A 700-Kb Physical Map of a Region of 16Q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1

[CANCER RESEARCH 60, 1690–1697, March 15, 2000] A 700-kb Physical Map of a Region of 16q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1

Adam J. W. Paige, Karen J. Taylor, Aengus Stewart, John G. Sgouros, Hani Gabra, Grant C. Sellar, John F. Smyth, David J. Porteous, and J. E. Vivienne Watson2 Imperial Cancer Research Fund [A. J. W. P. , K. J. T., H. G., G. C. S., J. F. S., J. E. V. W.] and MRC Human Genetics Unit [D. J. P.], Western General Hospital, Edinburgh EH4 2XU, United Kingdom, and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [A. S., J. G. S.]

ABSTRACT RDA on DNA from malignant ovarian ascites led us to the identification of a homozygous deletion at 9p21 that encompassed the We have identified a >600-kb region at 16q23.2 that is homozygously previously characterized tumor suppressor gene cluster p16, p15, and deleted from malignant ovarian ascites using representational difference p19 (5, 7, 8) described in Ref. 9. Here we describe the characterization analysis. Overlapping homozygous deletions were also observed in the colon carcinoma cell line HCT116 and a xenograft established from the of another homozygous deletion in DNA from the same patient, which small cell lung cancer cell line WX330. This region coincides with that we show maps to 16q23.2. This region shows allele imbalance and described previously by others as showing loss of heterozygosity in pros- DNA loss in many tumor types including prostate cancer (10, 11), tate and breast cancers (C. Li et al., Genes Chromosomes Cancer, 24: breast cancer (12–15), hepatocellular carcinoma (16), and ovarian 175–182, 1999; A. Latil et al., Cancer Res., 57: 1058–1062, 1997; K. cancer (17). Furthermore, the common aphidicolin-inducible fragile Driouch et al., Genes Chromosomes Cancer, 19: 185–191, 1997; A. Iida et site FRA16D also maps to 16q23.2 (18). There have been numerous al., Br. J. Cancer, 75: 264–267, 1997). In addition, the minimally deleted reports of common fragile sites associated with chromosomal rear- region spans the common fragile site FRA16D. We have constructed a rangements in cancer, including translocations (11q) and deletions 700-kb physical map encompassing the deleted region. By fluorescence in (3p; reviewed in Ref. 19). The most extensively characterized of these situ hybridization of aphidicolin-induced metaphase chromosomes, we is FRA3B at 3p14.2. RDA identified a probe that was homozygously have preliminary data to suggest that P1-derived bacterial artificial chromosome clones from the contig lie on both sides of FRA16D. This is deleted in cancer cell lines (20). This probe was subsequently mapped confirmed by extensive fluorescence in situ hybridization analysis of the to a YAC and BAC contig in 3p14.2 and found to be within FHIT/ region reported in the accompanying article (M. Mangelsdorf et al., FRA3B (6). Cancer Res., 60: 1683–1689, 2000) and is consistent with an involvement It is thought that common fragile sites may be prone to breaks and of this common fragile site in the loss of 16q23.2 material in various cancer deletions in dividing cells, thus providing a possible mechanism for types. The minimally deleted region of approximately 210 kb has been the inactivation of any neighboring genes. If one of those neighboring characterized using our own markers and public domain markers. Eleven genes acts as a tumor suppressor, then cells in which such a deletion distinct expressed sequences mapped to the region, providing a basis for occurs will have a selective growth advantage. identifying the predicted tumor suppressor gene in this region. We demonstrate here the identification of a small region of homozygous deletion common to an ovarian tumor, a colon carcinoma INTRODUCTION cell line, and a small cell lung cancer cell line. We have constructed a complete physical and partial transcript map across the minimal Relatively few of the many tumor suppressor or growth suppressor deleted region and identified 11 distinct expressed sequences. These genes identified to date have been shown to be involved in ovarian represent possible candidates as novel tumor suppressor genes in- cancer. As a strategy directed toward the identification of novel tumor volved in cancer development in several different tumor types. suppressor genes involved in the initialization or progression of ovarian cancer, we have performed RDA3 on DNA from the malignant and fibroblast cells of an ascites specimen obtained from a patient with MATERIALS AND METHODS ovarian cancer. First described by Lisitsyn et al. (1), RDA allows the isolation of DNA that has been gained or lost from the tumor speci- PEO4 malignant and fibroblast cells were derived by differential trypsiniza- men, relative to the normal DNA from the same individual. Homozy- tion of cells in an ascites specimen obtained from a patient with ovarian cancer gous genomic DNA deletions in tumor cells are typically associated (9). The PEO4 cell line was established from the same primary malignant with the inactivation or loss of a gene involved in the control of cell ascitic cells (21). WX330 is a xenograft of a cell line that had been established growth or differentiation. Homozygous deletions are relatively rare, from a small cell lung carcinoma (22). HCT116 is a colonic adenocarcinoma cell line described in Ref. 23 and was a gift from Susan Farrington (MRC but where they have been identified, they have played an important HGU, Edinburgh, United Kingdom). FATO is a lymphoblastoid cell line from role in the isolation of tumor suppressor genes including RB1, WT1, EBV-transformed normal male lymphocytes (a gift from Veronica van Hey- BRCA2, p16, and FHIT (2–6). ningen, MRC HGU, Edinburgh, United Kingdom). Other tumor cell lines were obtained from a tumor bank (ICRF Clare Hall; American Type Culture Received 8/18/99; accepted 1/19/00. Collection, Manassas, VA), and details are available on request. E-cadherin The costs of publication of this article were defrayed in part by the payment of page probes were provided by M. Bussemakers (University Hospital Nijmegen, charges. This article must therefore be hereby marked advertisement in accordance with Nijmegen, the Netherlands). All oligonucleotide primers for PCR were syn- 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by the Imperial Cancer Research Fund and the United Kingdom Medical thesized by Iain Goldsmith (ICRF Clare Hall). Research Council. Identification of a Homozygous Deletion. RDA was carried out as de- 2 To whom requests for reprints should be addressed at, Imperial Cancer Research scribed previously (9). Products were cloned into pBSlox (24) and sequenced Fund Medical Oncology Unit, Western General Hospital, Crewe Road, Edinburgh, EH4 as described previously (9). Primers were designed to the sequences using the 2XU, United Kingdom. Phone: 44-131-332-2471, ext. 2401; Fax: 44-131-332-8494; E-mail: [email protected]. programs PRIMER (Whitehead Institute for Biomedical Research) and 3 The abbreviations used are: RDA, representational difference analysis; FISH, fluo- OLIGO 4.0 (Wojciech Rychlik) and are shown in Table 1. The chromosomal rescence in situ hybridization; LOH, loss of heterozygosity; PAC, P1-derived bacterial location of the RDA products was determined by screening a monochromo- artificial chromosome; YAC, yeast artificial chromosome; EST, expressed sequence tag; some hybrid mapping panel (HGMP-RC, Cambridge, United Kingdom) and a STS, sequence tagged site; ICRF, Imperial Cancer Research Fund; HGMP-RC, Human Genome Mapping Project Resource Center; MRC HGU, Medical Research Council cytogenetic breakpoint mapping panel by PCR (David Callen, Adelaide Wom- Human Genetics Unit; Mb, megabase. en’s and Children’s Hospital, Adelaide, Australia; Ref. 25). PCR was carried 1690

Table 1 STS and EST markers mapped on the YAC and PAC contigs All previously described markers and genes are shown with their GenBank accession number and their source. Primer sequences are given for novel STS and EST markers as are the method of their derivation and any homology to sequences in GenBank. Two markers were mapped as probes by hybridization, and the sequence is not available for these two markers. GenBank accession no. or Homology to other Markers primer sequence GenBank sequences Probe derivation Existing STSs/ESTs AFMA336YG9 D16S504 Z24121 http://www-ls.lanl.gov/Nature95/Nature95.html D16S516 Z24594 D16S518 Z24645 D16S3029 Z52358 D16S3049 Z53009 D16S3096 Z53592 D16S435E M78830 10102 T50247 IM1 N53108 Bednarek et al. (37) IM2 AA229508 IM3 AA570335 IM4 N62411 N79373 IM7 H54363 H54285, T54906, T55073 IM9 R05832 W86667, W86864, AA693565 IM11 AA807730 IM17 R60779 http://www.ncbi.nlm.nih.gov/genemap98 IM18 Z38870 IM20 T63488 IM22 AA016227 AI097501, H18209, Z41625 Genes CFR-1 U64791 http://www.ncbi.nlm.nih.gov/genemap98 ADTG ACCCAAGCTGAAGAACGAGA Y12226 CTGTCCAAAGTGAGCAGGGT MAF H03998 Tradd L41690 HHCMA56 U13395 KARS D32053 RDA products RD30 GAATAATTTCAAAGAGGGAGG AA447275 RDA products homozygously deleted in the tumor cells, but not fibroblast cells, of an ascites specimen CAGCAGTACGTACATAACTGTT RD53 TTTGTTTGGCTCTAGAAAGC GACTTGGACTGTCACCTTGG RD69 TTAGCAAAAGAAAGGGAGTG GTGGAACCTTTAGGGCTTAT Inter-Alu PCR Alu-PCR on: Alu11 GCTTGCAAAGATGAGGGAAG YAC933H2 with 451 primer CAGAGCCTTCCTCTGGACAC Alu12 ACACATTGTGGGGAGGTTGT YAC933H2 with 211 primer GGGGAATTTCTGAGTCATGG Alu20 CAGTGGTTGGGTCTGGAGAT YAC933H2 with 211 primer CCCCCTGATGCTTTGTTAAA Alu29 AGGCTGCAGTGAGCCATAAT YAC801B6 with 211 primer TCCCCTATGGCTGCTATTGT DOP end cloning DOPa end clones from: 4t7 GGGTCAGAGTCAGTACAAATGG AA885102, AI457266, AI205831, AA447280 PAC81N24 with T7 end CAAATGGGAGATACTTGTTTGC 5t7 GCCAGCCACTCGTTTTTATC PAC137B22 with T7 end AACATGGCAATGCTAAGGAG 7t7 GCACACATTTGCACAGATAC PAC34I1 with T7 end GGAGGTCACCTGTCTGTGT 8t7 TAGCTCACTCATTAGGCACC PAC24K21 with T7 end CCAGTGTGATGGATATCTGC 10sp6 AATAACTCCTTCCAAAAGGC AA807730 PAC22N23 with Sp6 end AAGTCCAGACATCTGACAGG 10t7 GTCATTCCAATAAGTCCAGG R98301 PAC22N23 with T7 end AATGATGAGTTTTGGTCTGG 17sp6 CGAGAAGAAAATGTGGACTC PAC113I12 with Sp6 end TTCCCAGAAAAAGTAGATGC 21sp6 ACTCACTCTCTAACCCTCCC PAC225C13 with Sp6 end CAACCTTCCTTCCTTTGC IM97 CAATAGGGCCATGAAAGCAT AA007376, T86714, YAC972D3 with pYACR end CAGAGACTGAGATGGCCACA AA700384, T87615, T80206, T86812, AA527945 Exon trapping Exon trapping from PAC81N24 using the pSPL3 vector ETA1 TATTTGCAGCATGTCTTGCC AA010088, AA010189 TGCTTGGCACATGGTAAAAA Random sequence Clones derived from rapid, single-pass 178 TACGCTGAATATCACTGGAG sequencing of a 1-kb insert shotgun library TGCCAACCAGTACACAAATA generated from PAC81N24 5.1A6 CCAGGAACACCAAAACAC AA297515 AAACAGAAGGAGCACCAG IM23 AGAGCAGTAGGCAGTGTGGG R01705 CAAGATTGGAAGAGCCTTGG IM25 TTGAAAGCTGGGATTGTTGC W04204, N70268 TCTTGGGAGCTTGAGGGC (continued on next page) 1691

Table 1 Continued GenBank accession no. or Homology to other Markers primer sequence GenBank sequences Probe derivation IM28 ATGGCACCAGGAGATCATTA AA398024 AAGTAATTGCACAGACCCCA IM29 TATGTTGGTGTCTGATTTGG T93255, HS25561 TCCCATTTCACAGTGTTTCT IM30 TGAGGCAGTGATGTACTGTT AI432669 CTCACGCAGAGCAGAATC Probes 2sp6 700-bp DOP-PCR product PAC219H9 with Sp6 end 27sp6 250-bp Fok I fragment of cloned DOP-PCR PAC43B22 with Sp6 end product a DOP, degenerate oligo-primed. out using standard “touchdown” conditions [50 ng of template, 150 pg of each fragments were separated on a 0.8% gel and then transferred to a nylon primer, 200 ␮M deoxynucleotide triphosphates, 1 unit of Taq polymerase membrane (MSI) by Southern blotting. The membrane was hybridized as

(ICRF Pic Taq), 1.5 mM MgCl2, and 50 mM KCl], unless otherwise stated. described above with radiolabeled probes. Reaction conditions 94°C for 3 min; (94°C 30 s; 65°C 30 s; 72°C 30 s) ϫ 2; Shotgun Sequencing of PAC 81N24. PAC DNA was sheared by sonica- decrease annealing temperature by 2°C every two cycles down to 55°C; (94°C tion at an amplitude of 30 ␮m for 10 s. Fragments greater than 500 bp were 30 s; 55°C 30 s; 72°C 30 s) ϫ 20; 72°C 2 min. Reactions were carried out on size-selected by agarose gel electrophoresis and then purified (Prep-a-gene; a Hybaid Omnigene or MJ Tetrad thermocycler. Bio-Rad). DNA was then subcloned into pBSlox plasmid vector that had been Creation of PAC Contig. RDA products were used as probes to screen linearized by digestion with SmaI and dephosphorylated with calf intestinal human PAC libraries. RPCI-1 (P. Ioannou, Roswell Park Cancer Institute, phosphatase (a gift from C. Boyd, MRC HGU; prepared by K. Millar, MRC Buffalo, NY) was obtained from the HGMP-RC and the Sanger Centre HGU) exactly as described previously (24). Clones were then plated out using (Hinxton Hall, Cambridge, United Kingdom), and RPCI-6 (B. Zhao, Roswell blue-white color selection, and a Flexys colony picker (PBA Technologies) Park Cancer Institute) was obtained from the German Human Genome Project was used to pick 720 clones into 96-well trays. Clones were gridded onto inked Resource Center (Berlin, Germany). Probes were generated by PCR on DNA nitrocellulose membranes for hybridization. Clones were stored in 20% glyc- from the lymphoblastoid cell line FATO, followed by gel purification (Prep- erol at Ϫ70°C. This library had a mean insert size of 1 kb. A shotgun library a-Gene; Bio-Rad). Probe DNA was radiolabeled according to standard meth- with a mean insert of size 3 kb was also prepared in the same way from 81N24 ods. DNA was obtained from PAC clones either by using a Qiagen midi DNA DNA sheared by sonication at 30 ␮mfor3s. purification kit (Qiagen UK Ltd.) or by standard alkaline lysis (HGMP-RC). Clones were restriction enzyme-digested with NotI, EagI, BssHII, or SalI DNA from the clones in the 1-kb insert library was prepared using a 96-well 4 (Roche) following the manufacturer’s specifications. The fragments were tray miniprep method provided by Mark Vaudin or Qiagen BioRobot. DNA separated by pulsed field gel electrophoresis using a Bio-Rad DRII apparatus, was checked by digestion with EcoRI/XhoI according to the manufacturer’s typically on a 1% agarose gel, with 5–20s pulse times at 6 V/cm for 20 h. DNA instructions and by separating the fragments by gel electrophoresis. Clones was immobilized onto MSI nylon membrane (Micron Separations Inc., West- were sequenced in 96-well trays using an ABI PRISM rhodamine dye termi- borough, MA) by standard Southern transfer and cross-linked at 120 J in a nator kit on a Hybaid subambient Omnigene thermal cycler. Sequencing Stratalinker (Stratagene). Membranes were hybridized with radiolabeled reactions were precipitated according to manufacturer’s instructions (Perkin- probes under standard conditions, and signal was detected by exposure to Elmer) and run on an ABI 377 machine (Graham Clark, ICRF London, Kodak X-OMAT film overnight. London, United Kingdom; Agnes Gallacher, MRC HGU, Edinburgh, United Generation of Markers. YAC clones from the CEPH MegaYAC library Kingdom). (26) were identified from the Whitehead STS map and obtained from David All sequences were prescreened using RepeatMasker5 and assembled into Callen, HGMP-RC, and the German Human Genome Project Resource Center. contigs using the Staden program Gap4 (Ref. 30; HGMP-RC). Homology DNA was prepared from YAC clones using a Nucleon YAC miniprep kit, searches were performed using BLAST against GenBank, European Molecular following the manufacturer’s instructions (ScotLab Bioscience, Luton, United Biology Laboratory, dbEST, dbSTS, SwissProt/TREMBL, and Escherichia Kingdom). End clones were obtained from PAC and YAC clones using coli genomic databases. degenerate oligo-primed PCR exactly as described previously (27), using the Cytogenetic Mapping of PAC Clones. Aphidicholin was used to induce primers AATTTATCACTACGGAATTC and CCGATCTCAAGATTACG- fragile site expression in the lymphoblastoid cell line FATO according to the GAATTC for YAC clones. Products were either directly sequenced after method described by Glover et al. (31). Cells were harvested between 0.5 and purification on 0.8% agarose gel and DNA extraction (Prep-a-Gene; Bio-Rad) 2 h after the addition of colcemid and then lysed and fixed according to or subcloned into pGemT-easy (Promega), followed by amplification and standard methods (32). One ␮g of each PAC was labeled with either digoxy- DNA preparation using a Qiagen miniprep kit, before sequencing. All sequenc- genin-dUTP or biotin -16-dUTP according to the manufacturer’s instructions ing reactions were carried out using an ABI PRISM dye terminator cycle (Boehringer/Roche) and then cohybridized to metaphase chromosomes using sequencing kit (Perkin-Elmer). standard techniques (32). PAC 81N24 was exon-trapped using vector pSPL3 (Ref. 28; Life Technol- Slides were viewed using a Zeiss Axioplan microscope with a charge- ogies, Inc.). The protocol was carried out according to the manufacturer’s coupled device camera. Images were captured using IPLab SmartCapture instructions, with advice and materials from Donny Black (Cancer Research software. Campaign Beatson Laboratories, Glasgow, United Kingdom). Final PCR products were cloned into pGemT (Promega) and sequenced as described above. Screening of Candidate Genes. Unique primers were obtained for each of Inter-Alu PCR was carried out using the method described previously (29). the candidate genes MAF, CFR-1, KARS, HHCMA56, and Tradd from the PCR was carried out using the following conditions: 95°C for 3 min, (95°C for GeneBridge4 database. Primers for ADTG were derived from the sequence for 30 s, 58°C for 1 min, and 72°C for 1 min) ϫ 30, 72°C for 5 min. Products were the cDNA clone in the GenBank (see Table 1). PCR buffer was as described blunt-end filled with T4 DNA polymerase before being cloned into pBSlox and above, using 2 mM MgCl2 for MAF, CFR-1, KARS, and HHCMA56; 1.5 mM sequenced as described above. PCR primers for existing and novel markers MgCl2 for ADTG;and3mM MgCl2 for Tradd. Conditions for the reactions were designed for unique sequences as described above. were touchdown from 62°C to 52°C for MAF, CFR-1, KARS, and HHCMA56; STS and EST primers from across the PAC contig were used to screen a touchdown from 63°C to 53°C for ADTG; and touchdown from 62°C to 52°C panel of 54 tumor cell lines to identify additional homozygous deletions of this region. DNA was extracted from tumor cell lines using a Nucleon BACC2 kit 4 Mark Vaudin, personal communication. (Scotlab BioSciences). A subset of cell lines was digested with EcoRI, and the 5 A. F. A. Smit and P. Green, unpublished observations. 1692

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2000 American Association for Cancer Research. HOMOZYGOUS DELETIONS AT 16q23.2 for Tradd with an extra 10 cycles at 52°C. Degenerate PCR for cadherin family members was performed using the primers and method described in Ref. 33 on DNA from PAC clones and YAC clones and on the cell line FATO as a positive control. Products were separated on a 2.5% agarose gel and transferred to a nylon membrane (MSI) by Southern blot. Blots of digested PAC clones (described above) were hybridized with cadherin probe pSM13 (exons 7–13), and blots of degenerate PCR products were hybridized with cadherin probe pSM14 (exons 14–16; Ref. 34). Fig. 2. Hybridization of probe 10102 on tumor cell lines. DNA from tumor cell lines was digested with EcoRI and subjected to electrophoresis through a 0.8% gel. The DNA RESULTS was transferred by standard Southern blot to nylon membrane. Radiolabeled probe derived from a genomic clone from the 1-kb insert library and positive for the marker 10102 was Generation of PAC and YAC Contig Spanning the Homozy- hybridized to the membrane overnight under standard conditions. The blot was washed with 0.2ϫ SSC, 0.1% SDS and exposed to film for 9 days. Lane 1, WX330; Lane 2, gous Deletions. RDA identified five unique products of a total of six TR175; Lane 3, TR146; Lane 4, HCT116; Lane 5, HeLa; Lane 6, OVCAR3; Lane 7, characterized that were deleted from the tumor but present in the PEO4; Lane 8, FATO. fibroblast populations of the malignant ovarian ascites specimen. The products were cloned and sequenced as described previously, and xenograft of a small cell lung cancer; and (b) HCT116, a colonic unique primers were designed for each product. By performing PCR adenocarcinoma cell line. PCR screening and Southern hybridization on a monochromosome hybrid panel, we were able to map the RDA of these cell lines with the markers AFMA336YG9 and 10102 re- products. The characterization and localization of one of these clones vealed that neither was deleted in the colonic cell line (Fig. 2), and to 9p21 have been described previously (9). PCR using primers thus the region of homozygous loss in HCT116 was smaller than the derived from the other cloned products showed that all four of them deletions in the other two cell lines and was flanked by these markers. mapped to chromosome 16. One of these clones gave a complex It is likely that the tumor suppressor gene is located within or close to pattern by PCR and was not pursued further. The remaining three this minimal deletion. Gastric adenocarcinoma cell line AGS, origi- products were mapped by PCR on a cytogenetic breakpoint panel nally reported to have a homozygous deletion at 3p14.2 around (Fig. 1). All three were shown to lie between CY113(D) and FRA3B (35), has been identified by Mangelsdorf et al. (36) as having CY121, a distance estimated to be approximately 6 Mb, located at an additional homozygous deletion at 16q23.2, around FRA16D. The 16q23.2 (25). AGS cell line was confirmed as having a deletion mapping within our STS and EST markers from the region listed on the chromosome 16 contig, but it does not narrow down the minimal deleted region integrated map (25) were positioned on YAC clones identified as delineated by HCT116 (see Fig. 3). lying between the cytogenetic breakpoints and mapped relative to the To analyze this region more extensively, we constructed a higher- deletion in the original ovarian tumor. The resulting YAC contig was resolution physical map across the HCT116 deletion using PAC approximately 3 Mb in length and extended between markers clones. Three unique RDA products (RD30, RD53, and RD69) were D16S518 and D16S504/D16S516 (see Fig. 1). YAC clone 801B6 used to screen the RPCI-1 human PAC library by hybridization and fully encompassed the region of homozygous loss in PEO4, thus identified a total of seven PAC clones. To generate additional markers defining the maximum size of the deletion as 1.4 Mb. for physical mapping, inter-Alu PCR was performed on YAC clones A panel of tumor cell lines and xenografts was screened with 801B6 and 933H2, and two of the resulting products, Alu11 and markers from within the deletion (Table 1). Of 54 cell lines, only 2 Alu20 (see Table 1), were used to rescreen the RPCI-1 library and others were shown to contain homozygous deletions: (a) WX330, a identify additional PAC clones. End sequences from a number of the PACs and YACs were obtained by degenerate oligo-primed PCR end cloning (see Table 1), and two of these markers, 7t7 and IM97, were used to isolate additional PAC clones from the RPCI-1 and RPCI-6 libraries, respectively. PCR primers designed from all of the end sequences and Alu PCR clones were also used to map the PAC clones to construct a contig map. The degree of overlap between the PACs was determined by restriction enzyme analysis. Digested PAC fragments were separated by pulsed field electrophoresis and hybridized with several of the markers in the region. The resulting contig containing 23 clones is ϳ700 kb in length and is shown in Fig. 3. The EagI and BssHII restriction sites are shown. No NotI sites were found in any of the clones. A BssHII site was identified near the proximal end of PAC 253H19 but was not detectable in any of the overlapping clones and appears to be due to a polymorphism in this clone gener- ating a novel restriction site. The PAC clones surrounding this polymorphic site were therefore placed in the contig on the basis of both EagI and SalI restriction data and their STS content. The resulting PAC contig encompasses the minimal deletion as defined by the HCT116 cell line and defines this region of loss as Fig. 1. Localization of a homozygous deletion on 16q. The RDA products were ϳ mapped to 16q23.2, a region containing the polymorphic markers D16S515, D16S518, being 210 kb and flanked by the markers Alu20 and 10102 (see Fig. D16S516, D16S504, and D16S507, which have been shown to exhibit LOH in a variety 3). Although the contig does not fully encompass the regions homozy- of tumor types (10–14, 16), and the common fragile site FRA16D. PCR screening of a gously lost in two of the other cell lines, it does contain much of the cytogenetic breakpoint panel localized the RDA products to a ϳ6-Mb region between the CY113(D) and CY121 breakpoints. YAC clones positive for the RDA products were deleted regions, including the PEO4 distal breakpoint and the WX330 aligned into a contig of approximately 3 Mb containing D16S518 and D16S504, which proximal breakpoint. The contig also extends more than 200 kb encompassed the homozygous deletion. A PAC contig of 700 kb encompassing the minimal deletion was built up starting with PAC clones positive for the RDA products, proximally and distally of the minimal deletion and is thus likely to followed by chromosome walking both proximally and distally. contain any tumor suppressor gene affected by the deletion. 1693

Fig. 3. Physical map of the 16q23.2 deletion interval. a, relative positions of EST markers (filled circles) and STS markers (E) within the YAC and PAC contig. Solid filled circles (F) represent EST markers lying within the minimally deleted region. The extent of the FRA16D region is based on data presented by Mangelsdorf et al. (36). b, PAC contig encompassing ϳ700 kb. PAC clones were obtained from the RPCI-1 library or, where indicated, the RPCI-6 library (see “Materials and Methods”). A scale bar with distances shown in kb is given, and the positions of EagI, BssHII, and SalI sites are indicated as E, B, and S, respectively. A BssHII site was identified in PAC 253H19 (B) but was not found to be present in any of the overlapping PAC clones and was presumed to be created due to a polymorphism in that clone. The PAC clones around this site were aligned with respect to the EagI and SalI sites and their STS content. c, YAC contig encompassing ϳ3 Mb. (Contig length is based on the insert sizes provided by the Whitehead Institute for Biomedical Research.) YAC clones were obtained from the CEPH MegaYAC library (Genethon). YACs are not shown to scale but are positioned with respect to the STS/EST map shown in a. d, depiction of the 16q23 chromosome region from a gastric adenocarcinoma cell line (AGS), a small cell lung carcinoma (WX330), an ovarian adenocarcinoma ascitic specimen (PEO4), and a colonic adenocarcinoma (HCT116). The extent of the homozygous deletions in the three tumors is shown by the unfilled, dashed bars, whereas the filled bars represent DNA that has been maintained. The deletion regions represent that which is homozygously deleted from both chromosomes in each tumor sample.

We have identified 11 putative transcripts that map within the PCR primers were designed for each of these clones and used to map minimal deletion and an additional 9 transcripts that are immediately the ESTs onto the YAC/PAC contig. adjacent by using a variety of methods. Exon trapping performed on Eleven of these ESTs lie within the minimal deletion and are PAC clone 81N24 resulted in a single correctly spliced product in therefore disrupted in all three cell lines, whereas an additional nine addition to a number of aberrant products involving rearrangement or ESTs lie outside the minimal deletion but are within the regions of cryptic splicing of the trap vector, pSPL3. The potential exon thus homozygous loss in WX330 and PEO4. isolated (ETA1) was found to show homology to a known EST (see Exclusion of Candidate Genes. Several potential tumor suppres- Table 1) and mapped back to the minimal deletion. Shotgun sequenc- sor loci have been identified previously and mapped to either chro- ing of PAC clone 81N24 has resulted in approximately 60% coverage mosome 16q or the region of conserved synteny on mouse chromo- of this clone that covers most of the minimal deletion. BLAST some 8 (38). The MAF oncogene (39), the human Golgi searching of genome databases with these sequences has led to the sialoglycoprotein CFR-1 (also known as MG160 or GLG1; Ref. 40), identification of six additional EST clones, 5.1A6, IM23, IM25, and the ␥ adaptin gene (ADTG; Ref. 41) have all been mapped by IM28, IM29, and IM30 (see Table 1). Several of the PAC and YAC FISH to 16q22–23. ESTs from cDNA clones showing homology to end clones (4t7, 10sp6, 10t7, and IM97) also showed homology to human lysyl tRNA synthetase (KARS; Ref. 42) and human oxi- known ESTs, as did one of the original RDA products, RD30 (see doreductase (HHCMA56) have been positioned on the GeneBridge4 Table 1). The remaining expressed sequences shown in Fig. 2 were map between the markers D16S515 and D16S422 at 16q23, and an identified from previously published maps of chromosome 16: (a) additional candidate locus, Tradd, has been mapped to the mouse 435E and 10102 were identified from the integrated chromosome 16 syntenic region on chromosome 8 (43). map (25); (b) IM1-11 were identified from the work of Bednarek et al. We screened DNA from our YAC contig and the deletion-contain- (37); and (c) IM17-22 were identified from the GeneBridge4 map. ing cell lines for all six genes by PCR. All of the candidate genes were 1694

Fig. 4. FISH analysis of fragile chromosomes. PACs 211O19, 81N24, 24K21, and 93A3 were labeled with different antigens and cohybridized onto metaphase chromosomes that had been cul- tured in the presence of aphidicolin to induce common fragile sites. Each of the figure sections (a, b, and c) comprises of three versions of the same image viewed with different filters. The first (i) shows 4Ј,6-diamidino-2-phenylindole staining of the chromosome, the second (ii) is specific for the signal from PAC 81N24, and the third (iii) is specific for the signal from PAC 24K21. An arrow on the 4Ј,6-diamidino-2-phenylindole image indicates the fragile site. In a and b, the chromosome has broken at the fragile site, with telomeric fusion of the distal fragment to the intact chromatid. c shows a chromosome in which the fragile site can be seen as a region of constriction. In a and b, the PAC clones appear distal to the breakpoint, whereas in c, the clones appear to span the fragile site.

found to be present in all of the cell lines and therefore must lie breakage at FRA16D in one of the chromatids, with telomeric fusion outside the deleted regions (data not shown). In addition, all of the loci of the distal fragment to the intact chromatid (see Fig. 4). Signal from were found to lie outside of the YAC contig, with the exception of the PAC clones was seen at the very end of the distal fragment (Fig. HHCMA56, which is contained within YAC clone 972D3 and there- 4, a and b). However, in a few cases (2 of 30 cases), signal from fore lies several hundred kilobases distal of the PAC contig and the clones 211O19, 81N24, and 24K21 was observed spanning a region of minimally deleted region. constriction at FRA16D, suggesting that these clones lie very close We also screened our PAC and YAC contig for sequences homol- but just distal to the fragile site region (an example is shown in Fig. ogous to cadherin genes. Seven members of the gene family are 4c). Our markers 17Sp6 and Alu20, which lie less than 50 kb proximal already known to map to 16q; five are located proximal of 16q23, and of 81N24, have been mapped by Mangelsdorf et al. (36) on to their ␭ two are located distally (Ref. 44; Fig. 1). Cadherins are a family of clones ␭504 and ␭87. The extensive FISH analysis performed by calcium-dependent cell-cell adhesion molecules that have been impli- Mangelsdorf et al. (36) shows that ␭504 and ␭87 lie within the most cated previously in tumor and invasion suppression (45); therefore, a likely region for the fragile site, thus ratifying our location of the novel cadherin family member would represent a clear candidate as a clones 81N24, 211O19, and 24K21 just distal to FRA16D and con- tumor suppressor gene. We hybridized the PAC clones with a plasmid firming that our PAC contig spans the fragile site region. containing the highly conserved extracellular repeated domains of CDH1 derived from E-cadherin. In addition, we performed PCR on DISCUSSION the YAC and PAC clones using primers degenerate for a conserved region of the cytoplasmic domain of the cadherin family and then RDA has enabled us to identify two homozygous deletions in the hybridized a blot of the PCR products with a probe derived from the malignant ascites from a patient with ovarian cancer. The first deletion E-cadherin cytoplasmic domain. There was no evidence consistent extended over approximately 2 Mb and encompassed the tumor sup- with a cadherin gene being contained within the PAC or YAC contig pressor genes p16, p15, and p19 on 9p21 (9). The second deletion, by either method (data not shown). described here, extends over a maximum of 1.4 Mb (a minimum of Thus, we have excluded MAF, CFR-1, KARS, ADTG, HHCMA56, 600 kb) at 16q23.2. Tradd, and members of the cadherin gene family from lying within We have identified additional overlapping homozygous deletions in both the 700-kb PAC contig and a 1.4-Mb YAC encompassing the tumors derived from two different tissue types: (a) a xenograft of a homozygous deletions observed in PEO4, HCT116, and WX330. It is small cell lung carcinoma cell line WX330; and (b) the well-charac- therefore unlikely that any of these genes are involved in the evolution terized colonic adenocarcinoma cell line HCT116. The deletion in of these tumors. However, we do not exclude the possibility that the HCT116 is wholly contained within the deletions of both the ovarian expression of one or more of these genes may be altered due to a long cancer and lung cancer and is approximately 210 kb in size. We range position effect. propose that this region contains a novel tumor suppressor gene that Analysis of FRA16D. We mapped our PAC contig relative to the is involved in the initiation or progression of tumor formation in common fragile site FRA16D by performing FISH with clones epithelial ovarian cancer, small cell lung cancer, and colonic adeno- 211O19, 81N24, 24K21, and 93A3 on metaphase chromosomes in- carcinoma. The significance of this putative tumor suppressor gene duced to display the common fragile sites through folate depletion and may be relevant to an even wider range of cancers because high levels treatment with aphidicholin. of LOH in this same region are observed in breast cancer, prostate In the majority of spreads examined (28 of 30), there had been cancer, and hepatocellular carcinoma. In addition, a homozygous 1695

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2000 American Association for Cancer Research. HOMOZYGOUS DELETIONS AT 16q23.2 deletion of the same region has been identified in a tumor cell line cancer. The characterization of a deletion in this region and the from a gastric adenocarcinoma (36). construction of a physical map across it have identified a number of The construction of a YAC and PAC contig across the deletions has independent transcripts, the starting point for identifying a novel enabled us to characterize the deletions and to map 11 expressed tumor suppressor gene of relevance to a wide range of cancers. sequences to the minimally deleted region. We have excluded six candidate genes mapped previously to either human chromosome 16q23 or the region of conserved synteny on mouse chromosome 8. ACKNOWLEDGMENTS We were also unable to detect any members of the cadherin gene We thank members of the molecular genetics section MRC HGU for family in our contig. materials and much helpful advice, in particular, Chris Boyd, Heather David- We have preliminary evidence suggesting that the contig spans the son, and Kirsty Millar. We also thank Pat Malloy for help with FISH, Paul common fragile site FRA16D (Fig. 4), and this is substantiated by the Perry for digital imaging, Graham Clark at ICRF Lincoln’s Inn Fields for data presented by Mangelsdorf et al. (36). It is thought that fragile sequencing, the Central Cell Services and oligonucleotide synthesis laborato- sites may be the targets of mutagens and carcinogens and may ries at ICRF Clare Hall, Marion Bussemakers for materials, Mark Hirst for therefore be prone to rearrangement or breakage during the evolution valued discussion, Rob Richards and his group for sharing unpublished data, of a tumor (46); indeed, translocation breakpoints at (14;16)(q32.3;23) and Nick Hastie for continued support. observed in some cases of multiple myeloma have been shown to bracket FRA16D (47). REFERENCES The precise relationship of aphidicolin-inducible common fragile sites to tumorigenesis is still not understood. There are several com- 1. Lisitsyn, N., Lisitsyn, N., and Wigler, M. Cloning the differences between two complex genomes. Science (Washington DC), 259: 946–951, 1993. mon fragile sites that can be induced in the chromosomes of most 2. Friend, S., Bernards, R., Roggel, J., Weinberg, R., Rapaport, J., Albert, D., and Dryja, individuals in vitro, including 3p14, 2q31, 6q26, 7q31.2, 16q23, and T. A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature (Lond.), 323: 643–646, 1986. Xp22 (31). However, unlike the rare fragile sites, they have not been 3. Call, K. M., Glaser, T., Ito, C. Y., Buckler, A. J., Pelletier, J., Haber, D. A., Rose, associated with any discrete genomic structure. Two other common E. A., Kral, A., Yeger, H., and Lewis, W. H. Isolation and characterization of a zinc fragile sites have been shown to be associated with LOH or deletion finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell, 60: 509–520, 1990. in tumors, FRA3B (3p14.2) and FRA7G (7q31.2). Sequence analysis 4. Schutte, M., da-Costa, L. T., Hahn, S. A., Moskaluk, C., Hoque, A. T., Rozenblum, of these regions has failed to give a definitive explanation for the E., Weinstein, C. L., Bittner, M., Meltzer, P. S., Trent, J. M., Yeo, C. J., Hruban, molecular basis of their observed fragility (48–50), but hot spots for R. H., and Kern, S. E. Identification by representational difference analysis of a homozygous deletion in pancreatic carcinoma that lies within the BRCA2 region. viral integration and sequence homologies with small polydispersed Proc. Natl. Acad. Sci. USA, 92: 5950–5954, 1995. circular DNA have been suggested. Mathematical modeling of the 5. Kamb, A., Gruis, N. A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavtigian, S. V., Stockert, E., Day, R. R., Johnson, B. E., and Skolnick, M. H. A cell cycle regulator sequence reveals unusual DNA structures, in particular, regions of potentially involved in genesis of many tumor types. Science (Washington DC), 264: high flexibility, which may affect replication, condensation, organi- 436–440, 1994. zation, and recombination of the chromosome (49, 51). Delays in 6. Ohta, M., Inoue, H., Cotticelli, M. G., Kastury, K., Baffa, R., Palazzo, J., Siprashvili, Z., Mori, M., McCue, P., Druck, T., Croce, C. M., and Huebner, K. The FHIT gene, DNA replication at common fragile sites due to the primary and spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) secondary structure of their DNA could result in the breaks observed breakpoint, is abnormal in digestive tract cancers. Cell, 84: 587–597, 1996. ␤ in vitro after culture with DNA polymerase inhibitors (52, 53). A 7. Hannon, G. J., and Beach, D. p15INK4B is a potential effector of TGF- -induced cell cycle arrest. Nature (Lond.), 371: 257–261, 1994. similar mechanism of chromosomal breakage may occur in vivo 8. Quelle, D. E., Zindy, F., Ashmun, R. A., and Sherr, C. J. Alternative reading frames during tumor development, when the normal checks of genome in- of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993–1000, 1995. tegrity may be deficient, thus providing a possible link between fragile 9. Watson, J. E. V., Gabra, H., Taylor, K. J., Rabiasz, G. J., Morrison, H., Perry, P., sites and neoplasia. In our system, both PEO4 cells and one of the Smyth, J. F., and Porteous, D. J. Identification and characterization of a homozygous other deletion-containing tumor cell lines (HCT116) show genetic deletion found in ovarian ascites by representational difference analysis. Genome Res., 9: 226–233, 1999. instability, but it appears that the instability has arisen in each cell line 10. Li, C., Berx, G., Larsson, C., Auer, G., Aspenblad, U., Pan, Y., Sundelin, B., Ekman, via a different mechanism. Invoking the hypothesis of Lengauer et al. P., Nordenskjold, M., van Roy, F., and Bergerheim, U. S. R. Distinct deleted regions (54), PEO4 cells appear to have generalized chromosomal instability on chromosome segment 16q23–24 associated with metastases in prostate cancer. Genes Chromosomes Cancer, 24: 175–182, 1999. with aneuploidy and multiple rearranged chromosomes, as demon- 11. Latil, A., Cussenot, O., Fournier, G., Driouch, K., and Lidereau, R. Loss of heterozy- strated by previous comparative genomic hybridization analysis (9) gosity at chromosome 16q in prostate adenocarcinoma: identification of three independent regions. Cancer Res., 57: 1058–1062, 1997. and FISH analysis (data not shown), whereas HCT116 cells show 12. Driouch, K., Dorion-Bonnet, F., Briffod, M., Champeme, M. H., Longy, M., and microsatellite instability, are near diploid, and do not show general- Lidereau, R. Loss of heterozygosity on chromosome arm 16q in breast cancer ized genomic instability (55). This suggests that breakage at common metastases. Genes Chromosomes Cancer, 19: 185–191, 1997. 13. Iida, A., Isobe, R., Yoshimoto, M., Kasumi, F., Nakamura, Y., and Emi, M. Local- fragile sites is independent of the chromosomal instability or micro- ization of a breast cancer tumour-suppressor gene to a 3-cM interval within chromo- satellite instability status of the cell, and thus the mechanism causing somal region 16q22. Br. J. Cancer, 75: 264–267, 1997. rearrangement and loss of DNA at fragile sites requires further inves- 14. Chen, T., Sahin, A., and Aldaz, C. M. Deletion map of chromosome 16q in ductal carcinoma in situ of the breast: refining a putative tumor suppressor gene region. tigation. One hypothesis suggested by recent sequence analysis of Cancer Res., 56: 5605–5609, 1996. deletions at FRA3B proposes that homologous recombination be- 15. Roylance, R., Gorman, P., Harris, W., Liebmann, R., Barnes, D., Hanby, A., and Sheer, D. Comparative genomic hybridization of breast tumors stratified by histo- tween repetitive elements is a mechanism for repair of breaks at logical grade reveals new insights into the biological progression of breast cancer. common fragile sites and results in the deletion of intervening se- Cancer Res., 59: 1433–1436, 1999. quences (49). 16. Chou, Y-H., Chung, K-C., Jeng, L-B., Chen, T-C, and Liaw, Y-F. Frequent allelic loss on chromosomes 4q and 16q associated with human hepatocellular carcinoma in In this study, we have described the identification of three homozy- Taiwan. Cancer Lett., 123: 1–6, 1998. gous deletions around 16q23 in three different tumors. We propose 17. Iwabuchi, H., Sakamoto, M., Sakunaga, H., Ma, Y. Y., Carcangiu, M. L., Pinkel, D., that deletion of 16q23.2 has been selected for in these tumors due to Yang-Feng, T. L., and Gray, J. W. Genetic analysis of benign, low-grade, and high-grade ovarian tumors. Cancer Res., 55: 6172–6180, 1995. the concomitant loss of function of a tumor suppressor gene located in 18. Doggett, N. A., Breuning, M. H., and Callen, D. F. Report of the fourth international this region. The frequently observed loss and rearrangement of 16q23 workshop on human chromosome 16 mapping 1995. Cytogenet. Cell Genet., 72: 271–293, 1996. in many different tumors suggests that this novel tumor suppressor 19. Smith, D. I., Huang, H., and Wang, L. Common fragile sites and cancer. Int. J. Oncol., gene is important in several different cancers, including ovarian 12: 187–196, 1998. 1696

20. Lisitsyn, N. A., Lisitsina, N. M., Dalbagni, G., Barker, P., Sanchez, C. A., Gnarra, J., 38. Becker-Follmann, J., Gaa, A., Bausch, E., Natt, E., Scherer, G., and von Deimling, O. Linehan, W. M., Reid, B. J., and Wigler, M. H. Comparative genomic analysis of High-resolution mapping of a linkage group on mouse chromosome 8 conserved on tumors: detection of DNA losses and amplification. Proc. Natl. Acad. Sci. USA, 92: human chromosome 16Q. Mamm. Genome, 8: 172–177, 1997. 151–155, 1995. 39. Yoshida, M. C., Nishizawa, M., Kataoka, K., Goto, N., Fujiwara, K. T., and Kawai, 21. Wolf, C., Hayward, I., Lawrie, S., Buckton, K., McIntyre, M., Adams, D., Lewis, A., S. Localization of the human MAF protooncogene on chromosome 16 to bands Scott, A., and Smyth, J. Cellular heterogeneity and drug resistance in two ovarian q22–q23. Cytogenet. Cell Genet., 58: 2003, 1991. adenocarcinoma cell lines derived from a single patient. Int. J. Cancer, 39: 695–702, 40. Mourelatos, Z., Gonatas, J. O., Cinato, E., and Gonatas, N. K. Cloning and sequence 1987. analysis of the human MG160, a fibroblast growth factor and E-selectin binding 22. Hay, F. G., Duncan, L. W., and Leonard, R. C. F. Establishment and characterisation membrane sialoglycoprotein of the Golgi apparatus. DNA Cell Biol., 15: 1121–1128, of two new small cell lung cancer cell lines–one from a patient with previous familial 1996. retinoblastoma. Br. J. Cancer, 63: 43–45, 1991. 41. Peyrard, M., Parveneh, S., Lagercrantz, S., Ekman, M., Fransson, I., Sahlen, S., and 23. Brattain, M. G., Fine, W. D., Khaled, F. M., Thompson, J., and Brattain, D. E. Dumanski, J. P. Cloning, expression pattern, and chromosomal assignment to 16q23 Heterogeneity of malignant cells from a human colonic carcinoma. Cancer Res., 41: of the human ␥-adaptin gene (ADTG). Genomics, 50: 275–280, 1998. 1751–1756, 1981. 42. Nomura, N., Nagase, T., Miyajima, N., Sazuka, T., Tanaka, A., Sato, S., Seki, N., 24. Boyd, A. C. Turbo cloning: a fast, efficient method for cloning PCR products and Kawarabayasi, Y., Ishikawa, K., and Tabata, S. Prediction of the coding sequences of other blunt-ended DNA fragments into plasmids. Nucleic Acids Res., 21: 817–821, unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041– 1993. KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1. DNA 25. Doggett, N. A., Goodwin, L. A., Tesmer, J. G., Meincke, L. J., Bruce, D. C., Clark, Res., 1: 223–229, 1994. L. M., Altherr, M. R., Ford, A. A., Chi, H. C., Marrone, B. L., Longmire, J. L., Lane, 43. Pan, M. G., Xiong, J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Goeddel, S. A., Whitmore, S. A., Lowenstein, M. G., Sutherland, R. D., Mundt, M. O., Knill, D. V. Sequence, genomic organization, and chromosome localization of the mouse E. H., Bruno, W. J., Macken, C. A., Torney, D. C., Wu, J-R., Griffith, J., Sutherland, TRADD gene. J. Inflamm., 46: 168–175, 1995. G. R., Deaven, L. L., Callen, D. F., and Moyzis, R. K. An integrated physical map of 44. Kremmidiotis, G., Baker, E., Crawford, J., Eyre, H. J., Nahmias, J., and Callen, D. F. human chromosome 16. Nature (Lond.), 377: 335–365, 1995. Localization of human cadherin genes to chromosome regions exhibiting cancer- 26. Chumakov, I., Rigault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G., Gervy, P., related loss of heterozygosity. Genomics, 49: 467–471, 1998. LeGall, I., Soularue, P., and Grinas, L. Continuum of overlapping clones spanning the 45. Berx, G., Cleton-Jansen, A. M., Nollet, F., de Leeuw, W. J., van de Vijver, M., entire human chromosome 21q. Nature (Lond.), 359: 380–387, 1992. Cornelisse, C., and van Roy, F. E-cadherin is a tumour/invasion suppressor gene 27. Wu, C., Zhu, S., Simpson, S., and de Jong, P. J. DOP-vector PCR: a method for rapid mutated in human lobular breast cancers. EMBO J., 14: 6107–6115, 1995. isolation and sequencing of insert termini from PAC clones. Nucleic Acids Res., 24: 46. Yunis, J. J., Soreng, A. L., and Bowe, A. E. Fragile sites are targets of diverse 2614–2615, 1996. mutagens and carcinogens. Oncogene, 1: 59–69, 1987. 28. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, 47. Chesi, M., Bergsagel, P. L., Shonukan, O. O., Martelli, M. L., Brents, L. A., Chen, T., A. J. Isolation of genes from complex sources of mammalian genomic DNA using Schrock, E., Ried, T., and Kuehl, W. M. Frequent dysregulation of the c-maf exon amplification. Nat. Genet., 6: 98–105, 1994. proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 29. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., 91: 4457–4463, 1998. Webster, T. D., Ledbetter, D. H., and Caskey, C. T. Alu polymerase chain reaction: 48. Boldog, F., Gemmill, R. M., West, J., Robinson, M., Robinson, L., Li, E., Roche, J., a method for rapid isolation of human-specific sequences from complex DNA Todd, S., Waggoner, B., Lundstrom, R., Jacobson, J., Mullokandov, M. R., Klinger, sources. Proc. Natl. Acad. Sci. USA, 86: 6686–6690, 1989. H., and Drabkin, H. A. Chromosome 3p14 homozygous deletions and sequence 30. Staden, R. The Staden sequence analysis package. Mol. Biotechnol., 5: 233–241, analysis of FRA3B. Hum. Mol. Genet., 6: 193–203, 1997. 1996. 49. Mimori, K., Druck, T., Inoue, H., Alder, H., Berk, L., Mori, M., Huebner, K., and 31. Glover, T. W., Berger, C., Coyle, J., and Echo, B. DNA polymerase ␣ inhibition by Croce, C. M. Cancer-specific chromosome alterations in the constitutive fragile aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. region FRA3B. Proc. Natl. Acad. Sci. USA, 96: 7456–7461, 1999. Hum. Genet., 67: 136–142, 1984. 50. Huang, H., Qian, J., Proffit, J., Wilber, K., Jenkins, R., and Smith, D. I. FRA7G 32. Lichter, P., and Cremer, T. Chromosome analysis by non-isotopic in situ hybridiza- extends over a broad region: coincidence of human endogenous retroviral sequences tion. In: D. E. Rooney and B. H. Czepulkowski (eds.), Human Cytogenetics: A (HERV-H) and small polydispersed circular DNAs (spcDNA) and fragile sites. Practical Approach, Ed. 1, Vol. 1, pp. 157–192. Oxford, United Kingdom: Oxford Oncogene, 16: 2311–2319, 1998. University Press, 1992. 51. Mishmar, D., Rahat, A., Scherer, S. W., Nyakatura, G., Hinzmann, B., Kohwi, Y., 33. Suzuki, S., Sano, K., and Tanihara, H. Diversity of the cadherin family: evidence for Mandel-Gutfroind, Y., Lee, J. R., Drescher, B., Sas, D. E., Margalit, H., Platzer, M., eight new cadherins in nervous tissue. Cell Regul., 2: 261–270, 1991. Weiss, A., Tsui, L. C., Rosenthal, A., and Kerem, B. Molecular characterization of a 34. Bussemakers, M. J., van Bokhoven, A., Mees, S. G., Kemler, R., and Schalken, J. A. common fragile site (FRA7H) on human chromosome 7 by the cloning of a simian Molecular cloning and characterization of the human E-cadherin cDNA. Mol. Biol. virus 40 integration site. Proc. Natl. Acad. Sci. USA, 95: 8141–8146, 1998. Rep., 17: 123–128, 1993. 52. Wang, L., Darling, J., Zhang, J. S., Huang, H., Liu, W., and Smith, D. I. Allele- 35. Kastury, K., Baffa, R., Druck, T., Ohta, M., Cotticelli, M. G., Inoue, H., Negrini, M., specific late replication and fragility of the most active common fragile site, FRA3B. Rugge, M., Huang, D., Croce, C. M., Palazzo, J., and Huebner, K. Potential gastro- Hum. Mol. Genet., 8: 431–437, 1999. intestinal tumor suppressor locus at the 3p14.2 FRA3B site identified by homozygous 53. Le Beau, M. M., Rassool, F. V., Neilly, M. E., Espinosa, R., III, Glover, T. W., Smith, deletions in tumor cell lines. Cancer Res., 56: 978–983, 1996. D. I., and McKeithan, T. W. Replication of a common fragile site, FRA3B, occurs late 36. Mangelsdorf, M., Ried, K., Woollatt, E., Dayan, S., Eyre, H., Finnis, M., Hobson, L., in S phase and is delayed further upon induction: implications for the mechanism of Nancarrow, J., Venter, D., Baker, E., and Richards, R. I. Chromosomal fragile site fragile site induction. Hum. Mol. Genet., 7: 755–761, 1998. FRA16D and DNA instability in cancer. Cancer Res., 60: 1683–1689, 2000. 54. Lengauer, C., Kinzler, K. W., and Vogelstein, B. Genetic instabilities in human 37. Bednarek, A. K., and Aldaz, C. M. Characterization of transcripts from a commonly cancers. Nature (Lond.), 396: 643–649, 1998. deleted area of chromosome 16 (q23.3–q24.1). Proc. Am. Assoc. Cancer Res., 39: 55. Lengauer, C., Kinzler, K. W., and Vogelstein, B. Genetic instability in colorectal 128, 1998. cancers. Nature (Lond.), 386: 623–627, 1997.

1697

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2000 American Association for Cancer Research. A 700-kb Physical Map of a Region of 16q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D

Adam J. W. Paige, Karen J. Taylor, Aengus Stewart, et al.

Cancer Res 2000;60:1690-1697.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/60/6/1690

Cited articles This article cites 53 articles, 16 of which you can access for free at: http://cancerres.aacrjournals.org/content/60/6/1690.full#ref-list-1

Citing articles This article has been cited by 16 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/60/6/1690.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/60/6/1690. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.