DOCSLIB.ORG

A 700-Kb Physical Map of a Region of 16Q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A 700-Kb Physical Map of a Region of 16Q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1 [CANCER RESEARCH 60, 1690–1697, March 15, 2000] A 700-kb Physical Map of a Region of 16q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1 Adam J. W. Paige, Karen J. Taylor, Aengus Stewart, John G. Sgouros, Hani Gabra, Grant C. Sellar, John F. Smyth, David J. Porteous, and J. E. Vivienne Watson2 Imperial Cancer Research Fund [A. J. W. P. , K. J. T., H. G., G. C. S., J. F. S., J. E. V. W.] and MRC Human Genetics Unit [D. J. P.], Western General Hospital, Edinburgh EH4 2XU, United Kingdom, and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [A. S., J. G. S.] ABSTRACT RDA on DNA from malignant ovarian ascites led us to the identi- fication of a homozygous deletion at 9p21 that encompassed the We have identified a >600-kb region at 16q23.2 that is homozygously previously characterized tumor suppressor gene cluster p16, p15, and deleted from malignant ovarian ascites using representational difference p19 (5, 7, 8) described in Ref. 9. Here we describe the characterization analysis. Overlapping homozygous deletions were also observed in the colon carcinoma cell line HCT116 and a xenograft established from the of another homozygous deletion in DNA from the same patient, which small cell lung cancer cell line WX330. This region coincides with that we show maps to 16q23.2. This region shows allele imbalance and described previously by others as showing loss of heterozygosity in pros- DNA loss in many tumor types including prostate cancer (10, 11), tate and breast cancers (C. Li et al., Genes Chromosomes Cancer, 24: breast cancer (12–15), hepatocellular carcinoma (16), and ovarian 175–182, 1999; A. Latil et al., Cancer Res., 57: 1058–1062, 1997; K. cancer (17). Furthermore, the common aphidicolin-inducible fragile Driouch et al., Genes Chromosomes Cancer, 19: 185–191, 1997; A. Iida et site FRA16D also maps to 16q23.2 (18). There have been numerous al., Br. J. Cancer, 75: 264–267, 1997). In addition, the minimally deleted reports of common fragile sites associated with chromosomal rear- region spans the common fragile site FRA16D. We have constructed a rangements in cancer, including translocations (11q) and deletions 700-kb physical map encompassing the deleted region. By fluorescence in (3p; reviewed in Ref. 19). The most extensively characterized of these situ hybridization of aphidicolin-induced metaphase chromosomes, we is FRA3B at 3p14.2. RDA identified a probe that was homozygously have preliminary data to suggest that P1-derived bacterial artificial chro- mosome clones from the contig lie on both sides of FRA16D. This is deleted in cancer cell lines (20). This probe was subsequently mapped confirmed by extensive fluorescence in situ hybridization analysis of the to a YAC and BAC contig in 3p14.2 and found to be within FHIT/ region reported in the accompanying article (M. Mangelsdorf et al., FRA3B (6). Cancer Res., 60: 1683–1689, 2000) and is consistent with an involvement It is thought that common fragile sites may be prone to breaks and of this common fragile site in the loss of 16q23.2 material in various cancer deletions in dividing cells, thus providing a possible mechanism for types. The minimally deleted region of approximately 210 kb has been the inactivation of any neighboring genes. If one of those neighboring characterized using our own markers and public domain markers. Eleven genes acts as a tumor suppressor, then cells in which such a deletion distinct expressed sequences mapped to the region, providing a basis for occurs will have a selective growth advantage. identifying the predicted tumor suppressor gene in this region. We demonstrate here the identification of a small region of ho- mozygous deletion common to an ovarian tumor, a colon carcinoma INTRODUCTION cell line, and a small cell lung cancer cell line. We have constructed a complete physical and partial transcript map across the minimal Relatively few of the many tumor suppressor or growth suppressor deleted region and identified 11 distinct expressed sequences. These genes identified to date have been shown to be involved in ovarian represent possible candidates as novel tumor suppressor genes in- cancer. As a strategy directed toward the identification of novel tumor volved in cancer development in several different tumor types. suppressor genes involved in the initialization or progression of ovar- ian cancer, we have performed RDA3 on DNA from the malignant and fibroblast cells of an ascites specimen obtained from a patient with MATERIALS AND METHODS ovarian cancer. First described by Lisitsyn et al. (1), RDA allows the isolation of DNA that has been gained or lost from the tumor speci- PEO4 malignant and fibroblast cells were derived by differential trypsiniza- men, relative to the normal DNA from the same individual. Homozy- tion of cells in an ascites specimen obtained from a patient with ovarian cancer gous genomic DNA deletions in tumor cells are typically associated (9). The PEO4 cell line was established from the same primary malignant with the inactivation or loss of a gene involved in the control of cell ascitic cells (21). WX330 is a xenograft of a cell line that had been established growth or differentiation. Homozygous deletions are relatively rare, from a small cell lung carcinoma (22). HCT116 is a colonic adenocarcinoma cell line described in Ref. 23 and was a gift from Susan Farrington (MRC but where they have been identified, they have played an important HGU, Edinburgh, United Kingdom). FATO is a lymphoblastoid cell line from role in the isolation of tumor suppressor genes including RB1, WT1, EBV-transformed normal male lymphocytes (a gift from Veronica van Hey- BRCA2, p16, and FHIT (2–6). ningen, MRC HGU, Edinburgh, United Kingdom). Other tumor cell lines were obtained from a tumor bank (ICRF Clare Hall; American Type Culture Received 8/18/99; accepted 1/19/00. Collection, Manassas, VA), and details are available on request. E-cadherin The costs of publication of this article were defrayed in part by the payment of page probes were provided by M. Bussemakers (University Hospital Nijmegen, charges. This article must therefore be hereby marked advertisement in accordance with Nijmegen, the Netherlands). All oligonucleotide primers for PCR were syn- 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by the Imperial Cancer Research Fund and the United Kingdom Medical thesized by Iain Goldsmith (ICRF Clare Hall). Research Council. Identification of a Homozygous Deletion. RDA was carried out as de- 2 To whom requests for reprints should be addressed at, Imperial Cancer Research scribed previously (9). Products were cloned into pBSlox (24) and sequenced Fund Medical Oncology Unit, Western General Hospital, Crewe Road, Edinburgh, EH4 as described previously (9). Primers were designed to the sequences using the 2XU, United Kingdom. Phone: 44-131-332-2471, ext. 2401; Fax: 44-131-332-8494; E-mail: [email protected]. programs PRIMER (Whitehead Institute for Biomedical Research) and 3 The abbreviations used are: RDA, representational difference analysis; FISH, fluo- OLIGO 4.0 (Wojciech Rychlik) and are shown in Table 1. The chromosomal rescence in situ hybridization; LOH, loss of heterozygosity; PAC, P1-derived bacterial location of the RDA products was determined by screening a monochromo- artificial chromosome; YAC, yeast artificial chromosome; EST, expressed sequence tag; some hybrid mapping panel (HGMP-RC, Cambridge, United Kingdom) and a STS, sequence tagged site; ICRF, Imperial Cancer Research Fund; HGMP-RC, Human Genome Mapping Project Resource Center; MRC HGU, Medical Research Council cytogenetic breakpoint mapping panel by PCR (David Callen, Adelaide Wom- Human Genetics Unit; Mb, megabase. en’s and Children’s Hospital, Adelaide, Australia; Ref. 25). PCR was carried 1690 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2000 American Association for Cancer Research. HOMOZYGOUS DELETIONS AT 16q23.2 Table 1 STS and EST markers mapped on the YAC and PAC contigs All previously described markers and genes are shown with their GenBank accession number and their source. Primer sequences are given for novel STS and EST markers as are the method of their derivation and any homology to sequences in GenBank. Two markers were mapped as probes by hybridization, and the sequence is not available for these two markers. GenBank accession no. or Homology to other Markers primer sequence GenBank sequences Probe derivation Existing STSs/ESTs AFMA336YG9 D16S504 Z24121 http://www-ls.lanl.gov/Nature95/Nature95.html D16S516 Z24594 D16S518 Z24645 D16S3029 Z52358 D16S3049 Z53009 D16S3096 Z53592 D16S435E M78830 10102 T50247 IM1 N53108 Bednarek et al. (37) IM2 AA229508 IM3 AA570335 IM4 N62411 N79373 IM7 H54363 H54285, T54906, T55073 IM9 R05832 W86667, W86864, AA693565 IM11 AA807730 IM17 R60779 http://www.ncbi.nlm.nih.gov/genemap98 IM18 Z38870 IM20 T63488 IM22 AA016227 AI097501, H18209, Z41625 Genes CFR-1 U64791 http://www.ncbi.nlm.nih.gov/genemap98 ADTG ACCCAAGCTGAAGAACGAGA Y12226 CTGTCCAAAGTGAGCAGGGT MAF H03998 Tradd L41690 HHCMA56 U13395 KARS D32053 RDA products RD30 GAATAATTTCAAAGAGGGAGG AA447275 RDA products homozygously deleted in the tumor cells, but not fibroblast cells, of an ascites specimen CAGCAGTACGTACATAACTGTT RD53 TTTGTTTGGCTCTAGAAAGC GACTTGGACTGTCACCTTGG RD69 TTAGCAAAAGAAAGGGAGTG GTGGAACCTTTAGGGCTTAT Inter-Alu PCR Alu-PCR on: Alu11 GCTTGCAAAGATGAGGGAAG YAC933H2 with 451 primer CAGAGCCTTCCTCTGGACAC Alu12 ACACATTGTGGGGAGGTTGT YAC933H2 with 211 primer GGGGAATTTCTGAGTCATGG
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Identification of C3 As a Therapeutic Target for Diabetic Nephropathy By
    www.nature.com/scientificreports OPEN Identifcation of C3 as a therapeutic target for diabetic nephropathy by bioinformatics analysis ShuMei Tang, XiuFen Wang, TianCi Deng, HuiPeng Ge & XiangCheng Xiao* The pathogenesis of diabetic nephropathy is not completely understood, and the efects of existing treatments are not satisfactory. Various public platforms already contain extensive data for deeper bioinformatics analysis. From the GSE30529 dataset based on diabetic nephropathy tubular samples, we identifed 345 genes through diferential expression analysis and weighted gene coexpression correlation network analysis. GO annotations mainly included neutrophil activation, regulation of immune efector process, positive regulation of cytokine production and neutrophil-mediated immunity. KEGG pathways mostly included phagosome, complement and coagulation cascades, cell adhesion molecules and the AGE-RAGE signalling pathway in diabetic complications. Additional datasets were analysed to understand the mechanisms of diferential gene expression from an epigenetic perspective. Diferentially expressed miRNAs were obtained to construct a miRNA-mRNA network from the miRNA profles in the GSE57674 dataset. The miR-1237-3p/SH2B3, miR-1238-5p/ ZNF652 and miR-766-3p/TGFBI axes may be involved in diabetic nephropathy. The methylation levels of the 345 genes were also tested based on the gene methylation profles of the GSE121820 dataset. The top 20 hub genes in the PPI network were discerned using the CytoHubba tool. Correlation analysis with GFR showed that SYK, CXCL1, LYN, VWF, ANXA1, C3, HLA-E, RHOA, SERPING1, EGF and KNG1 may be involved in diabetic nephropathy. Eight small molecule compounds were identifed as potential therapeutic drugs using Connectivity Map. It is estimated that a total of 451 million people sufered from diabetes by 2017, and the number is speculated to be 693 million by 2045 1.
    [Show full text]
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . LysRS (H-300): sc-98559 BACKGROUND APPLICATIONS The fidelity of protein synthesis requires efficient discrimination of amino LysRS (H-300) is recommended for detection of LysRS of mouse, rat and acid substrates by aminoacyl-tRNA synthetases. Aminoacyl-tRNA synthetases human origin by Western Blotting (starting dilution 1:200, dilution range function to catalyze the aminoacylation of tRNAs by their corresponding amino 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein acids, thus linking amino acids with tRNA-contained nucleotide triplets. LysRS (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution (lysyl-tRNA synthetase), also known as KARS, KRS or KARS2, exists as both range 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution mitochondrial and cytoplasmic isoforms (625 and 576 amino acids, respec - range 1:30-1:3000). tively) that belong to the tRNA synthetase family and are thought to play a LysRS (H-300) is also recommended for detection of LysRS in additional role in autoimmune diseases, such as polymyositis or dermatomyositis. The species, including equine, canine, bovine and porcine. gene encoding LysRS maps to human chromosome 16, which encodes over 900 genes and comprises nearly 3% of the human genome. Suitable for use as control antibody for LysRS siRNA (h): sc-75718, LysRS siRNA (m): sc-75719, LysRS shRNA Plasmid (h): sc-75718-SH, LysRS shRNA REFERENCES Plasmid (m): sc-75719-SH, LysRS shRNA (h) Lentiviral Particles: sc-75718-V and LysRS shRNA (m) Lentiviral Particles: sc-75719-V.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • Mutations in KARS, Encoding Lysyl-Trna Synthetase, Cause Autosomal-Recessive Nonsyndromic Hearing Impairment DFNB89
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector REPORT Mutations in KARS, Encoding Lysyl-tRNA Synthetase, Cause Autosomal-Recessive Nonsyndromic Hearing Impairment DFNB89 Regie Lyn P. Santos-Cortez,1,8 Kwanghyuk Lee,1,8 Zahid Azeem,2,3 Patrick J. Antonellis,4,5 Lana M. Pollock,4,6 Saadullah Khan,2 Irfanullah,2 Paula B. Andrade-Elizondo,1 Ilene Chiu,1 Mark D. Adams,6 Sulman Basit,2 Joshua D. Smith,7 University of Washington Center for Mendelian Genomics, Deborah A. Nickerson,7 Brian M. McDermott, Jr.,4,5,6 Wasim Ahmad,2 and Suzanne M. Leal1,* Previously, DFNB89, a locus associated with autosomal-recessive nonsyndromic hearing impairment (ARNSHI), was mapped to chromo- somal region 16q21–q23.2 in three unrelated, consanguineous Pakistani families. Through whole-exome sequencing of a hearing- impaired individual from each family, missense mutations were identified at highly conserved residues of lysyl-tRNA synthetase (KARS): the c.1129G>A (p.Asp377Asn) variant was found in one family, and the c.517T>C (p.Tyr173His) variant was found in the other two families. Both variants were predicted to be damaging by multiple bioinformatics tools. The two variants both segregated with the nonsyndromic-hearing-impairment phenotype within the three families, and neither mutation was identified in ethnically matched controls or within variant databases. Individuals homozygous for KARS mutations had symmetric, severe hearing impairment across all frequencies but did not show evidence of auditory or limb neuropathy. It has been demonstrated that KARS is expressed in hair cells of zebrafish, chickens, and mice.
    [Show full text]
  • ADHD) Gene Networks in Children of Both African American and European American Ancestry
    G C A T T A C G G C A T genes Article Rare Recurrent Variants in Noncoding Regions Impact Attention-Deficit Hyperactivity Disorder (ADHD) Gene Networks in Children of both African American and European American Ancestry Yichuan Liu 1 , Xiao Chang 1, Hui-Qi Qu 1 , Lifeng Tian 1 , Joseph Glessner 1, Jingchun Qu 1, Dong Li 1, Haijun Qiu 1, Patrick Sleiman 1,2 and Hakon Hakonarson 1,2,3,* 1 Center for Applied Genomics, Children’s Hospital of Philadelphia, Philadelphia, PA 19104, USA; [email protected] (Y.L.); [email protected] (X.C.); [email protected] (H.-Q.Q.); [email protected] (L.T.); [email protected] (J.G.); [email protected] (J.Q.); [email protected] (D.L.); [email protected] (H.Q.); [email protected] (P.S.) 2 Division of Human Genetics, Department of Pediatrics, The Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA 3 Department of Human Genetics, Children’s Hospital of Philadelphia, Philadelphia, PA 19104, USA * Correspondence: [email protected]; Tel.: +1-267-426-0088 Abstract: Attention-deficit hyperactivity disorder (ADHD) is a neurodevelopmental disorder with poorly understood molecular mechanisms that results in significant impairment in children. In this study, we sought to assess the role of rare recurrent variants in non-European populations and outside of coding regions. We generated whole genome sequence (WGS) data on 875 individuals, Citation: Liu, Y.; Chang, X.; Qu, including 205 ADHD cases and 670 non-ADHD controls. The cases included 116 African Americans H.-Q.; Tian, L.; Glessner, J.; Qu, J.; Li, (AA) and 89 European Americans (EA), and the controls included 408 AA and 262 EA.
    [Show full text]
  • Ejhg2009157.Pdf
    European Journal of Human Genetics (2010) 18, 342–347 & 2010 Macmillan Publishers Limited All rights reserved 1018-4813/10 $32.00 www.nature.com/ejhg ARTICLE Fine mapping and association studies of a high-density lipoprotein cholesterol linkage region on chromosome 16 in French-Canadian subjects Zari Dastani1,2,Pa¨ivi Pajukanta3, Michel Marcil1, Nicholas Rudzicz4, Isabelle Ruel1, Swneke D Bailey2, Jenny C Lee3, Mathieu Lemire5,9, Janet Faith5, Jill Platko6,10, John Rioux6,11, Thomas J Hudson2,5,7,9, Daniel Gaudet8, James C Engert*,2,7, Jacques Genest1,2,7 Low levels of high-density lipoprotein cholesterol (HDL-C) are an independent risk factor for cardiovascular disease. To identify novel genetic variants that contribute to HDL-C, we performed genome-wide scans and quantitative association studies in two study samples: a Quebec-wide study consisting of 11 multigenerational families and a study of 61 families from the Saguenay– Lac St-Jean (SLSJ) region of Quebec. The heritability of HDL-C in these study samples was 0.73 and 0.49, respectively. Variance components linkage methods identified a LOD score of 2.61 at 98 cM near the marker D16S515 in Quebec-wide families and an LOD score of 2.96 at 86 cM near the marker D16S2624 in SLSJ families. In the Quebec-wide sample, four families showed segregation over a 25.5-cM (18 Mb) region, which was further reduced to 6.6 Mb with additional markers. The coding regions of all genes within this region were sequenced. A missense variant in CHST6 segregated in four families and, with additional families, we observed a P value of 0.015 for this variant.
    [Show full text]
  • Differential Co-Expression Analysis of Obesity-Associated Networks in Human Subcutaneous Adipose Tissue
    Europe PMC Funders Group Author Manuscript Int J Obes (Lond). Author manuscript; available in PMC 2012 July 01. Published in final edited form as: Int J Obes (Lond). 2012 January ; 36(1): 137–147. doi:10.1038/ijo.2011.22. Europe PMC Funders Author Manuscripts Differential co-expression analysis of obesity-associated networks in human subcutaneous adipose tissue A.J. Walley1,*, P. Jacobson2,*, M. Falchi1,*, L. Bottolo1,3, J.C. Andersson1,2, E. Petretto3,4, A. Bonnefond5, E. Vaillant5, C. Lecoeur5, V. Vatin5, M. Jernas2, D. Balding1,6, M. Petteni1, Y.S. Park1, T. Aitman4, S. Richardson3, L. Sjostrom2, L. M. S. Carlsson2,*, and P. Froguel1,5,*,† 1 Department of Genomics of Common Disease, School of Public Health, Imperial College London, Hammersmith Hospital, Du Cane Road, London, W12 0NN, UK 2 Department of Molecular and Clinical Medicine, The Sahlgrenska Academy, Gothenburg University, SE-413 07 Gothenburg, Sweden 3 Department of Epidemiology and Biostatistics, School of Public Health, Imperial College London, St Marys Hospital, 161 Norfolk Place, London, UK 4 MRC Clinical Sciences Centre, Division of Clinical Sciences, Imperial College London, Commonwealth Building, Hammersmith Hospital, Du Cane Road, London, W12 0NN, UK 5CNRS 8090-Institute of Biology, Pasteur Institute, Lille, France. 6Institute of Genetics, University College London, Kathleen Lonsdale Building, 5 Gower Place, London, WC1 E6B, UK Abstract Europe PMC Funders Author Manuscripts Objective—To use a unique obesity-discordant sib-pair study design to combine differential expression analysis, expression quantitative trait loci (eQTLs) mapping, and a co-expression regulatory network approach in subcutaneous human adipose tissue to identify genes relevant to the obese state.
    [Show full text]
  • Increased Dosage of High-Affinity Kainate Receptor Gene Grik4alters Synaptic Transmission and Reproduces Autism Spectrum Disorde
    The Journal of Neuroscience, October 7, 2015 • 35(40):13619–13628 • 13619 Cellular/Molecular Increased Dosage of High-Affinity Kainate Receptor Gene grik4 Alters Synaptic Transmission and Reproduces Autism Spectrum Disorders Features X M. Isabel Aller, Valeria Pecoraro, Ana V. Paternain, XSantiago Canals, and XJuan Lerma Instituto de Neurociencias, Consejo Superior de Investigaciones Científicas, Universidad Miguel Herna´ndez de Elche, 03550 San Juan de Alicante, Spain The understanding of brain diseases requires the identification of the molecular, synaptic, and cellular disruptions underpinning the behavioral features that define the disease. The importance of genes related to synaptic function in brain disease has been implied in studies describing de novo germline mutations and copy number variants. Indeed, de novo copy number variations (deletion or dupli- cation of a chromosomal region) of synaptic genes have been recently implicated as risk factors for mental retardation or autism. Among these genes is GRIK4, a gene coding for a glutamate receptor subunit of the kainate type. Here we show that mice overexpressing grik4 in the forebrain displayed social impairment, enhanced anxiety, and depressive states, accompanied by altered synaptic transmission, showing more efficient information transfer through the hippocampal trisynaptic circuit. Together, these data indicate that a single gene variation in the glutamatergic system results in behavioral symptomatology consistent with autism spectrum disorders as well as in alterations in
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Ewing Sarcoma Family of Tumors-Derived Small Extracellular Vesicle Proteomics Identify Potential Clinical Biomarkers
    www.oncotarget.com Oncotarget, 2020, Vol. 11, (No. 31), pp: 2995-3012 Research Paper Ewing sarcoma family of tumors-derived small extracellular vesicle proteomics identify potential clinical biomarkers Glenson Samuel1,2,3,*, Jennifer Crow4,*, Jon B. Klein5,6, Michael L. Merchant5, Emily Nissen7, Devin C. Koestler3,7, Kris Laurence1, Xiaobo Liang4, Kathleen Neville8, Vincent Staggs2,9, Atif Ahmed2,10, Safinur Atay4,11 and Andrew K. Godwin3,4 1Division of Pediatric Hematology Oncology and Bone Marrow Transplantation, Children’s Mercy Hospital, Kansas City, MO, USA 2Department of Pediatrics, University of Missouri-Kansas City, Kansas City, MO, USA 3University of Kansas Cancer Center, Kansas City, MO, USA 4Department of Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS, USA 5Clinical Proteomics Laboratory, Department of Medicine, University of Louisville, Louisville, KY, USA 6Robley Rex VA Medical Center, Louisville, KY, USA 7Department of Biostatistics & Data Science, University of Kansas Medical Center, Kansas City, KS, USA 8Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR, USA 9Biostatistics & Epidemiology Core, Children’s Mercy Hospital, Kansas City, MO, USA 10Department of Pathology, Children’s Mercy Hospital, Kansas City, MO, USA 11Bristol-Myers Squibb, Cambridge, MA, USA *These authors contributed equally to this work Correspondence to: Andrew K. Godwin, email: [email protected] Keywords: Ewing sarcoma; EWS-ETS; biomarkers; extracellular vesicles; exosomes Received: April 18, 2020 Accepted: June 20, 2020 Published: August 04, 2020 Copyright: Samuel et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
    [Show full text]