DOCSLIB.ORG

Selenoproteins of the Thyroid Gland: Expression, Localization and Possible Function of Glutathione Peroxidase 3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Selenoproteins of the Thyroid Gland: Expression, Localization and Possible Function of Glutathione Peroxidase 3 Article in press - uncorrected proof Biol. Chem., Vol. 388, pp. 1053–1059, October 2007 • Copyright ᮊ by Walter de Gruyter • Berlin • New York. DOI 10.1515/BC.2007.122 Selenoproteins of the thyroid gland: expression, localization and possible function of glutathione peroxidase 3 Cornelia Schmutzler1,*, Birgit Mentrup1,a, Lutz Introduction: the thyroid gland, thyroid Schomburg1, Cuong Hoang-Vu2, Volker Herzog3 hormones and selenium and Josef Ko¨ hrle1 The main physiological function of the thyroid gland is 1 Institut fu¨ r Experimentelle Endokrinologie, Charite´– the synthesis of thyroid hormones (TH), for which it is the Universita¨ tsmedizin Berlin, Charite´ platz 1, exclusive source in the vertebrate body. THs are key D-10117 Berlin, Germany regulators of development, growth, and differentiation, 2 Experimentelle und Chirurgische Onkologie, Martin- particularly of the nervous system, as well as many phys- Luther-Universita¨ t Halle/Wittenberg, Magdeburger Str. iological processes in the adult, such as body tempera- 18, D-06097 Halle/Saale, Germany ture, heart activity and energy metabolism. THs are 3 Institut fu¨ r Zellbiologie, Rheinische Friedrich-Wilhelms- synthesized by the epithelial cells of the thyroid gland, Universita¨ t, Ulrich-Haberland-Str. 61a, D-53121 Bonn, the thyrocytes (Taurog, 2005). These cells line the lumen Germany of the thyroid follicles, which contain the so-called col- * Corresponding author loid, mainly consisting of thyroglobulin (Tg) and small e-mail: [email protected] amounts of other proteins. The three crucial steps of TH synthesis are all catalyzed by a single enzyme, the heme protein thyroid peroxidase (TPO) and comprise: (1) the oxidation of iodide; (2) the iodination of ‘hormonogenic’ tyrosine residues of Tg; and (3) the oxidative coupling of two iodinated tyrosine residues to give Tg-bound TH thy- Abstract roxine (T4) and triiodo-thyronine (T3). Tg is secreted in dimeric form (2=330 kDa, 19 S) towards the apical lumen The thyroid gland has an exceptionally high selenium of the thyroidal follicle. After iodination and coupling, the content, even during selenium deficiency. At least 11 colloidal Tg with the bound TH may be proteolyzed either selenoproteins are expressed, which may be involved in in the follicular space or within lysosomes after micro- the protection of the gland against the high amounts of pinocytotic uptake. This eventually leads to TH release into the circulation. Alternatively, Tg forms highly poly- H2O2 produced during thyroid hormone biosynthesis. As determined here by in situ hybridization and Northern merized ‘storage Tg’ deposited in the colloid lumen (see blotting experiments, glutathione peroxidases (GPx) 1 below). Thus, Tg is another central player in the reaction and 4 and selenoprotein P were moderately expressed, sequence of TH biosynthesis. occurring selectively in the follicular cells and in leuko- An essential co-substrate for TPO in this pathway is H O , which provides oxidative equivalents for TPO and cytes of germinal follicles of thyroids affected by Hashi- 2 2 is produced in high amounts by the NADPH-dependent moto’s thyroiditis. Selenoprotein 15 was only marginally flavoproteins thyroid oxidase DUOX (dual oxidases) 1 expressed and distributed over all cell types. GPx3 and 2. Thus, as a consequence of its normal physiolog- mRNA was exclusively localized to the thyrocytes, ical activity, the gland is continuously exposed to relevant showed the highest expression levels and was down- concentrations of H O (in addition to the ‘normal’ share regulated in 5 of 6 thyroid cancer samples as compared 2 2 of a cell, which is contributed by mitochondrial metabo- to matched normal controls. GPx3 could be extracted lism) and to H O -derived reactive oxygen species (ROS) from thyroidal colloid by incubation with 0.5% sodium 2 2 probably arising as by-products of these processes. dodecyl sulfate indicating that this enzyme is (i) secreted Although TH synthesis is compartmentalized to the into the follicular lumen and (ii) loosely attached to the lumen of the follicles, and both the DUOX enzymes and colloidal thyroglobulin. These findings are consistent with TPO are localized to the apical membrane of the thyro- a role of selenoproteins in the protection of the thyroid cyte, H O can freely diffuse into the cytoplasm and from possible damage by H O . Particularly, GPx3 might 2 2 2 2 nucleus, where it may lead to aberrant oxidation and iodi- use excess H2O2 and catalyze the polymerization of thyroglobulin to the highly cross-linked storage form nation of proteins and lipids, trigger apoptosis and induce DNA damage. However, the H O produced is present in the colloid. 2 2 consumed at least in part to form a special ‘storage Tg’. This form consists of highly polymeric Tg cross-linked by Keywords: deiodinase; glutathione peroxidase 1; intra- and intermolecular disulfide bonds and is depos- glutathione peroxidase 3; glutathione peroxidase 4; ited in the follicular lumen in protein concentrations of up selenoprotein 15; selenoprotein P; thyroglobulin. to 590 mg/ml as insoluble protein globules (Berndorfer et al., 1996). In the current model, it is assumed that the aPresent address: Max-Planck-Institut fu¨ r Molekulare Genetik, formation of these covalent bonds is also catalyzed by Fabeckstr. 60-62, D-14195 Berlin, Germany. TPO. Bereitgestellt von | Universitäts- und Landesbibliothek Bonn (Universitäts- und Landesbibliothek Bonn) 2007/218 Angemeldet | 172.16.1.226 Heruntergeladen am | 12.07.12 14:38 Article in press - uncorrected proof 1054 C. Schmutzler et al. The thyroid gland, together with the brain and several stimulation by TSH triggering of compensatory growth of other endocrine tissues, is among the organs with the the thyroid as well as – inadequately – increased H2O2 highest selenium (Se) content in vertebrates (Dickson and production for TH synthesis. However, the latter cannot Tomlinson, 1967; Behne et al., 1988). Furthermore, under be counter-regulated due to inadequate function of H2O2- conditions of Se deficiency, the gland retains or even scavenging selenoenzymes, resulting in a ‘vicious circle’ accumulates Se, as shown in rats exposed to nutritional of stimulation and increased tissue damage followed by Se shortage (Behne et al., 1988; Bermano et al., 1995). thyroid necrosis and, finally, fibrosis. Other factors, such These findings have been impressively verified in a as deficiency in further trace elements, may also contrib- genetic model for Se deficiency, the selenoprotein P ute to pathogenesis. In rats, Se deficiency aggravates the (SePP) knockout mouse, which lacks the plasma protein susceptibility to inflammation and necrosis of the thyroid SePP, the main Se distributor in the vertebrate organism. gland caused by iodide overload in iodine-deficient thy- SePP knockout mice display decreased serum Se levels, roid glands; TGFb seems to play a prominent role in this with manifest growth defects and neurological abnor- process (reviewed by Ko¨ hrle et al., 2005). However, con- malities indicating Se deficiency in the central nervous tradictory data have also been published (Colzani et al., system (Hill et al., 2003; Schomburg et al., 2003). Sur- 1999). prisingly, however, thyroid Se concentration, thyroid Thyroid carcinoma, although it comprises only 1% of glutathione peroxidase (GPx) activity, thyroid gland mor- all cancers diagnosed, is the most frequent malignant phology, and serum levels of T4, T3 and TSH were within disease of the endocrine system, and the anaplastic var- normal range. Thus, the thyroid gland occupies a partic- iant is one of the most deadly cancers, with a mean sur- ularly high rank in the Se hierarchy that regulates the pri- vival rate of only a few months after diagnosis (Pasieka, ority according to which various tissues obtain their share 2003). The Norwegian JANUS control study demonstrat- of a limited pool of Se. Accordingly, at least 11 seleno- ed an elevated risk of developing thyroid carcinoma proteins occur in the thyroid gland (Behne et al., 1988), associated with prediagnostically low plasma Se concen- including 59-deiodinases type I and type II (59DI, 59DII), trations (Glattre et al., 1989). Another study examined glutathione peroxidases GPx1, GPx3 and GPx4, thiore- concentrations of minerals in the blood and thyroid tissue doxin reductase (TrxR), the Se transport protein SePP of several patients with thyroid diseases and found that and selenoprotein 15 (SeP15), where they may catalyze patients with thyroid cancer had the lowest mean Se lev- redox reactions involved in various physiological pro- els (Kucharzewski et al., 2003). cesses such as the scavenging of ROS, TH metabolism Accordingly, in thyroid cancer, the expression of vari- and others (Ko¨ hrle, 2005; Ko¨ hrle et al., 2005). ous selenoproteins is dysregulated. 59DI expression and The observations summarized above indicate that an enzyme activity are decreased or absent in thyroid car- adequate Se supply is required for proper thyroid func- cinoma tissues and cell lines (Ko¨ hrle, 1997). DNA array tion. This conclusion is supported by additional data link- data indicate that 59DI is down-regulated in follicular thy- ing several pathological conditions of the thyroid gland roid adenoma compared to follicular thyroid carcinoma, to Se status. For example, patients with autoimmune thy- and the same is true for SePP (Barden et al., 2003). Sele- roiditis (AITD) seem to benefit from Se supplementation. nium binding protein 1 (SELENBP1; Chang et al.,
Load more

Recommended publications
  • Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution
    Peroxidase and NADPH-Cytochrome C Reductase Activity During Thyroid Hyperplasia and Involution KUNIHIRO YAMAMOTO AND LESLIE J. DEGROOT Thyroid Study Unit, Department of Medicine, University of Chicago, Chicago, Illinois 60637 ABSTRACT. The regulation of iodination was in- TSH injection, whether expressed per mg gland vestigated in male rats during physiological altera- weight, per mg protein, or per fxg DNA, suggesting tions in thyroid function. Thyroid hyperplasia was enzyme induction and cellular hypertrophy. Involu- Downloaded from https://academic.oup.com/endo/article/95/2/606/2618917 by guest on 30 September 2021 produced by giving 0.01% PTU in drinking water or tion by T4 administration caused a decrease in injection of TSH (2 USP U/day); involution was thyroid weight, DNA content, and enzyme activity per induced after PTU treatment by giving 3 fig L-T4/ml gland. The main reason for the decrease in enzyme in drinking water. Increase in activity of thyroid activity per gland was a diminution of cell numbers. peroxidase and NADPH-cytochrome c reductase per During thyroid hyperplasia and involution, perox- gland exceeded gains in thyroid weight and DNA idase and NADPH-cytochrome c reductase activity content early in hyperplasia, but increased essen- is regulated by TSH. During the onset of TSH tially in parallel manner during chronic PTU treat- action, peroxidase and NADPH-cytochrome c re- ment. Enzyme activity per /xg DNA increased to ductase increase to a greater extent than thyroid 155% of control after 4 days of PTU treatment, weight and DNA content, suggesting preferential decreased to 138% on the seventh day, and was at enzyme synthesis in addition to cell hypertrophy.
    [Show full text]
  • Thyroid Peroxidase Antibody Is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease
    Published online: 2018-07-02 Article Thieme Li Fang et al. Thyroid Peroxidase Antibody is … Exp Clin Endocrinol Diabetes 2018; 00: 00–00 Thyroid Peroxidase Antibody is Associated with Plasma Homocysteine Levels in Patients with Graves’ Disease Authors Fang Li1 * , Gulibositan Aji1 * , Yun Wang2, Zhiqiang Lu1, Yan Ling1 Affiliations ABSTRACT 1 Department of Endocrinology and Metabolism, Zhong- Purpose Homocysteine is associated with cardiovascular, shan Hospital, Fudan University, Shanghai, China inflammation and autoimmune diseases. Previous studies have 2 Department of Endocrinology and Metabolism, the shown that thyroid peroxidase antibody is associated with ho- Second Hospital of Shijiazhuang City, Shijiazhuang, mocysteine levels in hypothyroidism. The relationship between Hebei Province, China thyroid antibodies and homocysteine in hyperthyroidism re- mains unclear. In this study, we aimed to investigate the asso- Key words ciation of thyroid antibodies with homocysteine in patients human, cardiovascular risk, hyperthyroidism with Graves’ disease. Methods This was a cross-sectional study including 478 received 07.04.2018 Graves’ disease patients who were consecutively admitted and revised 10.05.2018 underwent radioiodine therapy. Homocysteine, thyroid hor- accepted 14.06.2018 mones, thyroid antibodies, glucose and lipids were measured. Results Patients with homocysteine levels above the median Bibliography were older and had unfavorable metabolic parameters com- DOI https://doi.org/10.1055/a-0643-4692 pared to patients with homocysteine levels below the median. Published online: 2.7.2018 Thyroglobulin antibody or thyroid peroxidase antibody was Exp Clin Endocrinol Diabetes 2020; 128: 8–14 associated with homocysteine levels (β = 0.56, 95 %CI 0.03- © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · 1.08, p = 0.04; β = 0.75, 95 %CI 0.23-1.27, p = 0.005).
    [Show full text]
  • Thyroid Surgery for Patients with Hashimoto's Disease
    ® Clinical Thyroidology for the Public VOLUME 12 | ISSUE 7 | JULY 2019 HYPOTHYROIDISM Thyroid surgery for patients with Hashimoto’s disease BACKGROUND SUMMARY OF THE STUDY Hypothyroidism, or an underactive thyroid, is a common This study enrolled patients with hypothyroidism due to problem. In the United States, the most common cause Hashimoto’s thyroiditis who received treatment with thy- of hypothyroidism is Hashimoto’s thyroiditis. This is an roidectomy and thyroid hormone replacement or thyroid autoimmune disorder where antibodies attack the thyroid, hormone replacement alone. The outcome of the study causing inflammation and destruction of the gland. Char- was a patient-reported health score on the generic Short acteristic of Hashimoto’s thyroiditis are high antibodies Form-36 Health Survey (SF-36) after 18 months. to thyroid peroxidase (TPO Ab) on blood tests. Hypo- thyroidism is treated by thyroid hormone and returning Patients were in the age group of 18 to 79 years. They all thyroid hormone levels to the normal range usually had a TPOAb titer >1000 IU/L and reported persistent resolves symptoms in most patients. symptoms despite having normal thyroid hormone levels based on blood tests. Typical symptoms included fatigue, However, in some patients, symptoms may persist despite increased need for sleep associated with reduced sleep what appears to be adequate treatment based on blood quality, joint and muscle tenderness, dry mouth, and dry tests of thyroid function. This raises the possibility that eyes. Follow up visits were done every 3 months for 18 some symptoms may be related to the autoimmune months and the thyroid hormone therapy was adjusted as condition itself.
    [Show full text]
  • How Useful Are Autoantibodies in Diagnosing Thyroid Disorders?
    Evidence Based Answers CLINIcAL INQUiRiES from the Family Physicians Inquiries Network Heather Downs, DO, How useful are autoantibodies and Albert A. Meyer, MD New Hanover Regional Medical in diagnosing thyroid disorders? Center, Wilmington, NC Donna Flake, MSLS, MSAS Coastal Area Health Education Evidence-based answer Center, Wilmington, NC They’re useful in diagnosing Graves’ increases or decreases the probability disease and, to a lesser extent, of autoimmune thyroid disease by only autoimmune thyroid disease; they can also a small to moderate degree (SOR: B, 3 help predict hypothyroidism. Thyrotropin cross-sectional studies). receptor antibodies (TRAb) may be mildly Thyroid-stimulating hormone (TSH) elevated in a variety of thyroid disorders, levels >2 mU/L, although still in the normal but a TRAb level >10 U/L increases range, can be followed up with TPOAb ® the probability of Graves’ disease by Dowdentesting to determine Health whether Mediathe patient a moderate to large degree (strength has an increased probability of developing of recommendation [SORCopyright]: B, cross- hypothyroidism (SOR: B, cohort study sectional study). A positive or negativeFor personalwith a vague hypothyroidism use only reference thyroid peroxidase antibody (TPOAb) test standard). Clinical commentary FAST TRACK In equivocal situations and pregnancy, infiltrative disorders, Reidel’s thyroiditis, antibodies may help or subacute granulomatous thyroiditis are Thyroid Under most circumstances, hypo- and suspected. TPOAb may help predict the autoantibodies hyperthyroid disorders can be diagnosed development of clinical hypothyroidism in can help diagnose by testing TSH and free T , without thyroid patients with TSH in the range of 5-10 mU/L. 4 Graves’ disease antibody testing. Radionuclide uptake and Pregnancy-related hyperthyroidism scan provide diagnostic information for requires antibody testing because and autoimmune hyperthyroid states.
    [Show full text]
  • In Thyroid Cancer
    Metere et al. Cancer Cell Int (2018) 18:7 https://doi.org/10.1186/s12935-018-0504-4 Cancer Cell International PRIMARY RESEARCH Open Access A possible role for selenoprotein glutathione peroxidase (GPx1) and thioredoxin reductases (TrxR1) in thyroid cancer: our experience in thyroid surgery Alessio Metere1* , Francesca Frezzotti1, Claire Elizabeth Graves2, Massimo Vergine1, Alessandro De Luca1, Donatella Pietraforte3 and Laura Giacomelli1 Abstract Background: Oxidative stress is responsible for some alterations in the chemical structure and, consequently, in the function of proteins, lipids, and DNA. Recent studies have linked oxidative stress to cancers, particularly thyroid cancer, but the mechanisms remain unclear. Here, we further characterize the role of oxidative stress in thyroid cancer by analyzing the expression of two selenium antioxidant molecules, glutathione peroxidase (GPx1) and thioredoxin reductase (TrxR1) in thyroid cancer cells. Methods: Samples of both healthy thyroid tissue and thyroid tumor were taken for analysis after total thyroidectomy. The expression of GPx1 and TrxR1 was revealed by Western blot analysis and quantifed by densitometric analy- ses, while the evaluation of free radicals was performed by Electron Paramagnetic Resonance (EPR)-spin trapping technique. Results: Our results show a decrease in the expression of GPx1 and TrxR1 ( 45.7 and 43.2% respectively, p < 0.01) in the thyroid cancer cells compared to the healthy cells. In addition, the EPR− technique− shows an increase of free radicals in tumor tissue, signifcantly higher than that found in healthy thyroid tissue ( 116.3%, p < 0.01). + Conclusions: Our fndings underscore the relationship between thyroid cancer and oxidative stress, showing the imbalance of the oxidant/antioxidant system in thyroid cancer tissue.
    [Show full text]
  • NNT Mutations: a Cause of Primary Adrenal Insufficiency, Oxidative Stress and Extra- Adrenal Defects
    175:1 F Roucher-Boulez and others NNT, adrenal and extra-adrenal 175:1 73–84 Clinical Study defects NNT mutations: a cause of primary adrenal insufficiency, oxidative stress and extra- adrenal defects Florence Roucher-Boulez1,2, Delphine Mallet-Motak1, Dinane Samara-Boustani3, Houweyda Jilani1, Asmahane Ladjouze4, Pierre-François Souchon5, Dominique Simon6, Sylvie Nivot7, Claudine Heinrichs8, Maryline Ronze9, Xavier Bertagna10, Laure Groisne11, Bruno Leheup12, Catherine Naud-Saudreau13, Gilles Blondin13, Christine Lefevre14, Laetitia Lemarchand15 and Yves Morel1,2 1Molecular Endocrinology and Rare Diseases, Lyon University Hospital, Bron, France, 2Claude Bernard Lyon 1 University, Lyon, France, 3Pediatric Endocrinology, Gynecology and Diabetology, Necker University Hospital, Paris, France, 4Pediatric Department, Bab El Oued University Hospital, Alger, Algeria, 5Pediatric Endocrinology and Diabetology, American Memorial Hospital, Reims, France, 6Pediatric Endocrinology, Robert Debré Hospital, Paris, France, 7Department of Pediatrics, Rennes Teaching Hospital, Rennes, France, 8Pediatric Endocrinology, Queen Fabiola Children’s University Hospital, Brussels, Belgium, 9Endocrinology Department, L.-Hussel Hospital, Vienne, France, 10Endocrinology Department, Cochin University Hospital, Paris, France, 11Endocrinology Department, Lyon University Hospital, Bron-Lyon, France, 12Paediatric and Clinical Genetic Department, Correspondence Nancy University Hospital, Vandoeuvre les Nancy, France, 13Pediatric Endocrinology and Diabetology, should be
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • A Machine Learning Tool for Predicting Protein Function Anna
    The Woolf Classifier Building Pipeline: A Machine Learning Tool for Predicting Protein Function Anna Farrell-Sherman Submitted in Partial Fulfillment of the Prerequisite for Honors in Computer Science under the advisement of Eni Mustafaraj and Vanja Klepac-Ceraj May 2019 © 2019 Anna Farrell-Sherman Abstract Proteins are the machinery that allow cells to grow, reproduce, communicate, and create multicellular organisms. For all of their importance, scientists still have a hard time understanding the function of a protein based on its sequence alone. For my honors thesis in computer science, I created a machine learning tool that can predict the function of a protein based solely on its amino acid sequence. My tool gives scientists a structure in which to build a � Nearest Neighbor or random forest classifier to distinguish between proteins that can and cannot perform a given function. Using default Min-Max scaling, and the Matthews Correlation Coefficient for accuracy assessment, the Woolf Pipeline is built with simplified choices to guide users to success. i Acknowledgments There are so many people who made this thesis possible. First, thank you to my wonderful advisors, Eni and Vanja, who never gave up on me, and always pushed me to try my hardest. Thank you also to the other members of my committee, Sohie Lee, Shikha Singh, and Rosanna Hertz for supporting me through this process. To Kevin, Sophie R, Sophie E, and my sister Phoebe, thank you for reading my drafts, and advising me when the going got tough. To all my wonderful friends, who were always there with encouraging words, warm hugs, and many congratulations, I cannot thank you enough.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • REVIEW Iodothyronine Deiodinase Structure and Function
    189 REVIEW Iodothyronine deiodinase structure and function: from ascidians to humans Veerle M Darras and Stijn L J Van Herck Animal Physiology and Neurobiology Section, Department of Biology, Laboratory of Comparative Endocrinology, KU Leuven, Naamsestraat 61, PO Box 2464, B-3000 Leuven, Belgium (Correspondence should be addressed to V M Darras; Email: [email protected]) Abstract Iodothyronine deiodinases are important mediators of thyroid of each of them, however, varies amongst species, develop- hormone (TH) action. They are present in tissues throughout mental stages and tissues. This is especially true for 0 the body where they catalyse 3,5,3 -triiodothyronine (T3) amphibians, where the impact of D1 may be minimal. D2 production and degradation via, respectively, outer and inner and D3 expression and activity respond to thyroid status in ring deiodination. Three different types of iodothyronine an opposite and conserved way, while the response of D1 is deiodinases (D1, D2 and D3) have been identified in variable, especially in fish. Recently, a number of deiodinases vertebrates from fish to mammals. They share several have been cloned from lower chordates. Both urochordates common characteristics, including a selenocysteine residue and cephalochordates possess selenodeiodinases, although in their catalytic centre, but show also some type-specific they cannot be classified in one of the three vertebrate types. differences. These specific characteristics seem very well In addition, the cephalochordate amphioxus also expresses conserved for D2 and D3, while D1 shows more evolutionary a non-selenodeiodinase. Finally, deiodinase-like sequences diversity related to its Km, 6-n-propyl-2-thiouracil sensitivity have been identified in the genome of non-deuterostome and dependence on dithiothreitol as a cofactor in vitro.
    [Show full text]
  • Thiol Peroxidases Mediate Specific Genome-Wide Regulation of Gene Expression in Response to Hydrogen Peroxide
    Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide Dmitri E. Fomenkoa,1,2, Ahmet Koca,1, Natalia Agishevaa, Michael Jacobsena,b, Alaattin Kayaa,c, Mikalai Malinouskia,c, Julian C. Rutherfordd, Kam-Leung Siue, Dong-Yan Jine, Dennis R. Winged, and Vadim N. Gladysheva,c,2 aDepartment of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664; bDepartment of Life Sciences, Wayne State College, Wayne, NE 68787; dDepartment of Medicine, University of Utah Health Sciences Center, Salt Lake City, UT 84132; eDepartment of Biochemistry, University of Hong Kong, Hong Kong, China; and cDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Joan Selverstone Valentine, University of California, Los Angeles, CA, and approved December 22, 2010 (received for review July 21, 2010) Hydrogen peroxide is thought to regulate cellular processes by and could withstand significant oxidative stress. It responded to direct oxidation of numerous cellular proteins, whereas antioxi- several redox stimuli by robust transcriptional reprogramming. dants, most notably thiol peroxidases, are thought to reduce However, it was unable to transcriptionally respond to hydrogen peroxides and inhibit H2O2 response. However, thiol peroxidases peroxide. The data suggested that thiol peroxidases transfer have also been implicated in activation of transcription factors oxidative signals from peroxides to target proteins, thus activating and signaling. It remains unclear if these enzymes stimulate or various transcriptional programs. This study revealed a previously inhibit redox regulation and whether this regulation is widespread undescribed function of these proteins, in addition to their roles or limited to a few cellular components.
    [Show full text]
  • Micrornas As New Regulators of Neutrophil Extracellular Trap Formation
    International Journal of Molecular Sciences Review MicroRNAs as New Regulators of Neutrophil Extracellular Trap Formation Sonia Águila † , Ascensión M. de los Reyes-García †, María P. Fernández-Pérez, Laura Reguilón-Gallego, Laura Zapata-Martínez, Inmaculada Ruiz-Lorente, Vicente Vicente , Rocío González-Conejero *,‡ and Constantino Martínez *,‡ Department of Hematology and Medical Oncology, Morales Meseguer University Hospital, Centro Regional de Hemodonación, Universidad de Murcia, IMIB, C/Ronda de Garay S/N, 30003 Murcia, Spain; [email protected] (S.Á.); [email protected] (A.M.d.l.R.-G.); [email protected] (M.P.F.-P.); [email protected] (L.R.-G.); [email protected] (L.Z.-M.); [email protected] (I.R.-L.); [email protected] (V.V.) * Correspondence: [email protected] (R.G.-C.); [email protected] (C.M.); Tel.: +34-968341990 (R.G.-C. & C.M.); Fax: +34-968261914 (R.G.-C. & C.M.) † These authors contributed equally to this work. ‡ These authors shared senior authorship. Abstract: Neutrophil extracellular traps (NETs) are formed after neutrophils expelled their chromatin content in order to primarily capture and eliminate pathogens. However, given their characteristics due in part to DNA and different granular proteins, NETs may induce a procoagulant response linking inflammation and thrombosis. Unraveling NET formation molecular mechanisms as well Citation: Águila, S.; de los as the intracellular elements that regulate them is relevant not only for basic knowledge but also Reyes-García, A.M.; Fernández-Pérez, to design diagnostic and therapeutic tools that may prevent their deleterious effects observed in M.P.; Reguilón-Gallego, L.; several inflammatory pathologies (e.g., cardiovascular and autoimmune diseases, cancer).
    [Show full text]