[CANCER RESEARCH 60, 1690–1697, March 15, 2000] A 700-kb Physical Map of a Region of 16q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1 Adam J. W. Paige, Karen J. Taylor, Aengus Stewart, John G. Sgouros, Hani Gabra, Grant C. Sellar, John F. Smyth, David J. Porteous, and J. E. Vivienne Watson2 Imperial Cancer Research Fund [A. J. W. P. , K. J. T., H. G., G. C. S., J. F. S., J. E. V. W.] and MRC Human Genetics Unit [D. J. P.], Western General Hospital, Edinburgh EH4 2XU, United Kingdom, and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [A. S., J. G. S.] ABSTRACT RDA on DNA from malignant ovarian ascites led us to the identi- fication of a homozygous deletion at 9p21 that encompassed the We have identified a >600-kb region at 16q23.2 that is homozygously previously characterized tumor suppressor gene cluster p16, p15, and deleted from malignant ovarian ascites using representational difference p19 (5, 7, 8) described in Ref. 9. Here we describe the characterization analysis. Overlapping homozygous deletions were also observed in the colon carcinoma cell line HCT116 and a xenograft established from the of another homozygous deletion in DNA from the same patient, which small cell lung cancer cell line WX330. This region coincides with that we show maps to 16q23.2. This region shows allele imbalance and described previously by others as showing loss of heterozygosity in pros- DNA loss in many tumor types including prostate cancer (10, 11), tate and breast cancers (C. Li et al., Genes Chromosomes Cancer, 24: breast cancer (12–15), hepatocellular carcinoma (16), and ovarian 175–182, 1999; A. Latil et al., Cancer Res., 57: 1058–1062, 1997; K. cancer (17). Furthermore, the common aphidicolin-inducible fragile Driouch et al., Genes Chromosomes Cancer, 19: 185–191, 1997; A. Iida et site FRA16D also maps to 16q23.2 (18). There have been numerous al., Br. J. Cancer, 75: 264–267, 1997). In addition, the minimally deleted reports of common fragile sites associated with chromosomal rear- region spans the common fragile site FRA16D. We have constructed a rangements in cancer, including translocations (11q) and deletions 700-kb physical map encompassing the deleted region. By fluorescence in (3p; reviewed in Ref. 19). The most extensively characterized of these situ hybridization of aphidicolin-induced metaphase chromosomes, we is FRA3B at 3p14.2. RDA identified a probe that was homozygously have preliminary data to suggest that P1-derived bacterial artificial chro- mosome clones from the contig lie on both sides of FRA16D. This is deleted in cancer cell lines (20). This probe was subsequently mapped confirmed by extensive fluorescence in situ hybridization analysis of the to a YAC and BAC contig in 3p14.2 and found to be within FHIT/ region reported in the accompanying article (M. Mangelsdorf et al., FRA3B (6). Cancer Res., 60: 1683–1689, 2000) and is consistent with an involvement It is thought that common fragile sites may be prone to breaks and of this common fragile site in the loss of 16q23.2 material in various cancer deletions in dividing cells, thus providing a possible mechanism for types. The minimally deleted region of approximately 210 kb has been the inactivation of any neighboring genes. If one of those neighboring characterized using our own markers and public domain markers. Eleven genes acts as a tumor suppressor, then cells in which such a deletion distinct expressed sequences mapped to the region, providing a basis for occurs will have a selective growth advantage. identifying the predicted tumor suppressor gene in this region. We demonstrate here the identification of a small region of ho- mozygous deletion common to an ovarian tumor, a colon carcinoma INTRODUCTION cell line, and a small cell lung cancer cell line. We have constructed a complete physical and partial transcript map across the minimal Relatively few of the many tumor suppressor or growth suppressor deleted region and identified 11 distinct expressed sequences. These genes identified to date have been shown to be involved in ovarian represent possible candidates as novel tumor suppressor genes in- cancer. As a strategy directed toward the identification of novel tumor volved in cancer development in several different tumor types. suppressor genes involved in the initialization or progression of ovar- ian cancer, we have performed RDA3 on DNA from the malignant and fibroblast cells of an ascites specimen obtained from a patient with MATERIALS AND METHODS ovarian cancer. First described by Lisitsyn et al. (1), RDA allows the isolation of DNA that has been gained or lost from the tumor speci- PEO4 malignant and fibroblast cells were derived by differential trypsiniza- men, relative to the normal DNA from the same individual. Homozy- tion of cells in an ascites specimen obtained from a patient with ovarian cancer gous genomic DNA deletions in tumor cells are typically associated (9). The PEO4 cell line was established from the same primary malignant with the inactivation or loss of a gene involved in the control of cell ascitic cells (21). WX330 is a xenograft of a cell line that had been established growth or differentiation. Homozygous deletions are relatively rare, from a small cell lung carcinoma (22). HCT116 is a colonic adenocarcinoma cell line described in Ref. 23 and was a gift from Susan Farrington (MRC but where they have been identified, they have played an important HGU, Edinburgh, United Kingdom). FATO is a lymphoblastoid cell line from role in the isolation of tumor suppressor genes including RB1, WT1, EBV-transformed normal male lymphocytes (a gift from Veronica van Hey- BRCA2, p16, and FHIT (2–6). ningen, MRC HGU, Edinburgh, United Kingdom). Other tumor cell lines were obtained from a tumor bank (ICRF Clare Hall; American Type Culture Received 8/18/99; accepted 1/19/00. Collection, Manassas, VA), and details are available on request. E-cadherin The costs of publication of this article were defrayed in part by the payment of page probes were provided by M. Bussemakers (University Hospital Nijmegen, charges. This article must therefore be hereby marked advertisement in accordance with Nijmegen, the Netherlands). All oligonucleotide primers for PCR were syn- 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by the Imperial Cancer Research Fund and the United Kingdom Medical thesized by Iain Goldsmith (ICRF Clare Hall). Research Council. Identification of a Homozygous Deletion. RDA was carried out as de- 2 To whom requests for reprints should be addressed at, Imperial Cancer Research scribed previously (9). Products were cloned into pBSlox (24) and sequenced Fund Medical Oncology Unit, Western General Hospital, Crewe Road, Edinburgh, EH4 as described previously (9). Primers were designed to the sequences using the 2XU, United Kingdom. Phone: 44-131-332-2471, ext. 2401; Fax: 44-131-332-8494; E-mail: [email protected]. programs PRIMER (Whitehead Institute for Biomedical Research) and 3 The abbreviations used are: RDA, representational difference analysis; FISH, fluo- OLIGO 4.0 (Wojciech Rychlik) and are shown in Table 1. The chromosomal rescence in situ hybridization; LOH, loss of heterozygosity; PAC, P1-derived bacterial location of the RDA products was determined by screening a monochromo- artificial chromosome; YAC, yeast artificial chromosome; EST, expressed sequence tag; some hybrid mapping panel (HGMP-RC, Cambridge, United Kingdom) and a STS, sequence tagged site; ICRF, Imperial Cancer Research Fund; HGMP-RC, Human Genome Mapping Project Resource Center; MRC HGU, Medical Research Council cytogenetic breakpoint mapping panel by PCR (David Callen, Adelaide Wom- Human Genetics Unit; Mb, megabase. en’s and Children’s Hospital, Adelaide, Australia; Ref. 25). PCR was carried 1690 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2000 American Association for Cancer Research. HOMOZYGOUS DELETIONS AT 16q23.2 Table 1 STS and EST markers mapped on the YAC and PAC contigs All previously described markers and genes are shown with their GenBank accession number and their source. Primer sequences are given for novel STS and EST markers as are the method of their derivation and any homology to sequences in GenBank. Two markers were mapped as probes by hybridization, and the sequence is not available for these two markers. GenBank accession no. or Homology to other Markers primer sequence GenBank sequences Probe derivation Existing STSs/ESTs AFMA336YG9 D16S504 Z24121 http://www-ls.lanl.gov/Nature95/Nature95.html D16S516 Z24594 D16S518 Z24645 D16S3029 Z52358 D16S3049 Z53009 D16S3096 Z53592 D16S435E M78830 10102 T50247 IM1 N53108 Bednarek et al. (37) IM2 AA229508 IM3 AA570335 IM4 N62411 N79373 IM7 H54363 H54285, T54906, T55073 IM9 R05832 W86667, W86864, AA693565 IM11 AA807730 IM17 R60779 http://www.ncbi.nlm.nih.gov/genemap98 IM18 Z38870 IM20 T63488 IM22 AA016227 AI097501, H18209, Z41625 Genes CFR-1 U64791 http://www.ncbi.nlm.nih.gov/genemap98 ADTG ACCCAAGCTGAAGAACGAGA Y12226 CTGTCCAAAGTGAGCAGGGT MAF H03998 Tradd L41690 HHCMA56 U13395 KARS D32053 RDA products RD30 GAATAATTTCAAAGAGGGAGG AA447275 RDA products homozygously deleted in the tumor cells, but not fibroblast cells, of an ascites specimen CAGCAGTACGTACATAACTGTT RD53 TTTGTTTGGCTCTAGAAAGC GACTTGGACTGTCACCTTGG RD69 TTAGCAAAAGAAAGGGAGTG GTGGAACCTTTAGGGCTTAT Inter-Alu PCR Alu-PCR on: Alu11 GCTTGCAAAGATGAGGGAAG YAC933H2 with 451 primer CAGAGCCTTCCTCTGGACAC Alu12 ACACATTGTGGGGAGGTTGT YAC933H2 with 211 primer GGGGAATTTCTGAGTCATGG