DOCSLIB.ORG

Crustacea: Decapoda: Atyidae) in Melanesia and Polynesia with Description of a New Species Camille Lorang, Gérard Marquet, Valentin De Mazancourt

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Crustacea: Decapoda: Atyidae) in Melanesia and Polynesia with Description of a New Species Camille Lorang, Gérard Marquet, Valentin De Mazancourt First Occurrence of the Genus Australatya (Crustacea: Decapoda: Atyidae) in Melanesia and Polynesia with Description of a New Species Camille Lorang, Gérard Marquet, Valentin de Mazancourt To cite this version: Camille Lorang, Gérard Marquet, Valentin de Mazancourt. First Occurrence of the Genus Australatya (Crustacea: Decapoda: Atyidae) in Melanesia and Polynesia with Description of a New Species. Pacific Science, University of Hawaii Press, 2020, 74 (3), pp.297-308. 10.2984/74.3.7. hal-03303256 HAL Id: hal-03303256 https://hal.archives-ouvertes.fr/hal-03303256 Submitted on 28 Jul 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Running title: New species of Australatya 2 3 First occurrence of the genus Australatya (Crustacea: Decapoda: Atyidae) in Melanesia 4 and Polynesia with description of a new species. 5 6 Camille Lorang1, Gérard Marquet1 and Valentin de Mazancourt1, 2 * 7 8 1 Muséum national d’Histoire naturelle, Unité Biologie des organismes et écosystèmes 9 aquatiques (BOREA), MNHN, Sorbonne Université, UCN, UA, CNRS, IRD, CP26, 57 rue 10 Cuvier 75005 Paris, France. 11 2 Museum für Naturkunde, Leibniz Institute for Evolution and Biodiversity Science, 12 Invalidenstraße 43, 10115 Berlin, Germany. 13 14 * Corresponding author. E-mail: [email protected] 15 16 Abstract: During specific inventories led by the Muséum national d’Histoire naturelle 17 (MNHN, Paris), numerous specimens of Atyidae, particularly of Atya-like shrimps were 18 collected in Melanesia (Vanuatu, Solomon Islands) and in Polynesia (Futuna, Samoa). These 19 specimens were morphologically and genetically examined. Our study revealed that some 20 specimens belonged to a new species in the genus Australatya Chace, 1983. The aim of this 21 paper is to describe this new species, Australatya keithi sp. nov., and discuss the distribution 22 of its genus in the studied area. 23 24 Introduction 25 1 26 Until recently, the taxonomy of Atyidae was mainly based on morphological characters. But, 27 in the Caridina genus, some characters have been proven highly variable within a species 28 (e.g. rostrum shape and indentation or coloration) and therefore taxonomically uninformative, 29 making it difficult to establish boundaries between them (von Rintelen and Cai 2009, de 30 Mazancourt et al. 2017). Thus, there is a need for an integrative and standardized approach to 31 improve the group’s systematics, focusing on informative morphological features and using 32 molecular characters (Page et al. 2005, Page and Hughes 2011). To illustrate this problem, we 33 focus here on the genus Australatya Chace, 1983. It has a wide but disjoint distribution in the 34 Indo-Pacific region and includes until now only three species: Australatya striolata 35 (McCulloch and McNeill 1923) and Australatya hawkei Choy, Page and Mos, 2019 from 36 Australia and Australatya obscura Han and Klotz, 2015 from the Philippines, Taiwan (Han 37 and Klotz 2015) and Ryukyu islands (Inui et al. 2019). This genus occurs in the higher course 38 of tropical rivers like other Atya-like shrimps (Atyoida pilipes (Newport, 1847) or Atyopsis 39 spinipes (Newport, 1847)). Only a few studies provided DNA data for species of Australatya 40 (see Cook et al. 2012; Han and Klotz, 2015; Choy et al. 2019). 41 One of the aims of the Muséum national d’Histoire naturelle (MNHN, Paris) is to carry out 42 faunistic inventories of rivers in tropical islands in order to establish better protection of these 43 fragile ecosystems and, in this context, to clarify the taxonomy of poorly known organisms. 44 For our study, several Pacific islands were surveyed: Futuna (Territory of Wallis and Futuna) 45 in October 2004 (Mary et al. 2006), Upolu (Samoa) in July 2008 (Keith et al. 2013) and again 46 in August 2014. Kolombangara and Vella Lavella islands (Solomon Islands) respectively in 47 November 2015 and October 2016, and Santo and Aneityum (Vanuatu) respectively in July 48 2005 and June 2015. As we collected specimens from these different islands from the Pacific 49 Ocean, we started to question the identity of some specimens previously identified as Atyoida 50 pilipes or Atyopsis spinipes collected from these islands. The aim of this study is thus to 2 51 combine morphological data with a 16S rDNA analysis to investigate the “Atya-like” shrimps 52 present in the sampled area. 53 54 Material and Methods 55 56 Collection of specimens 57 Specimens from Pacific islands were collected by electrofishing (portable Dekka 3,000 58 electric device, or SAMUS 1,000: http://www.electro-fisher.net/). All material was preserved 59 in 75%-95% alcohol and has been deposited in the collections of the MNHN in Paris. 60 61 Morphological comparison 62 The rostrum, the general cephalon, the pereopods 1, 2, 3 and 5 and the abdomen were 63 observed using a stereoscopic microscope. The proportions of the various joints of the 64 appendages were measured using microphotographs and AnalySIS Works software 65 (Olympus). Drawings were made using the ‘Digital Inking’ method (Coleman 2003, 2006) by 66 tracing vectorial paths on stacks of high-resolution photographs using Adobe Illustrator 67 (CS6). 68 69 Abbreviations for morphological analyses 70 The following abbreviations are used in the present text: cl, carapace length (mm): measured 71 from the post-orbital margin to the posterior margin of the carapace. P1: first pereopod. P2: 72 second pereopod. P3: third pereopod. P5: fifth pereopod. Pl1: first male pleopod. Pl2: second 73 male pleopod. 74 75 DNA extraction, amplification, sequencing 3 76 Molecular analyses were conducted on mitochondrial DNA, on the 16S ribosomal RNA 77 fragment, in order to differentiate each specimen by species and location. A total of 10 78 specimens of Australatya were genetically studied. 79 Total DNA was extracted from abdominal muscle samples using the NucleoSpin 96 Tissue 80 Core (Macherey-Nagel) protocol. For each sample, PCR reactions contained: 15.44 µl of 81 H2O, 2 µl of Taq buffer (15 mM + MgCl2), 1 µl of DMSO (1 ng/ml), 1 µl of BSA, 0.8 µl of 82 dNTP (6.6 mM), 0.32 µl of Forward primer (16Sar-Lmod: 83 TACTTCTGCCTGTTTATCAAAAA) and 0.32 µl of Reverse primer (16Sbmod: 84 GGTCTGAACTCAAATCATGTAAA), both at 10 pM, 0.12 µl of Taq polymerase (Qiagen), 85 and 3 µl of purified DNA from extraction. PCR program was: 4 min at 94°C, then 35 cycles 86 in three steps with 30 sec at 94°C, 40 sec at 42°C and 1 min at 72°C. The program finished 87 with 7 min at 72°C. PCR products were sequenced using Sanger method in both directions to 88 minimize mistakes. 89 90 Molecular analysis 91 Analyses were performed using Geneious 7.1.8. A multiple alignment was realized between 92 all sequences with the MUSCLE algorithm (Edgar 2004). Using Bayesian information 93 criterion in jModelTest (Guindon and Gascuel 2003, Darriba et al. 2012) we retained the GTR 94 + G + I model. From this alignment, a phylogenetic tree was produced by MrBayes 3.2.6, 95 available on CIPRES Science Gateway V3.3 server (Miller et al. 2010, 96 https://www.phylo.org), running for 10,000,000 generations, a sampling frequency of 1,000 97 and a burn in of 10%. Support for nodes was determined using posterior probabilities 98 calculated by MrBayes. With MEGA X (Kumar et al. 2018), another phylogenetic tree was 99 made by maximum likelihood using the same substitution model. Robustness of the nodes 4 100 was assessed using non-parametric bootstrapping (Felsenstein 1985) with 1,000 bootstrap 101 replicates. 102 Species delimitation analyses were realized with the ABGD v. 07/12/18 method (Puillandre et 103 al. 2011) to estimate intra and interspecific divergence in our data using JC69 distances. 104 Priors were left as default (Pmin: 0.001; Pmax 0.1; 10 steps; relative gap width: 1.5; 20 bins). 105 106 Results and Discussion 107 108 Morphological analyses 109 Measures and observations made on the specimens caught allowed us to separate them into 110 three genera, i.e. Atyoida, Atyopsis and Australatya. The general criteria to identify species of 111 the genus Atyoida are P1 and P2 with chelae heteromorphic (with or without palm), P3 112 without meral spur in large males, 3rd maxilliped with uncinate terminal spine, Pl1 of male 113 with endopod tapering sinuously but rather regularly to slender apex, for genus Atyopsis are 114 P1 and P2 with chelae monomorphic (without palm), P3 with prominent spur on merus in 115 large males, 3rd maxilliped not terminating in single apical spine, Pl1 of male with endopod 116 rigid, rhomboidally oval, submarginally spinose, for Australatya are P1 and P2 with chelae 117 monomorphic (without palm), P3 without meral spur in large males, interno-inferior margin 118 of merus forming a carina with 4–9 strong teeth-like spiniform setae, third maxilliped 119 dimorphic between sexes, with uncinate terminal spiniform seta (nail) partially concealed by 120 dense serrate setae in males, tip rounded, without a nail in females, Pl1 of male with endopod 121 tapering to slender apex. The species found in this last genus is new. The description of this 122 species follows thereafter. 11 specimens of Australatya have been identified in our samples: 3 123 from the Solomon Islands, 2 from Futuna, 4 from Samoa and 2 from Vanuatu.
Load more

Recommended publications
  • Decapod Crustacean Grooming: Functional Morphology, Adaptive Value, and Phylogenetic Significance
    Decapod crustacean grooming: Functional morphology, adaptive value, and phylogenetic significance N RAYMOND T.BAUER Center for Crustacean Research, University of Southwestern Louisiana, USA ABSTRACT Grooming behavior is well developed in many decapod crustaceans. Antennular grooming by the third maxillipedes is found throughout the Decapoda. Gill cleaning mechanisms are qaite variable: chelipede brushes, setiferous epipods, epipod-setobranch systems. However, microstructure of gill cleaning setae, which are equipped with digitate scale setules, is quite conservative. General body grooming, performed by serrate setal brushes on chelipedes and/or posterior pereiopods, is best developed in decapods at a natant grade of body morphology. Brachyuran crabs exhibit less body grooming and virtually no specialized body grooming structures. It is hypothesized that the fouling pressures for body grooming are more severe in natant than in replant decapods. Epizoic fouling, particularly microbial fouling, and sediment fouling have been shown r I m ans of amputation experiments to produce severe effects on olfactory hairs, gills, and i.icubated embryos within short lime periods. Grooming has been strongly suggested as an important factor in the coevolution of a rhizocephalan parasite and its anomuran host. The behavioral organization of grooming is poorly studied; the nature of stimuli promoting grooming is not understood. Grooming characters may contribute to an understanding of certain aspects of decapod phylogeny. The occurrence of specialized antennal grooming brushes in the Stenopodidea, Caridea, and Dendrobranchiata is probably not due to convergence; alternative hypotheses are proposed to explain the distribution of this grooming character. Gill cleaning and general body grooming characters support a thalassinidean origin of the Anomura; the hypothesis of brachyuran monophyly is supported by the conservative and unique gill-cleaning method of the group.
    [Show full text]
  • A Migratory Shrimp's Perspective on Habitat Fragmentation in The
    A MIGRATORY SHRIMP’S PERSPECTIVE ON HABITAT FRAGMENTATION IN THE NEOTROPICS: EXTENDING OUR KNOWLEDGE FROM PUERTO RICO BY MARCIA N. SNYDER1,3), ELIZABETH P. ANDERSON2,4) and CATHERINE M. PRINGLE1,5) 1) Odum School of Ecology, University of Georgia, Athens, Georgia 30602, U.S.A. 2) Global Water for Sustainability Program, Florida International University, Miami, FL 33199, U.S.A. ABSTRACT Migratory freshwater fauna depend on longitudinal connectivity of rivers throughout their life cycles. Amphidromous shrimps spend their adult life in freshwater but their larvae develop into juveniles in salt water. River fragmentation resulting from pollution, land use change, damming and water withdrawals can impede dispersal and colonization of larval shrimps. Here we review current knowledge of river fragmentation effects on freshwater amphidromous shrimp in the Neotropics, with a focus on Puerto Rico and Costa Rica. In Puerto Rico, many studies have contributed to our knowledge of the natural history and ecological role of migratory neotropical shrimps, whereas in Costa Rica, studies of freshwater migratory shrimp have just begun. Here we examine research findings from Puerto Rico and the applicability of those findings to continental Costa Rica. Puerto Rico has a relatively large number of existing dams and water withdrawals, which have heavily fragmented rivers. The effects of fragmentation on migratory shrimps’ distribution have been documented on the landscape-scale in Puerto Rico. Over the last decade, dams for hydropower production have been constructed on rivers throughout Costa Rica. In both countries, large dams restrict shrimps from riverine habitat in central highland regions; in Puerto Rico 27% of stream kilometers are upstream of large dams while in Costa Rica 10% of stream kilometers are upstream of dams.
    [Show full text]
  • Universidade De São Paulo Ffclrp
    UNIVERSIDADE DE SÃO PAULO FFCLRP - DEPARTAMENTO DE BIOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA COMPARADA Avaliação sistemática de camarões de água doce do gênero Atya Leach, 1816 (Crustacea: Decapoda: Atyidae) por meio de dados moleculares Caio Martins Cruz Alves de Oliveira Dissertação apresentada à Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto da USP, como parte das exigências para a obtenção do título de Mestre em Ciências, Área: BIOLOGIA COMPARADA Ribeirão Preto - SP 2017 UNIVERSIDADE DE SÃO PAULO FFCLRP - DEPARTAMENTO DE BIOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA COMPARADA Avaliação sistemática de camarões de água doce do gênero Atya Leach, 1816 (Crustacea: Decapoda: Atyidae) por meio de dados moleculares Caio Martins Cruz Alves de Oliveira Orientador: Prof. Dr. Fernando Luis Medina Mantelatto Co-orientadora: Profa. Dra. Mariana Terossi Rodrigues Mariano Dissertação apresentada à Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto da USP, como parte das exigências para a obtenção do título de Mestre em Ciências, Área: BIOLOGIA COMPARADA Versão Original Ribeirão Preto - SP 2017 Autorizo a reprodução e divulgação total ou parcial deste trabalho, por qualquer meio convencional ou eletrônico, para fins de estudo e pesquisa, desde que citada a fonte. Oliveira, C. M. C. A. “Avaliação sistemática de camarões de água doce do gênero Atya Leach, 1816 (Crustacea: Decapoda: Atyidae) por meio de dados moleculares” Ribeirão Preto, 2017 vii+107p. Dissertação (Mestrado – Programa de Pós-graduação em Ciências. Área de concentração: Biologia Comparada). Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo (FFCLRP-USP). Orientador: Mantelatto, F.L.M.; Co-orientadora: Mariano, M.T.R.
    [Show full text]
  • May Atyid Shrimps Act As Potential Vectors of Crayfish Plague?
    A peer-reviewed open-access journal NeoBiota 51: 65–80 (2019) Atyid shrimps as potential A. astaci vectors 65 doi: 10.3897/neobiota.51.37718 RESEARCH ARTICLE NeoBiota http://neobiota.pensoft.net Advancing research on alien species and biological invasions May atyid shrimps act as potential vectors of crayfish plague? Agata Mrugała1, Miloš Buřič2, Adam Petrusek1, Antonín Kouba2 1 Department of Ecology, Faculty of Science, Charles University, Viničná 7, Prague 2 CZ-12844, Czech Re- public 2 University of South Bohemia in České Budějovice, Faculty of Fishery and Protection of Waters, South Bohemian Research Centre of Aquaculture and Biodiversity of Hydrocenoses, Zátiší 728/II, 389 25 Vodňany, Czech Republic Corresponding author: Agata Mrugała ([email protected]) Academic editor: Belinda Gallardo | Received 26 June 2019 | Accepted 3 October 2019 | Published 1 November 2019 Citation: Mrugała A, Buřič M, Petrusek A, Kouba A (2019) May atyid shrimps act as potential vectors of crayfish plague? NeoBiota 51: 65–80. https://doi.org/10.3897/neobiota.51.37718 Abstract The causative agent of crayfish plague, Aphanomyces astaci Schikora, was long considered to be a specialist pathogen whose host range is limited to freshwater crayfish. Recent studies, however, provided evidence that this parasite does not only grow within the tissues of freshwater-inhabiting crabs but can also be successfully transmitted by them to European crayfish species. The potential to act as alternative A. astaci hosts was also indicated for freshwater shrimps. We experimentally tested resistance of two freshwater atyid shrimps: Aty- opsis moluccensis (De Haan, 1849) and Atya gabonensis Giebel, 1875. They were infected with the A.
    [Show full text]
  • Evaluation of the Distribution of Shrimp Species Found in Southern Benin Through the Lake Nokoué-Ocean Complex
    Evaluation of the Distribution of Shrimp Species Found in Southern Benin Through the Lake Nokoué-ocean Complex Sèlomè Wilfried Sintondji ( [email protected] ) University of Abomey-Calavi: Universite d'Abomey-Calavi https://orcid.org/0000-0002-8720-8650 Amoussou Sylvain Gozingan Universite d'Abomey-Calavi Zacharie Sohou Universite d'Abomey-Calavi Matthieu Taymans Royal Belgian Institute of Natural Sciences: Institut royal des Sciences Naturelles de Belgique Katrijn Baetens Royal Belgian Institute of Natural Sciences: Institut royal des Sciences Naturelles de Belgique Geneviève Lacroix Royal Belgian Institute of Natural Sciences: Institut royal des Sciences Naturelles de Belgique Emile Didier Fiogbé Universite d'Abomey-Calavi Research article Keywords: Crustacea, Migration, Salinity, Habitat map, Habitat suitability study Posted Date: July 28th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-737076/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background The export of shrimp to the European Union was one of the mainstays of the Beninese economy. It is an income-generating activity for the populations living along lake Nokoué. The lack of a sheries management strategy has caused a drastic decline in shrimp production in lake Nokoué since 2003. To remedy this problem, it is necessary to hypothesize on their spatio-temporal dynamics in the lake Nokoué-Cotonou channel complex. This is investigated by combining a literature review on their life cycles and habitat suitability with spatio-temporal evolution of salinity obtained from in-situ observations. Results The literature review recognizes the presence in southern Benin of species of the genus Macrobrachium, Atya and Desmocaris (seven, two and one respectively) and ve species of marine shrimps belonging to three genera: the genus Penaeus, the genus Holthuispenaeopsis and the genus Parapenaeus.
    [Show full text]
  • Atya Gabonensis) from River Benue, Nigeria
    Sustainability, Agri, Food and Environmental Research, (ISSN: 0719-3726), 9(2), 2021: 205-215 http://dx.doi.org/10.7770/safer-V0N0-art2257 Nutrient and anti-nutrient composition of processed crayfish (Atya gabonensis) from river Benue, Nigeria. Composición de nutrientes y antinutrientes del cangrejo de río procesado (Atya gabonensis) del río Benue, Nigeria. I.M. Iwar*, & C.M. Amu Department of Wildlife and Range Management, Federal University of Agriculture, Makurdi, Nigeria Corresponding Author: +2347030857281; E-mail: [email protected] / [email protected] ABSTRACT The species of crayfish identified as (Atya gabonensis) along River Benue Nigeria and were captured and analyzed for nutrient and antinutrient content including, proximate composition (crude protein, crude fat, crude fiber, ash, and moisture content), as well as vitamin A, Vitamin B components, Vitamin C, Vitamin D, vitamin E, Vitamin K and select mineral concentrations. Additionally, some important antinutrients in crayfish were also examined. The proximate composition showed that moisture content was (9.54%), protein was (7.46%), Crude fibre was (5.60%), fat was (1.57%) and ash was (2.47%) respectively. This was found to be rich in protein and considerably high amount of moisture content. The anti-nutrient composition analysis revealed the presence of Saponin (0.471mg/100g), Alkaloid (3.905mg/100g), flavonoid (0.675mg/100g), tannin (0.017mg/100g), Phytate (0.060mg/100g), Oxalate (0.005mg/100g) and others, all of which are below toxic level. For mineral and vitamin compositions, potassium was significantly (P>0.05) higher than iron, zinc, magnesium, calcium and phosphorus while vitamin C was (4.920mg/100g) which is higher than all other vitamins evaluated.
    [Show full text]
  • Assessment of the Risk to Norwegian Biodiversity from Import and Keeping of Crustaceans in Freshwater Aquaria
    VKM Report 2021: 02 Assessment of the risk to Norwegian biodiversity from import and keeping of crustaceans in freshwater aquaria Scientific Opinion of the Panel on Alien Organisms and Trade in Endangered Species of the Norwegian Scientific Committee for Food and Environment VKM Report 2021: 02 Assessment of the risk to Norwegian biodiversity from import and keeping of crustaceans in freshwater aquaria. Scientific Opinion of the Panel on Alien Organisms and trade in Endangered Species (CITES) of the Norwegian Scientific Committee for Food and Environment 15.02.2021 ISBN: 978-82-8259-356-4 ISSN: 2535-4019 Norwegian Scientific Committee for Food and Environment (VKM) Postboks 222 Skøyen 0213 Oslo Norway Phone: +47 21 62 28 00 Email: [email protected] vkm.no vkm.no/english Cover photo: Mohammed Anwarul Kabir Choudhury/Mostphotos.com Suggested citation: VKM, Gaute Velle, Lennart Edsman, Charlotte Evangelista, Stein Ivar Johnsen, Martin Malmstrøm, Trude Vrålstad, Hugo de Boer, Katrine Eldegard, Kjetil Hindar, Lars Robert Hole, Johanna Järnegren, Kyrre Kausrud, Inger Måren, Erlend B. Nilsen, Eli Rueness, Eva B. Thorstad and Anders Nielsen (2021). Assessment of the risk to Norwegian biodiversity from import and keeping of crustaceans in freshwater aquaria. Scientific Opinion of the Panel on Alien Organisms and trade in Endangered Species (CITES) of the Norwegian Scientific Committee for Food and Environment. VKM report 2021:02, ISBN: 978-82-8259- 356-4, ISSN: 2535-4019. Norwegian Scientific Committee for Food and Environment (VKM), Oslo, Norway. 2 Assessment of the risk to Norwegian biodiversity from import and keeping of crustaceans in freshwater aquaria Preparation of the opinion The Norwegian Scientific Committee for Food and Environment (Vitenskapskomiteen for mat og miljø, VKM) appointed a project group to draft the opinion.
    [Show full text]
  • Decapoda, Palaemonidae): Uma Abordagem Molecular E Morfológica De Padrões Filogeográficos, Evolução De Características Ecológicas
    UNIVERSIDADE DE SÃO PAULO FFCLRP - DEPARTAMENTO DE BIOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA COMPARADA Sistemática do gênero Palaemon Weber, 1795 (Decapoda, Palaemonidae): uma abordagem molecular e morfológica de padrões filogeográficos, evolução de características ecológicas e status taxonômico das espécies no Brasil FABRÍCIO LOPES DE CARVALHO Tese apresentada à Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto-USP, como parte das exigências para obtenção do título de Doutor em Ciências - Área: Biologia Comparada. RIBEIRÃO PRETO / SP 2014 UNIVERSIDADE DE SÃO PAULO FFCLRP - DEPARTAMENTO DE BIOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA COMPARADA Sistemática do gênero Palaemon Weber, 1795 (Decapoda, Palaemonidae): uma abordagem molecular e morfológica de padrões filogeográficos, evolução de características ecológicas e status taxonômico das espécies no Brasil FABRÍCIO LOPES DE CARVALHO Tese apresentada à Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto-USP, como parte das exigências para obtenção do título de Doutor em Ciências - Área: Biologia Comparada. Orientador: Prof. Dr. Fernando Luis Medina Mantelatto Versão Corrigida RIBEIRÃO PRETO / SP 2014 Carvalho, F. L. Sistemática do gênero Palaemon Weber, 1795 (Decapoda, Palaemonidae): uma abordagem molecular e morfológica de padrões filogeográficos, evolução de características ecológicas e status taxonômico das espécies no Brasil 192 p. Tese apresentada à Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto-USP. Orientador: Fernando Luis Medina Mantelatto
    [Show full text]
  • INFRAORDER CARIDEA Dana, 1852
    click for previous page - 67 - Local Names: Kwei kung (Thailand), Rebon, Djembret (Indonesia; names used for a mixture of Acetes, penaeid larvae and Mysidacea). Literature: Omori, 1975:69, Figs. 14,30. Distribution: Indo-West Pacific: south coast of China to Malaya, Singapore and Indonesia. Habitat: Depth 9 to 55 m, possibly also shallower. Bottom mud and sand. Marine. Size: Total length 17 to 26 mm , 20 to 34 mm . Interest to Fishery: Omori (1975:69) reported the species from the fish market in Jakarta (Indonesia) and also mentioned it as one of the species of the genus fished commercially in Thailand and Singapore. Sergestes lucens Hansen, 1922 SERG Serg 1 Sergestes lucens Hansen, 1922, Résult.Campagne Sci.Prince Albert I, 64:38,121 Synonymy: Sergestes kishinouyei Nakazawa & Terao, 1915; Sergetes phosphoreus Kishinouye, 1925. FAO Names: Sakura shrimp (En), Chevrette sakura (Fr), Camarón sakura (Sp). Local Names: Sakura ebi (Japan) [Niboshi ebi for the dried product]. Literature: Gordon, 1935:310, Figs.lc,3a,4,5,6a,b,7; Omori, 1969:1-83, textfigs. 1-40, col. Pl. 1. Distribution: Indo-West Pacific: so far only known from Japan (Tokyo, Sagami and Suruga Bays). Habitat: In shallow coastal waters. Planktonic. Marine. Size: Maximum total length 35 to 43 mm , 37 to 48 mm . Interest to Fishery: Notwithstanding the restricted area of the species, it "is one of the commercially important shrimps in Japan, and is one of the few planktonic organisms which [are] utilized by Man directly" (Omori, 1969:l); the annual landing around 1969 was 4 000 to 7 000 t.
    [Show full text]
  • Crustacea and Shrimp in the Freshwater Aquarium JBL 2
    BROCHUREJBL9 What - Why - How ? Crustacea and shrimp in the freshwater aquarium JBL 2 Contents Page Preliminary note ............................................................. 3 Preconditions .................................................................. 4 Equipping the aquarium ................................................. 4 The right water ............................................................... 6 Food ............................................................................ 10 Care ............................................................................. 11 Communities ................................................................. 12 Overview of species - shrimp Dwarf shrimp ................................................................ 13 Fan shrimp ..................................................................... 14 Large-clawed shrimp ...................................................... 15 Overview of species - crustaceans Dwarf crayfish ............................................................... 16 Large American crayfish ................................................. 17 Cherax from Australia and Papua New Guinea .............. 18 Crab .............................................................................. 22 Photo overview: Dwarf shrimp ................................................................ 24 Fan shrimp ..................................................................... 26 Large-clawed shrimp ...................................................... 27 Dwarf crayfish
    [Show full text]
  • 120 Fee (Rathbun, 1900:313), Id
    120 SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY FIGURE 48.—Atya scabra (from male from Sao Tiago, Cape Verde Islands): a, dorsal view of cephalic region; b, mesial view of appendices masculina and interna; c, lateral view of cephalic region; d, lateral view of second through fifth abdominal pleura; e, lateral view of preanal carina;/, lateral view of third pereiopod; g, dorsal view of telson; h, flexor surface of distal part of third pereiopod. (Scales marked in 1 mm increments.) fee (Rathbun, 1900:313), Id* (17.3), 22 Mar 1897, GHANA: (1) Environs of Cape Coast between R.P. Currie. (2) fBM> St. Paul River near Handi Elmina and Anomabu (Rutherford, 1971:87,88). / (6°54 N, 10°22'W), 1$ (24.3), 6 Mar 1970, R. CAMEROON: (1) "Etome in Bachen" (Aurivillius, Garms. (3) *RNHL, Sheffelinsville between Mon- 1898:16). (2) Victoria (Balss, 1925:239). (3) Bim- rovia and Marshall (Holthuis, 1966:235), 16* bia River near Dikullu (Monod, 1928:121; (12.2), 1887, J. BGttikofer. (4) fBM, Cavalla 1933:462). (4) stream near Tiko (Monod, River near Nyaake, Grand Gedeh Co (4°51'N, 1933:462). (5) Kienke River near Kribi (Monod, 7°35'W), \6 (23.1), 13 Dec 1970, RG. (5) 1933:462), (6) fRNHL, about 3 km N of Kribi, fUSNM, Liberia Harbel, 64 km inland from 1 juv (3.9), 5 Aug 1964, B. de Wilde-Duyfjes. (7) Monrovia, 19 (17.7), "Smithsonian Firestone *RNHL, pools and waterfalls of the Lobe River Exped. to Liberia." (6) fUSNM, Cavalla River about 9.0 km S of Kribi (Holthuis, 1966:235), 56* at Bolobo, 26 (20.1, 23.3), 1$ (10.2), H.A.
    [Show full text]
  • Beautiful, but Also Potentially Invasive
    Ekológia (Bratislava) Vol. 34, No. 2, p. 155–162, 2015 DOI:10.1515/eko-2015-0016 BEAUTIFUL, BUT ALSO POTENTIALLY INVASIVE BORIS LIPTÁK*, BARBORA VITÁZKOVÁ South Bohemian Research Center of Aquaculture and Biodiversity of Hydrocenoses, Faculty of Fisheries and Pro- tection of Waters, University of South Bohemia in České Budějovice, Zátiší 728/II, 38925 Vodňany, Czech Republic; e-mail: [email protected] Department of Zoology, Faculty of Natural Sciences, Comenius University in Bratislava, Mlynská dolina B-1, 842 15 Bratislava, Slovak Republic * Author for correspondence Abstract Lipták B., Vitázková B.: Beautiful, but also potentially invasive. Ekológia (Bratislava), Vol. 34, No. 2, p. 155–162, 2015. Introduction of non-indigenous exotic species to new areas, where they may establish viable popula- tions and become invasive, is a considerable problem in the protection of nature worldwide, as these species may alter the indigenous species population structure and potentially even decrease the biodi- versity. The European fauna underwent through major negative changes on the continent and nowa- days, it experiences another new treat, represented by the expanding aquarium pet trade, and with it, associated species (and disease) introductions. Exotic freshwater crustaceans are one of the taxa widely incorporated in the business, counting a remarkable number of species. Recent records of the exotic marbled crayfish or Marmorkrebs (Procambarus fallax f. virginalis) in German in open ecosystems in Slovakia pointed to human-mediated introductions associated with aquarium pet trade in the country. In this regard, a study of the aquarium pet trade both in expositions and shops and online was assessed. Several crustacean taxa are available both in pet trade exhibitions and online through the Internet.
    [Show full text]