DOCSLIB.ORG

Characterization of the Interaction Between Titin Kinase Domain And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of the Interaction Between Titin Kinase Domain And Florida State University Libraries Electronic Theses, Treatises and Dissertations The Graduate School 2011 Characterization of the Interaction Between Titn Kinase Domain and Enigma/Pdlim7 Arif Fazel Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] THE FLORIDA STATE UNIVERSITY COLLEGE OF ARTS AND SCIENCES CHARACTERIZATION OF THE INTERACTION BETWEEN TITN KINASE DOMAIN AND ENIGMA/PDLIM7 By ARIF FAZEL A Thesis submitted to the Department of Biological Science in partial fulfillment of the requirements for the degree of Master of Science Degree Awarded: Summer Semester, 2011 The members of the committee approve the thesis of Arif Fazel defended on June 16, 2011 _________________________________ Dr. Thomas C.S. Keller III Major Professor _________________________________ Dr. Thomas M. Roberts Committee Member _________________________________ Dr. Wu Min Deng Committee Member Approved: ___________________________________________________ P. Bryant Chase, Chair, Department of Biological Science ___________________________________________________ Joseph Travis, Dean, College of Arts and Sciences The Graduate School has verified and approved the above-named committee members ii TABLE OF CONTENTS List of Tables……………………………………………………………………………..iv List of Figures…………………………………….……………………………………….v Abbreviations……....……………………………………………………………………..vi Abstract……...………………………………………………...…………………………vii 1. INTRODUCTION…………………….………………………………….……………1 2. MATERIALS AND METHODS……….…………………………………………….12 3. RESULTS..………………………………….………………….……………………..19 4. DISCUSSION……………………………………………………………….…….…..26 REFERENCES……………………………………………………………….………….30 BIOGRAPHICAL SKETCH…………………………………………………………….34 iii LIST OF TABLES Table 1. Primers for yeast vector pGAD-GH…………………………………………..14 Table 2. Primers for pET41a Protein expression vector…………………………….….16 Table 3. Sequences of Enigma………………………………………………………….17 Table 4. Table of Y2H results……………………………………………………….….21 iv LIST OF FIGURES Figure 1. Striated Sarcomere……………………………………………………..………2 Figure 2. Titin interactome……………………………………...………………..………2 Figure 3. Ribbon diagram of Titin Kinase Domain……………………...……….……...5 Figure 4. Organization of nonmuscle cell stress fiber…………………...……………….6 Figure 5. Diagram of Enigma protein…………………………………..…………..…...11 Figure 6a. GST-Enigma Mid Domain Purification………………………………….…..21 Figure 6b. GST-Enigma LIM domain purification……………………………….……..22 Figure 7. GST-Enigma LIM3 purification………………………………………………22 Figure 8. Gel Image of LIM3-Kin4 interaction…………………………….……….…..24 Figure 9. Immunofluorescent localization of TKK and PDLIM7 in hMSCs…….……..26 v ABBREVIATIONS Adaptor protein with PH and SH2 domain……………………...……………………..APS Enigma LIM domain 1……………………………………………………………….LIM1 Enigma LIM domain 2……………………………………………………………….LIM2 Enigma LIM domain 3……………………………………………………………….LIM3 Enigma Mid region ……………………………………………….……………….….MID Human mesenchymal stem cell…………………..………………………………….hMSC Insulin Receptor…………………………………………………….…………………InsR Lin-11, Isl-1, Mec-3…………………………….……...……………………….....…..LIM Oncogenic form of RTK…………………………………………….……………..Ret/ptc2 Postsynaptic density 95, Discs large, ZO-1……………………..………….…..…......PDZ . Receptor Tyrosine Kinases…………………………………………………....………RTK Serum Response Factor……………………………………...………….….……….....SRF Titin Kinase Domain………………………………………...………………..…….....TKD Yeast-2-Hybrid………………………………………………………………………..Y2H vi ABSTRACT Titin is a very large protein that contributes to sarcomere structure and mechanosensing in striated muscle. Our lab discovered isoforms of titin in nonmuscle cells (Eilersten and Keller, 1992). Nonmuscle cell titin (c-titin) contains an alpha-actinin binding Z-repeat region, a distinctly PEVK region, a myosin filament-binding region, and the kinase domain also present in striated muscle titin isoforms. In striated muscle, the titin kinase domain (TKD) functions as a mechanosensor that signals changes in gene expression through interaction with nbr1 and p62. A previous yeast two hybrid (Y2H) screen to identify proteins that interact with the TKD in nonmuscle cells revealed an interaction with the ubiquitously expressed scaffold protein Enigma/PDLIM7. Enigma/PDLIM7 consists of an N-terminal PDZ domain that binds to β-tropomyosin on actin filaments, a Mid piece, and C-terminal region containing three LIM domains. The work described here further characterizes the interaction between the TKD and Enigma/PDLIM7. Y2H analysis with cloned TKD and Enigma/PDLIM7 fragments demonstrated that a region of the Enigma/PDLIM7 Mid piece and LIM1 and LIM3 domains interact with TKD. In vitro pull-down assays with bacterially expressed protein confirmed the interaction between TKD and Enigma LIM3. Immunolocalization of the TKD and Enigma/PDLIM7 in cultured human mesenchymal stem cells containing robust stress fibers revealed that both TKD and Enigma localized along stress fibers where they could interact, but there was little direct overlap in the cells under the standard culture conditions tested. These results support the possibility that Enigma/PDLIM7 functions as a scaffold to localize the TKD near actin filaments in the cytoskeleton of nonmuscle cells. vii CHAPTER 1 GENERAL INTRODUCTION Striated Muscle Titin Striated muscle myofibers contain myofibrils composed of linearly arranged sarcomeres. The sarcomere is the functional unit of muscle contraction and where the three major filament proteins actin, myosin and titin interact. In sarcomeres thick filaments of myosin II, the molecular motor protein, and thin filaments of actin work together to drive the filament sliding that contracts muscle. The sarcomere is divided into four parts – the Z-line, I band, A-band and M-line. Actin filaments are anchored to the Z- line by interacting with the cross-linking protein α-actinin and extend into the I band. Myosin II thick filaments make up the A band and are anchored to the Z-line through titin and the M-line through an interaction with myomesin and titin. Titin is the third most abundant protein found in the sarcomere. Titin is a giant protein ranging in size from 2000 kDa to 4000 kDa depending on the muscle type. A single titin molecule is about 1 µm long and contains about 300 immunoglobulin (Ig) and fibronectin-like (Fn) domains. Each of these domains contains about 100 amino acids folded into a β-sheet sandwich. Single titin molecules span half the sarcomere, where the titin N-terminus is anchored to the Z-disc and the C-terminus anchored at the M-line (Figure 1). 1 Figure 1. Striated Sarcomere (Dr. F. Schoeni-Affoher, University of Fribourg, Switzerland. http://emedicine.medscape.com/article/1170911-overview#a0104) During muscle development, titin assists in the integration of the contractile proteins actin and myosin and is thought to act as a template directing assembly of thick filaments (Whiting, A. et al. 1989). Through the direct and indirect interactions that have been discovered to date, it is clear that titin functions as a scaffold that keeps the sarcomere intact (Figure 2). Further studies into titin are now demonstrating its involvement with muscle architecture, elasticity, and signaling. Figure 2. Titin interactome; direct (red) and indirect (yellow) interacting molecules of striated muscle titin. (Linke, W. 2008) 2 The Z-disk of striated muscle is one the most highly organized cellular structures. It anchors and aligns at least three major sarcomeric filament systems, including actin, titin and nebulin. Proper sorting and localization of proteins within the Z-disk region are critical for myofibril assembly, as well as for linking contractile functions of muscle sarcomeres to membrane systems. Parts of the Z-disk are also involved in signaling processes that may regulate muscle development and degradation. The titin N-terminus is anchored to the Z-disk through a series of protein-protein interactions. One is between the Z1Z2 domain of titin and telethonin. Studies show that titin interacting with telethonin is assembled into an antiparallel complex (Zou, P. et al. 2006). Downstream of the Z1Z2 region is the titin Z-repeat region that binds to α-actinin, which crosslinks titin with actin. The region of titin that spans the I-band between the Z-disc and the end of the myosin bipolar filament contains serially linked regions that confer passive elasticity in response to physiological stress (Horowits, R. et al. 1986). Passive tension in the I-band portion maintains the equidistance of the A-band between the Z-discs. The I-band region of titin is composed of tandem Ig domains, the N2-region, and a PEVK (Proline, Glutamate, Valine, Lysine) region. The Ig domain region of titin, located within the elastic section of this giant muscle protein, is responsible for the molecule’s extensibility and passive elasticity. The PEVK length in titin isoforms correlates with muscle stiffness and seems responsible for length gains at moderate sarcomere lengths where passive force increases, suggesting a role in muscle elasticity (Linke, W. 1998). The PEVK domain contains 110 to 225 exons, which encode 26 to 28 highly conserved amino acid domains, some of which are homologous to SH3 domains. The secondary and tertiary structure of the PEVK domains is not well understood. SH3-like domains are usually involved in signaling mechanisms. Based on these characteristics, it is suggested that the PEVK domain may serve as a mechanical and signaling stretch response center. The A-band region of titin is the largest with a molecular weight of 2 MDa and a length
Load more

Recommended publications
  • The Wiskott-Aldrich Syndrome: the Actin Cytoskeleton and Immune Cell Function
    Disease Markers 29 (2010) 157–175 157 DOI 10.3233/DMA-2010-0735 IOS Press The Wiskott-Aldrich syndrome: The actin cytoskeleton and immune cell function Michael P. Blundella, Austen Wortha,b, Gerben Boumaa and Adrian J. Thrashera,b,∗ aMolecular Immunology Unit, UCL Institute of Child Health, London, UK bDepartment of Immunology, Great Ormond Street Hospital NHS Trust, Great Ormond Street, London, UK Abstract. Wiskott-Aldrich syndrome (WAS) is a rare X-linked recessive primary immunodeficiency characterised by immune dysregulation, microthrombocytopaenia, eczema and lymphoid malignancies. Mutations in the WAS gene can lead to distinct syndrome variations which largely, although not exclusively, depend upon the mutation. Premature termination and deletions abrogate Wiskott-Aldrich syndrome protein (WASp) expression and lead to severe disease (WAS). Missense mutations usually result in reduced protein expression and the phenotypically milder X-linked thrombocytopenia (XLT) or attenuated WAS [1–3]. More recently however novel activating mutations have been described that give rise to X-linked neutropenia (XLN), a third syndrome defined by neutropenia with variable myelodysplasia [4–6]. WASP is key in transducing signals from the cell surface to the actin cytoskeleton, and a lack of WASp results in cytoskeletal defects that compromise multiple aspects of normal cellular activity including proliferation, phagocytosis, immune synapse formation, adhesion and directed migration. Keywords: Wiskott-Aldrich syndrome, actin polymerization, lymphocytes,
    [Show full text]
  • Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
    www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Phenotypic Modulation of Smooth Muscle Cells in Atherosclerosis Is Associated with Downregulation of LMOD1, SYNPO2, PDLIM7, PLN and SYNM
    Markers of smooth muscle cells Perisic et al. Phenotypic modulation of smooth muscle cells in atherosclerosis is associated with downregulation of LMOD1, SYNPO2, PDLIM7, PLN and SYNM Perisic L1, Rykaczewska U1, Razuvaev A1, Sabater-Lleal M2, Lengquist M1, Miller CL3, Ericsson I1, Röhl S1, Kronqvist M1, Aldi S1, Magné J2, Vesterlund M4, Li Y2, Yin H2, Gonzalez Diez M2, Roy J1, Baldassarre D5,6, Veglia F6, Humphries SE7, de Faire U8,9, Tremoli E5,6, on behalf of the IMPROVE study group, Odeberg J10, Vukojević V11, Lehtiö J4, Maegdefessel L2, Ehrenborg E2, Paulsson-Berne G2, Hansson GK2, Lindeman JHN12, Eriksson P2, Quertermous T3, Hamsten A2, Hedin U1 1Department of Molecular Medicine and Surgery, Karolinska Institutet, Sweden, 2Department of Medicine, Karolinska Institutet, Sweden, 3Division of Vascular Surgery, Stanford University, USA, 4Science for Life Laboratory, Sweden, 5Dipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano, Milan, Italy, 6Centro Cardiologico Monzino, IRCCS, Milan, Italy, 7British Heart Foundation Laboratories, University College of London, Department of Medicine, Rayne Building, London, United Kingdom, 8Division of Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, 9Department of Cardiology, Karolinska University Hospital Solna, Karolinska Institutet, Stockholm, Sweden, 10Science for Life Laboratory, Department of Proteomics, Sweden, 11Department of Clinical Neuroscience, Center for Molecular Medicine, Karolinska Institutet, Sweden, 12Department of Vascular
    [Show full text]
  • Original Article Prognostic Value of the PDLIM Family in Acute Myeloid Leukemia
    Am J Transl Res 2019;11(9):6124-6131 www.ajtr.org /ISSN:1943-8141/AJTR0096980 Original Article Prognostic value of the PDLIM family in acute myeloid leukemia Longzhen Cui1,2,3,4*, Zhiheng Cheng5*, Kai Hu6*, Yifan Pang7, Yan Liu3, Tingting Qian1,2, Liang Quan1,2, Yifeng Dai8, Ying Pang1, Xu Ye1, Jinlong Shi9, Lin Fu1,2,4 1Department of Hematology, 2Translational Medicine Center, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260, Guangdong, China; 3Translational Medicine Center, 4Department of Hematology, Huaihe Hospital of Henan University, Kaifeng 475000, Henan, China; 5Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands; 6Department of Hematology and Lymphoma Research Center, Peking University, Third Hospital, Beijing 100191, China; 7Department of Medicine, William Beaumont Hospital, Royal Oak, MI 48073, USA; 8Immunoendocrinology, Division of Medical Biology, Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands; 9Department of Medical Big Data, Chinese PLA General Hospital, Beijing 100853, China. *Equal contributors. Received April 22, 2019; Accepted June 26, 2019; Epub September 15, 2019; Published September 30, 2019 Abstract: Acute myeloid leukemia (AML) is a genetically complex, highly aggressive hematological malignancy. Prognosis is usually with grim. PDZ and LIM domain proteins (PDLIM) are involved in the regulation of a variety of biological processes, including cytoskeletal organization, cell differentiation, organ development, neural signaling or tumorigenesis. The clinical and prognostic value of the PDLIM family in AML is unclear. To understand the role of PDLIM expression in AML, The Cancer Genome Atlas (TCGA) database was screened and 155 de novo AML pa- tients with complete clinical information and the expression data of the PDLIM family were included in the study.
    [Show full text]
  • Structural Basis of Thymosin-Β4/Profilin Exchange Leading to Actin Filament Polymerization
    Structural basis of thymosin-β4/profilin exchange leading to actin filament polymerization Bo Xuea,1,2, Cedric Leyratb,1, Jonathan M. Grimesb,c, and Robert C. Robinsona,d aInstitute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Biopolis, Singapore 138673; bDivision of Structural Biology, Henry Wellcome Building for Genomic Medicine, Oxford, OX3 7BN, United Kingdom; cDiamond Light Source Ltd., Harwell Science and Innovation Campus, Didcot, Oxfordshire, OX11 0DE, United Kingdom; and dDepartment of Biochemistry, National University of Singapore, Singapore 117597 Edited by Thomas D. Pollard, Yale University, New Haven, CT, and approved September 22, 2014 (received for review June 30, 2014) Thymosin-β4(Tβ4) and profilin are the two major sequestering shared between Tβ4 and profilin. During phases of polymeriza- proteins that maintain the pool of monomeric actin (G-actin) within tion, the profilin–actin complex gives up its actin to the elon- cells of higher eukaryotes. Tβ4 prevents G-actin from joining a fila- gating filaments. The liberated profilin competes with Tβ4 for its ment, whereas profilin:actin only supports barbed-end elongation. bound ATP–G-actin, effectively restoring the pool of polymeri- Here, we report two Tβ4:actin structures. The first structure shows zation-competent actin. On filament dissociation, ADP-actin is that Tβ4 has two helices that bind at the barbed and pointed faces preferentially sequestered by profiling because of the afore- of G-actin, preventing the incorporation of the bound G-actin into mentioned difference in its affinity toward profilin and Tβ4. In a filament. The second structure displays a more open nucleotide the profilin:actin complex, nucleotide exchange is enhanced, and binding cleft on G-actin, which is typical of profilin:actin structures, the resulting ATP-actin is subject to competition between pro- with a concomitant disruption of the Tβ4 C-terminal helix interac- filin and Tβ4, resulting in the restoration of the pool of Tβ4- tion.
    [Show full text]
  • Profilin and Formin Constitute a Pacemaker System for Robust Actin
    RESEARCH ARTICLE Profilin and formin constitute a pacemaker system for robust actin filament growth Johanna Funk1, Felipe Merino2, Larisa Venkova3, Lina Heydenreich4, Jan Kierfeld4, Pablo Vargas3, Stefan Raunser2, Matthieu Piel3, Peter Bieling1* 1Department of Systemic Cell Biology, Max Planck Institute of Molecular Physiology, Dortmund, Germany; 2Department of Structural Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany; 3Institut Curie UMR144 CNRS, Paris, France; 4Physics Department, TU Dortmund University, Dortmund, Germany Abstract The actin cytoskeleton drives many essential biological processes, from cell morphogenesis to motility. Assembly of functional actin networks requires control over the speed at which actin filaments grow. How this can be achieved at the high and variable levels of soluble actin subunits found in cells is unclear. Here we reconstitute assembly of mammalian, non-muscle actin filaments from physiological concentrations of profilin-actin. We discover that under these conditions, filament growth is limited by profilin dissociating from the filament end and the speed of elongation becomes insensitive to the concentration of soluble subunits. Profilin release can be directly promoted by formin actin polymerases even at saturating profilin-actin concentrations. We demonstrate that mammalian cells indeed operate at the limit to actin filament growth imposed by profilin and formins. Our results reveal how synergy between profilin and formins generates robust filament growth rates that are resilient to changes in the soluble subunit concentration. DOI: https://doi.org/10.7554/eLife.50963.001 *For correspondence: peter.bieling@mpi-dortmund. mpg.de Introduction Competing interests: The Eukaryotic cells move, change their shape and organize their interior through dynamic actin net- authors declare that no works.
    [Show full text]
  • PDLIM7 (NM 005451) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC111943 PDLIM7 (NM_005451) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: PDLIM7 (NM_005451) Human Untagged Clone Tag: Tag Free Symbol: PDLIM7 Synonyms: LMP1; LMP3 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_005451, the custom clone sequence may differ by one or more nucleotides ATGGATTCCTTCAAAGTAGTGCTGGAGGGGCCAGCACCTTGGGGCTTCCGGCTGCAAGGGGGCAAGGACT TCAATGTGCCCCTCTCCATTTCCCGGCTCACTCCTGGGGGCAAAGCGGCGCAGGCCGGAGTGGCCGTGGG TGACTGGGTGCTGAGCATCGATGGCGAGAATGCGGGTAGCCTCACACACATCGAAGCTCAGAACAAGATC CGGGCCTGCGGGGAGCGCCTCAGCCTGGGCCTCAGCAGGGCCCAGCCGGTTCAGAGCAAACCGCAGAAGG CCTCCGCCCCCGCCGCGGACCCTCCGCGGTACACCTTTGCACCCAGCGTCTCCCTCAACAAGACGGCCCG GCCCTTTGGGGCGCCCCCGCCCGCTGACAGCGCCCCGCAGCAGAATGGACAGCCGCTCCGACCGCTGGTC CCAGATGCCAGCAAGCAGCGGCTGATGGAGAACACAGAGGACTGGCGGCCGCGGCCGGGGACAGGCCAGT CGCGTTCCTTCCGCATCCTTGCCCACCTCACAGGCACCGAGTTCATGCAAGACCCGGATGAGGAGCACCT GAAGAAATCAAGCCAGGTGCCCAGGACAGAAGCCCCAGCCCCAGCCTCATCTACACCCCAGGAGCCCTGG CCTGGCCCTACCGCCCCCAGCCCTACCAGCCGCCCGCCCTGGGCTGTGGACCCTGCGTTTGCCGAGCGCT ATGCCCCGGACAAAACGAGCACAGTGCTGACCCGGCACAGCCAGCCGGCCACGCCCACGCCGCTGCAGAG CCGCACCTCCATTGTGCAGGCAGCTGCCGGAGGGGTGCCAGGAGGGGGCAGCAACAACGGCAAGACTCCC GTGTGTCACCAGTGCCACAAGGTCATCCGGGGCCGCTACCTGGTGGCGCTGGGCCACGCGTACCACCCGG AGGAGTTTGTGTGTAGCCAGTGTGGGAAGGTCCTGGAAGAGGGTGGCTTCTTTGAGGAGAAGGGCGCCAT
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Force-Independent Interactions of Talin and Vinculin Govern Integrin-Mediated Mechanotransduction
    bioRxiv preprint doi: https://doi.org/10.1101/629683; this version posted May 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Force-independent interactions of talin and vinculin govern integrin-mediated mechanotransduction Paul Atherton1, Franziska Lausecker1, Alexandre Carisey1, Andrew Gilmore1, David Critchley2, Igor Barsukov3, and Christoph Ballestrem1, 1Wellcome Trust Centre for Cell-Matrix Research, University of Manchester, Manchester M13 9PT, UK. 2Department of Biochemistry, University of Leicester, Lancaster Road, Leicester LE1 9HN, UK. 3Institute of Integrative Biology, University of Liverpool, BioSciences Building, Crown Street, Liverpool L69 7ZB, UK. Talin, vinculin and paxillin are core components of the dy- C-terminal D5 tail domain (Vt) that masks the talin binding namic link between integrins and actomyosin. Here we study site in the D1 domain (Cohen et al., 2005). Furthermore, a the mechanisms that mediate their activation and association FRET conformation sensor has shown that vinculin is in an using a mitochondrial-targeting assay, structure-based mutants, open conformation within FAs (Chen et al., 2005). For talin, and advanced microscopy. As expected, full-length vinculin and the primary auto-inhibitory interaction is between the F3 do- talin are auto-inhibited and do not interact with each other in main of the N-terminal FERM domain and R9, one of the this state. Contrary to previous models that propose a critical 13 -helical bundles (R1-R13) in the flexible C-terminal rod role for forces driving talin-vinculin association, our data show a that force-independent relief of auto-inhibition is sufficient to (Calderwood et al., 2013).
    [Show full text]
  • Medical Cell Biology Microfilaments 1 Thomas J
    MEDICAL CELL BIOLOGY MICROFILAMENTS September 24, 2003 Thomas J. Schmidt, Ph.D. Department of Physiology and Biophysics 5-610 BSB, 335-7847 Reading Assignment: Molecular Biology of the Cell (4th ed..), 2001, by B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts, and P. Walter; Chapter 16, pp. 907-925, 927-939, 943-981 Key Concepts: 1. The cytoskeleton is a complex network of protein filaments (actin filaments, intermediate filaments and microtubules) that traverses the cell cytoplasm and performs many important and diverse cellular functions. 2. Thin actin filaments, which are present in all cells, are composed of two helically interwined chains of G-actin monomers. 3. A variety of proteins including spectrin, filamin, gelsolin, thymosin, profilin, fimbrin and α-actinin regulate the dynamic state of actin filaments 4. The spectrin membrane skeleton, which is composed primarily of actin filaments located at the cytoplasmic surface of the cell membrane, is essential for maintaining cellular shape and elasticity as well as membrane stability. 5. Cell motility is mediated by actin-filaments organized into specific cellular projections referred to as lamellipodia and filopodia. Medical Cell Biology Microfilaments 1 Thomas J. Schmidt, Ph.D. Email: [email protected] September 24, 2003 Key Terms: cytoskeleton cytochalasins actin filaments (actin) phalloidins intermediate filaments (vimentin, spectrin membrane skeleton lamin) spectrin microtubules (tubulin) actin microfilaments ankyrin F-actin band 4.1 G-actin glycophorin myosin II band 3.0 myosin I hereditary spherocytosis actin microfilaments hereditary elliptocytosis treadmilling sickle cell anemia actin-binding proteins spectrin supergene family spectrin spectrin filamin α-actin fimbrin dystrophin α-actinin microvilli gelsolin terminal web thymosin lamellipodium profilin filopodia villin stress fibers contractile bundles Medical Cell Biology Microfilaments 2 Thomas J.
    [Show full text]
  • New Model for Stacking Monomers in Filamentous Actin from Skeletal Muscles of Oryctolagus Cuniculus
    International Journal of Molecular Sciences Article New Model for Stacking Monomers in Filamentous Actin from Skeletal Muscles of Oryctolagus cuniculus Anna V. Glyakina 1,2, Alexey K. Surin 1,3,4, Sergei Yu. Grishin 1 , Olga M. Selivanova 1, Mariya Yu. Suvorina 1, Liya G. Bobyleva 5, Ivan M. Vikhlyantsev 5 and Oxana V. Galzitskaya 1,5,* 1 Institute of Protein Research, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia; [email protected] (A.V.G.); [email protected] (A.K.S.); [email protected] (S.Y.G.); [email protected] (O.M.S.); [email protected] (M.Y.S.) 2 Institute of Mathematical Problems of Biology, Russian Academy of Sciences, Keldysh Institute of Applied Mathematics, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia 3 The Branch of the Institute of Bioorganic Chemistry, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia 4 State Research Center for Applied Microbiology and Biotechnology, 142279 Obolensk, Moscow Region, Russia 5 Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia; [email protected] (L.G.B.); [email protected] (I.M.V.) * Correspondence: [email protected]; Tel.: +7-903-675-0156 Received: 29 September 2020; Accepted: 3 November 2020; Published: 6 November 2020 Abstract: To date, some scientific evidence (limited proteolysis, mass spectrometry analysis, electron microscopy (EM)) has accumulated, which indicates that the generally accepted model of double-stranded of filamentous actin (F-actin) organization in eukaryotic cells is not the only one. This entails an ambiguous understanding of many of the key cellular processes in which F-actin is involved.
    [Show full text]