rossnagel, B. G., & Scoles, G. J. (2000). The development of oat microsatellite markers and their use in identifying relationships among

151

Avena species and oat cultivars. Theoretical and Applied Genetics, 101(8), 1259-1268.

Li, C., Vihera-Aarnio, A., Puhakainen, T., Junttila, O., Heino, P., & Palva, E. T. (2003). Ecotype-dependent control of growth, dormancy and freezing tolerance under seasonal changes in Betula pendula Roth. Trees, 17(2), 127- 132.

Liang, S., Wu, X., & Byrne, D. (2017). Genetic analysis of flower size and production in diploid rose. Journal of the American Society for Horticultural Science, 142(4), 306-313.

Li-Marchetti, C., Le Bras, C., Chastellier, A., Relion, D., Morel, P., Sakr, S., ... others. (2017). 3D phenotyping and QTL analysis of a complex character: rose bush architecture. Tree Genetics and Genomes, 13(5), 112-119.

Linde, M., Hattendorf, A., Kaufmann, H., & Debener, T. (2006). Powdery mildew resistance in roses: QTL mapping in different environments using selective genotyping. Theoretical and Applied Genetics, 113(6), 1081-1092.

Liorzou, M., Pernet, A., Li, S., Chastellier, A., Thouroude, T., Michel, G., ... others. (2016). Nineteenth century French rose (Rosa spp.) germplasm shows a shift over time from a European to an Asian genetic background. Journal of Experimental Botany, 67(15), 4711-4725.

Lipe, W. N., & Crane, J. C. (1966). Dormancy regulation in peach seeds. Science, 153(35), 541-542.

Liu, B., & Wendel, J. F. (2003). Epigenetic phenomena and the evolution of plant allopolyploids. Molecular Phylogenetics and Evolution, 29(3), 365-379.

Liu, D., Liu, X., Meng, Y., Sun, C., Tang, H., Jiang, Y., ... others. (2013). An organ- specific role for ethylene in rose petal expansion during dehydration and rehydration. Journal of Experimental Botany, 64(8), 2333-2344.

Liu, F., Cohen, Y., Fuchs, M., Plaut, Z., & Grava, A. (2006). The effect of vapor pressure deficit on leaf area and water transport in flower stems of soil-less culture rose. Agricultural Water Management, 81(2), 216-224.

152

Lizuka, M., & Gebreeyesus, M. (2018). Discovery of non-traditional agricultural exports in Latin America: diverging pathways through learning and innovation. Innovation and Development, 8(1), 59-78.

Lloyd, D. G., & Schoen, D. J. (1992). Self and cross-fertilization in plants, Functional dimensions. International Journal of Plant Sciences, 153(3), 358- 369.

Loewus, M. W., Sasaki, K., Leavitt, A. L., Munsell, L., Sherman, W. R., & Loewus, F. A. (1982). Enantiomeric form of myo-inositol-1-phosphate produced by myo-inositol-1-phosphate synthase and myo-inositol kinase in higher plants. Plant Physiology, 70(6), 1661-1663.

Long, S. P., & Bernacchi, C. J. (2003). Gas exchange measurements, what can they tell us about the underlying limitations to photosynthesis? Procedures and sources of error. Journal of Experimental Botany, 54(392), 2393-2401.

Longhi, S., Giongo, L., Buti, M., Surbanovski, N., Viola, R., Velasco, R., ... others. (2014). Molecular genetics and genomics of the Rosoideae: state of the art and future perspectives. Horticulture Research, 1, 11-22.

Lu, J., Bai, M., Ren, H., Liu, J., & Wang, C. (2017). An efficient transient expression system for gene function analysis in rose. Plant Methods, 13(1), 116-118.

Lv, C., Zhang, X., Liu, G., & Deng, C. (2012). Seed yield model of Haloxylon ammodendron bunge in Junggar Basin, China. Pakistan Journal of Botany, 44(4), 1233-1239.

Ma, N., Tan, H., Liu, X., Xue, J., Li, Y., & Gao, J. (2006). Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha. Journal of Experimental Botany, 57(11), 2763-2773.

Ma, N., Xue, J., Li, Y., Liu, X., Dai, F., Jia, W., ... others. (2008). Rh-PIP2; 1, a rose aquaporin gene, is involved in ethylene-regulated petal expansion. Plant Physiology, 148(2), 894-907.

153

Mabellini, A., Ohaco, E., Ochoa, M. R., Kesseler, A. G., Marquez, C. A., & Michelis, A. D. (2011). Chemical and physical characteristics of several wild rose species used as food or food ingredient. International Journal of Industrial Chemistry, 2(3), 158–171.

Mackay, W. A., George, S. W., Mckenney, C., Sloan, J. J., Cabrera, R. I., Reinert, J. A., ... others. (2008). Performance of garden roses in north-central Texas under minimal input conditions. Hort Technology, 18(3), 417-422.

Macnish, A. J., Leonard, R. T., Borda, A. M., & Nell, T. A. (2010). Genotypic variation in the postharvest performance and ethylene sensitivity of cut rose flowers. Horticultural Science, 45(5), 790-796.

Macovei, A., Caser, M., Mattia, D., Valassi, A., Giovannini, A., Carbonera, D., ... others. (2016). Prolonged cold storage affects pollen viability and germination along with hydrogen peroxide and nitric oxide content in Rosa hybrida. Notulae Botanicae Horti Agrobotanici Cluj-Napoca, 44(1), 6-10.

Macphail, V. J. (2007). Pollination biology of wild roses (Rosa spp.) in eastern Canada. Proquest, 174.

Macphail, V. J., & Kevan, P. G. (2009). Review of the breeding systems of wild roses (Rosa spp.). Floriculture and Ornamental Biotechnology, 1-13.

Mantur, S. M., Bagali, A. N., & Patil, S. R. (2010). Influence of bending and pruning on different varieties of roses under naturally ventilated polyhouse. Karnataka Journal of Agricultural Sciences, 18(2), 474-477.

Marchant, R., Davey, M. R., Lucas, J. A., Lamb, C. J., Dixon, R. A., & Power, J. B. (1998). Expression of a chitinase transgene in rose (Rosa hybrida L.) reduces development of blackspot disease (Diplocarpon Rosae Wolf). Molecular Breeding, 4(3), 187-194.

Marchant, R., Power, J. B., Davey, M. R., Chartier-Hollis, J. M., & Lynch, P. T. (1992). Cryopreservation of pollen from two rose cultivars. Euphytica, 66(3), 235-241.

154

Marks, G. E. (1954). An aceto-carmine glycerol jelly for use in pollen-fertility counts. Stain Technology, 29(5), 277-277.

Marques, I., Loureiro, J., Draper, D., Castro, M., & Castro, S. (2018). How much do we know about the frequency of hybridisation and polyploidy in the Mediterranean region?. Plant Biology, 20, 21-37.

Martin, M., Piola, F., Chessel, D., Jay, M., & Heizmann, P. (2001). The domestication process of the Modern Rose; genetic structure and allelic composition of the rose complex. Theoretical and Applied Genetics, 102(3), 398-404.

Mascarini, L., Lorenzo, G. A., & Vilella, F. (2006). Leaf area index, water index, and red: Far red ratio calculated by spectral reflectance and its relation to plant architecture and cut rose production. Journal of the American Society for Horticultural Science, 131(3), 313-319.

Matloobi, M. (2012). Light harvesting and photosynthesis by the canopy: a review. Advances in Photosynthesis Fundamental Aspects, 14-21.

Maurya, R. P., Yadav, R. C., Godara, N. R., & Beniwal, V. S. (2013). In vitro plant regeneration of rose (Rosa hybrida L.) through various explants. Journal of Experimental Biology, 1(2), 111-119.

Mayer A. M., & Poljakoff-Mayber, A. (1982). The Germination of Seeds. Pergamon International Library of Science, Technology, Engineering and Social Studies, 3, 14-16.

Mayland‐Quellhorst, E., Foller, J., & Wissemann, V. (2012). Biological Flora of the British Isles: Rosa Spinosissima L. Journal of Ecology, 100(2), 561-576.

Mehraj, H., Ahsan, M. K., Mahmud, M. F., Hussain, M. S., & Uddin, A. J. (2014). characterization of three strawberry germplasm at Sher-e-Bangla Agricultural University. International Journal of Business, Social and Scientific Research, 1(3), 134-138.

Mibus, H., Buanong, M., Sisler, E. C., & Serek, M. (2007). New inhibitors of

155

ethylene perception in improvement of display quality in miniature roses (Rosa hybrida L.). Advances in Plant Ethylene Research, 15-20.

Mikanagi, Y., Saito, N., Yokoi, M., & Tatsuzawa, F. (2000). Anthocyanins in flowers of genus Rosa, sections Cinnamomeae, Chinenses, Gallicanae and some modern garden roses. Biochemical Systematics and Ecology, 28(9), 887-902.

Misra, P., & Srivastava, A. K. (2004). Molecular investigations in ornamental floricultural plants. Journal of Plant Biotechnology, 6, 131–143.

Miyamoto, K., Ueda, J., & Kamisaka, S. (1992). Sugar accumulation in growing subhooks of etiolated Pisum sativum seedlings‐Stimulation of sugar exudation and invertase activity in epicotyls by gibberellic acid. Physiologia Plantarum, 84(1), 106-112.

Moe, R. & T. Kristoffersen, T. (1969). The effects of temperature and light on growth and flowering of Rosa bacara in greenhouses. Acta Horticulturae, 14, 157- 167.

Moghaddam, H. H., Leus, L., De Riek, J., Van Huylenbroeck, J., & Van Bockstaele, E. (2012). Construction of a genetic linkage map with SSR, AFLP and morphological markers to locate QTLs controlling pathotype-specific powdery mildew resistance in diploid roses. Euphytica, 184(3), 413-427.

Mohapatra, A., & Rout, G. R. (2005). Identification and analysis of genetic variation among rose cultivars using random amplified polymorphic DNA. Zeitschrift Fur Naturforschung C, 60(8), 611-617.

Mor, Y., & Halevy, A. H. (1980). Promotion of sink activity of developing rose shoots by light. Plant Physiology, 66(5), 990-995.

Morey, D. (1959). Observations on the genetics of doubleness in roses. American Rose Annual, 44, 113-116.

Morpeth, D. R., & Hall, A. M. (2000). Microbial enhancement of seed germination in Rosa corymbifera ‘Laxa’. Seed Science Research, 10(4), 489-494.

156

Mortensen, L. M., & Gislerod, H. R. (1999). Influence of air humidity and lighting period on growth, vase life and water relations of 14 rose cultivars. Scientia Horticulturae, 82(4), 289-298.

Mortensen, L. M., & Gislerod, H. R. (2005). Effect of air humidity variation on powdery mildew and keeping quality of cut roses. Scientia Horticulturae, 104(1), 49-55.

Mulla, A. L., Patil, M. T., Singh, B. R., & Bhujbal, B. (1994). Growth and flowering performance of promising exotic rose cultivars. Journal of Maharashtra Agricultural Universities, 6, 260-267.

Muller, R., Stummann, B. M., & Andersen, A. S. (2001). Comparison of postharvest properties of closely related miniature rose cultivars (Rosa hybrida L.). Scientia Horticulturae, 91(4), 325-337.

Muller, R., Stummann, B. M., & Serek, M. (2000). Characterization of an ethylene receptor family with differential expression in rose (Rosa hybrida L.) flowers. Plant Cell Reports, 19(12), 1232-1239.

Nadeem, M., Akond, M., Riaz, A., Qasim, M., Younis, A., & Farooq, A. (2014). Pollen morphology and viability relates to seed production in hybrid roses. Plant Breeding and Seed Science, 68(1), 25-38.

Nadeem, M., Khan, M. A., Riaz, A., & Ahmad, R. (2011). Evaluation of growth and flowering potential of Rosa hybrida cultivars under Faisalabad climatic conditions. Pakistan journal of Agriculture Sciences, 48(4), 283-288.

Nadeem, M., Younis, A., Riaz, A., & Lim, K. B. (2015). Crossability among modern roses and heterosis of quantitative and qualitative traits in hybrids. Horticulture, Environment and Biotechnology, 56(4), 487-497.

Nadpal, J. D., Lesjak, M. M., Sibul, F. S., Anackov, G. T., Cetojevic-Simin, D. D., Mimica-Dukic, N. M., … others. (2016). Comparative study of biological activities and phytochemical composition of two rose hips and their preserves: Rosa canina L. and Rosa arvensis Huds. Food Chemistry, 192, 907-914.

157

Nejad, A. R., & Van Meeteren, U. (2005). Stomatal response characteristics of Tradescantia virginiana grown at high relative air humidity. Physiologia Plantarum, 125(3), 324-332.

Ngugi, H. K., & Scherm, H. (2006). Biology of flower-infecting fungi. Annual Reviews Phytopathology, 44, 261-282.

Nirit, B., Asher, B. T., Haya, F., Pini, S., Liona, R., Amram, C., … others. (2006). Application of treated wastewater for cultivation of roses (Rosa hybrida) in soil-less culture. Scientia Horticulturae, 108(2), 185-193.

Niu, G., & Rodriguez, D. S. (2008). Responses of growth and ion uptake of four rose rootstocks to chloride-or sulfate-dominated salinity. Journal of the American Society for Horticultural Science, 133(5), 663-669.

Niu, G., & Rodriguez, D. S. (2009). Growth and physiological responses of four rose rootstocks to drought stress. Journal of the American Society for Horticultural Science, 134(2), 202-209.

Niu, G., Rodriguez, D. S., & Aguiniga, L. (2008). Effect of saline water irrigation on growth and physiological responses of three rose rootstocks. Horticultural Science, 43(5), 1479-1484.

Noguchi, Y., Muro, T., & Morishita, M. (2008). The possibility of using decaploid interspecific hybrids (Fragaria× ananassa× F. nilgerrensis) as a parent for a new strawberry. In VI International Strawberry Symposium, 842 (pp. 447- 450).

Noor, M. J., Ahmad, M., Asghar, R., Kanwal, A., & Pervaiz, S. (2004). Palynological studies of cultivated plant species at University of Arid Agriculture, Rawalpindi, Pakistan. Asian Journal Plant Sciences, 3(4), 476-479.

Notani, A., Baloch, S. K., Baloch, A., Bashir, W., Arain, A. R., Ali, I., … others. (2014). Effect of Pruning Intervals on the quality and production of Rose (Rosa Indica L.). Persian Gulf Crop Protection, 3(2), 13-21.

Nybom, H., Esselink, G. D., Werlemark, G., Leus, L., & Vosman, B. (2006). Unique

158

genomic configuration revealed by microsatellite DNA in polyploid dogroses, Rosa. Caninae. Journal of Evolutionary Biology, 19(2), 635-648.

Nybom, H., Werlemark, G., Esselink, D. G., & Vosman, B. (2004). Sexual preferences linked to rose taxonomy and cytology. In I International Rose Hip Conference, 690 (pp. 21-28).

Ogawa, M., Hanada, A., Yamauchi, Y., Kuwahara, A., Kamiya, Y., & Yamaguchi, S. (2003). Gibberellin biosynthesis and response during Arabidopsis seed germination. The Plant Cell, 15(7), 1591-1604.

Okunlola, A. I., Adebayo, R. A., & Orimogunje, A. D. (2011). Methods of braking seed dormancy on germination and early seedling growth of African locust bean (Parkia biglobosa). Journal of Horticulture and Forestry, 3(1), 1-6.

Oliveira, E. J., Padua, J. G., Zucchi, M. I., Vencovsky, R., & Vieira, M. L. C. (2006). Origin, evolution and genome distribution of microsatellites. Genetics and Molecular Biology, 29(2), 294-307.

Oni, O., & Bada, S. O. (1992). Effects of seed size on seedling vigour in Idigbo (Terminalia Ivorensis). Journal of Tropical Forest Science, 215-224.

Otagaki, S., Ogawa, Y., Oyant, H. L., Foucher, F., Kawamura, K., Horibe, T., … others. (2015). Genotype of flowering locus homologue contributes to flowering time differences in wild and cultivated roses. Plant Biology, 17(4), 808-815.

Oyant, H. L., Crespel, Zhang, S.R.L. & Foucher.F. (2008). Genetic linkage maps of rose constructed with new microsatellite markers and locating QTL controlling flowering traits. Tree Genetics and Genomics, 4, 11-23.

Pal, P. K. (2013). Evaluation, genetic diversity, recent development of distillation method, challenges and opportunities of Rosa damascena: a review. Journal of Essential Oil Bearing Plants, 16(1), 1-10.

Pal, P. K., Agnihotri, V. K., & Singh, R. D. (2014). Impact of level and timing of pruning on flower yield and secondary metabolites profile of Rosa

159

damascena under western Himalayan region. Industrial Crops and Products, 52, 219-227.

Pandey, S. K., & Singh, H. (2011). A simple, cost-effective method for leaf area estimation. Journal of Botany, 1-6.

Panteris, E., Apostolakos, P., & Galatis, B. (1993). Microtubule organization, mesophyll cell morphogenesis, and intercellular space formation in Adiantum capillus veneris leaflets. Protoplasma, 172(4), 97-110.

Park, Y. G., & Jeong, B. R. (2012). Effect of light intensity during stenting propagation on rooting and subsequent growth of two rose cultivars. Flower Research Journal, 20(4), 228-232.

Pati, P. K., Rath, S. P., Sharma, M., Sood, A., & Ahuja, P. S. (2006). In vitro propagation of rose - a review. Biotechnology Advances, 24(1), 94-114.

Pearson, H. M., & Harney, P. M. (1984). Pollen viability in Rosa (Genotypes). Horticultural Science, 19, 710-711.

Peng, J., & Harberd, N. P. (2002). The role of GA-mediated signalling in the control of seed germination. Current Opinion in Plant Biology, 5(5), 376-381.

Perez-Jimenez, M., Besnard, G., Dorado, G., & Hernandez, P. (2013). Varietal tracing of virgin olive oils based on plastid DNA variation profiling. Plos One, 8(8), 705-707.

Pettersen, R. I., Mortensen, L. M., Moe, R., & Gislerod, H. R. (2006). Air humidity control essential for rose production under continuous lighting. Acta Horticulturae, 711, 323.

Phillips, A. L. (1998). Gibberellins in Arabidopsis. Plant Physiology and Biochemistry, 36(1-2), 115-124.

Phumichai, C., Phumichai, T., & Wongkaew, A. (2015). Novel chloroplast microsatellite (SSR) markers for genetic diversity assessment of cultivated and wild Hevea rubber. Plant Molecular Biology Reporter, 33(5), 1486- 1498.

160

Pipino, L., Leus, L., Scariot, V., & Van Labeke, M. C. (2013). Embryo and hip development in hybrid roses. Plant Growth Regulation, 69(2), 107-116.

Pipino, L., Leus, L., Scariot, V., Giovannini, A., & Van Labeke, M. C. (2009). Pollen diameter relates to seed production in cut roses. In V International Symposium on Rose Research and Cultivation, 6 (pp. 143-146).

Pipino, L., Scariot, V., Gaggero, L., Mansuino, A., Van Labeke, M. C., & Giovannini, A. (2011a). Enhancing seed germination in hybrid tea roses. Propagation of Ornamental Plants, 11(3), 111-118.

Pipino, L., Van Labeke, M. C., Mansuino, A., Scariot, V., Giovannini, A., & Leus, L. (2011b). Pollen morphology as fertility predictor in hybrid tea roses. Euphytica, 178(2), 203-214.

Plaut, Z., & Zieslin, N. (1977). The effect of canopy wetting on plant water status, CO2 fixation, ion content and growth rate of ‘Baccara’roses. Physiologia Plantarum, 39(4), 317-322.

Plaut, Z., Zieslin, N., Grawa, A., & Gazit, M. (1979). The response of rose plants to evaporative cooling: Flower production and quality. Scientia Horticulturae, 11(2), 183-190.

Podwyszynska, M., Gabryszewska, E., Dyki, B., Stepowska, A.A., Kowalski, A., & Jasinski, A. (2015). Phenotypic and genome size changes (variation) in synthetic tetraploids of Daylily (Hemerocallis) in relation to their diploid counterparts. Euphytica, 203, 1-16.

Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S., & Rafalski, A. (1996). The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding, 2(3), 225-238.

Praneetha, S., Jawaharlal, M., & Vijayakumar, M. (2002). Performance of anthuriums under shadenet condition at Yercaud, Floriculture Research Trend in India. In Proceeding of the National Symposium on Indian Floriculture in the new Millenium, Lal-Bagh, Bangalore (pp. 25-27).

161

Qasim, M., Ahmad, I., & Ahmad, T. (2008). Optimizing fertigation frequency for Rosa hybrida. Pakistan Journal of Botany, 40(2), 533-545.

Quero, J. L., Villar, R., Maranon, T., Zamora, R., Vega, D., & Sack, L. (2008). Relating leaf photosynthetic rate to whole-plant growth: drought and shade effects on seedlings of four Quercus species. Functional Plant Biology, 35(8), 725-737.

Rajapakse, S., Byrne, D. H., Zhang, L., Anderson, N., Arumuganathan, K., & Ballard, R. E. (2001). Two genetic linkage maps of tetraploid roses. Theoretical and Applied Genetics, 103(4), 575-583.

Ramanujam, S., Tiwari, A. S., & Mehra, R. B. (1974). Genetic divergence and hybrid performance in mung bean. Theoretical and Applied Genetics, 45(5), 211- 214.

Ramsay, L., Macaulay, M., Cardle, L., Morgante, M., Ivanissevich, S. D., Maestri, E., ... others. (1999). Intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements in barley. The Plant Journal, 17(4), 415-425.

Ramzan, A., Hanif, M., & Tariq, S. (2014). Performance of Rosa hybrida cultivars under agro climatic conditions of Islamabad, Pakistan. Journal of Agriculture Research, 52(1), 153-159.

Rao, A. N., & Chin, L. W. (1973). Pollen viability and germination in some orchid hybrids. Gardens Bulletin Singapore, 26, 245-257.

Rauf, S., Khan, I. A., & Khan, F. A. (2006). Colchicine-Induced tetraploidy and changes in allele frequencies in colchicine treated populations of diploids assessed with RAPD markers in Gossypium arboretum L. Turkish Journal of Biology, 30(2), 93-100.

Raviv, M., Lieth, J. H., Burger, D. W., & Wallach, R. (2001). Optimization of Transpiration and Potential Growth Rates of Kardinal Rose with Respect to Root-zone Physical Properties. Journal of the American Society for Horticultural Science, 126(5), 638-643.

162

Razungles, A., Oszmianski, J., & Sapis, J. C. (1989). Determination of carotenoids in fruits of Rosa spp. (Rosa canina and Rosa rugosa) and of chokeberry (Aronia Melanocarpa). Journal of Food Science, 54(3), 774-775.

Razzaq, T., & Kappe, C. O. (2010). Continuous flow organic synthesis under high‐ temperature/pressure conditions. Chemistry–An Asian Journal, 5(6), 1274- 1289.

Reid, M. S., Dodge, L. L., Mor, Y., & Evans, R. Y. (1988). Effects of ethylene on rose opening. In IV International Symposium on Postharvest Physiology of Ornamental Plants, 261(pp. 215-220).

Richer, C., Poulin, M., & Rioux, J. A. (2007). Factors influencing pollen germination in three Explorer roses. Canadian Journal of Plant Science, 87(1), 115-119.

Riffault, L., Destandau, E., Pasquier, L., Andre, P., & Elfakir, C. (2014). Phytochemical analysis of Rosa hybrida ‘Jardin de Granville’ by HPTLC, HPLC-DAD and HPLC-ESI-HRMS: Polyphenolic fingerprints of six plant organs. Phytochemistry, 99, 127-134.

Ritzinger, R., & Lyrene, P. M. (1999). Flower morphology in blueberry species and hybrids. Horticultural Science, 34(1), 130-131.

Roberts, A. (2003). Encyclopedia of rose science. Academic Press, 1(2), 504-512.

Roberts, A. V., Gladis, T., & Brumme, H. (2009). DNA amounts of roses (Rosa spp.) and their use in attributing ploidy levels. Plant Cell Reports, 28(1), 61-71.

Roitsch, T., & Gonzalez, M. C. (2004). Function and regulation of plant invertases: sweet sensations. Trends in Plant Science, 9(12), 606-613.

Roman, H., Rapicault, M., Miclot, A. S., Larenaudie, M., Kawamura, K., Thouroude, T., … others. (2015). Genetic analysis of the flowering date and number of petals in rose. Tree Genetics and Genomes, 11(4), 85.

Rosati, C., Simoneau, P., Treutter, D., Poupard, P., Cadot, Y., Cadic, A., … others (2003). Engineering of flower color in forsythia by expression of two

163

independently-transformed dihydroflavonol 4-reductase and anthocyanidin synthase genes of flavonoid pathway. Molecular Breeding, 12(3), 197-208.

Rosu, C. M., Manzu, C., Olteanu, Z., Oprica, L., Oprea, A., Ciornea, E., … others. (2011). Several fruit characteristics of Rosa sp. genotypes from the Northeastern region of Romania. Notulae Botanicae Horti Agrobotanici Cluj-Napoca, 39(2), 203-208.

Rout, G. R., Mohapatra, A., & Jain, S. M. (2006). Tissue culture of ornamental pot plant: A critical review on present scenario and future prospect. Biotechnology Advances, 24(6), 531-560.

Rusanov, K., Kovacheva, N., Vosman, B., Zhang, L., Rajapakse, S., Atanassov, A., … others. (2005). Microsatellite analysis of Rosa damascena accessions reveals genetic similarity between genotypes used for rose oil production and old Damask rose. Theoretical and Applied Genetics, 111(4), 804-809.

Saidi, A., Eghbalnegad, Y., & Hajibarat, Z. (2017). Study of genetic diversity in local rose varieties (Rosa spp.) using molecular markers. Banat's Journal of Biotechnology, 8(16), 148-157.

Saitou, N., & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4), 406-425.

Samiei, L., Naderi, R., Khalighi, A., Shahnejat-Bushehri, A. A., Mozaffarian, V., Esselink, G. D., ... others. (2010). Genetic diversity and genetic similarities between Iranian rose species. Journal of Horticultural Science and Biotechnology, 85(3), 231-237.

Sarkhosh, A., Zamani, Z., Fatahi, R., & Ebadi, A. (2006). RAPD markers reveal polymorphism among some Iranian pomegranate (Punica granatum L.) genotypes. Scientia Horticulturae, 111(1), 24-29.

Scariot, V., Akkak, A., & Botta, R. (2006). Characterization and genetic relationships of wild species and old garden roses based on microsatellite analysis. Journal of American Society for Horticultural Science, 131(1), 66-

164

73.

Schanzer, I. A., & Vagina, A. V. (2007). ISSR (inter simple sequence repeat) markers reveal natural intersectional hybridization in wild roses. Wulfenia, 14, 1-14.

Schieber, A., Mihalev, K., Berardini, N., Mollov, P., & Carle, R. (2005). Flavonol glycosides from distilled petals of Rosa damascena Mill. Zeitschrift Fur Naturforschung C, 60(5-6), 379-384.

Schroder, J., Stenger, H., & Wernicke, W. (2001). Tubulin genes are differentially expressed during leaf cell development in barley (Hordeum vulgare L.). Plant Molecular Biology, 45(6), 723-730.

Semeniuk, P. (1971). Inheritance of recurrent blooming in Rosa Wichuraiana. Journal of Heredity, 62(3), 203.

Semeniuk, P., & Stewart, R. N. (1966). Effect of temperature and duration of after- ripening period on germination of Rosa nutkana seeds. In Proceedings of the American Society for Horticultural Science, 89 (pp. 689).

Sen, S. M., & Gunes, M. (1996). Some physical and chemical properties of rose hips grown in Tokat district. In Proceedings of the 1st Rose Hip Symposium, 5 (pp. 6).

Serek, M. (1993). Ethephon and silver thiosulfate affect postharvest characteristics of Rosa hybrida ‘Victory Parade’. Horticultural Science, 28(3), 199-200.

Serek, M., & Andersen, A. S. (1993). AOA and BA influence on floral development and longevity of potted ‘Victory Parade’ miniature rose. Horticultural Science, 28(10), 1039-1040.

Sevelius, N., Hyttinen, T., & Somersalo, S. (2000). Selection of rose cultivars for low light greenhouse production by photosynthetic features. In III International Symposium on Rose Research and Cultivation, 547 (pp. 159- 166).

Shafique, A., Maqbool, M., Nawaz, M. A., & Ahmed, W. (2011). Performance of

165

various snapdragon (Antirrhinum majus L.) cultivars as cut flower in Punjab, Pakistan. Pakistan Journal of Botany, 43(2), 1003-1010.

Sharkey, T. D. (2005). Effects of moderate heat stress on photosynthesis: importance of thylakoid reactions, rubisco deactivation, reactive oxygen species, and thermotolerance provided by isoprene. Plant, Cell and Environment, 28(3), 269-277.

Shin, H. K., Lieth, J. H., & Kim, S. H. (2000). Effects of temperature on leaf area and flower size in rose. In III International Symposium on Rose Research and Cultivation, 547(pp. 185-191).

Shubin, L., Ningning, Z., Qing, Z., Huijun, Y., Hongying, J., Qigang, W., … others. (2015). Inheritance of perpetual blooming in Rosa chinensis ‘Old Blush’. Horticultural Plant Journal, 1(2), 108-112.

Shulaev, V., Sargent, D. J., Crowhurst, R. N., Mockler, T. C., Folkerts, O., Delcher, A. L., ... others. (2011). The genome of woodland strawberry (Fragaria vesca). Nature Genetics, 43(2), 109.

Shupert, D. A., Byrne, D. H., & Pemberton, B. H. (2005). Inheritance of flower traits, leaflet number and prickles in roses. In IV International Symposium on Rose Research and Cultivation, 751(pp. 331-335).

Sims, D. A., & Gamon, J. A. (2003). Estimation of vegetation water content and photosynthetic tissue area from spectral reflectance: a comparison of indices based on liquid water and chlorophyll absorption features. Remote Sensing of Environment, 84(4), 526-537.

Sindhu, G. S., & Kumar, R. (2004). Performance of rose cut flower varieties under unheated polyhouse conditions. Recent Trends and Future Strategies, 67-79.

Singh, B. R., Patil, M. T., Patil, G. K., & Bhujbal, B. G. (1994). Performance of Indian bred rose cultivars. Journal of Maharashtra Agricultural Universities, 19, 344-345.

Singh, D. P., Jermakow, A. M., & Swain, S. M. (2002). Gibberellins are required for

166

seed development and pollen tube growth in Arabidopsis. The Plant Cell, 14(12), 3133-3147.

Smith, A. E., Zukel, J. W., Stone, G. M., & Riddell, J. A. (1959). Plant growth inhibitors, factors affecting the performance of maleic hydrazide. Journal of Agricultural and Food Chemistry, 7(5), 341-344.

Smulders, M. J. M., Esselink, D., Voorrips, R. E., & Vosman, B. (2009). Analysis of a database of DNA profiles of 734 Hybrid Tea Rose varieties. In XXIII International Eucarpia Symposium, Section Ornamentals: Colourful Breeding and Genetics, 836 (pp. 169-175).

Soliman, A.S., Al-Ani, B.A., Al-Salih, A.A., & Saadawi, I.S. 1976. Viability studies of apple cultivars. Journal of Horticultural Sciences, 47, 191-198.

Soujanya, P., Kulkarni, B. S., Kumar, R., Munikrishnappa, P. M., Shivapriya, M., & Harshavardhan, M. (2018). Evaluation of rose (Rosa hybrida L.) varieties for growth, yield and quality under eastern dry zone of Karnataka. Journal of Pharmacognosy and Phytochemistry, 7(5), 165-168.

Souza, F. S., Martarello, F. H. H., Rosolem, C. A., & Oosterhuis, D. (2007). Efeito do cloreto de mepiquat na espessura de folhas do algodoeiro em funcao da temperatura. Revista Brasileira Biociencias, 5(52), 315-317.

Spiller, M., Berger, R. G., & Debener, T. (2010). Genetic dissection of scent metabolic profiles in diploid rose populations. Theoretical and Applied Genetics, 120(7), 1461-1471.

Spiller, M., Linde, M., Oyant, H. L., Tsai, C. J., Byrne, D. H., Smulders, M. J., ... others. (2011). Towards a unified genetic map for diploid roses. Theoretical and Applied Genetics, 122(3), 489-500.

Staub, J. E., Serquen, F. C., & Gupta, M. (1996). Genetic markers, map construction, and their application in plant breeding. Horticultural Science, 31(5), 729- 741.

Steel, R. G., & Torrie, J. H. (1986). Principles and procedures of statistics: A

167

biometrical approach. McGraw-Hill.

Stephenson, A. G., & Bertin, R. I. (1983). Male competition, female choice, and sexual selection in plants. Pollination Biology, 109, 149.

Stone, J. L., Thomson, J. D., & Dent‐Acosta, S. J. (1995). Assessment of pollen viability in hand‐pollination experiments: a review. American Journal of Botany, 82(9), 1186-1197.

Svejda, F. (1968). Effect of temperature and seed coat treatment on the germination of rose seeds. Horticultural Science, 3(3), 184-185.

Tabaei, A. S., Sahebi, M., Jafari, A. A., & Rezaei, M. B. (2004). Evaluation of flower yield and morphological characteristics of 11 Rosa damascena Mill. genotypes using multivariate analyses. Iranian Journal of Medicinal and Aromatic Plants, 20, 199-213.

Tabassum, R., Ghaffoor, A., Waseem, K., & Nadeem, M. A. (2002). Evaluation of rose cultivars as cut flower production. Asian Journal of Plant Sciences, 1(6), 668-669.

Tackholm, G. (1922). Zytologische Studien uber die Gattung Rosa. Acta Horticulturae, 7(3), 97-381.

Taj, S., Khan, M. T. I., Abbas, M., & Bashir, A. (2013). Price spread and marketing margins of cut rose in Punjab, Pakistan. Pakistan Journal of Agricultural Research, 26(1). 16-23.

Takahashi, R., Fujitani, C., Yamaki, S., & Yamada, K. (2007). Analysis of the cell wall loosening proteins during rose flower opening. In International Conference on Quality Management in Supply Chains of Ornamentals, 755 (pp. 483-488).

Talia, C., Cristiano, G., & Forleo, L. R. (2003). Evaluation of new anthurium cultivars in soilless culture. Acta Horticulturae, 23-27.

Tallman, G. (2004). Are diurnal patterns of stomatal movement the result of alternating metabolism of endogenous guard cell ABA and accumulation of

168

ABA delivered to the apoplast around guard cells by transpiration?. Journal of Experimental Botany, 55(405), 1963-1976.

Tan, H., Liu, X., Ma, N., Xue, J., Lu, W., Bai, J., … others. (2006). Ethylene- influenced flower opening and expression of genes encoding ETRs, CTRs, and EIN3s in two cut rose cultivars. Postharvest Biology and Technology, 40(2), 97-105.

Tang, G. Q., Luscher, M., & Sturm, A. (1999). Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. The Plant Cell, 11(2), 177-189.

Thiyagu, K., Boopathi, N. M., Nadarajan, N., Gopikrishnan, A., Selvakumar, P., Magadum, S., … others. (2012). Sampling and exploitation of genetic variation exist in locally adapted accessions using phenotypic and molecular markers for genetic improvement of cotton. Gene Conserve, 11(44) 43-49.

Tillberg, E. (1984). Levels of endogenous indole-3-acetic acid in achenes of Rosa rugosa during dormancy release and germination. Plant Physiology, 76(1), 84-87.

Torre, S., & Fjeld, T. (2001). Water loss and postharvest characteristics of cut roses grown at high or moderate relative air humidity. Scientia Horticulturae, 89(3), 217-226.

Torres, A. M., Millan, T., & Cubero, J. I. (1993). Identifying rose cultivars using random amplified polymorphic DNA markers. Horticultural Science, 28(4), 333-334.

Trouverie, J., Chateau-Joubert, S., Thevenot, C., Jacquemot, M. P., & Prioul, J. L. (2004). Regulation of vacuolar invertase by abscisic acid or glucose in leaves and roots from maize plantlets. Planta, 219(5), 894-905.

Ueda, Y., & Akimoto, S. (2001). Cross-and self-compatibility in various species of the genus Rosa. The Journal of Horticultural Science and Biotechnology, 76(4), 392-395.

169

Ueda, Y., Nishihara, S., Tomita, H., & Oda, Y. (2000). Photosynthetic response of Japanese rose species Rosa bracteata and Rosa rugosa to temperature and light. Scientia Horticulturae, 84(4), 365-371.

Uehara, K., & Hogetsu, T. (1993). Arrangement of cortical microtubules during formation of bordered pit in the tracheids of Taxus. Protoplasma, 172(2-4), 145-153.

Uggla, M. (2004). Cultivate the wild roses-experiences from rose hip production in Sweden. In I International Rose Hip Conference, 690 (pp. 83-90).

Uggla, M., & Nybom, H. (1996). Domestication of a new crop in Sweden-dogroses (Rosa sect. Caninae) for commercial rose hip production. In Eucarpia Symposium on Fruit Breeding and Genetics, 484 (pp. 147-152).

Ushio, A., Mae, T., & Makino, A. (2008). Effects of temperature on photosynthesis and plant growth in the assimilation shoots of a rose. Soil Science and Plant Nutrition, 54(2), 253-258.

Usman, M., Ashfaq, M., Taj, S., & Abid, M. (2014). An economic analysis of cut- rose flower in Punjab, Pakistan. The Journal of Animal and Plant Sciences, 24(2), 651-655.

Vainstein, A., Zamir, D., & Weiss, D. (2003). Fragrance and pigments/Functional Genomics. In Encyclopedia of Rose Science (pp. 263-265).

Van der Sart, D. M., & De Visser, P. H. (2004). Nutrient uptake of cut roses grown on substrate. In International Conference on Sustainable Greenhouse Systems-Greensys, 691 (pp. 357-364).

Van Doorn, W. G. (1997). Water relations of cut flowers. Horticultural. Reviews, 18(1), 1-68.

Van Doorn, W. G. (2002). Effect of ethylene on flower abscission: a survey. Annals of Botany, 89(6), 689-693.

Van Doorn, W. G., & Kamdee, C. (2014). Flower opening and closure: an update. Journal of Experimental Botany, 65(20), 5749-5757.

170

Van Doorn, W. G., & Van Meeteren, U. (2003). Flower opening and closure: A review. Journal of Experimental Botany, 54(389), 1801-1812.

Van Doorn, W. G., Groenewegen, G., Vandepol, P. A., & Berkholst, C. E. (1991). Effects of carbohydrate and water status on flower opening of cut Madelon roses. Postharvest Biology and Technology, 1(1), 47-57.

Vanbockstaele, E., Van Huylenbroeck, J., & Leus, L. (2004). Interploidy Crosses in Roses: Use of Triploids. In I International Rose Hip Conference, 690 (pp. 109-112).

Vandersart, D. M., & Devisser, P. H. (2004). Nutrient uptake of cut roses grown on substrate. In International Conference on Sustainable Greenhouse Systems- Greensys, 691 (pp. 357-364).

Vanoverbeek, J. (1966). Plant hormones and regulators. Science, 152(3723), 721- 731.

Vasil, O. Y. (2009). Reproduction systems of representatives of the genus Rosa L. under conditions of continental climate. Contemporary Problems of Ecology, 2(4), 361-368.

Vasil, O.Y., & Tzygankova, A. (2018). Winter-hardiness assessment in groundcovering roses by histochemistry. In Bio Web of Conferences, 11 (pp. 00042).

Vendramini, F., Diaz, S., Gurvich, D. E., Wilson, P. J., Thompson, K., & Hodgson, J. G. (2002). Leaf traits as indicators of resource‐use strategy in floras with succulent species. New Phytologist, 154(1), 147-157.

Vergauwen, R., Ende, V.W., & Laere, V.A. (2000). The role of fructan in flowering of Campanula rapunculoides. Journal of Experimental Botany, 51(348), 1261-1266.

Verhoeven, H. A., Blaas, J., & Brandenburg, W. A. (2016). Fragrance profiles of wild and cultivated roses. In Encyclopedia of Rose Science (pp. 240-248).

Visser, T., Vries, D., Scheurink, J. A. M., & Welles, G. W. H. (1977). Hybrid tea-

171

rose pollen. II. Inheritance of pollen viability. Euphytica, 26(3), 729-732.

Von Malek, B., & Debener, T. (1998). Genetic analysis of resistance to blackspot (Diplocarpon rosae) in tetraploid roses. Theoretical and Applied Genetics, 96(2), 228-231.

Vonabrams, G. J., & Hand, M. E. (1956). Seed dormancy in Rosa as a function of climate. American Journal of Botany, 43(1), 7-12.

Vukosavljev, M., Di Guardo, M., Van de Weg, W. E., Arens, P., & Smulders, M. J. M. (2012). Quantification of allele dosage in tetraploid roses. Towards Marker Assisted Breeding in roses: from marker development to QTL detection, 53.

Vukosavljev, M., Zhang, J., Esselink, G. D., Van‘t Westende, W. P. C., Cox, P., Visser, R. G. F., ... others. (2013). Genetic diversity and differentiation in roses: a garden rose perspective. Scientia Horticulturae, 162, 320-332.

Walters, R. G. (2005). Towards an understanding of photosynthetic acclimation. Journal of Experimental Botany, 56(411), 435-447.

Wang, H., Yang, Y., Li, M., Liu, J., & Jin, W. (2017). Residents preferences for roses, features of rose plantings and the relations between them in built-up areas of Beijing, China. Urban Forestry and Urban Greening, 27, 1-8.

Wang, Q., Zhang, H., Jian, H., Qiu, X., Li, S., & Tang, K. (2010). Studies on pollen viability and stigma receptivity of Chinese rose varieties: Yunfen and Yunmei. Acta Agriculturae Universitatis Jiangxiensis, 32(3), 458-461.

Warmenhoven, M., Eveleens-Clark, B., Van Mourik, N., Marissen, N., & Dehoog, J. (2000). Effects of plant density, harvest methods and bending of branches on the production and quality of roses. In III International Symposium on Rose Research and Cultivation, 547 (pp. 311-317).

Warner, R. M., & Erwin, J. E. (2000). Estimation of total canopy photosynthetic capacity of roses grown under two canopy management systems. In IV International ISHS Symposium on Artificial Lighting, 580 (pp. 89-93).

172

Welling, A., Kaikuranta, P., & Rinne, P. (1997). Photoperiodic induction of dormancy and freezing tolerance in Betula pubescens. Involvement of ABA and dehydrins. Physiologia Plantarum, 100(1), 119-125.

Werlemark, G. (2000). Evidence of apomixis in hemisexual dogroses, Rosa Caninae. Sexual Plant Reproduction, 12(6), 353-359.

Werlemark, G. (2009). Dogrose: Wild plant, bright future. Chronica Horticulturae, 49(2), 8-13.

Werlemark, G., & Nybom, H. (2001). Skewed distribution of morphological character scores and molecular markers in three interspecific crosses in Rosa section Caninae. Hereditas, 134(1), 1-13.

Werlemark, G., Carlson-Nilsson, U., Uggla, M., & Nybom, H. (1995). Effects of temperature treatments on seedling emergence in dogroses, Rosa Caninae (L). Acta Agriculturae Scandinavica B-Plant Soil Sciences, 45(4), 278-282.

Werlemark, G., Uggla, M., & Nybom, H. (1999). Morphological and RAPD markers show a highly skewed distribution in a pair of reciprocal crosses between hemisexual dogrose species, Rosa Caninae. Theoretical and Applied Genetics, 98(4), 557-563.

Wernicke, W., Gunther, P., & Jung, G. (1993). Microtubules and cell shaping in the mesophyll of Nigella damascena L. Protoplasma, 173(2), 8-12.

White, J. W., & Holcomb, E. J. (1987). A manual of greenhouse rose production. Ithaca: Roses Incorporated, 14-21.

Widrlechner, M. P. (1981). History and utilization of Rosa damascena. Economic Botany, 35(1), 42-58.

Winkel-Shirley, B. (2001). Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiology, 126(2), 485-493.

Wissemann, V. (2002). Molecular evidence for allopolyploid origin of the Rosa Canina-complex (Rosaceae). Journal of Applied Botany, 76(6), 176-178.

173

Wollmann, H., Mica, E., Todesco, M., Long, J. A., & Weigel, D. (2010). On reconciling the interactions between a petal A2, miR172 and agamous with the ABC model of flower development. Development, 137(21), 3633-3642.

Wronska-Pilarek, D., & Tomlik-Wyremblewska, A. (2010). Pollen viability and in vitro germination of selected Central European species from genus Rosa analysed with different methods. Dendrobiology, 64, 43-53.

Wylie, A. (1955). The history of garden roses. Endeavour, 14(56), 181-189.

Xu, Q., Wen, X., & Deng, X. (2004). A simple protocol for isolating genomic DNA from chestnut rose (Rosa roxburghii Tratt) for RFLP and PCR analyses. Plant Molecular Biology Reporter, 22(3), 301-302.

Xu, T., Wu, Y., Yi, X., Tan, J., Zhao, H., Yu, C., ... others. (2018). Reinforcement of resistance of modern rose to black spot disease via hybridization with Rosa rugosa. Euphytica, 214(10), 175.

Xu, Y., & Crouch, J. H. (2008). Marker-assisted selection in plant breeding: From publications to practice. Crop Science, 48(2), 391-407.

Yamada, K., Norikoshi, R., Suzuki, K., Imanishi, H., & Ichimura, K. (2009). Determination of subcellular concentrations of soluble carbohydrates in rose petals during opening by nonaqueous fractionation method combined with infiltration–centrifugation method. Planta, 230(6), 1115-1127.

Yambe, Y., & Takeno, K. (1992). Improvement of rose achene germination by treatment with macerating enzymes. Horticultural Science, 27(9), 1018- 1020.

Yan, Z. F., Dolstra, O., Hendriks, T., Prins, T. W., Stam, P., & Visser, P. B. (2005a). Vigour evaluation for genetics and breeding in rose. Euphytica, 145(3), 339- 347.

Yan, Z., Denneboom, C., Hattendorf, A., Dolstra, O., Debener, T., Stam, P., … others. (2005b). Construction of an integrated map of rose with AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers. Theoretical and

174

Applied Genetics, 110(4), 766-777.

Yokoya, K., Roberts, A. V., Mottley, J., Lewis, R., & Brandham, P. E. (2000). Nuclear DNA amounts in roses. Annals of Botany, 85(4), 557-561.

Younis, A., Riaz, A., Ahmed, R., & Raza, A. (2007). Effect of hot water, sulphuric acid and nitric acid on the germination of rose seeds. In International Conference on Quality Management in Supply Chains of Ornamentals, 755 (pp. 105-108).

Younis, A., Riaz, A., Aslam, S., Ahsan, M., Tariq, U., Javaid, F., ... others. (2013). Effect of different pruning dates on growth and flowering of Rosa centifolia. Pakistan Journal of Agriculture Sciences, 50, 605-609.

Yu, C., Luo, L., Pan, H., Guo, X., Wan, H., & Zhang, Q. (2015). Filling gaps with construction of a genetic linkage map in tetraploid roses. Frontiers in Plant Science, 5, 796.

Zarina, G., Munir, M., Qasim, M., Jamil, M., & Baloch, J. (2004). Effect of extent of pruning on growth and floweringcharacteristics of six exotic rose cultivars. Sarhad Journal of Agriculture, 22, 15-24.

Zeb, J., Khan, Z., & Jan, A. S. (2007). Marketing of Floriculture in NWFP. Sarhad Journal of Agriculture, 23(3), 815.

Zeiger, E., Talbott, L. D., Frechilla, S., Srivastava, A., & Zhu, J. (2002). The guard cell chloroplast: A perspective for the twenty‐first century. New Phytologist, 153(3), 415-424.

Zeinali, H., Tabaei-Aghdaei, S. R., & Arzani, A. (2009). A study of morphological variations and their relationship with flower yield and yield components in Rosa damascena. Journal Agriculture Science and Technology, 11(4), 439- 448.

Zekavati, H. R. (2014). Effects of time and severity of pruning on growth and branch development of rose (Rosa spp.). Asian Journal of Agricultural Sciences, 6(3), 79-82.

175

Zekavati, H. R., & Zadeh, A. A. (2013). Effect of time and type of pruning on the growth characteristics of rose. International Journal of Agriculture and Crop Sciences, 6(11), 698.

Zhang, J., Esselink, G. D., Che, D., Fougere-Danezan, M., Arens, P., & Smulders, M. J. M. (2013). The diploid origins of allopolyploid rose species studied using single nucleotide polymorphism haplotypes flanking a microsatellite repeat. The Journal of Horticultural Science and Biotechnology, 88(1), 85- 92.

Zhang, L. H., Byrne, D. H., Ballard, R. E., & Rajapakse, S. (2006). Microsatellite marker development in rose and its application in tetraploid mapping. Journal of the American Society for Horticultural Science, 131(3), 380-387.

Zhang, X., Zhang, J., Zhang, W., Yang, T., Xiong, Y., & Che, D. (2016). Transcriptome sequencing and de novo analysis of Rosa multiflora under cold stress. Acta Physiologiae Plantarum, 38(7), 164.

Zhang, Y., Xu, H., Zhang, H., Hong, S., Li, J., Chen, T., ... others. (2018). Cultural practices for edible roses in the open field in tropical areas. Agricultural Biotechnology, 7(1), 2164-2193.

Zhou, Z. Q., Bao, W. K., & Wu, N. (2009). Dormancy and germination in Rosa Multibracteata Hemsl. & Wilson. Scientia Horticulturae, 119(4), 434-441.

Zhou, Z. Q., Wu, N., Bao, W. K., & Qiu, P. F. (2008). Post-dispersal factors regulating dormancy and germination of Rosa soulieana seeds. Belgian Journal of Botany, 103-111.

Zhou, Z., & Bao, W. (2011). Levels of physiological dormancy and methods for improving seed germination of four rose species. Scientia Horticulturae, 129(4), 818-824.

Zieslin, N. (1992). Regulation of flower formation in rose plants: a reappraisal. Scientia Horticulturae, 49(4), 305-310.

Zieslin, N., & Mor, Y. (1990). Light on roses. A review. Scientia Horticulturae,

176

43(2), 1-14.

Zieslin, N., Hurwitz, A., & Halevy, A. H. (1975). Flower production and the accumulation and distribution of carbohydrates in different parts of Baccara rose plants as influenced by various pruning and pinching treatments. Journal of Horticultural Science, 50(4), 339-348.

Zlatev, Z., & Lidon, F. C. (2012). An overview on drought induced changes in plant growth, water relations and photosynthesis. Emirates Journal of Food and Agriculture, 57-72.

Zlesak, D. C. (2007). Rose. In Flower Breeding and Genetics (pp. 695-740).

Zlesak, D. C. (2009). Pollen diameter and guard cell length as predictors of ploidy in diverse rose cultivars, species, and breeding lines. Floriculture and Ornamental Biotechnology, 3, 53-70.

Zlesak, D. C., Zuzek, K., & Hokanson, S. C. (2007). A dominant male sterility gene, RSMS1, derived from female Rosa Setigera Mich. and its introgression into modern roses. Horticultural Science, 42(4), 915-916.

Zuraw, B., Sulborska, A., Stawiarz, E., & Chmielewska, W. E. (2015). Flowering biology and pollen production of four species of the genus Rosa L. Acta Agrobotanica, 68(3), 267-278.

177

178

179

180

181

182

183

184

185

186

187

188