Characterization of the Interaction Between Titin Kinase Domain And

Florida State University Libraries

Electronic Theses, Treatises and Dissertations The Graduate School

2011 Characterization of the Interaction Between Titn Kinase Domain and Enigma/Pdlim7 Arif Fazel

Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected]

THE FLORIDA STATE UNIVERSITY

COLLEGE OF ARTS AND SCIENCES

CHARACTERIZATION OF THE INTERACTION BETWEEN

TITN KINASE DOMAIN AND ENIGMA/PDLIM7

ARIF FAZEL

A Thesis submitted to the Department of Biological Science in partial fulfillment of the requirements for the degree of Master of Science

Degree Awarded: Summer Semester, 2011

The members of the committee approve the thesis of Arif Fazel defended on June 16, 2011

______Dr. Thomas C.S. Keller III Major Professor

______Dr. Thomas M. Roberts Committee Member

______Dr. Wu Min Deng Committee Member

Approved:

______P. Bryant Chase, Chair, Department of Biological Science

______Joseph Travis, Dean, College of Arts and Sciences

The Graduate School has verified and approved the above-named committee members

TABLE OF CONTENTS

List of Tables……………………………………………………………………………..iv

List of Figures…………………………………….……………………………………….v

Abbreviations……....……………………………………………………………………..vi

Abstract……...………………………………………………...…………………………vii

1. INTRODUCTION…………………….………………………………….……………1

2. MATERIALS AND METHODS……….…………………………………………….12

3. RESULTS..………………………………….………………….……………………..19

4. DISCUSSION……………………………………………………………….…….…..26

REFERENCES……………………………………………………………….………….30

BIOGRAPHICAL SKETCH…………………………………………………………….34

iii

LIST OF TABLES

Table 1. Primers for yeast vector pGAD-GH…………………………………………..14

Table 2. Primers for pET41a Protein expression vector…………………………….….16

Table 3. Sequences of Enigma………………………………………………………….17

Table 4. Table of Y2H results……………………………………………………….….21

LIST OF FIGURES

Figure 1. Striated Sarcomere……………………………………………………..………2

Figure 2. Titin interactome……………………………………...………………..………2

Figure 3. Ribbon diagram of Titin Kinase Domain……………………...……….……...5

Figure 4. Organization of nonmuscle cell stress fiber…………………...……………….6

Figure 5. Diagram of Enigma protein…………………………………..…………..…...11

Figure 6a. GST-Enigma Mid Domain Purification………………………………….…..21

Figure 6b. GST-Enigma LIM domain purification……………………………….……..22

Figure 7. GST-Enigma LIM3 purification………………………………………………22

Figure 8. Gel Image of LIM3-Kin4 interaction…………………………….……….…..24

Figure 9. Immunofluorescent localization of TKK and PDLIM7 in hMSCs…….……..26

ABBREVIATIONS

Adaptor protein with PH and SH2 domain……………………...……………………..APS

Enigma LIM domain 1……………………………………………………………….LIM1

Enigma LIM domain 2……………………………………………………………….LIM2

Enigma LIM domain 3……………………………………………………………….LIM3

Enigma Mid region ……………………………………………….……………….….MID

Human mesenchymal stem cell…………………..………………………………….hMSC

Insulin Receptor…………………………………………………….…………………InsR

Lin-11, Isl-1, Mec-3…………………………….……...……………………….....…..LIM

Oncogenic form of RTK…………………………………………….……………..Ret/ptc2

Postsynaptic density 95, Discs large, ZO-1……………………..………….…..…...... PDZ . Receptor Tyrosine Kinases…………………………………………………....………RTK

Serum Response Factor……………………………………...………….….……….....SRF

Titin Kinase Domain………………………………………...………………..…….....TKD

Yeast-2-Hybrid………………………………………………………………………..Y2H

ABSTRACT

Titin is a very large protein that contributes to sarcomere structure and mechanosensing in striated muscle. Our lab discovered isoforms of titin in nonmuscle cells (Eilersten and Keller, 1992). Nonmuscle cell titin (c-titin) contains an alpha-actinin binding Z-repeat region, a distinctly PEVK region, a myosin filament-binding region, and the kinase domain also present in striated muscle titin isoforms. In striated muscle, the titin kinase domain (TKD) functions as a mechanosensor that signals changes in gene expression through interaction with nbr1 and p62. A previous yeast two hybrid (Y2H) screen to identify proteins that interact with the TKD in nonmuscle cells revealed an interaction with the ubiquitously expressed scaffold protein Enigma/PDLIM7. Enigma/PDLIM7 consists of an N-terminal PDZ domain that binds to β-tropomyosin on actin filaments, a Mid piece, and C-terminal region containing three LIM domains. The work described here further characterizes the interaction between the TKD and Enigma/PDLIM7. Y2H analysis with cloned TKD and Enigma/PDLIM7 fragments demonstrated that a region of the Enigma/PDLIM7 Mid piece and LIM1 and LIM3 domains interact with TKD. In vitro pull-down assays with bacterially expressed protein confirmed the interaction between TKD and Enigma LIM3. Immunolocalization of the TKD and Enigma/PDLIM7 in cultured human mesenchymal stem cells containing robust stress fibers revealed that both TKD and Enigma localized along stress fibers where they could interact, but there was little direct overlap in the cells under the standard culture conditions tested. These results support the possibility that Enigma/PDLIM7 functions as a scaffold to localize the TKD near actin filaments in the cytoskeleton of nonmuscle cells.

vii

CHAPTER 1

GENERAL INTRODUCTION

Striated Muscle Titin

Striated muscle myofibers contain myofibrils composed of linearly arranged sarcomeres. The sarcomere is the functional unit of muscle contraction and where the three major filament proteins actin, myosin and titin interact. In sarcomeres thick filaments of myosin II, the molecular motor protein, and thin filaments of actin work together to drive the filament sliding that contracts muscle. The sarcomere is divided into four parts – the Z-line, I band, A-band and M-line. Actin filaments are anchored to the Z- line by interacting with the cross-linking protein α-actinin and extend into the I band. Myosin II thick filaments make up the A band and are anchored to the Z-line through titin and the M-line through an interaction with myomesin and titin. Titin is the third most abundant protein found in the sarcomere. Titin is a giant protein ranging in size from 2000 kDa to 4000 kDa depending on the muscle type. A single titin molecule is about 1 µm long and contains about 300 immunoglobulin (Ig) and fibronectin-like (Fn) domains. Each of these domains contains about 100 amino acids folded into a β-sheet sandwich. Single titin molecules span half the sarcomere, where the titin N-terminus is anchored to the Z-disc and the C-terminus anchored at the M-line (Figure 1).

Figure 1. Striated Sarcomere (Dr. F. Schoeni-Affoher, University of Fribourg, Switzerland. http://emedicine.medscape.com/article/1170911-overview#a0104)

During muscle development, titin assists in the integration of the contractile proteins actin and myosin and is thought to act as a template directing assembly of thick filaments (Whiting, A. et al. 1989). Through the direct and indirect interactions that have been discovered to date, it is clear that titin functions as a scaffold that keeps the sarcomere intact (Figure 2). Further studies into titin are now demonstrating its involvement with muscle architecture, elasticity, and signaling.

Figure 2. Titin interactome; direct (red) and indirect (yellow) interacting molecules of striated muscle titin. (Linke, W. 2008)

The Z-disk of striated muscle is one the most highly organized cellular structures. It anchors and aligns at least three major sarcomeric filament systems, including actin, titin and nebulin. Proper sorting and localization of proteins within the Z-disk region are critical for myofibril assembly, as well as for linking contractile functions of muscle sarcomeres to membrane systems. Parts of the Z-disk are also involved in signaling processes that may regulate muscle development and degradation. The titin N-terminus is anchored to the Z-disk through a series of protein-protein interactions. One is between the Z1Z2 domain of titin and telethonin. Studies show that titin interacting with telethonin is assembled into an antiparallel complex (Zou, P. et al. 2006). Downstream of the Z1Z2 region is the titin Z-repeat region that binds to α-actinin, which crosslinks titin with actin. The region of titin that spans the I-band between the Z-disc and the end of the myosin bipolar filament contains serially linked regions that confer passive elasticity in response to physiological stress (Horowits, R. et al. 1986). Passive tension in the I-band portion maintains the equidistance of the A-band between the Z-discs. The I-band region of titin is composed of tandem Ig domains, the N2-region, and a PEVK (Proline, Glutamate, Valine, Lysine) region. The Ig domain region of titin, located within the elastic section of this giant muscle protein, is responsible for the molecule’s extensibility and passive elasticity. The PEVK length in titin isoforms correlates with muscle stiffness and seems responsible for length gains at moderate sarcomere lengths where passive force increases, suggesting a role in muscle elasticity (Linke, W. 1998). The PEVK domain contains 110 to 225 exons, which encode 26 to 28 highly conserved amino acid domains, some of which are homologous to SH3 domains. The secondary and tertiary structure of the PEVK domains is not well understood. SH3-like domains are usually involved in signaling mechanisms. Based on these characteristics, it is suggested that the PEVK domain may serve as a mechanical and signaling stretch response center. The A-band region of titin is the largest with a molecular weight of 2 MDa and a length of about 0.8 µm. In the A-band, titin interacts with the thick filament lattice and with M-line proteins. The region of titin that interacts with a myosin thick filament is composed of Ig and Fn domains that are arranged as super repeats. This super-repeat

region is hypothesized to act as a molecular ruler for the myosin-II filament formation within the sarcomere. Located near the C-terminus in the M-line region of titin is a serine/threonine kinase domain (TKD). Protein kinases are enzymes that usually regulate processes or pathways via phosphorylation. Kinases transfer a phosphate from ATP to the hydroxyl group of a serine, threonine, or tyrosine of the substrate protein. Phosphorylation can either activate or inactivate various cellular processes. The activity of kinases can be regulated by interaction with specific regulatory domains or proteins. Sequence comparisons and biochemical assays showed that TKD is part of the Ca2+-calmodulin regulated serine/threonine kinase subfamily. Regulation by Ca2+-calmodulin has been found in myosin light chain kinases and twitchin kinase, an invertebrate version of titin found in invertebrate muscle. In the absence of calmodulin, the substrate-binding site is blocked by helix αR2 from the regulatory tail (Mayans, O. et al. 1998). Mayans et al. showed that the titin kinase has a dual mechanism of activation that consists of binding of Ca2+-calmodulin to the regulatory tail and phosphorylation of a tyrosine in the active site (at the 170 amino acid position of the kinase domain). When TKD is in the autoinhibited conformation, the catalytic aspartate residue at the 127 position is trapped in a hydrogen-bond network with residues arginine 129, glutamine 150 and tyrosine 170. Tyrosine 170 (Y170) is in the P +1 loop, which in other kinases is typically where the substrate binds (Figure 3). The second part of the dual regulatory mechanism involves phosphorylation at Y170, which releases the P +1 loop from the substrate-binding site allowing substrate to interact with kinase. In addition, the adjacent Y169 is set free from the αR1-helix where Ca2+- calmodulin binds.

Figure 3. Ribbon diagram of Titin Kinase Domain. Red, regulatory tail; cyan, catalytic loop; green, activation segment; magenta, P+1 loop (Mayans, O. et al. 1998).

Two models for how the TKD gets activated have been proposed, the “fall-apart” and the “loop out” models. In the ‘fall-apart’ model the regulatory tail consisting of the αR1, αR2, and the βR1 are completely released upon binding to calcium sensitive proteins, whereas in the “loop out” model the αR1 and βR1 are anchored and only the αR2 loops out. Molecular dynamics studies have shown that TKD is a stretch sensor in the sarcomere and can convert the mechanical force from contraction into a biochemical signal. Mechanical force causes a breakdown of the β-sheets of TKD, which leads to a rearrangement of the autoinhibitory tail and opening of the active site for kinase activity. Therefore the “fall-apart” model seems to fit best. There is not much known about TKD targets. One protein known to be a substrate of TKD is telethonin. Telethonin is found in adult striated muscle in the Z-disk. During myofibrillogenesis in differentiating early myocytes, TKD becomes activated by calmodulin binding and phosphorylation, and then phosphorylates the C-terminus of telethonin. It is suggested that when telethonin gets phosphorylated that it regulates myostatin (Miller, G. et al. 2003). Myostatin is a negative regulator of muscle growth; secretion of myostatin leads to decreased myoblast proliferation and differentiation. Another TKD target is in a signaling complex where TKD interacts with a zinc- finger protein nbr1. Nbr1 binds to and directs the ubiquitin-associated p62/SQSTM1 to

sarcomeres, and p62 interacts with MURF2, a ligand of the activation domain of the serum response transcription factor (SRF). Once p62 interacts with MURF2, MURF2 translocates to the cytoplasm and the SRF protein is active. However under mechanical arrest and TKD inactivity, MURF2 localizes to the nucleus and inhibits SRF activity, which reduces muscle gene expression (Lange, S. et al. 2005). Through this mechanism, it has been suggested that mechanically induced conformational changes activate TKD, which then activates nbr1. Nbr1 activation triggers events in which p62 is turned on and interacts with MURF2. MURF2 is released from SRF, which cooperates with other myogenic transcription factors to regulate heart development and postnatal hypertrophic growth.

Non-Muscle Organization

The cytoskeleton of nonmuscle cells maintains cell shape and enables cell movement. Stress fibers are organized, dynamic cytoskeletal structures that play crucial roles in cell motility and adhesion. Stress fibers are organized like sarcomeres with antiparallel actin filaments interdigitated with myosin II bipolar filaments.

Figure 4. Organization of a nonmuscle cell stress fiber (Langanger, G. 1986)

Stress Fiber formation is regulated through the GTPase protein Rho, which is stimulated by extracellular signals such as lysophosphatidic acid (LPA) (Amano, M. 1997). Rho activated kinase (ROCK) and the FH1 domain of the protein mDia are downstream effectors that induce stress fiber formation through myosin II filament formation and actin polymerization (Watanabe, N. et al. 1997). Previous work done in the Keller lab showed that titin also exists in non-muscle cells. Cellular titin (c-titin) co-localizes with myosin II filaments in stress fibers and can organize myosin II filaments in stress fiber-like arrays in vitro (Eilertsen, K. et al. 1994). I will be investigating titin involvement in non-muscle cells, particularly that of the titin kinase domain (TKD) and its potential binding partner Enigma/PDLIM7.

Cellular Titin

Cellular titin (c-titin) was discovered in the brush border cytoskeleton (Eilertsen and Keller, 1992). It was also found in stress fibers, fibroblasts and platelets. C-titin from brush borders and platelets have been shown to interact with α-actinin and arrange nonmuscle myosin II filaments into an ordered array similar to that of myosin II filaments in stress fibers (Cavnar, P. et al. 2007; Eilertsen, K. et al. 1994; Eilertsen and Keller, 1992). Full-length c-titin isoforms contain the C-terminal titin kinase domain. Cavnar investigated the possible role of c-titin kinase in regulating cytoskeletal organization. He showed that expression of c-titin kinase causes HeLa cells to round up and lose their shape. Through yeast-2-hybrid analysis, it was shown that the titin kinase interacts with Hax-1, a ubiquitous protein that associates with the F-actin binding protein cortactin (Gallagher, AR. et al. 2000) and is thought to be anti-apoptotic (Cilenti, L. 2004). The Y2H analysis also revealed c-titin kinase domain interacting with Enigma/PDLIM7.

Enigma

Enigma/PDLIM7 is a member of a family of proteins composed of a conserved PDZ and three LIM domains. The PDZ domain was discovered based on sequence homologies apparent in certain proteins: Postsynaptic density 95 (PSD-95), Discs large, and ZO-1 (Nourry, C., 2003). PDZ domains are about 90 amino acid long β-barrel structures that bind to the sequence S/T-X-V/L/I often found near the C-terminus of target proteins. The first characterization of PDZ domain binding demonstrated that the first two PDZ domains of PSD-95 bound to the C-terminal T/S-X-V motif of Shaker type K+ channels (Kim, E. 1995). Deletion of valine or mutation to alanine drastically reduced binding to the PDZ (Nourry, C. 2003). Most PDZ domain-containing proteins act as adaptors that bind receptors and serve as scaffolds for bringing together components of large protein complexes that may be used in signal transduction (Nourry, C. 2003). Several PDZ-containing proteins act as scaffolds for assembling components of signal transduction complexes at cell-cell junctions. Work done by Guy et al. showed that the PDZ domain of Enigma/PDLIM7 binds to the actin binding protein β-tropomyosin in the Z line of striated muscle (Guy, P. et al. 1999). Tropomyosin is a protein that binds actin and regulates actin interaction with myosin in order to generate force during muscle contraction. The Enigma/PDLIM7 PDZ domain binds specifically to sequence T-S-L found at the β-tropomyosin C-terminus (Guy, P. et al. 1999). Enigma/PDLIM7 also has been shown to localize to actin filaments in fibroblasts through its PDZ domain (Guy, P. et al. 1999). As a scaffold protein, Enigma/PDLIM7 could localize LIM-binding proteins close to actin filaments where those proteins could regulate or participate in actin cytoskeleton function. LIM domains, named for the homeodomain proteins in which they were discovered (Lin-11, Isl-1, and Mec-3), are cysteine-rich domains that contain about 60 amino acids and two coordinated Zn2+ ions (Guy, P. et al. 1999). Nuclear LIM domains interact with transcription factors, whereas cytoplasmic LIM domains bind to protein kinases (Wu and Gill 1994) and other cytoskeletal targets. Wu et al. showed that Enigma/PDLIM7 LIM2 binds specifically to the Ret receptor tyrosine kinase and LIM3 binds specifically to Insulin Receptor (InsR) in yeast-two-hybrid and GST pull-down

assays. Further analysis of the target sites for both LIM2 and LIM3 demonstrated that they both recognize Tyr-containing motifs located outside the tyrosine kinase core of Ret and InsR, suggesting that different LIM domains have the ability to distinguish between Tyr-based motifs. A significant binding partner of Enigma/PDLIM7 is the InsR receptor tyrosine kinase. When blood glucose levels are increased, insulin is released from pancreatic β- cells. Insulin binds to the InsR α-subunit on the exoplasmic side of the cell. This then triggers autophosphorylation of tyrosine residues on the β-subunit cytoplasmic domain. When activated, the InsR activates various proteins and pathways. Insulin receptor binding proteins contain a conserved pleckstrin homology (PH) domain at their N- terminus followed by a phosphotyrosine-binding (PTB) domain. The PTB domain interacts with phosphorylated tyrosine in the cytoplasmic part of the InsR. These proteins serve as docking molecules for various effectors such as PI3K and phosphotyrosine phosphatase 2 (Zick, Y. 2008) and activate pathways such as the PI3K and MAPK kinase pathways. The PI3K pathway triggers metabolic functions of insulin such as glucose transport, protein and glycogen synthesis. Metabolic effects of insulin that require PI3K activity include GLUT4 translocation, glucose uptake, activation of fatty acid synthase and glycogen synthase, and stimulation of amino acid transport and protein synthesis (Moodie, S.A. et al. 1999). The MAPK kinase cascade leads to enhanced cell growth. Barres, R. et al. (2005) using a yeast-two-hybrid approach showed that Enigma/PDLIM7 also interacts with APS (Adaptor protein with PH and SH2 domain) and that an intact LIM region was necessary for Enigma/PDLIM7 binding to APS. APS is an adaptor protein that is recruited by receptor tyrosine kinases (RTK), including the insulin receptor (InsR). APS belongs to a family of SH2 adaptor molecules; these scaffolding proteins share proline-rich regions, PH and SH2 domains, and a C-terminal tyrosine subject to phosphorylation. APS associates with phosphotyrosines situated within the activation loop of the insulin receptor via the SH2 domain. The Enigma/PDLIM7-APS interaction was further confirmed by co-expressing Myc-tagged APS and HA-tagged Enigma/PDLIM7 in HEK 293 cells. Immunoprecipitation of Enigma/PDLIM7 with an anti-HA antibody co-precipitated the APS (Barres, R. et al. 2005).

Barres et al. also showed that APS colocalized with actin in membrane ruffles along with a small amount of Enigma/PDLIM7. When insulin was added to the InsR, with which Enigma/PDLIM7 also interacts, co-localization of APS, actin and Enigma/PDLIM7 increased three-fold (Barres, R. et al. 2005). These findings support the idea that APS, InsR and Enigma/PDLIM7 all interact and work together in a way to promote and or stabilize actin cytoskeletal structures. This supports a model that in which Enigma/PDLIM7-APS interaction links insulin signaling to actin cytoskeleton organization. Enigma/PDLIM7 LIM2 interacts with a constitutively active, oncogenic form of the Receptor Tyrosine Kinase (Ret/ptc2) (Wu, RY. et al., 1996). Ret/ptc2 is just like other receptor tyrosine kinases in that it is activated through dimerization and phosphorylation of the cytoplasmic domains once substrate has bound to the exoplasmic domain. Ret/ptc2 is found in papillary thyroid carcinoma, like other RTKs it activates Ras and Raf for MAPK mitogenic signaling (Durick, K. et al. 1997). Enigma/PDLIM7 binds to Ret/ptc2 in a phosphorylation independent manner through the LIM2 domain of the LIM region, and is anchored to the cell’s periphery via the PDZ domain; most likely the PDZ domain is bound to the actin cytoskeleton. Shc also binds to the Ret/ptc2 tyrosine 586. However Shc has to be phosphorylated in order to induce the mitogenic signaling pathway. It seems that Enigma/PDLIM7 assists with subcellular targeting followed by phosphorylation of the tyrosine 586 on Ret/ptc2 then Shc binds triggering the mitogenic pathway. The work done by Wu showed that the interactions between the different LIM domains and their respective binding proteins were sequence specific. The common feature between the two interacting proteins is that both active InsR and Ret have autophosphorylated tyrosine residues. LIM2 recognized the amino acid sequence NKLY on Ret and LIM3 recognized the sequence GPLGPLYA on InsR. Tyrosine containing tight-turns such as the one formed by the InsR recognition sequence, are the essential structural feature of the endocytic codes of many proteins. Phosphorylated tyrosine residues in specific sequence contexts serve as recognition sites for Shc and PTB domains.

The previous discovery that the titin kinase domain interacts with Enigma/PDLIM7 led to my research described here. Additional characterization of the TKD-Enigma/PDLIM7 interaction could elucidate an unknown linkage between TKD and the actin cytoskeleton. Moreover, such a structural linkage could enable TKD to play a role in stretch sensing in nonmuscle cells. The main objective of my project was to characterize the interaction of the c-titin kinase domain and the Enigma/PDLIM7 protein. Enigma/PDLIM7 is divisible into three main regions: the PDZ, a mid piece, and the three LIM domains. The clone of Enigma/PDLIM7 that was found with the original c-titin kinase domain yeast-two-hybrid screen lacked the PDZ. Based on literature research and my current results, the LIM domain and mid piece of Enigma/PDLIM7 interacts with the c-titin kinase domain. Not much is known about the mid piece, but because it shows strong interaction with TKD, this may suggest it is necessary in order to aid the localization of the LIM region closer to the titin kinase. For this project, I used the yeast-two-hybrid approach along with other protein- protein interaction analysis to investigate the interaction between TKD and each of these regions of Enigma/PDLIM7. I also used immunofluorescence colocalization studies to investigate the interaction between titin kinase and Enigma/PDLIM7 in non-muscle cells.

Mid

PDZ LIM LIM LIM

Figure 5. Diagram of Enigma/PDLIM7 protein.

CHAPTER 2

MATERIALS AND METHODS

Yeast-2-Hybrid Vector Preparation

Cellular titin kinase fragment Kin4 was cloned by RT-PCR from total RNA isolated from the megakaryocyte cell line CHRF-288-11 using primers against amino acids 24705-25005 of cardiac titin EMBL accession number X90568 (Cavnar, P. et al. 2007). The Kin4 construct was cloned into the pGBKT7 BD (Clontech) using the BamH1/EcoR1 sites (BamH1: 5’-GCGGGATCCCGTGCTGGAGAGCCTCCGATGCT- 3’, EcoR1: 5’- GGGAATTCGTAGATGAAACCAGGGAAGTCTCCATGACTAAA-3’). The vector was first transformed into E. Coli where the DNA was amplified and isolated using a miniprep kit (Qiagen). The vector was transformed into the Saccharomyces cerevisiae strain AH109 using the lithium acetate based transformation method and grown in synthetic medium lacking tryptophan. One CFU was picked and grown in 5 ml of liquid -Trp media. Two mls were frozen in 80% glycerol to make a stock. DNA was isolated from the remaining 3ml of yeast culture using a modified Qiagen miniprep protocol, using lyticase to degrade yeast cell walls to make protoplasts. Fragments of Enigma/PDLIM7, specifically the mid region, the LIM region, and the individual LIM domains (LIM1, LIM2, and LIM3) were PCR-amplified using the primers in Table 1. The PCR was done for 30 cycles under the following conditions: 95°C for 30 seconds, 65°C for 45 seconds, 72°C for 2 minutes. Enigma/PDLIM7 fragments were cloned into the pGAD-GH GAL4 activation domain vector (Clontech) also using the BamH1/EcoR1 sites, transformed into AH109 yeast and grown in media lacking leucine. Yeast glycerol stocks and isolated vector DNA were prepared as described previously.

Y2H Screening

For Y2H screening, the Kin4-BD yeast that was selected from the –Trp plate was transformed with the Mid-AD, LIM-AD, LIM1-AD, LIM2-AD, and LIM3-AD respectively. Initially the transformants were screened on plates lacking leucine and tryptophan and incubated for 4 – 5 days at 30°C to obtain yeast that had both vectors. The positive colonies of the various combinations of Enigma/PDLIM7 with Kin4 were then streaked onto selective plates: –Leu/-Trp/-His and –Leu/-Trp/-His/-Ade. Growth on these plates indicated interaction between Kin4 and the region of Enigma/PDLIM7. Positive clones were grown in liquid media lacking leucine, tryptophan, histidine and adenine. The AD vector DNA was isolated using the modified miniprep protocol (Qiagen) as previously described. The DNA was then transformed into Escherichia coli strain DH5α and the bacteria containing the pGAD-GH vector were selected using ampicillin resistance. Plasmid DNA was isolated from E. coli colonies, analyzed by PCR using the primers found in Table 1 and sequenced using the T7 terminator sequencing primer.

Table 1. Primers for yeast vector pGAD‐GH

Primers for Yeast Vector pGAD-GH Mid BamH1-R Mid EcoR1-F 5’– GAG CTA ATG GAT CCT CAG ACC 5’– AGG CCA GTG AAT TCC TTG CCC TTG TGG CAC TGG TGA CAC ACG –3’ ACC TCA CAG GCA –3’ LIM 1 R BamH1 LIM 1 F EcoR1 5’- CGA TGG ATC CCT ACT GCA RAG 5’- GCC AGT GAA TTC GGC AAG ACT CGC ACG TCA –3’ CCC GTG TGT CAC C-3’ LIM II R BamH1 LIM II F EcoR1 5’- CGA TGG ATC CCT ACA TGG CAT 5’-GCC AGT GAA TTC CGC TAT GCA TTC GTG CCA A –3’ CCC AGC TGT GCC-3’ LIM III R BamH1 LIM III F EcoR1 5’-AGC TCG ATG GAT CCT CAC ACA 5’-AGG CCA GTG AAT TCG AGA AGA TGA GAG AAG GCA TGG CTC-3’ TGT TTG GCA CGA AAT GC-3’

Protein Expression and Purification

Kin4 was cloned into the pMAL expression vector (Clontech) containing the Maltose Binding protein tag (MBP) and expressed in E. coli. PCR-amplified Kin4 cDNA (Kin4 PCR primers; XbaI: 5’- GCGCGGTCTAGAGTAGATGAAACCAGGGAAGTCTCCATG-3’, HindIII: 5’- GGGAAGCTTTAGCGATGCTGTCATGCGAGATTTCCTCTG-3’), and pMAL vector were both digested with Xbal and HindIII, gel purified, and ligated together. The ligated Kin4-pMAL vector was transformed into BL21 competent cells and plated on LB media with ampicillin. For Kin4-MBP expression, a starter culture of 25mls LB/Amp was grown overnight at 37oC. The starter was then diluted into 300mls of LB/Amp and shaken for 5 hours at 37oC until an O.D. of 0.6 to 1.0 was reached. The Kin4-MBP expression was induced by addition of 300μl of IPTG and incubated at room temperature for 12 hours. The expressed MBP-fusion protein was purified using a pMAL protein

Fusion and Purification System (New England BioLabs). Two mls of amylose resin, sufficient to bind 6 mg of fusion protein, in a 2.5 X 10 cm column was used to purify the Kin4-MBP fusion protein from the cell lysates. After loading, the column was washed with 12 volumes of column buffer (20mM Tris-Cl, 200mM NaCl and 1mM EDTA). Kin4-MBP bound to the column was eluted with column buffer containing 10mM maltose. Enigma/PDLIM7 protein fragments (Mid-AD and LIM3-AD) that were amplified with the primers in Table 2 and cloned into pET-41a vector using EcoR1/BamH1 cut sites (thanks to the Molecular Cloning Facility at FSU). The Enigma/PDLIM7 Mid piece and LIM3 proteins were first expressed on a small scale to determine optimal expression conditions. Clones from the transformed BL21 cells were grown in 8 – 10ml of LB media with kanamycin at 37oC overnight. This starter culture was added to 300ml of LB with kanamycin and grown until an O.D. of 0.6 – 1.0 was reached and 300μl of IPTG was added to induce expression. The culture was shaken at 30°C and 1ml samples were taken every 2 hours for 10 hours. Samples were pelleted and solubilized in Laemmli sample buffer (SDS, 2-Mercaptoethanol, Bromophenol Blue, 1M Tris-Cl pH 6.8) and analyzed by SDS-PAGE. For both the Mid piece and LIM3 proteins, optimal expression conditions were 8 hours post induction at 30°C or 12 to 16 hours at room temperature post induction. The LIM region required induction for over 24 hours at room temperature. The bacteria were centrifuged for 15 minutes at 8200 rpm in 4°C (GSA rotor). The pellets were washed with about 100mls of 1X PBS and centrifuged for another 15 minutes. Pellets were either stored at -20°C or resuspended in Lysis buffer (1X PBS, 1% Triton X) and sonicated with Ultrasonic Processor Do Heat Systems for 7 cycles at 15 seconds each. The sonicated bacterial preparation was centrifuged at 14,400 rpm for 38 minutes (SS34 rotor) at 4°C and the supernatant recovered. The expressed GST-fusion proteins in the bacterial lysates were purified using a Pierce GST Fusion Protein Purification Kit (according to manufacturer's recommendations). The supernatant was loaded onto a GST-agarose column. The column was washed with 10mls of 1X PBS. The GST-fusion protein was eluted off the column using elution buffer (50 mM Tris-Cl, pH 8.0 containing 10 mM reduced glutathione) that binds competitively to the column. Samples from the eluent were

analyzed by SDS-PAGE. The Mid region of Enigma/PDLIM7 is 46 kDa (including the GST-tag) and the LIM region is 47 kDa (including GST-tag). The purified Kin4 and Lim3 fragments were used for a pull down assay to confirm the interactions that were originally found by Y2H analysis. In order to further purify the proteins to ensure their quality for the pull-down. They were concentrated using a Centricon centrifugal filter device (Millipore). After seeing which fractions of the eluents yielded the most protein, they were pooled together and then centrifuged through the filter device for 30 minutes at 3400 rpms.

Table 2. Primers for pET41a Protein expression vector.

Primers for pET41a Expression Vector Mid Bam H1pET-F Mid Eco R1pET-R 5’GTGCTAGGATCCCTTGCCCACCTCACA 5’AGGCCAGTGAATTCCACGGGAGTC GGCACC-3’ TTGCC-3’ Lim Bam H1pET-F Lim Eco R1pET-R 5’GAGCTAGGATCCCCCGTGTGTCACCAGTGCC- 5’-AGGCCAGTGAATTCCACA 3’ TGAGAGAAGGC-3’ Lim3 Bam H1pET-F 5’GAGCTAAGGATCCGGCACGAAATGCCATGGC- 3’

Table 3. Sequences of Enigma/PDLIM7 that were cloned for both Y2H and Protein expression.

Cloned Enigma Sequences MID region CTTGCCCACCTCACAGGCACCGAGTTCATGCAAGACCCGGATGAGGAGCACCTGAAGAAATCAAG CCAGGTGCCCAGGACAGAAGCCCCAGCCCCAGCCTCATCTACACCCCAGGAGCCCTGGCCTGGCC CTACCGCCCCCAGCCCTACCAGCCGCCCGCCCTGGGCTGTGGACCCTGCGTTTGCCGAGCGCTAT GCCCCGGACAAAACGAGCACAGTGCTGACCCGGCACAGCCAGCCAGCCACGCCCACGCCGCTGCA GAGCCGCACCTCCATTGTGCAGGCAGCTGCCGGAGGGGTGCCAGGAGGGGGCAGCAACAACGGCA AGACTCCCGT LIM1 Domain TGTCACCAGTGCCACAAGGTCATCCGGGGCCGCTACCTGGTGGCGCTGGGCCACGCGTACCACCC GGAGGAGTTTGTGTGTAGCCAGTGTGGGAAGGTCCTGGAAGAGGGTGGCTTCTTTGAGGAGAAGG GCGCCATCTTCTGCCCACCATGCTATGACGTGCGCTATGCA LIM2 Domain CCCAGCTGTGCCAAGTGCAAGAAGAAGATTACAGGCGAGATCATGCACGCCCTGAAGATGACCTG GCACGTGCACTGCTTTACCTGTGCTGCCTGCAAGACGCCCATCCGGAACAGGGCCTTCTACATGG AGGAGGGCGTGCCCTATTGCGAGCGAGACTATGAGAAGATGTTTGGC LIM3 Domain ACGAAATGCCATGGCTGTGACTTCAAGATCGACGCTGGGGACCGCTTCCTGGAGGCCCTGGGCTT CAGCTGGCATGACACCTGCTTCGTCTGTGCGATATGTCAGATCAACCTGGAAGGAAAGACCTTCT ACTCCAAGAAGGACAGGCCTCTCTGCAAGAGCCATGCCTTCTCTCATGTGTGA

Pull – Down Assay

For this in vitro assay, the Kin4 was purified and immobilized on Amylose beads as described above. The purified GST-Enigma/PDLIM7 fragments described above were dialyzed into binding buffer (25mM KCl, 10mM Imidazole, 1mM MgCl2, and 0.1mM EDTA) and concentrated. The pull-down assay used is a modified version of the Pierce protocol. In the assay, we used 60µl of amylose beads pelleted in a 1.5ml eppendorf tube instead of the spin columns. The beads were washed 5 times with a modified wash buffer

(50mM KCl, 10mM Imidazole, 1mM MgCl2, 0.1mM EDTA and 0.1% Triton-X 100, pH 7.0). Then 300µl of the Kin4-MBP protein was added to the beads. The tubes were rotated at 4oC for 12 hours and centrifuged for 2 minutes at 14,000 rpm. The beads were washed twice and 300µl of the GST-LIM3 was added. The tubes were rotated at 4o C for another 12 hours. The tubes were centrifuged for 2 minutes and a 30µl sample of the supernatant was obtained for analysis. Beads were washed once more with 100µl of

MBP wash buffer. The beads were resuspended in an elution buffer with maltose (1M Tris-Cl, 200mM NaCl, 0.5M EDTA, and 10.5mM Maltose) to elute the Kin4-MBP and bound GST-Enigma/PDLIM7 fragment. The beads were pelleted and the supernatant was analyzed by SDS-PAGE on a 12% acrylamide gel.

Immunofluorescence

HMSCs were cultured to 50-60% confluence in T225 culture flasks in α-MEM medium (Sigma-Aldrich) with added NaHCO3 (2.2mg/L) and 16.5% FBS (Atlanta Biological) . The cells were removed from the culture flask with TrypLE and seeded onto coverslip in 6 well plates at a density of 3x105cells/well. For immunofluorescence, the culture medium was aspirated from the wells and the coverslips were washed with PBS twice for 5 min. The hMSCs were then fixed with paraformaldehyde in CBS

(10mM MES, 138mM KCl, 3mM MgCl2, 2mM EGTA, pH 6.1) for 20min, washed with PBS twice for 5 min, and incubated with 0.2% Triton-x-100 (Tx-100) in PBS with gentle shaking for 10 min. The coverslips were washed twice with 0.05% Tx-100 in PBS for 5 min and incubated with 10% goat serum to prevent non-specific binding at 37oC for 1 hour before addition of a mouse monoclonal anti-Enigma/PDLIM7 primary antibody (Abnova) at a dilution of 1:50 in 1% goat serum in 0.05% Tx-100 in PBS and incubation at 37oC for 2 hours. Excess primary antibody was removed by washing with 1% goat serum for 10 min. An Alexa fluor 488-labeled goat anti-mouse fluorescent secondary antibody () was added at a 1:300 dilution in 1%goat serum in 0.05% Tx-100 in PBS and incubated at 37oC for 1 hour. The cells were washed with 1% goat serum in 0.05%Tx- 100 in PBS for 10 min before addition of a 1:150 dilution 1% goat serum in 0.05%Tx- 100 in PBS of the rabbit polyclonal anti-titin kinase domain TKK antibody (raised in the T Keller lab; Cavnar, P. et al. 2007). Cells were incubated at 37oC for two hours in the primary antibody and washed for 10 min as described above. A goat anti-rabbit Alexa fluor 568-labeled secondary antibody was added at a 1:300 dilution in 1% goat serum in 0.05% Tx-100 in PBS and incubated at 37oC for 1 hour. Cells were washed sequentially with 0.05% Tx-100 in PBS for 5 min, twice with PBS for 5 min, and finally with distilled

water twice. The coverslips were mounted onto slides using Prolong with DAPI. The slides were air dried for 24 hours and images were obtained with Nikon Microscope.

CHAPTER 3

RESULTS

Identification of Enigma Domains that Bind Cellular Titin Kinase

A previous yeast-two-hybrid screen using the Kin4 construct of the TKD to screen a HeLa cDNA library yielded 400 positive colonies. Of the 33 colonies analyzed further, one contained a prey vector with an insert sequence that encoded part of the Enigma/PDLIM7 protein. Most of the other colonies contained several different constructs of Hax1, characterization of which is described elsewhere (A. Felix, PhD Dissertation, FSU, 2011). Enigma/PDLIM7 is a protein that contains an N-terminal PDZ domain, a mid piece and three C-terminal LIM domains. The Enigma/PDLIM7 clone recovered in the Y2H screen encoded approximately half the mid piece and the three LIM domains. Y2H analysis with the Kin4 construct in the bait vector and fragments of Enigma/PDLIM7 in the prey vector was used to establish the regions of Enigma/PDLIM7 that bind to Kin4. Yeast colonies were initially screened on plates lacking both leucine and tryptophan to obtain surviving yeast that contained both vectors. Clones from the –Leu/-Trp plate were then screened for Kin4-Enigma/PDLIM7 fragment interaction on –Leu/-Trp/-His and – Leu/-Trp/-His/-Ade agar plates and in liquid media. The results obtained with the Kin4- BD and Enigma-AD constructs are indicated in Table 4. Column 1 of Table 4 lists the specific Enigma/PDLIM7 fragments tested for binding to Kin4. Column 2 illustrates growth of the yeast on –Leu/-Trp/-His/-Ade plates. Growth that occurred was given a score of four pluses, where there was no growth a score of four minuses was given.

Table 4. Table of Y2H results, including amino acid sequences that were tested for interaction with Kin4.

Y2H Assay Y2H Result Score Enigma Fragments PRTEAPAPASSTPQEPWPGPTAPSPTSR PPWAVDPAFAERYAPDKTSTVLTRHSQP Mid-AD/Kin4-BD ++++ ATPTPLQSRTSIVQAAAGGVPGGGSNNG KTP CHQCHKVIRGRYLVALGHAYHPEEFVCS QCKVLEEGGFFEEKGAIFCPPCYDVRYA PSCAKCKKKITGEIMHALKMTWHVHCFT LIM-AD/Kin4-BD ++++ CAACKTPIRNRAFYMEEGVPYCERDYEK MGFTKCHGCDFKIDAGDRFLEALGFSWH DTCFVCAICQINLEGKTFYSKKDRPLCK SHAFSHV

CHQCHKVIRGRYLVALGHAYHPEEFVCS LIM1-AD/Kin4-BD ++++ QCKVL

CAKCKKKITGEIMHALKMTWHVHCFTCA LIM2-AD/Kin4-BD ---- ACKTPI

CHGCDFKIDAGDRFLEALGFSWHDTCFV LIM3-AD/Kin4-BD ++++ CAICQINL

Yeast containing the Enigma/PDLIM7 Mid-AD and Kin4-BD vectors grew well on the plates. The yeast containing the entire LIM region also grew well. When the LIM domains were tested individually for interaction with Kin4. LIM1 and LIM3 showed strong interactions but LIM2 had no growth.

Protein Expression and Pull-Down Assay

In order to confirm interaction between TKD and Enigma/PDLIM7 fragments the proteins were cloned into pMAL (MBP) and pET41a (GST) expression vectors respectively. The Kin4 TKD fragment was expressed as an MBP-fusion protein and purified by Amylose resin column chromatography. Enigma/PDLIM7 fragments were expressed as GST-fusion proteins and purified by Glutathione column chromatography. Figures 6a, 6b and 7 show SDS-PAGE of fractions obtained during the expression and purification of the Mid, LIM and LIM3 Enigma/PDLIM7 fragments. The elution fractions from the three Glutathione columns contained proteins that migrated at the rate expected for the predicted molecular weight of the expressed GST-Enigma/PDLIM7 fragments. These fractions also contained several unidentified bands. These bands could be proteolytic breakdown products of the GST-fusion proteins or they could be bacterial proteins that failed to elute in the wash steps and contaminated the elution fractions; the pattern of these bands in the 20-30 kDa range looks somewhat similar in all three sets of elution samples.

1 2 3 4 5 6 7

175 kDa

80 kDa 58 kDa

46 kDa ‐ MID

30 kDa

23 kDa 17 kDa

Figure 6a. GST-Enigma/PDLIM7 Mid Domain Expression and Purification. 1: ladder, 2: Flow through, 3: Wash, 4: Elution 1, 5-7: Elution fractions 3, 5, and 7.

1 2 3 4 5 6 7 8 9 10

175 kDa

80 kDa 58 kDa

46 kDa ‐ LIM

30 kDa

Figure 6b. GST‐Enigma LIM domain purification. 1: Ladder, 2: Lysate, 3: Flow through 1, 4: Flow through 2, 5: Wash, 6‐10: Elution fractions 1, 3, 5, 7, 9

1 2 3 4 5 6 7 8 250 kDa 150 kDa

100 kDa 75 kDa

50 kDa LM

37 kDa

25 kDa ‐ LIM3

Figure 7. LIM3 purification. 1: Ladder, 2: Flow through, 3: Wash, 4‐8: Elution fractions 1, 3, 5, 7, 9

These GST-Enigma/PDLIM7 fusion proteins were tested for binding to MBP- Kin4 (approximately 75 kDa MW) in vitro using a pull-down assay. MBP-Kin4 immobilized on Amylose beads was incubated with an excess of each of the GST- Enigma/PDLIM7 fusion proteins. Only the Enigma/PDLIM7 LIM3 fragment showed evidence of binding in this assay and is shown here in Figure 8. The excess of GST- LIM3 that did not bind to the Kin4 beads was found in the supernatant and wash fractions. Elution of the MBP-Kin4 from the final washed pelleted beads co-eluted GST-LIM3, indicating that the LIM3 bound to the Kin4. The two additional bands between the MBP-Kin4 and GST-LIM3 bands in the fraction are most likely proteolytic breakdown products of the MBP-Kin4, because they resemble bands sometimes found in MBP-Kin4 eluted from Amylose beads shown in the Kin4 lane. Technical difficulties in obtaining sufficient amounts of the MBP-Kin4 and the other GST-Enigma fragments prevented obtaining definitive results for in vitro binding of the Mid-piece and LIM1 regions to the MBP-Kin4 (results not shown).

2 4 Kin4 1 3

250 kDa 150 kDa

100 kDa

75 kDa ‐ Kin4

50 kDa

37 kDa

25 kDa ‐ LIM3

Figure 8. Gel Image of LIM3/Kin4 interaction. 1: Ladder, 2: Supernatant, 3: Wash with LIM3, 4: Pellet with Kin4 and LIM3. The gel image on the right is of Kin4-MBP eluted from amylose beads showing contaminating breakdown product bands that are similar to those in Lane 4.

Immunofluorescence of TKD and Enigma/PDLIM7

Human mesenchymal stem cells (HMCS) produce fairly robust stress fibers, which can be used to assay for colocalization of the TKD and Enigma/PDLIM7 in the cytoskeletal structure. TKD was immunofluorescently localized using a rabbit polyclonal antibody named TKK developed in the lab and an anti-rabbit secondary antibody fluorescently labeled with Alexa Fluor 568 (red). Enigma/PDLIM7 was localized with a commercially available anti-PDLIM7 antibody and an Alexa Fluor 488-labeled anti- mouse secondary antibody (green). Figure 9 shows that both the TKD and Enigma/PDLIM7 localize along stress fibers. The merged image, however, showed little direct overlap of the staining patterns in the stress fibers. This suggests that

Enigma/PDLIM7 may interact with the closely localized titin kinase domain under certain cellular conditions, for example when the TKD is active. This interaction with the Enigma/PDLIM7 scaffold protein could position the active titin kinase domain to target specific actin cytoskeleton-associated substrates.

Figure 9. Immunofluorescent localization of TKD with the rabbit TKK anti‐TKD antibody (red) and Enigma/PDLIM7 with a mouse monoclonal anti‐PDLIM7 (green) in cultured hMSC cells. The merged images are overlays of the TKK and PDLIM7 images. The boxed areas 1 and 2 are enlarged in the lower set of images.

CHAPTER 4

DISCUSSION

C-titins from brush borders and platelets interact with α-actinin and arrange nonmuscle myosin II filaments into an ordered array similar to that of myosin II filaments in stress fibers (Cavnar, P. et al. 2007; Eilertsen et al., 1994; Eilertsen and Keller, 1992). Full-length c-titin isoforms contain the C-terminal titin kinase domain. TKD is part of the myosin light chain kinase family and has a dual mechanism of activation that consists of binding of Ca2+-calmodulin to the regulatory tail or stretch activation and phosphorylation of a tyrosine in the active site (at the 170 amino acid position of the kinase domain). The TKD is involved in sarcomeric signaling and gene regulation during skeletal muscle contraction. The elasticity of titin and the mechanical deformation of the M-line during muscle contraction suggest that the signaling properties of TKD can be controlled by mechanically induced changes (Lange, S. et al. 2005). Lange showed that in the activated state, TKD interacts with nbr1, a zinc-finger protein that binds to and recruits the ubiquitin-associated p62/SQSTM1 to sarcomeres. The p62 then recruits and binds MURF2, a ligand of the activation domain of the serum response transcription factor (SRF). MURF2 binding in sarcomeres frees SRF to activate muscle gene activity in the nucleus. Under conditions in which TK is inactive, such as in a prolonged state of relaxation, MURF2 localizes in the nucleus where it inhibits SRF activation of muscle gene activity. Although stress fibers in nonmuscle cells are organized like sarcomeres, with antiparallel actin filaments interdigitated with myosin II bipolar filaments, there is no distinct sarcomere-like M-line in stress fibers, and therefore TKD may project from the stress fiber in random positions. In fact, TKD has been shown to localize in a punctate pattern loosely associated with actin filaments of stress fibers (Cavnar, P. 2008). TKD kinase activity or binding to other proteins may regulate stability of stress fibers as in skeletal

muscle. Cavnar showed that overexpression of TKD results in the breakdown of stress fibers in epithelial cells (Cavnar, unpublished observations). This project confirmed Enigma/PDLIM7 as a potential binding partner of the cellular titin kinase domain and characterized the interaction further by identifying the regions of Enigma/PDLIM7 that specifically interact with TKD. Enigma/PDLIM7 is a member of a family of proteins composed of a conserved PDZ domain and three LIM domains. LIM domains contain about 60 amino acids organized into two cysteine-rich Zn2+ fingers each of which have a coordinated Zn2+ ion (Guy, P. et al. 1999). Cytoplasmic protein LIM domains bind to protein kinases and other cytoskeletal targets (Wu and Gill, 1994). Wu et al. showed that the Enigma/PDLIM7 LIM2 binds specifically to the Ret receptor tyrosine kinase and the LIM3 binds specifically to Insulin Receptor (InsR) in yeast two-hybrid and GST pull-down assays. Enigma/PDLIM7 LIM2 and LIM3 are similar in overall structure (two Zn2 fingers) and both bind to Tyr-based motifs; LIM2 binds to NKLY on the Ret receptor and LIM3 binds to GPLGPLYA on InsR receptors. Tyrosine-based motifs serve many functions; they are an essential structure of the endocytic codes of many proteins. Enigma/PDLIM7 was shown to bind to the Tyr 586 of Ret/ptc2, which helps to localize Ret/ptc2 into position for mitogenic signaling (Durick, K. et al. 1997). The GPLY motif of the InsR forms a Tyrosine tight turn that is recognized by LIM3 and contributes to the signaling properties of InsR. For example, after insulin binds to the InsR this triggers a kinase cascade that leads to the activation of the PI3K pathway. This particular PI3K pathway activated by InsR contributes to protein and glycogen synthase as well as to increasing the uptake of glucose by translocating the Glut4 transporter to the plasma membrane (Moodie, SA. et al. 1999). In the work described in this thesis, Y2H analysis was used to identify the specific Enigma/PDLIM7 regions that interact with the Kin4 construct of the TKD. For the Y2H analysis, Kin4, a TKD construct lacking the regulatory tail was fused with the GAL4- DNA binding domain in a pGBKT7 vector. The Enigma/PDLIM7 regions were cloned and fused with the GAL4 activation domain in a pGAD-GH vector. Colonies that grew on –Leu/-Tris/-His/-Ade plates indicated interaction of the Enigma/PDLIM7 region with Kin4 (Table 4). The analysis revealed strong Kin4 interaction with LIM3, a weaker

interaction with LIM1, and no interaction with LIM2. Surprisingly, Kin4 also interacted strongly with the Enigma/PDLIM7 Mid region construct in the Y2H analysis. The function of the Enigma/PDLIM7 Mid region, other than possibly just a spacer region between the PDZ domain and the LIM regions, is completely unknown. Pull-down assay using bacterially expressed Kin4 and Enigma/PDLIM7 Mid region, LIM region, and LIM3 domain protein fragments was used to confirm some of the Y2H binding results. Although technical problems with expressing the fusion proteins in bacteria prevented obtaining conclusive results with the Enigma/PDLIM7 Mid piece and LIM1 domains, GST-LIM3 appeared to bind to the MBP-Kin4 in the pull- down assay (Figure 8). This binding of Enigma/PDLIM7 LIM3 with the TKD Kin4 in the pull-down assay is consistent with the Y2H results also showing this interaction. Both the Y2H assay and the pull-down assay with expressed proteins demonstrate the Enigma/PDLIM7 may bind to the TKD in cells. To investigate where this interaction occurs in cells, both proteins were immunofluorescently localized in cultured human mesenchymal stem cells, which assemble robust stress fibers in culture. The immunolocalization results indicate that both proteins localize in or close to the stress fibers. Although there was little direct overlap of the immunofluorescent signals, the degree of colocalization found between Enigma/PDLIM7 and TKD is similar to that found between Kin4 and Hax-1, another TKD-binding protein found in our lab (A. Felix, unpublished observation). The work done here characterized the interaction between Enigma/PDLIM7 and Kin4. We have demonstrated that the Enigma/PDLIM7 Mid, LIM, LIM1 and LIM3 domains bind to Kin4, at least under the Y2H assay conditions. Based on the scaffolding role of Enigma/PDLIM7 in other cell systems, it can be hypothesized that it acts as a scaffold protein that anchors and/or localizes TKD close to its subcellular targets. At this point, only one phosphorylation target in non-muscle cells, Hax-1, is known. This positioning of TKD by Enigma/PDLIM7 may then enable TKD to phosphorylate Hax-1 and other potential targets yet to be discovered. Another interesting possibility is that interaction with Enigma/PDLIM7 plays a role in mechanoactivation of TKD activity. No distinct sarcomere-like M-line structure has been recognized in stress fibers, but anchorage of the Enigma/PDLIM7 Mid and LIM

region to the TKD and the PDZ to an actin filament could provide tension sufficient to activate the TKD activity as the actin filament slides along the myosin filament to which the c-titin is attached. This type of mechanism could contribute to the well-established property of mechanosensing exhibited by stress fibers in cells. More work can be done to enhance our understanding of the Enigma/PDLIM7- TKD interaction. Finer mapping of the Mid and LIM domain Kin4-binding sites should reveal a common structural feature of the domains or it might confirm that the interactions of TKD with the Enigma/PDLIM7 Mid and LIM domains is cooperative or independent of each other. Kin4 can be split into a β-sheet cap region (cloned previously in the lab as Kin4.1) and the core of the catalytic domain (cloned previously as Kin4.2), in order to determine whether the Mid and LIM1 or 3 domain regions of Enigma/PDLIM7 bind to a specific Kin4 region. It also would be important to determine whether Kin4 can phosphorylate Enigma/PDLIM7, possibly regulating Enigma/PDLIM7 activity or interaction with other proteins. Finally, further screening of potential interacting partners of both TKD and Enigma/PDLIM7 might lead to identifying a role for Enigma/PDLIM7 in forming a TKD-regulated signalosome in nonmuscle cells.

REFERENCE LIST

Amano, M., Chihara, K., Kimura, K., Fukata, Y., Nakamura, N., Matsuura, Y., & Kaibuchi, K. (1997). Formation of actin stress fibers and focal adhesions enhanced by rho-kinase. Science, 275(5304), pp. 1308-1311.

Arber, S. (1998). Regulation of actin dynamics through phosphorylation of cofilin by LIM-kinase. Nature, 393, 805-809.

Arber, S., & Caroni, P. (1996). Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ. Genes & Development, 10(3), 289-300.

Barres, R., Gremeaux, T., Gual, P., Gonzalez, T., Gugenheim, J., Tran, A., . . . Tanti, J. (2006). Enigma interacts with adaptor protein with PH and SH2 domains to control insulin-induced actin cytoskeleton remodeling and glucose transporter 4 translocation. Molecular Endocrinology, 20(11), 2864-2875.

Bauer, K., Kratzer, M., Otte, M., de Quintana, K. L., Hagmann, J., Arnold, G. J., Siess, W. (2000). Human CLP36, a PDZ-domain and LIM-domain protein, binds to α-actinin-1 and associates with actin filaments and stress fibers in activated platelets and endothelial cells. Blood, 96(13), 4236-4245.

Carrier, L., Bonne, G., & Schwartz, K. (1998). Cardiac myosin-binding protein C and hypertrophic cardiomyopathy. Trends in Cardiovascular Medicine, 8(4), 151-157.

Cavnar, J. Peter, Olenych, G., Scott, Keller III, T.C.S. (2007). Molecular idntificaiton and localization of cellular titin, a novel titin isoform in the fibroblast stress fiber. Cell Motility and the Cytoskeleton, 64(6), 418-433.

Chi, R. J., Olenych, S. G., Kim, K., & Keller III, T. C. S. (2005). Smooth muscle α- actinin interaction with smitin. The International Journal of Biochemistry & Cell Biology, 37(7), 1470-1482.

Cilenti, L. (2004). Regulation of HAX-1 anti-apoptotic protein by Omi/HtrA2 protease during cell death. The Journal of Biological Chemistry, 279(48), 50295.

Deane, J.,E., Ryan, D.,P., Sunde, ,Margaret, Maher, M.,J., Guss, ,J.Mitchell, Visvader, J.,E., & Matthews, J.,M. (2004). Tandem LIM domains provide synergistic binding in the LMO4:Ldb1 complex. The EMBO Journal, 23, 3589-3598.

Eilertsen, K. J. (1994). Cellular titin localization in stress fibers and interaction with myosin II filaments in vitro. The Journal of Cell Biology, 126(5), 1201.

Gallagher, A. R., Cedzich, A., Gretz, N., Somlo, S., & Witzgall, R. (2000). The polycystic kidney disease protein PKD2 interacts with hax-1, a protein associated with the actin cytoskeleton. Proceedings of the National Academy of Sciences, 97(8), 4017- 4022.

Gautel, M. (2010). The sarcomeric cytoskeleton: Who picks up the strain? Current Opinion in Cell Biology,

Gill, G. N. (1995). The enigma of LIM domains. Structure, 3(12), 1285-1289.

Greene, D. N., Garcia, T., Sutton, R. B., Gernert, K. M., Benian, G. M., & Oberhauser, A. F. (2008). Single-molecule force spectroscopy reveals a stepwise unfolding of caenorhabditis elegans giant protein kinase domains. Biophysical Journal, 95(3), 1360- 1370.

Guy, P. M. (1999). The PDZ domain of the LIM protein enigma binds to beta- tropomyosin. Molecular Biology of the Cell, 10(6), 1973.

Horowits, R. (1986). A physiological role for titin and nebulin in skeletal muscle. Nature, 323(6084), 160.

Hoshijima, M. (2006). Mechanical stress-strain sensors embedded in cardiac cytoskeleton: Z disk, titin, and associated structures. American Journal of Physiology.Heart and Circulatory Physiology, 290(4), H1313-25.

Kadrmas, J.,L., & Beckerle, M.,C. (2004). The LIM domain: From the cytoskeleton to the nucleus. Nature Reviews Molecular Cell Biology, 5, 920-931.

Kim, ,Eunjoon, Niethammer, ,Martin, Rothschild, ,Adam, Nung Jan, ,Yuh, & Sheng, ,Morgan. (1995). Clustering of shaker-type K+ channels by interaction with a family of membrane-associated guanylate kinases. Nature, 378, 85-88.

Krcmery, J., Camarata, T., Kulisz, A., & Simon, H. (2010). Nucleocytoplasmic functions of the PDZ-LIM protein family: New insights into organ development. BioEssays, 32(2), 100-108.

Langanger, G. (1986). The molecular organization of myosin in stress fibers of cultured cells. The Journal of Cell Biology, 102(1), 200.

Lange, S., Xiang, F., Yakovenko, A., Vihola, A., Hackman, P., Rostkova, E., Gautel, M. (2005). The kinase domain of titin controls muscle gene expression and protein turnover. Science, 308(5728, Women's Health), pp. 1599-1603.

Linke, W.A., Ivemeyer, M., Mundel, P., Stockmeier, M.R., Kolmerer, B. (1998). Nature of PEVK-titin elasticity in skeletal muscle. Proceedings of the National Academy of Sciences 95(14), 8052-8057.

Linke, W. A. (2008). Sense and stretchability: The role of titin and titin-associated proteins in myocardial stress-sensing and mechanical dysfunction. Cardiovascular Research, 77(4), 637-648.

Mayans, O. (1998). Structural basis for activation of the titin kinase domain during myofibrillogenesis. Nature, 395(6705), 863.

Miller, G. (2003). A targeted deletion of the C-terminal end of titin, including the titin kinase domain, impairs myofibrillogenesis. Journal of Cell Science, 116(23), 4811.

Moodie, S. A., Alleman-Sposeto, J., & Gustafson, T. A. (1999). Identification of the APS protein as a novel insulin receptor substrate. Journal of Biological Chemistry, 274(16), 11186-11193.

Narumiya, S. (1997). Rho effectors and reorganization of actin cytoskeleton. FEBS Letters, 410(1), 68.

Nourry, C., Grant, S. G. N., & Borg, J. (2003). PDZ domain proteins: Plug and play! Science Signaling, 2003(179), re7.

Pomiès, P., Macalma, T., & Beckerle, M. C. (1999). Purification and characterization of an α-actinin-binding PDZ-LIM protein that is up-regulated during muscle differentiation. Journal of Biological Chemistry, 274(41), 29242-29250.

Roof, D. J., Hayes, A., Adamian, M., Chishti, A. H., & Li, T. (1997). Molecular characterization of abLIM, a novel actin-binding and double zinc finger protein. The Journal of Cell Biology, 138(3), 575-588.

Sanger, J. W., & Sanger, J. M. (2001). Fishing out proteins that bind to titin. The Journal of Cell Biology, 154(1), pp. 21-24.

Schmeichel, K. L., & Beckerle, M. C. (1994). The LIM domain is a modular protein- binding interface. Cell, 79(2), 211-219.

Soteriou, A., Clarke, A., Martin, S., & Trinick, J. (1993). Titin folding energy and elasticity. Proceedings: Biological Sciences, 254(1340), pp. 83-86.

Titin - wikipedia, the free encyclopedia. Retrieved 9/9/2010, 2010, from http://en.wikipedia.org/wiki/Titin

Unfolding titin immunoglobulin domains. Retrieved 9/9/2010, 2010, from http://www.ks.uiuc.edu/Research/smd_imd/titin/

Vicente-Manzanares, ,Miguel, Ma, ,Xuefei, Adelstein, R.,S., & Horwitz, A.,Rick. (2009). Non-muscle myosin II takes centre stage in cell adhesion and migration. Nature Reviews Molecular Cell Biology, 10, 778-790.

Watanabe, ,Naoki, Kato, ,Takayuki, Fujita, ,Akiko, Ishizaki, ,Toshimasa, & Narumiya, ,Shuh. (1999). Cooperation between mDia1 and ROCK in rho-induced actin reorganization. Nature: Cell Biology, 1, 136-143.

Watanabe, ,Naoki, Madaule, ,Pascal, Reid, ,Tim, Ishizaki, ,Toshimasa, Watanabe, ,Go, Kakizuka,Narumiya, ,Shuh. (1997). p140mDia, a mammalian homolog of drosophila diaphanous,is a target protein for rho small GTPase and is a ligand for profilin. The EMBO Journal, 16, 3044-3056.

Whiting, A., Wardale, J., & Trinick, J. (1989). Does titin regulate the length of muscle thick filaments? Journal of Molecular Biology, 205(1), 263-268.

Zick, Y. (2001). Insulin resistance: A phosphorylation-based uncoupling of insulin signaling. Trends in Cell Biology, 11(11), 437-441.

Zou, P., Pinotsis, N., Lange, S., Song, YH., Popov, A., Marvidis, I., Mayans, O., Gautel, M., Wilmanns, M. (2006). Palindromic assembly of the giant muscle protein titin in the sarcomeric Z-disk. Nature Letters 439112, 229-233.

BIOGRAPHICAL SKETCH

Arif Fazel

Arif Fazel was born and raised in Northern Virginia a few miles outside of Washington D.C. After graduating high school Arif and his parents decided to move to Florida. Reasons for moving were that his father had retired from having worked over 25 years at the World Bank and most of the schools Arif had applied to were in Florida. After four years of living in Tampa, FL Arif graduated from the University of Tampa in spring of 2007 with a Bachelor’s degree in Biology and a minor in Chemistry. Having come from a family where many cousins were either medical doctors or in the IT field, Arif wanted to do something different. He came to Florida State University to pursue a graduate degree in Cell and Molecular Biology. While in graduate school Arif researched protein interactions involving the titin protein in the lab of Dr. Thomas C.S. Keller III. Also in graduate school Arif was given the opportunity to be a teaching assistant where he taught for 11 out of 12 semesters. As a TA Arif taught Bio 2010 lab and Cell Structure/Function. It was after his first year of teaching that he realized he wanted to remain in the academic field and pursue a teaching career after graduate school. Arif continues to work on helping others improve their teaching skills by providing feedback to newer TAs and being involved with the TA Training Committee of the Department of Biological Science.