Guanylate-Binding Protein-1 Is a Potential New Therapeutic Target For

Total Page:16

File Type:pdf, Size:1020Kb

Guanylate-Binding Protein-1 Is a Potential New Therapeutic Target For Quintero et al. BMC Cancer (2017) 17:727 DOI 10.1186/s12885-017-3726-2 RESEARCH ARTICLE Open Access Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer Melissa Quintero1†, Douglas Adamoski1,3†, Larissa Menezes dos Reis1,3†, Carolline Fernanda Rodrigues Ascenção1,3, Krishina Ratna Sousa de Oliveira1,3, Kaliandra de Almeida Gonçalves1, Marília Meira Dias1, Marcelo Falsarella Carazzolle2 and Sandra Martha Gomes Dias1* Abstract Background: Triple-negative breast cancer (TNBC) is characterized by a lack of estrogen and progesterone receptor expression (ESR and PGR, respectively) and an absence of human epithelial growth factor receptor (ERBB2) amplification. Approximately 15–20% of breast malignancies are TNBC. Patients with TNBC often have an unfavorable prognosis. In addition, TNBC represents an important clinical challenge since it does not respond to hormone therapy. Methods: In this work, we integrated high-throughput mRNA sequencing (RNA-Seq) data from normal and tumor tissues (obtained from The Cancer Genome Atlas, TCGA) and cell lines obtained through in-house sequencing or available from the Gene Expression Omnibus (GEO) to generate a unified list of differentially expressed (DE) genes. Methylome and proteomic data were integrated to our analysis to give further support to our findings. Genes that were overexpressed in TNBC were then curated to retain new potentially druggable targets based on in silico analysis. Knocking-down was used to assess gene importance for TNBC cell proliferation. Results: Our pipeline analysis generated a list of 243 potential new targets for treating TNBC. We finally demonstrated that knock-down of Guanylate-Binding Protein 1 (GBP1 ), one of the candidate genes, selectively affected the growth of TNBC cell lines. Moreover, we showed that GBP1 expression was controlled by epidermal growth factor receptor (EGFR) in breast cancer cell lines. Conclusions: We propose that GBP1 is a new potential druggable therapeutic target for treating TNBC with enhanced EGFR expression. Keywords: Breast cancer, Triple-negative breast cancer, Gene expression, RNA-Seq, Transcriptomics, Therapeutic target Background the discovery of novel genes and transcripts. As such, The emergence of next-generation sequencing (NGS) RNA-Seq has become an important tool in cancer technology has provided a large amount of data, much studies [6], contributing to reduced costs and less time of which is publicly available [1, 2]. Specifically, RNA- being spent in benchtop experiments, thus speeding up Seq has been used for the estimation of RNA abun- the resolution of biological problems. However, a chal- dance [3, 4], alternative splicing detection [5–7], and lenge remains in achieving intelligible data analysis and efficient laboratory validation. Triple-negative breast cancer (TNBC) is characterized by a lack of estrogen and progesterone receptor expres- sion (ESR and PGR, respectively) and an absence of * Correspondence: [email protected] †Equal contributors human epithelial growth factor receptor (ERBB2)amp- 1Brazilian Biosciences National Laboratory (LNBio), Brazilian Center for Research lification. Approximately to 15–20% of breast malig- in Energy and Materials (CNPEM), Campinas, São Paulo 13083-970, Brazil nancies are TNBC [8]. Patients with TNBC often Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Quintero et al. BMC Cancer (2017) 17:727 Page 2 of 16 exhibit unfavorable histopathologic features at diagno- RNA sample preparation kit v2 (Illumina) for samples se- sis, mainly consisting of a higher histologic grade, larger quenced at the High-Throughput Sequencing Facility tumor size, and frequent metastasis to the lymph nodes (HTSF) of the University of North Carolina at Chapel Hill [9]. As a consequence, TNBC is associated with a (UNC, USA) and the High-Performance Technologies shorter median time to relapse and death [10]. TNBC Central Laboratory (LaCTAD) of the University of Campi- represents an important clinical challenge since it does nas (UNICAMP, Brazil), respectively. After isolation, the not respond to hormone therapy, which targets the mRNAs were fragmented in the presence of divalent abovementioned receptors [11, 12]. Moreover, TNBC is cations and high temperatures and then employed for highly heterogeneous [13], indicating the necessity of cDNA synthesis with random primers using the Super- identifying unifying molecular targets, which may help script II Reverse Transcriptase (Life Technologies) kit. guide more efficient and less toxic therapeutic manage- The MDAMB231 and SKBR3 samples were sequenced at ment [14, 15]. HTSF, while the MDAMB436, MDAMB468, BT549 and Guanylate-Binding Protein-1 (GBP1) is a member of the MCF7 samples were sequenced at LaCTAD. All samples large GTPase family and is induced by interferons [16] were sequenced using the paired-end × 100 base pairs and inflammatory cytokines [17]. GBP1 is also transcrip- technique on the Hiseq2000 platform (Illumina). Level 3 tionally regulated by epidermal growth factor receptor TCGA RNA-Seq data (RNASeqV2 raw count estimates) (EGFR). In glioblastoma [18, 19] and esophageal squa- and related clinical data (immunohistochemical results for mous cell carcinoma [20], GBP1 upregulation via the ER, PR and HER2 TNBC markers) for 1093 tumor tissues EGFR signaling pathway contributes to tumor prolifera- from the Breast Invasive Carcinoma (BRCA) dataset, as tion and migration both in vitro and in vivo. Moreover, well as 112 normal breast tissue samples, were down- GBP1 is described as a component of the cytoskeletal loaded from the Genomic Data Commons Legacy Archive gateway of drug resistance in ovarian cancer [21, 22]. (National Cancer Institute) on November 10, 2016, from GBP1 expression is also linked to a lack of responsiveness legacy database. Cell line RNA-Seq data (accession codes to radiotherapy in some tumors [23], and GBP1 is overex- GSE58135 [25] and GSE48213 [26]) were obtained from pressed in pancreatic cancer that is refractory to oncolytic the Gene Expression Omnibus [27] by downloading raw virus therapy [24]. FASTQ files from the DDBJ Sequence Read Archive [28] In this work, we utilized RNA-Seq data obtained from (DRA) or NCBI Sequence Read Archive (SRA) [29]. TNBC tissues as well as cell lines that were publicly FastQC [30] was used to evaluate the quality of the available from The Cancer Genome Project (TCGA) reads. Reads presenting a mean quality score below 30 and the Gene Expression Omnibus Portal (GEO), were removed. Those that exhibited a quality score respectively, to search for new therapeutic targets for above this threshold but included bases at the extrem- TNBC. To complement our findings, we also per- ities with a quality score below 20 were trimmed using formed transcriptomics analyses of several TNBC cell Skewer [31] following guidelines published elsewhere lines. The obtained lists of overexpressed genes were [32], up to a minimum of 30 base pairs. The processed inter-crossed and compared with data from normal tis- reads were aligned against the hg19 genome using sues from the TCGA. Methylome and proteomic data STAR [33], and transcript abundance was estimated were integrated to our analysis to give further support with RNA-Seq by Expectation-Maximization (RSEM) to our findings. Using this approach, we identified 243 [34]. We applied upper-quantile normalization to per- genes, which were subsequently evaluated for their form batch effects adjustments and render dataset from druggability potential. GBP1 was the second gene on distinct sources comparable [35]. the list, and knock-down of GBP1 in TNBC and non- TNBC cell lines showed that its expression is important Assignment of breast cancer marker status in the TCGA for TNBC cell growth. In addition, we demonstrated cohort that GBP1 expression is controlled by EGFR signaling The TCGA normalized log2 RSEM values for the ESR1, in breast cancer cells. Thus, we present GBP1 as a new PGR and ERBB2 genes were adjusted to a bimodal potential druggable target for TNBC with enhanced curve using an approach published previously [36, 37]. EGFR expression. Briefly, for each gene, log2 + 1-transformed [38], upper quartile-normalized [35] gene expression was fitted for Methods a 2-component Gaussian mixture distribution model RNA sequencing and data processing with the R package mclust [39]. The highest match be- Total RNA extraction was performed using the RNeasy tween the assignment and clinical data (when available) kit (Qiagen) according to the manufacturer’s instructions. was the criterion for selecting equal or variable vari- Then, mRNA was isolated with either the Dynabeads ance between the two Gaussian fits. For the microarray mRNA purification kit (Life Technologies) or the TrueSeq validation datasets, the same approach was used, but Quintero et al. BMC Cancer (2017) 17:727 Page 3 of 16 log2 + 1-transformed
Recommended publications
  • Guanine Nucleotidebinding Protein 1 Is One of the Key Molecules
    Guanine nucleotide-binding protein 1 is one of the key molecules contributing to cancer cell radioresistance Motoi Fukumoto,1 Tatsuya Amanuma,1 Yoshikazu Kuwahara,1 Tsutomu Shimura,1 Masatoshi Suzuki,1 Shiro Mori,2 Hiroyuki Kumamoto,3 Yohei Saito,4 Yasuhito Ohkubo,4 Zhenfeng Duan,5 Kenji Sano,6 Tomohiro Oguchi,7 Kazuyuki Kainuma,7 Shinichi Usami,7 Kengo Kinoshita,8 Inchul Lee9 and Manabu Fukumoto1 1Department of Pathology, Institute of Development, Aging and Cancer, Tohoku University, Sendai; 2Department of Oral and Maxillofacial Surgery, Tohoku University, Sendai; 3Division of Oral Pathology, Department of Oral Medicine and Surgery, Graduate School of Dentistry, Tohoku University, Sendai; 4Department of Radiopharmacy, Tohoku Pharmaceutical University, Sendai, Japan; 5Department of Hematology/Oncology, Massachusetts General Hospital, Boston, Massachusetts, USA; 6Department of Pathology, School of Medicine, Shinshu University, Matsumoto; 7Department of Otorhinolaryngology, School of Medicine, Shinshu University, Matsumoto, Japan; 8Graduate School of Information Sciences, Tohoku University, Sendai; 9Department of Pathology, Asan Medical Center, Seoul, Korea Key words Standard fractionated radiotherapy for the treatment of cancer consists of daily GTP-binding proteins, head and neck neoplasms, irradiation of 2-Gy X-rays, 5 days a week for 5–8 weeks. To understand the char- neoplasms, radiation, radiation oncology acteristics of radioresistant cancer cells and to develop more effective radiother- Correspondence apy, we established a series of novel, clinically relevant radioresistant (CRR) cells Manabu Fukumoto, Department of Pathology, IDAC, that continue to proliferate with 2-Gy X-ray exposure every 24 h for more than Tohoku University, 4-1 Seiryou-machi, Aoba-ku, Sendai, 30 days in vitro. We studied three human and one murine cell line, and their CRR Japan.
    [Show full text]
  • Contributes to Cell-Autonomous Immunity Against Toxoplasma Gondii Elizabeth M
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2013 Guanylate-binding protein 1 (Gbp1) contributes to cell-autonomous immunity against Toxoplasma gondii Elizabeth M. Selleck Washington University School of Medicine in St. Louis Sarah J. Fentress Washington University School of Medicine in St. Louis Wandy L. Beatty Washington University School of Medicine in St. Louis Daniel Degrandi Heinrich-Heine-Universitat Dusseldorf Klaus Pfeffer Heinrich-Heine-Universitat Dusseldorf See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Selleck, Elizabeth M.; Fentress, Sarah J.; Beatty, Wandy L.; Degrandi, Daniel; Pfeffer, Klaus; Virgin, Herbert W. IV; MacMicking, John D.; and Sibley, L. David, ,"Guanylate-binding protein 1 (Gbp1) contributes to cell-autonomous immunity against Toxoplasma gondii." PLoS Pathogens.,. e1003320. (2013). https://digitalcommons.wustl.edu/open_access_pubs/1496 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Elizabeth M. Selleck, Sarah J. Fentress, Wandy L. Beatty, Daniel Degrandi, Klaus Pfeffer, Herbert W. Virgin IV, John D. MacMicking, and L. David Sibley This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/1496 Guanylate-binding Protein 1 (Gbp1) Contributes to Cell- autonomous Immunity against Toxoplasma gondii Elizabeth M. Selleck1, Sarah J. Fentress1, Wandy L. Beatty1, Daniel Degrandi2, Klaus Pfeffer2, Herbert W. Virgin IV3, John D. MacMicking4, L. David Sibley1* 1 Department of Molecular Microbiology, Washington University School of Medicine, St.
    [Show full text]
  • C. Elegans Whole Genome Sequencing Reveals Mutational Signatures Related to Carcinogens and DNA Repair Deficiency
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press C. elegans whole genome sequencing reveals mutational signatures related to carcinogens and DNA repair deficiency Authors: Bettina Meier * (1); Susanna L Cooke * (2); Joerg Weiss (1); Aymeric P Bailly (1,3); Ludmil B Alexandrov (2); John Marshall (2); Keiran Raine (2); Mark Maddison (2); Elizabeth Anderson (2); Michael R Stratton (2); Anton Gartner * (1); Peter J Campbell * (2,4,5). * These authors contributed equally to this project. Institutions: (1) Centre for Gene Regulation and Expression, University of Dundee, Dundee, UK. (2) Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, UK. (3) CRBM/CNRS UMR5237, University of Montpellier, Montpellier, France. (4) Department of Haematology, University of Cambridge, Cambridge, UK. (5) Department of Haematology, Addenbrooke’s Hospital, Cambridge, UK. Address for correspondence: Dr Peter J Campbell, Dr Anton Gartner, Cancer Genome Project, Centre for Gene Regulation and Expression, Wellcome Trust Sanger Institute, The University of Dundee, Hinxton CB10 1SA, Dow Street, Cambridgeshire, Dundee DD1 5EH UK. UK. Tel: +44 (0) 1223 494745 Phone: +44 (0) 1382 385809 Fax: +44 (0) 1223 494809 E-mail: [email protected] E-mail: [email protected] Running title: mutation profiling in C. elegans Keywords: mutation pattern, genetic and environmental factors, C. elegans, cisplatin, aflatoxin B1, whole-genome sequencing. Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Mutation is associated with developmental and hereditary disorders, ageing and cancer. While we understand some mutational processes operative in human disease, most remain mysterious.
    [Show full text]
  • Exposing Toxoplasma Gondii Hiding Inside the Vacuole: a Role for Gbps, Autophagy and Host Cell Death
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Curr Opin Manuscript Author Microbiol. Author Manuscript Author manuscript; available in PMC 2020 February 06. Published in final edited form as: Curr Opin Microbiol. 2017 December ; 40: 72–80. doi:10.1016/j.mib.2017.10.021. Exposing Toxoplasma gondii hiding inside the vacuole: a role for GBPs, autophagy and host cell death Jeroen P Saeij1, Eva-Maria Frickel2 1School of Veterinary Medicine, Department of Pathology, Microbiology and Immunology, University of California, Davis, Davis, CA 95616, USA 2The Francis Crick Institute, Host-Toxoplasma Interaction Laboratory, 1 Midland Road, London NW1 1AT, UK Abstract The intracellular parasite Toxoplasma gondii resides inside a vacuole, which shields it from the host’s intracellular defense mechanisms. The cytokine interferon gamma (IFNγ) upregulates host cell effector pathways that are able to destroy the vacuole, restrict parasite growth and induce host cell death. Interferon-inducible GTPases such as the Guanylate Binding Proteins (GBPs), autophagy proteins and ubiquitin-driven mechanisms play important roles in Toxoplasma control in mice and partly also in humans. The host inflammasome is regulated by GBPs in response to bacterial infection in murine cells and may also respond to Toxoplasma infection. Elucidation of murine Toxoplasma defense mechanisms are guiding studies on human cells, while inevitably leading to the discovery of human-specific pathways that often function in a cell type-dependent manner. Introduction Toxoplasma gondii is an important pathogen of animals and humans with ~30% of the world’s population chronically infected. While immunocompetent people generally control the infection, Toxoplasma infection can lead to congenital abnormalities, ocular disease and health problems in the immunocompromised.
    [Show full text]
  • Abstracts In
    ECCB 2014 Accepted Posters with Abstracts G: Bioinformatics of health and disease G01: Emile Rugamika Chimusa, Jacquiline Wangui Mugo and Nicola Mulder. Leveraging ancestry along the genome of admixed individuals to resolve missing heritability in disease scoring statistics Abstract: Human genetics has been haunted by the mystery of “missing heritability” of common traits. Although studies have discovered several variants associated with common diseases and traits, these variants typically appear to explain only a minority of the heritability. Resolving missing heritability, the difference between phenotypic variance explained by associated SNPs and estimates of narrow-sense heritability (h2), will inform strategies for disease mapping and prediction of complex traits. Among biased estimates of h2 due to epistatic interactions and rare variants not captured by genotyping arrays have been cited to be the most can be the most explanations for missing heritability. Here, we present an approach for estimating heritability of traits based on sharing local ancestry segments between pairs of unrelated individuals in an admixed population. From simulation data and real data, we demonstrated that our approach outperformed current approaches for estimating heritability of traits and holds values in admixture mapping for deconvoluting genes underlying ethnic differences in complex diseases risk. G02: Sylvain Mareschal, Pierre-Julien Viailly, Philippe Bertrand, Fabienne Desmots-Loyer, Elodie Bohers, Catherine Maingonnat, Karen Leroy, Thierry Fest and Fabrice Jardin. Next- Generation Sequencing applied to tailor targeted therapies in lymphoma: the RELYSE project Abstract: Non-Hodgkin Lymphomas (NHL) are lymphoid cell malignancies accounting for about 4% of all cancers, with an incidence rate of 12 cases per 100,000 and per year in Europe.
    [Show full text]
  • Discovery of a Small Molecule TUBB3/Βiii-Tubulin Modulator in Lung Cancer
    Discovery of a small molecule TUBB3/βIII-tubulin modulator in lung cancer Felicity Chao Lin Kao A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy School of Women’s and Children’s Health Faculty of Medicine The University of New South Wales March 2016 TH E UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Kao First name: Felicity Other name/s: Chao Lin Abbreviation for degree as g iven in the University calendar: PhD School: School of Women's and Children's Health Faculty: Faculty of Medicine Title: Discovery of a small molecule TU883/I311 1·tubulin modulator in lung cancer Abstract Non-small Cell Lung Cancer (NSCLC) survival rates are dismal and chemotherapy resistance is a significant clinical problem. 13111-tubulin (encoded by TUBB3 gene) is aberranlly expressed and is associated with chemoresistance and tumour aggressiveness in NSCLC, where it has been identified as a bona fide target for chemosensitisation. Currently, there is no commercially available TUB83J13111-tubulin inhibitor. Regulation of 13111 -tubulin is poorly understood, making it difficult to target this protein. We sought to identify a chemical modulator of TU883J1311Hubulin expression, as it will be a valuable research tool to probe TU883J!3111-tubulin regulation . A novel small molecule TU883/13111-tubulin enhancer, WECC0017371 , was identified in our high throughput screen, based on its ability to modulate TUBB3 promoter activity. WECC001 7371 demonstrated the ability to significantly enhance TUBB3 mRNA and 13111-tubulin protein expression in a time· and dose-dependent manner. Additionally, WECC0017371 did not alter microtubule morphology but enhanced 13111-tubuli n immunostaining in two independent NSCLC cell lines, H460 and H1299, compared to control.
    [Show full text]
  • Human Genetics: International Projects and Personalized Medicine
    Drug Metabol Pers Ther 2016; 31(1): 3–8 Mini Review Maria Apellaniz-Ruiza, Cristina Gallegoa, Sara Ruiz-Pintoa, Angel Carracedo and Cristina Rodríguez-Antona* Human genetics: international projects and personalized medicine DOI 10.1515/dmpt-2015-0032 Received August 31, 2015; accepted October 19, 2015; previously Introduction published online November 18, 2015 Genetic variation databases describe naturally occur- Abstract: In this article, we present the progress driven ring genetic differences among individuals of the same by the recent technological advances and new revolu- species. This variation, accounting for 0.1% of our DNA tionary massive sequencing technologies in the field of [1], permits the flexibility and survival of a population human genetics. We discuss this knowledge in relation in the face of changing environmental circumstances, with drug response prediction, from the germline genetic but it also influences how people differ in their risk of variation compiled in the 1000 Genomes Project or in the disease or their response to drugs. It is well known that Genotype-Tissue Expression project, to the phenome- variability in response to drug therapy is the rule rather genome archives, the international cancer projects, such than the exception for most drugs, and these differences as The Cancer Genome Atlas or the International Cancer are among the major challenges in current clinical prac- Genome Consortium, and the epigenetic variation and its tice, drug development, and drug regulation [2, 3]. Thus, influence in gene expression, including the regulation of rather than accepting the “one drug fits all” approach, drug metabolism. This review is based on the lectures pre- researchers envision that drugs need to be tailored to fit sented by the speakers of the Symposium “Human Genet- the profile of each individual patient.
    [Show full text]
  • Detection and Manipulation of Live Antigen-Expressing Cells Using
    1 Title: Detection and manipulation of live antigen-expressing cells using 2 conditionally stable nanobodies 3 4 Authors: Jonathan C.Y. Tang1,2†, Eugene Drokhlyansky1,2†, Behzad Etemad3, 5 Stephanie Rudolph4, Binggege Guo1,2, Sui Wang1,2, Emily G, Ellis4, Jonathan Z. Li3, 6 Constance L. Cepko1,2* 7 8 Affiliations: 9 1Howard Hughes Medical Institute 10 2Departments of Genetics and Ophthalmology 11 Harvard Medical School, Boston, MA 02115, USA 12 3Brigham and Women's Hospital, Harvard Medical School, Boston, MA 02115, USA 13 4Department of Neurobiology 14 Harvard Medical School, Boston, MA 02115, USA 15 16 †These authors contributed equally to this work 17 *Corresponding author: [email protected] 18 19 Competing Interests: 20 J.C.Y.T, E.D., S.W. and C.L.C. have submitted a U.S. patent application regarding 21 destabilized nanobodies: International Application No. PCT/US2016/027749. Priority: 22 US Prov. Appl. No. 62/148,595. 23 24 25 26 Abstract: The ability to detect and/or manipulate specific cell populations based upon 27 the presence of intracellular protein epitopes would enable many types of studies and 28 applications. Protein binders such as nanobodies (Nbs) can target untagged proteins 29 (antigens) in the intracellular environment. However, genetically expressed protein 30 binders are stable regardless of antigen expression, complicating their use for 31 applications that require cell-specificity. Here, we created a conditional system in which 32 the stability of an Nb depends upon an antigen of interest. We identified Nb framework 33 mutations that can be used to rapidly create destabilized Nbs.
    [Show full text]
  • Microarray Analysis of Novel Genes Involved in HSV- 2 Infection
    Microarray analysis of novel genes involved in HSV- 2 infection Hao Zhang Nanjing University of Chinese Medicine Tao Liu ( [email protected] ) Nanjing University of Chinese Medicine https://orcid.org/0000-0002-7654-2995 Research Article Keywords: HSV-2 infection,Microarray analysis,Histospecic gene expression Posted Date: May 12th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-517057/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background: Herpes simplex virus type 2 infects the body and becomes an incurable and recurring disease. The pathogenesis of HSV-2 infection is not completely clear. Methods: We analyze the GSE18527 dataset in the GEO database in this paper to obtain distinctively displayed genes(DDGs)in the total sequential RNA of the biopsies of normal and lesioned skin groups, healed skin and lesioned skin groups of genital herpes patients, respectively.The related data of 3 cases of normal skin group, 4 cases of lesioned group and 6 cases of healed group were analyzed.The histospecic gene analysis , functional enrichment and protein interaction network analysis of the differential genes were also performed, and the critical components were selected. Results: 40 up-regulated genes and 43 down-regulated genes were isolated by differential performance assay. Histospecic gene analysis of DDGs suggested that the most abundant system for gene expression was the skin, immune system and the nervous system.Through the construction of core gene combinations, protein interaction network analysis and selection of histospecic distribution genes, 17 associated genes were selected CXCL10,MX1,ISG15,IFIT1,IFIT3,IFIT2,OASL,ISG20,RSAD2,GBP1,IFI44L,DDX58,USP18,CXCL11,GBP5,GBP4 and CXCL9.The above genes are mainly located in the skin, immune system, nervous system and reproductive system.
    [Show full text]
  • Strategic Plan 2011-2016
    Strategic Plan 2011-2016 Wellcome Trust Sanger Institute Strategic Plan 2011-2016 Mission The Wellcome Trust Sanger Institute uses genome sequences to advance understanding of the biology of humans and pathogens in order to improve human health. -i- Wellcome Trust Sanger Institute Strategic Plan 2011-2016 - ii - Wellcome Trust Sanger Institute Strategic Plan 2011-2016 CONTENTS Foreword ....................................................................................................................................1 Overview .....................................................................................................................................2 1. History and philosophy ............................................................................................................ 5 2. Organisation of the science ..................................................................................................... 5 3. Developments in the scientific portfolio ................................................................................... 7 4. Summary of the Scientific Programmes 2011 – 2016 .............................................................. 8 4.1 Cancer Genetics and Genomics ................................................................................ 8 4.2 Human Genetics ...................................................................................................... 10 4.3 Pathogen Variation .................................................................................................. 13 4.4 Malaria
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name guanylate binding protein 1, interferon-inducible Gene Symbol GBP1 Organism Human Gene Summary Guanylate binding protein expression is induced by interferon. Guanylate binding proteins are characterized by their ability to specifically bind guanine nucleotides (GMP GDP and GTP) and are distinguished from the GTP-binding proteins by the presence of 2 binding motifs rather than 3. Gene Aliases Not Available RefSeq Accession No. NC_000001.10, NT_032977.9 UniGene ID Hs.62661 Ensembl Gene ID ENSG00000117228 Entrez Gene ID 2633 Assay Information Unique Assay ID qHsaCED0002187 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000370473 Amplicon Context Sequence AATAAACTTCTCCTGAGTGGTACCAGCTTATGAGATTTCCTGAGTTGATACAGAG GTAAATGCATCTTTGTTGCACAATTTACAGTCTTTTTTTTTTTTTAAGAAAAAACAT GATTTTGATCATTGTACCACATGCCTTTATAAACTTTTGGTG Amplicon Length (bp) 124 Chromosome Location 1:89518779-89518932 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 96 R2 0.9999 cDNA Cq 22.48 cDNA Tm (Celsius) 77.5 gDNA Cq 23.04 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report GBP1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • Germline Determinants of the Somatic Mutation Landscape in 2,642 Cancer Genomes
    bioRxiv preprint doi: https://doi.org/10.1101/208330; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Germline determinants of the somatic mutation landscape in 2,642 cancer genomes Sebastian M Waszak1*, Grace Tiao2*, Bin Zhu3*, Tobias Rausch1*, Francesc Muyas4,5#, Bernardo Rodríguez-Martín6,7#, Raquel Rabionet4#, Sergei Yakneen1#, Georgia Escaramis4,8, Yilong Li9, Natalie Saini10, Steven A Roberts11, German M Demidov4,5, Esa Pitkänen1; Olivier Delaneau12-14, Jose Maria Heredia-Genestar15, Joachim Weischenfeldt1,16, Suyash S Shringarpure17, Jieming Chen18; Hidewaki Nakagawa19, Ludmil B Alexandrov20, Oliver Drechsel4,5, L Jonathan Dursi21, Ayellet V Segre2, Erik Garrison9, Serap Erkek1, Nina Habermann1, Lara Urban22, Ekta Khurana23, Andy Cafferkey22, Shuto Hayashi24, Seiya Imoto25, Lauri A Aaltonen26, Eva G Alvarez6,7, Adrian Baez-Ortega27, Matthew Bailey33, Mattia Bosio4,5, Alicia L Bruzos6,7, Ivo Buchhalter28, Carlos D. Bustamante29, Claudia Calabrese22, Anthony DiBiase30, Mark Gerstein31-33, Aliaksei Z Holik4,5, Xing Hua3, Kuan-lin Huang34, Ivica Letunic35, Leszek J Klimczak36, Roelof Koster3, Sushant Kumar31, Mike McLellan34, Jay Mashl34, Lisa Mirabello3, Steven Newhouse22, Aparna Prasad4,5, Gunnar Rätsch37, Matthias Schlesner28, Roland Schwarz38, Pramod Sharma30, Tal Shmaya17, Nikos Sidiropoulos16, Lei Song3,
    [Show full text]