A Chemogenomic Screening Identifies CK2 As a Target for Pro-Senescence

ARTICLE

Received 10 Nov 2014 | Accepted 21 Apr 2015 | Published 18 Jun 2015 DOI: 10.1038/ncomms8227 A chemogenomic screening identiﬁes CK2 as a target for pro-senescence therapy in PTEN-deﬁcient tumours

Madhuri Kalathur1,2,w, Alberto Toso1, Jingjing Chen1,2, Ajinkya Revandkar1,2, Claudia Danzer-Baltzer3,4,5, Ilaria Guccini1, Abdullah Alajati1, Manuela Sarti1, Sandra Pinton1, Lara Brambilla1, Diletta Di Mitri1, Giuseppina Carbone1, R. Garcia-Escudero1, Alessandro Padova6, Letizia Magnoni7, Alessia Tarditi7, Laura Maccari7, Federico Malusa7, Ravi Kiran Reddy Kalathur8, Lorenzo A. Pinna9, Giorgio Cozza9, Maria Ruzzene9, Nicolas Delaleu10, Carlo V. Catapano1, Ian J. Frew3,4,5 & Andrea Alimonti1,2

Enhancement of cellular senescence in tumours triggers a stable cell growth arrest and activation of an antitumour immune response that can be exploited for cancer therapy. Currently, there are only a limited number of targeted therapies that act by increasing senescence in cancers, but the majority of them are not selective and also target healthy cells. Here we developed a chemogenomic screening to identify compounds that enhance senescence in PTEN-deficient cells without affecting normal cells. By using this approach, we identified casein kinase 2 (CK2) as a pro-senescent target. Mechanistically, we show that Pten loss increases CK2 levels by activating STAT3. CK2 upregulation in Pten null tumours affects the stability of Pml, an essential regulator of senescence. However, CK2 inhibition stabilizes Pml levels enhancing senescence in Pten null tumours. Taken together, our screening strategy has identified a novel STAT3–CK2–PML network that can be targeted for pro-senescence therapy for cancer.

1 Institute of Oncology Research (IOR) and Oncology Institute of Southern Switzerland (IOSI), CH 6500 Bellinzona, Switzerland. 2 Faculty of Biology and Medicine, University of Lausanne (UNIL), CH-1011 Lausanne, Switzerland. 3 Institute of Physiology, University of Zurich, CH8006 Zurich, Switzerland. 4 Zurich Center for Integrative Human Physiology, University of Zurich, CH8006 Zurich, Switzerland. 5 Competence Center for Systems Physiology and Metabolic Diseases, CH8006 ETH Zurich, Switzerland. 6 IRBM Science Park S.p.A., 00040 Pomezia (Roma), Italy. 7 Siena Biotech Spa, 53100 Siena, Italy. 8 Experimental & Clinical Cell Therapy Institute, Spinal Cord & Tissue Regeneration Center Salzburg, Paracelsus Medizinische Privatuniversita¨t, Strubergasse 21, A-5020, Salzburg, Austria. 9 Department of Biomedical Sciences, University of Padova, and VIMM, 35131 Padua, Italy. 10 Broegelmann Research Laboratory, Department of Clinical Science, University of Bergen, 5021 Bergen, Norway. w Present address: Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA. Correspondence and requests for materials should be addressed to A.A. (email: [email protected]).

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227

oth genetic and epigenetic losses of the tumour suppressor screening platform, to evaluate the pro-senescence efficacy of gene PTEN are frequently observed in human cancers1. these compounds in Pten À / À mouse embryonic fibroblasts BInterestingly, while monoallelic loss or mutation of PTEN (MEFs; Fig. 1a). As previously reported, upon inactivation of drives cellular proliferation, complete inactivation of PTEN Pten, 30% of the cells undergo senescence whereas the remaining induces a senescence response, termed PTEN loss-induced 70% of Pten À / À cells bypass this arrest and continue to cellular senescence (PICS) that opposes tumour development1. proliferate7 (Supplementary Methods). This provides a However, this response is not complete since upon Pten screening window to identify compounds that enhance inactivation in vivo, a fraction of Pten null cells escapes senescence by further decreasing proliferation of Pten À / À cells, senescence promoting tumor formation1,2. We have previously as previously demonstrated for Nutlin-3, a MDM2 inhibitor1. demonstrated that inhibition of either MDM2 or PTEN by means Compounds that increased the percentage of senescent cells in the of small-molecule inhibitors enhances PICS thereby blocking screening platform were designated as pro-senescence tumour progression1. While this response depends on the compounds based on two parameters: 1) inhibition of cell functional activation of p53, recent findings demonstrate that proliferation and 2) increase of SA-b-galactosidase staining senescence can also be activated in Pten; Trp53 double null (SA-b-gal), a prototypical senescence marker1 (Fig. 1a). tumours by enhancing p27 levels through Skp2 inhibition3. These Experimentally, the screening was carried out in three steps. In findings, together with the recent demonstration that senescent the first step, 500 compounds were tested in triplicates using a tumour cells activate an anti-tumour immune response4, have single drug concentration (10 mM). Compounds that promoted a gained increasing interest for the clinical development of strong growth arrest in Pten null MEFs passed the first filter compounds that enhance senescence in cancer. However, the (efficacy filter; n ¼ 144/500). Positive hits were retested in use of pro-senescence compounds in the clinic has been limited triplicates in single concentration in both Ptenfl/fl and Pten À / À by their poor tolerability in cancer patients3. Indeed, the majority MEFs to assess growth arrest in both cell types (specificity filter). of these compounds block genes such as CDKs or MYC which are Finally, the selective compounds (n ¼ 33/144) were validated in essential for the function of normal cells3. Identification of novel duplicate in a concentration response assay (dose optimization genes that regulate senescence in PTEN-deficient tumours filter). To perform IC50, data were normalized on each plate without affecting normal cells would help to develop more according to the negative control on Ptenfl/fl and Pten À / À cells, effective and selective pro-senescence compounds for the respectively. IC50s were then evaluated on normalized data by treatment of different types of cancer3. This may be particularly using a four-parameter logistic model independently on each cell relevant for prostate cancer therapy since PTEN-deficient line. Twelve out of 33 compounds had a marked difference in the prostate tumours conserve an intact p53 response even at late IC50 between Ptenfl/fl and Pten À / À cells (Pten À / À IC50r 60% stage of tumorigenesis and may therefore benefit from treatments Ptenfl/flIC50) and were selected for the final step of the screening. that enhance senescence by targeting p53 or its regulators. Here Examples of compounds that did not pass the optimization filter we report the results of a screening designed to identify despite a previous selectivity at single dosage were: ‘druggable’ targets regulating senescence in PTEN-deficient cells. Clotrimazole8,9, Clomipramine hydrochloride10, Nifedipine11, Using chemogenomic and short hairpin RNA (shRNA) approaches, Trichostatin A12,13 and Garcinol14 (not specific cell growth we found that the inhibition of CK2 enhances PICS without affect- arrest between Ptenfl/fl and Pten À / À cells at the IC50). Finally, ing normal cells. Our results demonstrate that CK2 is selectively compounds were tested in SA-b-gal assay using both the cell lines upregulated in PTEN null cells and tumours and opposes PICS by to test for cellular senescence induction (SA-b–gal filter). affecting the stability of the promyelocytic leukaemia protein, PML, Compounds that increased the SA-b-gal staining more than a known regulator of senescence in cancer5. Interestingly, our study 30% as compared to dimethyl sulfoxide in Pten À / À cells passed also demonstrates that the upregulation of CK2 in Pten null this filter and were further validated by additional senescence tumours is mediated by activation of Stat3, which is highly markers (PAI-1 and p21) using RT–PCR and western blot. Seven phosphorylated in Pten null tumours. Taken together, our data out of 12 compounds were found to have significantly enhanced provide new insight into the mechanisms that drive senescence senescence in Pten À / À cells as compared to the untreated evasion in tumour cells and validate the effectiveness of an control (Supplementary Table 1a). Among these seven integrated approach for the identification of ‘pro-senescence’ compounds, we found two bona fide (quinalizarin/CK2i-Q, CX- compounds in PTEN-deficient tumours. 4945/CK2i-CX)16,24,25 and one predicted (CK2i-S)17 casein kinase 2 (CK2) small-molecule inhibitors, two cytotoxic compounds already available in the clinic (Carboplatin, Results Methotrexate18,19), a KISS120,21 and a DKK1 inhibitor Identification of pro-senescence compounds. For the identifi- (proprietary data of Sibi Spa; Supplementary Table 1a, cation of novel pro-senescence compounds that could be rapidly Supplementary Table 2b and Supplementary Fig. 1b). Examples moved to the clinic, we took advantage of a drug library of 500 of compounds that did not pass the SA-b–gal filter were: compounds including small-molecule inhibitors in advanced Penfluridol22 and 5-Iodotubericidin23 (did not induce cellular phase of preclinical development, or marked in the clinic for the senescence in the SA-b-gal assay in both cell lines). Interestingly, therapy of cancer and additional disorders (Supplementary bioinformatics analysis revealed that CK2 and DKK1 inhibitors Fig. 1a). This library was created from a larger library of 90,000 targeted common genetic pathways, whereas Carboplatin, compounds comprising: (1) New chemical entities, (2) com- Methotrexate and KISS1 targeted distinct and independent pounds in advanced phase of development, (3) compounds pathways (Supplementary Table 1b). These compounds were already in the clinic for the treatment of cancer and different also highly selective for Pten À / À cells (inhibition of proliferation disorders. The rationale behind the selection of compounds in for Ptenfl/flr20% and for Pten À / À Z50%) as compared to a advanced phase of development was based on the fact that these panel of anticancer compounds, already available in the clinic and compounds have already passed a significant number of tests included in the library (Supplementary Fig. 1b,c). both in vitro and in vivo (safety, toxicity and pharmacokinetics), thereby decreasing the risks of drug development failure due to adverse toxicity which is commonly observed in screenings based A kinome shRNA screen validates CK2 as a pro-senescence on new chemical entities6. Next, we set up a ‘pro-senescence’ target. As an independent approach to validate the targets

2 NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 ARTICLE

a 90,000 –/– Single concentration Compounds Pten

Counter assay SA-β-gal negative 500 Compound (Pten wt/null)(Filter) (Pten wt/null)(Filter) Cmall molecues candidate X

Cytostatic/Cytotoxic Ptenfl/fl SA-β-gal negative MEFs IC50 single replicate β (Proliferation and SA- -gal) Pten–/– Excluded -galactosidase β Proliferation MEFs SA- Validation of senescence (additional markers)

Relevant genes Selective Pre-clinical trials in Pten null involved in PICS Pro-senescence mouse models Small molecules

b e PTENhigh PTENLow 590 1.2 590 1.2 *** *** 1.4 *** *** 1.0 1.0 1.2 ***** ** *** 1 0.8 0.8 0.8 0.6 0.6 round 0.6 st 1 0.4 0.4 0.4 0.2 0.2 0.2

0 0 Fold change in growth 0 Crystal violet staining OD DMSO MDM2i CK2i-Q Crystal violet staining OD DMSO MDM2i CK2i-CX 22rv1 A375 MCF7 LnCaP U87MG ZR-75-1 MDA-MBHCC1500 -175-VII c MDA-Pca-2b DMSO CK2i fl/fl 100 Pten 100 fl/fl 70 –/– Pten Pten –/– 60 ***** ** *** 80 Pten 80 50 60 60 40 30

40 40 -gal positive cells

β 20 20 20 10 CK2i-Q CK2i-CX 0 % Of growth inhibition

0 % Of growth inhibition 0 –3.1–2.9–2.8–2.6–2.4–2.2–2.1–1.9–1.7–1.5–1.4–1.2–1.0 –3.1–2.9–2.7–2.6–2.4–2.2–2.0–1.9–1.7–1.5–1.3–1.2–1.0 % Of SA- 22rv1 A375 Concentration of the compound Concentration of the compound MCF7 LnCaP U87MG ZR-75-1 (mM, log scale) (mM, log scale) MDA-MBHCC1500 -175-VII d MDA-Pca-2b 60 fl/fl fl/fl ** ** *** Pten 60 ** ** *** Pten f 500 50 Pten–/– 50 Pten–/– 400 40 40 30 300

-gal positivity 30 -gal positivity β β round **

rd 20 20 200 10 2–3 10 100 0 % Of SA- Total number of cells % of SA- 0 0 DMSO MDM2i CK2i-Q Rapa DMSO MDM2i CK2i-CX Rapa HCT116 Pten HCT116 Pten HCT116 Pten HCT116 Pten Wt KO Wt+CK2i KO+CK2i fl/fl –/– fl/fl –/– Pten Pten Pten Pten 25 20X 20X 20X 20X ** 20 DMSO DMSO Isogenic cell lines 15

20X 20X 20X 20X 10 -gal positive cells

CK2i-CX β NS CK2i-Q 5

0 20X 20X 20X 20X

% Of SA- HCT116 Pten HCT116 Pten HCT116 Pten HCT116 Pten Wt KO Wt+CK2i KO+CK2i RAPA RAPA

HCT 116 HCT 116 HCT 116 HCT 116 Pten Wt Pten KO Pten Wt + CK2i Pten KO + CK2i Figure 1 | Pro-senescence screening platform: CK2 drives senescence in PTEN-deficient cells. (a) Graphical representation of the pro-senescence screening cascade using Ptenfl/fl and Pten À / À primary MEFs (left panel). The assay is based on the assessment of cellular proliferation and senescence-associated SA-b- gal activity using compounds administered at single dose or in a dose–response assay (right panel). (b) Proliferation of primary Pten À / À MEFs treated with vehicle, the MDM2 inhibitor (MDM2i) Nutlin-3, the CK2 inhibitors quinalizarin (CK2i-Q) and CX-4945 (CK2i-CX) over a period of 5 days. (c) Dose–response assay in primary Ptenfl/fl and Pten À / À MEFs to determine the IC50 of CK2i-Q and CK2i-CX. (d) Quantification of SA-b-gal positivity in Ptenfl/fl and Pten À / À MEFs treated with CK2i-Q, CK2i-CX, Nutlin-3 and Rapamycin (Rapa; upper Panel). Representative images of SA-b-gal staining in cells treated as indicated above (lower panel). Magnification is Â 20. Scale bar, 10 mM(e) Proliferation and SA-b-gal positivity of different cancer cell lines treated with CK2i-Q. (f) Proliferation (upper panel), representative images and quantification of SA-b-gal positivity (lower panel) in HCT 116 isogenic cells treated with CK2i-Q. (c,d–f). Scale bar, 10 mM. Data are represented as mean±s.d., nZ3. (***Po0.001, **Po0.01). P value indicates that the statistical significance was measured by Student’s t-test.

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 3 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 identified in the chemical screening, we employed ‘loss-of- Nutlin-3, used as positive control26 (Fig. 1b). Dose–response representation’ or ‘drop-out’ genetic screens that allow the rapid experiments performed with quinalizarin and CX-4945 and three screening of the effects of individual shRNAs in an shRNA library additional CK2 inhibitors confirmed the high selectivity of these used to infect populations of Ptenfl/fl and Pten À / À primary MEFs compounds for Pten À / À as compared to Ptenfl/fl MEFs (Fig. 1c (Supplementary Fig. 2a). To this end, we obtained a lentiviral and Supplementary Table 2b). kinome knockdown library comprising 3,280 shRNAs targeting Moreover, CK2 inhibition by quinalizarin strongly increased 672 mouse kinases. After infection of Ptenfl/fl MEFs with the SA-b-gal staining and both p21 and PAI-1 expression in Pten À / lentiviral library and Adeno-GFP or Adeno-Cre, PCR was used to À as compared to Ptenfl/fl cells (Fig. 1d and Supplementary isolate the integrated shRNAs from genomic DNA and deep Fig. 3a,b). Next we checked whether this selectivity was also sequencing of the shRNAs enabled the quantitative assessment of observed in human cancer cell lines expressing different PTEN the relative abundance of these shRNAs in the cell populations levels (Supplementary Table 3). Interestingly, CK2 inhibition before and after passaging of the cells (Supplementary Fig. 2a). resulted in an enhanced senescence response in PTEN-deficient We first filtered out shRNAs that were represented by less than cells when compared with human cancer cell lines expressing 200 reads in the deep sequencing analyses of the early time points high levels of PTEN (Fig. 1e). These findings were also validated and then selected individual shRNAs whose representation in the in a pair of HCT116 isogenic cancer cells with and without shRNA population displayed little change or only modest changes PTEN27 (Fig. 1f). Finally, the selectivity of these compounds was in Ptenfl/fl cells (less than an 8-fold change in representation at tested in MEFs of different genetic backgrounds. Although CK2 the late versus the early time point) but exhibited between inhibition induced a strong senescence response in Pten À / À 64- and 1,200-fold decreases in representation over time in the cells, it did not selectively affect senescence in Trp53 À / À and Pten À / À cells. A specific reduction in the representation of H-RasV12 infected MEFs (Supplementary Fig. 3c,d). shRNAs over time in the Cre-infected cells was indicative of anti- Taken together, these data suggest that Pten À / À cells and proliferative or anti-survival effects of those knockdowns in the PTEN-deficient human cancer cell lines are more sensitive than Pten À / À cells (Supplementary Fig. 2b). We conducted this cells of other genetic backgrounds to CK2 inhibition. screen twice and identified 75 shRNAs that fulfilled these criteria in both screens (Supplementary Table 2a). Consistent with the results of our chemical screen, among these hits was an shRNA CK2 transcription and protein levels are controlled by STAT3. targeting Csnk2a1, which encodes CK2a, a subunit of CK2. Next, we sought the mechanism underlying the selectivity of CK2 Western blotting confirmed that CK2a was indeed down- inhibitors for PTEN-deficient cells. CK2 is a serine/threonine regulated in both Ptenfl/fl and Pten À / À MEFs infected with the protein kinase that functions as a tetramer of two a and two b CK2 shRNA used in the screening (Supplementary Fig. 2c). Next subunits. The a subunits contain the catalytic activity, while the b subunits function as regulatory subunits, undergoing autopho- we assessed senescence and found an increase in both, SA-b-gal 28 staining and p53 protein levels using different CK2 shRNAs sphorylation . Interestingly, while CK2 levels are consistently elevated in some subsets of human cancers, the mechanisms (Supplementary Fig. 2d–f). Additional hits included shRNAs 29 targeting Akt2 and Akt3, known downstream effectors of the involved in CK2 upregulation remain unknown . We detected a strong upregulation of CK2a protein (hereafter referred to as PI3K pathway, and Plk1, a gene previously shown to be essential À / À for the viability of PTEN-deficient cells, suggesting that the screen CK2) and mRNA levels in both Pten cells and Pten null prostate conditional (Ptenpc À / À ) tumours but not in Ptenfl/fl was able to functionally identify genetic interaction partners in pc þ / þ Pten mutant cells. However, these and additional targets were not cells and Pten normal prostates (Pten ), (Fig. 2a,b and Supplementary Fig. 4a). Of note, CK2 protein upregulation was identified by the chemical screening and were not tested for À / À senescence induction in Pten null cells. also validated in PTEN HCT116 human isogenic cancer cells (Supplementary Fig. 4b). The increased CK2 levels in Ptenpc À / À tumours correlated with an increased CK2 kinase activity as CK2 inhibitors act as selective pro-senescence compounds. demonstrated by phosphorylation of AKT(Ser129), a specific CK2 inhibitors (CK2i) triggered a strong cell growth arrest marker of CK2 activity30 (Fig. 2c). We next performed a selectively in Pten À / À MEFs with no detectable level of apoptosis bioinformatics analysis in Ptenpc þ / þ and Ptenpc À / À tumours at dosage below 30 mM. Inhibition of proliferation in cells treated to identify transcription factors (TFs) responsible for CK2 mRNA with two CK2 inhibitors, quinalizarin24 and CX-4945 (ref. 25) upregulation. Towards this end, we analysed which of the most was similar to that of the cells treated with the MDM2 inhibitor, upregulated TFs in Ptenpc À / À tumours could also bind the CK2

Figure 2 | CK2 transcription and protein levels are upregulated in Ptenpc À / À tumour cells and STAT3 controls CK2 transcription. (a) Western blot analysis and quantification of CK2 and Pten protein levels in primary Ptenfl/fl and Pten À / À MEFs (upper panel) and Ptenpc þ / þ normal prostates and Ptenpc À / À prostate tumours (10–12weeks of age) (lower panel). (b) mRNA levels of CK2 in primary Ptenfl/fl and Pten À / À MEFs (upper panel) and Ptenpc þ / þ normal prostates and Ptenpc À / À prostate tumours (10–12weeks of age) (lower panel). (c) Immunofluorescence staining for pAKTSer129 in Ptenpc þ / þ and Ptenpc À / À tumour sections. Western blot shows the protein level of Pten and pAKTSer129 in Ptenpc þ / þ normal prostates and Ptenpc À / À prostate tumours (10–12weeks of age). Scale bar: 100 mM. (d) Heat map representation of the most upregulated and downregulated TFs predicted to bind to the CK2 promoter in Ptenpc þ / þ normal prostates and Ptenpc À / À prostate tumours (n ¼ 6). (e) IHC analysis of 12-week-old prostates from Ptenpc þ / þ and Ptenpc À / À tumours, stained for total STAT3, pSTAT3Ser727 and pSTAT3Tyr705. Magnification in all panels is Â 40. Insets in all panels show the Â 10 magnification Scale bar, 50 mM. (f) pSTAT3Ser727 and pSTAT3Tyr705 quantification of the experiment shown in e (n ¼ 4). (g) mRNA levels of CK2a in normal prostates and prostate tumours of the indicated genotypes. (h) Transcript levels of CK2a in Ptenfl/fl and Pten À / À MEFs treated with or without the JAK2/STAT inhibitor, NVP-BSK805. (i) Schematic representation of the CK2a promoter region (upper panel) and the ChIP assay performed in Pten À / À MEFs to confirm the Stat3 binding to the CK2a promoter (lower panel). Arrows indicate the length and position of the primers used in the experiment (j) Luciferase assay showing the promoter activity of human CK2a in cells treated with and without the JAK2/STAT inhibitor, NVP-BSK805. (k) Schematic representation of the mutated human STAT3-binding sites in the CK2 promoter region (upper panel) and luciferase activity (lower panel). Images (a,b,f,g,h,j,k) Data are represented as mean±s.d., nZ3(*Po0.05,**Po0.01, ***Po0.001). P value indicates the statistical significance as measured by Student’s t-test.

4 NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 ARTICLE promoter and identiﬁed three different STAT family members as Amongst these three STAT family members, signal transducer candidate TFs (Fig. 2d). In response to cytokines and growth and activator of transcription 3, Stat3 was strongly factors, STAT proteins are phosphorylated by receptor-associated phosphorylated at both Ser727 and Tyr705 in Ptenpc À / À kinases and then form homo- or heterodimers that translocate to tumours as compared to the Ptenpc þ / þ normal prostates the nucleus, where they act as transcriptional activators31. (Fig. 2e,f), whereas Stat1 and Stat2 were barely detectable by

+/+ +/+

pc pc

acb ** * pc+/+ pc–/– 4 4 Pten Pten Pten Pten pAKT(Ser129) 60 kDa CK2α 42 kDa 3 3 Pten (Ser129) Pten 54 kDa 2 2 54 kDa β-actin MEFs pAkt protein levels β-Actin mRNA levels α 42 kDa α 42 kDa

(fold change) 1 (fold change) 1 fl/fl –/– CK2 pc+/+ pc–/– Pten Pten CK2 Pten Pten 0 0 d Ptenfl/fl Pten–/– Ptenfl/fl Pten–/– Csnk2a1 Irf1 Ddit3 Ikzf1 5 5 Irf1 *** *** Jun α 42 kDa 4 CK2 4 Up in Stat1 Stat1 Pten 54 kDa 3 3 Stat2 Rreb1

Tissues 2 2 Stat3

Hsp90 protein levels 90 kDa mRNA levels α α Cebpb (fold change)

pc+/+ pc–/– (fold change) 1 Pten Pten 1 Nr2f6

CK2 Mef2c CK2 0 0 Mef2c Ptenpc+/+ Ptenpc–/– Ptenpc+/+ Ptenpc–/– Creb1 Down in

e H&E Stat3 pStat3Ser727 pStat3Tyr705 f pStat3Ser727 pStat3Tyr705 90

+/+ 80

pc ×10 ×10 ×10 ×10 *** ** 70

Pten 60 ×40 ×40 ×40 ×40 50 40 30 –/–

pc ×10 ×10 ×10 ×10

% Of positive cells 20 10 Pten ×40 ×40 ×40 ×40 0 Ptenpc+/+ Ptenpc–/– g h i –1,500 +500 –600 –500 +100 –1,800 –1,700 –1,600 –1,200 –1,100 –1,000 –900 –800 –700 –400 –300 –200 –100 +1 +200 +300 –1,400 –1,300 +400 –2,500 –2,300 –2,200 –2,100 –2,400 –2,000 –1,900 6 ** ** 4 –2,500 bp +500 bp 5 *** ** –2,184/–2,083 –1,228/–1,122 Predicted STAT3 binding sites 3 4 TSS

3 2 Fold enrichment Fold enrichment mRNA levels

mRNA levels 0 0.5 1.0 1.5 2 01 234 56 α 2 α (fold change)

(fold change) 1 Stat3 Stat3 CK2 1 CK2

0 0 IgG IgG ** pc+/+ pc–/– pc–/– NVP-BSK805 –+ –+ Pten Pten Pten ; fl/fl –/– Stat3pc–/– Pten Pten –100 –200 +500 –0 –300 –400 j k –500

700 –500 bp +500 bp M1 M2 M3 M4 M5 600 *** *** Predicted STAT3 binding sites 500 1.4 TSS 1.2 400 M = mutated 1 300 0.8 200 0.6 ** 100 *** ** % Renilla luciferase activity 0.4 0 0.2 EV hCK2pEV hCK2p 0 NVP-BSK805 – –++ Luciferase activity (fold changes) WT M1 M2 M3 M4 M5

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 5 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 western blot analysis. Interestingly, Stat3 protein and mRNA CK2 inhibition enhances senescence by stabilizing Pml level. levels were also strongly increased in Ptenpc À / À tumours (Fig. 2e We next sought to characterize the mechanism responsible for and Supplementary Fig. 4c). These data suggest that the activation the increased senescence in Pten À / À MEFs upon CK2 inhibition. of Stat3 in Ptenpc À / À tumours may control CK2 transcription. Recent evidence suggests that CK2 control the ubiquitin mediated To genetically validate this hypothesis, we intercrossed Ptenlx/lx; degradation of PML, a known regulator of senescence in PbCre þ mice with Stat3lx/lx mice to generate Ptenpc À / À ; cancer34,35. Given the high CK2 levels in Pten À / À cells, we Stat3pc À / À mice. Inactivation of Stat3 in Ptenpc À / À tumours therefore checked Pml protein levels and found that Pml was (Supplementary Fig. 4d,e) decreased the mRNA levels of CK2 to decreased in Pten À / À cells as compared to the Ptenfl/fl cells the levels of the Ptenpc þ / þ normal tissue (Fig. 2g). CK2 mRNA (Fig. 3a and Supplementary Fig. 6a). Interestingly, treatment of levels were also strongly decreased in Pten À / À MEFs treated Pten À / À cells with quinalizarin24 increased the protein levels of with NVP-BSK805, an inhibitor of the JAK2–STAT3 pathway32 Pml, the SA-b-gal staining and enhanced the average size of Pml (Fig. 2h). To further validate the role of Stat3 in the regulation nuclear bodies (Fig. 3b,c). Next, we assessed Pml stability in of CK2 transcription, we carried out a chromatin Pten À / À MEFs and found that Pml half-life was significantly immunoprecipitation experiment in Pten À / À cells and detected decreased as compared to the Ptenfl/fl MEFs (Fig. 3d). However, a significant enrichment of Stat3 at the CK2 promoter in inhibition of CK2 by quinalizarin increased the stability of Pml correspondence to a predicted STAT responsive element (Fig. 2i). protein in Pten À / À cells treated with cycloheximide, restoring As a positive control for this experiment, we used Socs3, a Pml and p53 levels (Fig. 3e). Note that under cycloheximide and previously characterized STAT3 target gene33 (Supplementary quinalizarin treatment, the mRNA levels of Pml did not change Fig. 4f). Experiments using a human CK2 promoter reporter (Supplementary Fig. 6b). Along this line, when Ptenfl/fl and confirmed that CK2 promoter activity was high in Pten À / À cells Pten À / À cells were treated with the proteasome inhibitor and that the inhibition of the Jak2/Stat3 pathway reduced CK2 MG132, the protein levels of Pml increased, demonstrating that promoter activity (Fig. 2j). Finally, we mutated five Stat3- Pml is degraded through the proteasome as previously reported34 predicted binding sites on the human CK2 promoter and we (Supplementary Fig. 6c). Importantly, Pml knocked down by found that three out of the five mutants showed a profound means of short interfering RNAs (siRNAs) blunted the reduction in the CK2 luciferase activity (Fig. 2k). In summary, senescence response in Pten À / À MEFs (Fig. 3f). Moreover, these data demonstrate that Stat3 binds to the CK2 promoter and treatment with the CK2 inhibitor, quinalizarin, in cells transfected increases CK2 transcription in both Pten À / À cells and tumours. with different siPML failed to induce any pro-senescence effect in As PTEN is frequently lost in patients with prostate cancer, we Pten null cells (Fig. 3f and Supplementary Fig. 6e,f). checked the correlation between PTEN, CSNK2A1 and STAT3 Taken together, these data suggest that CK2 upregulation mRNA levels in patients affected by advance prostate tumours by in Pten À / À cells favours the degradation of Pml, enabling a analysing two large microarray data sets. In the majority of fraction of cells to bypass PICS. Consistently, CK2 inhibition invasive prostate cancers (n ¼ 121), PTEN expression was potentiates senescence driven by Pten loss by stabilizing Pml significantly decreased as compared to the normal prostate protein levels. Finally, we checked the levels of PML and PTEN in samples (n ¼ 72; Supplementary Fig. 5a,b). These data reflect the a panel of prostate cancer cell lines and found a direct correlation high frequency of PTEN loss of heterozygosity in advanced between the level of PTEN and PML (Supplementary Fig. 6g). prostate tumours. Interestingly, we found a correlation between This was also associated with an increase in CSNK2A1 mRNA decreased PTEN expression and increased STAT3 and CSNK2A1 levels in PTEN-deficient cells (Supplementary Fig. 6h). mRNA levels in prostate cancer samples, in agreement with our We then checked in vivo whether CK2 upregulation in findings in mouse tumours (Supplementary Fig. 5a,b). Moreover, Ptenpc À / À tumours could drive attenuation of senescence CSNK2A1 overexpression and PTEN downregulation correlated in vivo. During an early stage of tumorigenesis, Ptenpc À / À with poor prognosis in patients affected by prostate cancer (both tumours develop high-grade prostatic intraepithelial neoplasia, disease-free survival and overall survival; Supplementary Fig. 5c characterized by a strong senescence response. However, at late and Supplementary Table 4). Taken together, these data stage, Ptenpc À / À tumours progress into more aggressive and demonstrate that the upregulation of CSNK2A1 is a common invasive tumours2. We therefore monitored CK2 activity and Pml feature of PTEN-deficient prostate tumours, emphasizing the levels in Pten null tumours at the onset of tumour invasiveness need to target CK2 for cancer prevention and therapy in these (mice at 15 weeks of age). Immunohistochemistry (IHC) revealed tumours. that within the Ptenpc À / À tumours the most invasive tumour

Figure 3 | CK2 inhibitors enhance senescence in Pten À / À MEFs by controlling PML levels. (a) Western blot analysis of prostate tissues for Pml in Ptenfl/fl and Pten À / À MEFs. (b) Western blot analysis for Pml protein levels (upper panel) and quantification (lower panel) in Ptenfl/fl and Pten À / À MEFs before and after treatment with the CK2i-Q. Representative images and quantification of SA-b-gal positivity in MEFs treated with vehicle and CK2i-Q. (c) Immunofluorescence staining for Pml in Ptenfl/fl and Pten À / À MEFs before and after treatment with the CK2i-Q. Quantification of the Pml bodies average size and s.d. is included in the panels. Scale bar, 5mM(d) Western blot analysis (upper panel) and quantification (lower panel) of Pml protein levels in primary Ptenfl/fl and Pten À / À MEFs after treatment with cycloheximide at different time points (0, 2, 4, 6 h) (e) Western blot analysis for PML and p53 in primary Ptenfl/fl and Pten À / À MEFs treated with both CK2i and cycloheximide at two different time points 4 and 6 h. (f) WB for Pml and Pten (upper panel) and SA-b-gal quantification for Ptenfl/fl and Pten À / À MEFs transfected with a siPml and treated with the CK2i-Q. WBs have been run on two different gels (g) IHC staining and quantification for PML, Ki-67 and pAKTSer129 in both PIN and invasive areas from Ptenpc À / À tumours at 15 weeks of age. Six samples per group were analysed. Invasive areas were defined using the following criteria: high percentage of Ki-67 staining and invasion of the stroma by the tumour epithelial cells. Scale bar, 50 mM(h) Percentage of mice affected with invasive prostate cancer in Ptenpc À / À tumours at different stages (n ¼ 10). (i) Western blot analysis for Pml and Pten in Ptenpc À / À tumours at different stages (1, 4 and 6 months). Ptenpc þ / þ normal prostate at 6 months is used as control (j) IHC staining (left panel) and quantification (right panel) of p16-positive cells in Ptenpc À / À tumours at different stages (1, 4 and 6 months). Inset shows the negativity for p16 staining in Ptenpc þ / þ normal prostate at 6 months. Scale bar: 50 mM. Images (b,e,f,g,h). Data are represented as mean±s.d. nZ3 (**Po0.01, ***Po0.001). P value indicates the statistical significance as measured by Student’s t-test. H&E, haematoxylin and eosin; Pos., positive.

6 NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 ARTICLE glands were characterized by high CK2 activity (assessed by stages, demonstrated that Pml levels progressively decreased pAKTSer129), high Ki-67 staining and low Pml protein levels, during tumour progression (Fig. 3h,i). Moreover, decreased Pml whereas the less aggressive glands displayed high levels of Pml levels correlated with a reduced percentage of p16-positive cells in and both low CK2 activity and Ki-67 positivity (Fig. 3g). A the tumours and an increased tumour invasiveness (Fig. 3j). further time-course analysis in Ptenpc À / À tumours at different These data suggest that activation of CK2 in Ptenpc À / À tumours

a b Pten–/– c Ptenfl/fl Pten–/– Merge Pml DAPI 300±9 nm CK2i – + – + Vehicle fl/fl Pml 106 kDa Pml 106 kDa Pten

Pten 54 kDa 54 kDa 390±11 nm Pten CK2i

HSP90 90 kDa +CK2i

50 kDa fl/fl α-Tubulin fl/fl –/– Pten Pten Pten 1.6 250±14 nm 1.4 80 ** ** –/– 1.2 1 60 0.8 Pten 0.6 40 750±13 nm

0.4 -gal positive cells Fold change in protein levels 0.2 −β 20 0 +CK2i CK2i – + – + 0 –/–

fl/fl –/– Vehicle CK2i Pten Pten Pten % of SA

def Ptenfl/fl Pten–/– Ptenfl/fl Pten–/– Ptenfl/fl Pten–/– Pten–/– Pten 54 kDa Pml 106 kDa Pml 106 kDa Pml 106 kDa β-Actin 42 kDa p53 β 53 kDa -Actin 42 kDa CHX 06204 2 4 6 β-Actin siPml – + – + – + – + Time (Hrs) 42 kDa CK2i – –– –+ +++ Ptenfl/fl Pten–/– ++++CHX fl/fl –/– fl/fl –/– 1.4 Pten Pten Pten Pten ––++CK2i 1.2 50 ** 466 4 Time (h) *** *** 1 40 0.8 30 -gal pos.cells

0.6 β 20 10

PML protein levels 0.4 062 4 0 Time (h) siPml – + – + – + – + % Of SA- CK2i – –––+ +++

pc–/– pc+/+ pc–/– g Pten 35 ** h i Pten Pten Ptenpc–/– PIN Invaisve area 30 120 25 Pml 106 kDa 20 100 15 80 Pten 10 H&E 60 54 kDa 5 40 Ki-67 pos. cells (%) 0 β-Actin PIN Invasive 20 42 kDa ×10 % Of mice with Pca 70 area 0 ×40 ×40 ** Time – 164 Time – 164 60 (months) (months) 50 40 p16 30 j ×40 ×40 Ptenpc–/– 20 Ptenpc+/+ 1 35 Pml pos. cells (%) 10 *** *** *** 0 30 PIN Invasive ×40 25 area 14 ** 20 12 15 Pml Ki-67 H&E 10 10 ×40 ** 8 Time (months) 5 % Of p16 pos. cells

×40 ×40 pos. cells (%) 6 0 Ser129 4 64 Time – 164 Ser129 2 (months) pAkt 0 ×40 pAkt PIN Invasive PIN Invasive area area

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 7 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227

a CK2i Analysis b Ptenpc–/– Ptenpc–/– +CK2i 8w 12w 2.5 120 *** ** ** ** 2.0 100 80 1.5 60 1.0 40 0.5 20 Relative tumour size Vehicle CK2i 0 % Of glands with PIN 0 Ptenpc–/– Ptenpc–/– AP VP DLP c Ptenpc–/– Ptenpc–/– +CK2i-CX d +CK2i

25 14 ** 50 ** *** ×10 ×10 12 40 20 H&E 10 8 30 15 ×40 ×40 pos. cells (%) 6 20 10

4 Ser129 10 5 p16 pos. cells (%) ×10 ×10 Ki-67 pos. cells (%) 2 Ki-67 0 0 pAKT 0 Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– ×40 ×40 +CK2i +CK2i +CK2i 70 ** 35 ** 70 ** 60 30 60 ×10 ×10 50 25 50 p16 40 20 40 pos. cells (%) pos. cells (%) 30 15 30 ×40 ×40 Tyr705 Ser727 20 10 20 10 5 Pml pos. cells (%) 10 pStat3 pStat3 0 0 0 ×10 ×10 Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– Ptenpc–/– PML +CK2i +CK2i +CK2i 70 ×40 ×40 e PML p53 60 Ptenpc–/– 3.5 ** ** 50 3.0 PML 106 kDa 2.5 ×10 ×10 40 Ser727 p53 53 kDa 2.0 30 E-cad 120 kDa 1.5

Stat3 1.0 20 Veh. CK2i ×40 ×40 0.5 CK2 pos. cells (%) 10 0 0 Veh. + – +– Ptenpc–/– Ptenpc–/– Protein level (fold change) CK2i –++ – ×10 ×10

Tyr705 +CK2i f SA-β-gal

Stat3 50 40X ×40 ** 40 30

×10 ×10 20 Ser129 ×10 10 -gal pos. cells (%) β pAkt Ptenpc–/– Ptenpc–/– +CK2i 0 pc–/– pc–/–

g SA- Pten Pten ×40 ×40 Cleaved caspase-3 3.5 * +CK2i 3.0 2.5 ×10 ×10 2.0

CK2 1.5 1.0 ×40 ×40 ×40 ×40 pos. cells (%) 0.5 pc–/– pc–/– Cleaved caspase-3 0 Pten Pten +CK2i Ptenpc–/– Ptenpc–/– +CK2i Figure 4 | The CK2 inhibitor, CX-4945, potentiates senescence by blocking tumour progression in Ptenpc À / À mice. (a) Schedule of treatment used in the preclinical trial with the timing of the drug administration in the Ptenpc À / À mice (n ¼ 12). (b) Quantification (left panel) of relative tumour size (APs) and percentage of PIN-affected glands in the anterior (AP), ventral (VP) and dorsolateral (DLPs) prostates of Ptenpc À / À mice in the two treatment groups. (c) Histopathological analysis of Ptenpc À / À prostate tumours before and after treatment with CK2i-CX and stained as indicated: H&E, Ki-67, p16, Pml, pAKTSer129, pStat3Tyr705, pStat3Ser727 and CK2. Original magnification, Â 40; insets show the Â 10 magnification. Scale bar, 50 mM. (d) Quantification of c. Sections from three mice were counted for each treatment group. (e) Representative western blot analysis for Pml and p53 protein levels in Ptenpc À / À tumours treated with vehicle or CK2i-CX and quantification of protein levels. (f)SA-b-gal staining of Ptenpc À / À tumours from vehicle and CK2i-treated mice and the percentage of SA-b-gal positive cells is represented as a bar graph. (g) IHC staining and quantification of cleaved caspase-3 in Ptenpc À / À tumours before and after treatment with CK2i-CX. Imaged (b,d,g) data are represented as mean±s.d. nZ3(*Po0.05,**Po0.01, ***Po0.001). P value indicates the statistical significance as measured by Student’s t-test. H&E, haematoxylin and eosin; Pos., positive.

8 NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 ARTICLE drives a concomitant downregulation of Pml resulting in models26,40,41 and from the identification of CK2 inhibitors that attenuation of senescence and promotion of tumour progression. show high selectivity in PTEN-deficient cells and tumours. Our screening approach coupling a small-molecule screening with a shRNA screen has allowed us to focus on a target that has been Inhibition of CK2 enhances senescence in Ptenpc À / À tumours. identified in both the screens, using complementary We next evaluated in a preclinical trial in vivo, whether the methodologies. Given that the tumour immune response is an inhibition of CK2 could block tumour progression in Ptenpc À / À essential component of the tumour suppressive function of mice by stabilizing Pml protein levels and promoting senescence. senescence in cancer, these compounds could be tested in the To block CK2 in vivo, we used CX-4945, a novel CK2 inhibitor in 25 pc–/– clinic either alone or in combination with compounds that clinical development . CX-4945 was administered to Pten activate the tumour immune response or reprogramme the mice at 8 weeks of age for 5 weeks (Fig. 4a). Interestingly, senescence-associated secretory phenotype as recently CX-4945 treatment decreased both tumour size and the number demonstrated from our group7,42. In this respect, we envisioned of PIN-affected glands in all the mouse prostate lobes analysed that our screening platform may also be implemented with (Fig. 4b). This was associated with decreased staining of Ki-67, different immune assays. For example, the conditioned media pStat3Tyr705, pStat3Ser727 and increased p16 staining (Fig. 4c,d). Ser129 pc À / À obtained from MEFs treated with selected pro-senescence Disappearance of pAKT staining in Pten tumours compounds might be transferred on different immune cell treated with CX-4945 was used as sign of impaired CK2 activity subtypes to assess their immunostimulatory capabilities. b (Fig. 4c,d). Strikingly, Pml and p53 protein levels and SA- -gal Mechanistically, our findings have also identified a previously staining were also increased in Ptenpc–/– tumours treated with unknown STAT3–CK2–PML network that can be targeted to CX-4945 (Fig. 4e,f). Finally, staining by caspase-3 revealed no enhance senescence in cancer. While CK2 acts by promoting major difference (0.5 versus 1.5% of positive cells per section) in tumorigenesis in different settings, its role as senescence regulator apoptosis between the treatment groups, suggesting that the main in PTEN-deficient tumours remained elusive. It has been shown function of CX-4945 in Ptenpc–/– tumours is to enhance that CK2 controls proliferation and apoptosis by promoting the senescence rather than apoptosis (Fig. 4g). These findings phosphorylation of several proteins including p53 (ref. 43). substantiate the pro-senescence potential of CX-4945 in a Intriguingly, although CK2 is upregulated in several cancers, the genetically engineered mouse prostate model and identify a mechanism underlying such upregulation was ambiguous. In this novel effective pro-senescence compound for prostate cancer respect, our findings demonstrate that activity of the JAK/STAT3 therapy. Our findings also point to CK2-induced PML pathway, one of the most commonly deregulated pathways in downregulation as a prominent mechanism of senescence cancer, resulted in CK2 overexpression, thus providing one of the attenuation and tumour progression in Pten null tumours. This mechanisms by which CK2 level is increased in cancer. Another is particularly noteworthy for human prostate cancer, where p53 intriguing finding of this study is the discovery that Pten null function often remains functional even in advanced tumours, 36 tumours at the late stage of tumorigenesis exhibit decreased levels whereas PML levels are often found decreased . of the tumour suppressor Pml, an essential regulator of oncogene induced senescence5. Previous evidence demonstrates that the Discussion Ptenpc À / À mice develop senescence in tumours at an early stage; Since the first discovery that senescence could be enhanced in however, the majority of these tumours eventually progress to cancer cells, great effort has been made to identify novel pro- invasive prostate cancer bypassing the initial senescence response senescence compounds for cancer therapy. However, few small driven by Pten loss. Our time-course analysis in Pten null molecules have been identified so far that enhances senescence in tumours analysed at different stages demonstrates that Pml levels tumours. Moreover, the majority of these molecules do not show decrease during tumour progression in parallel with p16 staining selectivity for tumour cells and the risk of toxicity for cancer positivity a marker of senescence. Importantly, we also detected patients remains high. These targeted compounds include increased levels of pAKTSer129 staining, a marker of CK2 kinase inhibitors of MDM2, MYC or CDK4, genes frequently deregu- activation in tumour regions with low level of Pml. This is lated in cancer, which also play a central role for the functional consistent with a model in which CK2 upregulation and Pml integrity of normal cells3. Senescence enhancement in normal downregulation contribute to senescence evasion in Pten null cells may therefore increase the risk of organ toxicity in patients tumours. Thus, in agreement with a model of intratumor affected by cancer. Thus, identifying small-molecule inhibitors heterogeneity, Pten loss promotes a senescence response that that increase senescence in cancer cells without affecting normal opposes tumour progression. However, a subset of Pten null cells cells is an attractive strategy for cancer therapy. Senescence is a upregulates CK2 that in turn promotes the evasion of cellular stable cell growth arrest which promotes tumour inhibition. senescence by decreasing the level of Pml (Supplementary Fig. 6i). Moreover, recent findings demonstrate that senescent tumour We believe that this mechanism may further contribute to the cells can be recognized and removed from cancerous tissues by senescence evasion mediated by tumour-infiltrating myeloid cells components of both the adaptive and the innate immunity37,38. in Pten null tumours7. Therefore, both cell autonomous and non- Indeed, senescent tumours cells are characterized by a autonomous mechanisms can promote senescence evasion in senescence-associated secretory phenotype that can recruit and tumours, suggesting that to design more efficient pro-senescence activate the tumour immune response37,39. Therefore, in stark therapies for cancer, novel compounds should target both cell contrast with current therapies (for example, chemotherapy) that intrinsic and extrinsic factors. mainly induce an apoptotic response, an effective pro-senescence The existence of this novel PTEN–STAT3–CK2 network has therapy is expected to induce both a potent cell growth arrest and also been validated in patients affected by prostate cancers a specific antitumour immune response, thereby resulting in through a bioinformatics analysis. Although we cannot rule out immune mediated tumour clearance. Here, we report the results the possibility that additional genes may cooperate with PTEN of a screening strategy developed to identify pro-senescence loss to drive tumour progression, and demonstrate that the compounds acting on a specific and relevant genetically defined inhibition of CK2 is highly effective in blocking tumour subset of cancers, such as PTEN null tumours. The validity of this development by enhancing senescence. Our results also indicate approach is supported by the effective identification of drug– the need to monitor PTEN and CK2 status in clinical studies and genotype associations already established in previous preclinical highlight the importance of testing CK2 inhibitors alone or in

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 9 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 combination with standard therapies in cancer patients. These (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700). Genomic DNA from the drugs have acceptable toxicity profiles and are currently in clinical non-Adenovirus-infected cells after two further days of culture was isolated by trials for different types of cancer25,44,45. In sum, our findings incubation for 4 h with lysis buffer (200 mM NaCl, 50 mM Tris, 10 mM EDTA, 1% SDS) containing proteinase K (500 mgmlÀ 1) and RNase A (83 mgmlÀ 1)at58°C, provide new insight into the mechanisms that regulate senescence followed by precipitation with NaCl/isopropanol and washing with 70% ethanol. evasion and encourage further efforts to screen for small The Adenovirus-infected cells were passaged every 3 days for a further 16 days molecules that could prove useful for pro-senescence therapy before genomic DNA isolation. To maintain representation of the shRNA library in 6 for cancer. the population, at least 5 Â 10 cells were utilized for genomic DNA isolation. To amplify the integrated shRNAs from the genomic DNA, PCR was conducted using a common forward primer containing sequencing adaptors and one of three Methods reverse primers containing a barcode sequence specific for the experimental Mouse crosses and MEF production. Ptenloxp/loxp mice were crossed with condition, as well as sequencing adapters. Forward primer 50–30 (bold highlights PB-Cre4 transgenic mice to generate prostate-specific deletion of Pten as previously sequence of homology to pLKO.1): reported1. MEFs were obtained by crossing male Ptenloxp/loxp mice with female 50-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG Ptenloxp/loxp female. A pregnant mouse at 13 or 14 day post coitum was sacrificed CTCTTCCGATCTATCTTGTGGAAAGGACGA-30 by cervical dislocation. Embryos were harvested and the individual MEFs were Reverse primers 50–30 (bold highlights Illumina Index six-nucleotide barcode cultured in DMEM containing 10% fetal bovine serum and 1% PenStrep. sequences and sequence of homology to pLKO.1): Primary Ptenlox/lox MEFs were infected with retroviruses expressing either 50-CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCA pMSCV-CRE-PURO-IRES-GFP or pMSCV-PURO-IRES-GFP for 48 h and GACGTGTGCTCTTCCGATCTATTCTTTCCCCTGCACT-30 selected with Puromycin at a concentration of 3 mgmlÀ 1 and as previously 50-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAG described1. All mice were maintained under specific pathogen-free conditions in ACGTGTGCTCTTCCGATCTATTCTTTCCCCTGCACT-30 the animal facilities of the IRB institute, and the experiments were performed 50-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAG according to the state guidelines and approved by the local ethical committee. ACGTGTGCTCTTCCGATCTATTCTTTCCCCTGCACT-30 Genomic DNA (15 ng) was used as PCR template in a 50-ml reaction containing 2.5 nmol of each primer, 5 U of Dream Taq (Thermo Scientific), 5 nmol dNTPs and Human cancer cell lines. Human prostate cancer cell lines (Supplementary 34 cycles at annealing temperature 56 °C and extension temperature 72 °C. The Table 3) were obtained from ATCC and were cultured according to manufacturer amplified PCR product was purified by excision from an agarose gel and instructions. HCT116 isogenic cell line was a gift from Waldman lab. purification using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and subjected to 100 bp paired-end deep sequencing using an Illumina HiSeq 2000 Pro-senescence screening platform. The screening has been carried out in three machine. Bioinformatic analysis was used to identify each experiment using the steps. In the first step of the screening, compounds have been tested in triplicate in unique barcodes and to map each individual sequencing read from the experiment Pten À / À MEFs, plated in 96-well dishes, using a single drug concentration to an individual hairpin sequence. For identification of experimental hits, shRNAs (10 mM). Compounds that promoted a strong growth arrest in Pten null MEFs were first filtered for those represented by at least 200 reads at the early time point. (inhibition of proliferation Z50%) have been considered positive hits and passed the first filter of the screening (efficacy filter). Positive hits were retested in triplicate Western blotting and histology. Protein was isolated from whole MEFs cell fl/fl À / À at a single concentration (10 mM) in both Pten and Pten MEFs to assess pellets lysed with RIPA buffer and BCA protein assay reagent was used to growth arrest in both cell types (specificity filter). Compounds that pass the determine the protein concentration. The following antibodies were used wt À / À cell_specificity filter (inhibition of proliferation for Pten r20% and for Pten for western blotting: p21, p16, PAI-1 (Santa Cruz), CK2a, Pten, Hsp90 (Cell Z50%) were validated in duplicate in a dose–response assay in MEFs plated in Signalling), PML (Millipore), p53 (Clone IMX25, Accurate Chemical Corp), 96-well dishes, to evaluate specificity at different concentrations (0.03–100 mM). pAKTSer129 was produced in rabbit30, b-actin (Sigma) and E-cadherin (BD Only the compounds having an optimal window of inhibition passed this filter Biosciences). Secondary antibodies for mouse and rabbit were purchased from GE (dose optimization filter). Finally, the compounds that passed all the filters were Healthcare. All dilutions are 1:1,000, except that b-actin antibody dilution is evaluated for SA-b-gal staining at three different concentrations in MEFs plated in 1:5,000 and Secondary antibody dilution is 1:5,000. Full gel scans are shown in 12-well dishes. Data shown refer to a single concentration (compound IC50). Data Supplementary Fig. 7. For IHC and immunofluorescence, the tissues were were normalized according to the negative control (dimethyl sulfoxide 100%). embedded in 37% formaldehyde and embedded in paraffin for sectioning. Nutlin-3, a previously characterized pro-senescence compound26 was used as a positive control. Concentration response was analysed with XLfit (IDBS) by using four parameters logistic model. CK2 shRNAs and PML siRNA transfection protocol. Mouse CK2 pLKO shRNA vectors were obtained from Sigma. Using 293T HEKs, lentiviral particles were produced for negative control or shRNA vectors. MEFs were harvested after 72 h of Proliferation and senescence assay. Four days after treatment, MEFs were fixed infection for western blotting and SA-b-gal activity. shRNA sequences: 50-CCGG for 20 min in a solution of buffered formalin (3.7%), washed with PBS (pH 7.3) and ACCTGTCAGCAGCGCCAATATCTCGAGATATTGGCGCTGCTGACAGGT subsequently stained with a 0.01% crystal violet solution. After removing excess TTTTTG-30 (Clone ID:NM_007788.3-1293s21c1) and 50-CCGGGCAATTGTAC stain, the crystal violet stained cells were dissolved in 1 ml of 10% SDS solution CAGACGTTAACCTCGAGGTTAACGTCTGGTACAATTGCTTTTTG-30 (Clone overnight and the optical density of the extracted dye was read with a spectro- ID:NM_007788.3-627s21c1). For the experiment with the PML siRNA, MEFs were photometer at 590 nm. In the senescence assay, cells were stained for SA-b-gal transfected 1 day after selection using a smart pool PML siRNA (GE Healthcare, activity, four days after treatment, using a senescence detection kit (Calbiochem). Dharmacon) and sequences of the siRNA targeting Pml from Qiagen used are The number of blue stained cells were counted and normalized to the DAPI- 50-CTGGATGTTCGATTCATGTAA-30 and 50-CCCAGCATATCTACTCCT positive cells. TTA-30.

Generation of lentiviral shRNA kinome library. An shRNA library in the Luciferase reporter gene assay. The promoter region of CSNK2A1 between pLKO.1 vector backbone comprising 3,280 shRNAs targeting 672 mouse kinases À 500 bp to þ 120 bp was cloned into a pGL4.24 luc2 vector to generate the was obtained from Sigma. A pooled DNA preparation of the library was generated CSNK2A1 reporter construct. Before transfection, immortalized MEFs were plated by growing bacterial cultures in deep-well 96-well plates inoculated from 96-well in 48-well plates and were co-transfected with CSNK2A1 reporter construct and a format bacterial glycerol stocks of the library. Culture medium was pooled and a control pGL4.27 renilla TK vector in triplicates. The ratio of reporter to control midi-prep (Machery Nagel Nucleobond 500 kit) was performed to isolate plasmid plasmid was 10:1. After 48 h of transient transfection, cell lysates were transferred DNA. Lentiviruses were produced by transfection of 293T cells with the pooled to 96-well plates and dual luminescence was measured using a Glo-Max library DNA together with psPAX2 and pMD2G (gift from Didier Trono, EPFL Luminometer (Promega). Different CSNK2A1 mutants were generated by PCR Lausanne) and harvesting of culture supernatant between 48 and 72 h after mutagenesis. Primers used are shown in Supplementary Table 5. transfection. Medium was filtered through a 0.45-mm filter and aliquots were frozen at À 80 °C. Virus titre was determined by infecting NIH3T3 cells with serial dilutions of the virus and assaying colony formation in the presence of puromycin Chromatin immunoprecipitation assay. Immortalized MEFs were grown in T-75 (4 mgmlÀ 1). flasks to a confluence of 90–95% and cells were fixed with 37% formaldehyde for 10 min and glycine for 5 min at room temperature. Nuclear extracts were sonicated using a Misonix 3,000 model sonicator to sheer crosslinked DNA to an average Kinome library screening. Primary MEFs (5 Â 106) derived from Ptenfl/fl mice fragment size of B500 bp. Sonicated chromatin was incubated for 16 h at 4 °C with were cultured in an incubator maintained at 5% CO2 and infected with the pooled magnetic protein A beads (Millipore) conjugated with either anti-Stat3 antibody mouse kinome lentiviral library at a multiplicity of infection of one functional viral (Cell Signalling) or mouse IgG antibody (Millipore) by incubating overnight at 4 °C particle per cell in the presence of polybrene (8 mgmlÀ 1). Two days later, cells were on a rotor. After incubation, beads were washed thoroughly and then centrifuged. split in three into medium containing puromycin (4 mgmlÀ 1) alone to select for The chromatin was eluted from the beads, and crosslinks were removed by virally infected cells or puromycin together with Adenovirus expressing GFP incubation at 65 °C for 5 h. DNA was then purified using the QIAquick PCR

10 NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications & 2015 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227 ARTICLE

Purification Kit (Qiagen). DNA was used to detect Stat3 binding to CK2 promoter References sequences by qRT-PCR. The ChIP primers (50-CAGCTGACAAACTGTAAAAG 1. Alimonti, A. et al. Subtle variations in Pten dose determine cancer GGG-30 and 50-TGGGTTATTTCTGTACCAGCCATT-30) were designed to susceptibility. Nat. Genet. 42, 454–458 (2010). amplify a region containing the putative Stat3-binding site ( À 1,228/ À 1,122 bp) in 2. Chen, Z. et al. Crucial role of p53-dependent cellular senescence in suppression 0 the mouse CK2 promoter As an internal negative control, the primers (5 -ATC of Pten-deficient tumorigenesis. Nature 436, 725–730 (2005). 0 0 CAGGATTATCAGGTTCAATTT-3 and 5 -AGAGGTCTATGTCTGGGGGTG 3. Nardella, C., Clohessy, J. G., Alimonti, A. & Pandolfi, P. P. Pro-senescence 0 TAG-3 ) were designed such that there is no putative Stat3-binding site ( À 2,184 to therapy for cancer treatment. Nat. Rev. Cancer 11, 503–511 (2011). À 2,083 bp). Primers pair used for positive control Socs3 are 50-CCCTTGCAG 0 0 0 4. Xue, W. et al. Senescence and tumour clearance is triggered by p53 restoration TTCTAAGTTCAACA-3 (forward) and 5 -ACCTTTGACAAGCGGACTCTC-3 in murine liver carcinomas. Nature 445, 656–660 (2007). (reverse). 5. Pearson, M. et al. PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature 406, 207–210 (2000). Quantitative real-time PCR. Quantitative real-time PCR was performed on 6. Guengerich, F. P. Mechanisms of drug toxicity and relevance to pharmaceutical RNA extracted from MEFs and prostatic tissues by using Trizol (Invitrogen) in development. Drug Metab Pharmacokinet. 26, 3–14 (2011). triplicates. Complementary DNA was prepared with SuperScript III First-Strand 7. Di Mitri, D. et al. Tumour-infiltrating Gr-1 þ myeloid cells antagonize Synthesis SuperMix (Invitrogen). Primers sequences used for p21, PAI-1, STAT3 senescence in cancer. Nature 515, 134–137 (2014). and p16 are reported previously42 and primers used for Pml forward 50-CAGGCC 8. Liu, H., Li, Y. & Raisch, K. P. Clotrimazole induces a late G1 cell cycle arrest 0 0 0 CTAGAGCTGTCTAAG-3 , reverse 5 -ATACACTGGTACAGGGTGTGC-3 ; and sensitizes glioblastoma cells to radiation in vitro. Anticancer Drugs 21, 0 0 0 Csnk2a forward 5 -AGGATAGCCAAGGTTCTGGGA-3 , reverse 5 -CCATCGCT 841–849 (2010). 0 0 TACGGGAGTGTC-3 ; CSNK2a forward 5 -GGTGGAATGGGGAAATCAA 9. Furtado, C. M., Marcondes, M. C., Sola-Penna, M., de Souza, M. L. & Zancan, 0 0 0 GAT-3 , reverse 5 -TGATGATGTTGGGACCTCCTC-3 . P. Clotrimazole preferentially inhibits human breast cancer cell proliferation, viability and glycolysis. PLoS ONE 7, e30462 (2012). Half-life determination and proteasome inhibitor. MEFs were treated at 10. Bilir, A. et al. Enhancement of vinorelbine-induced cytotoxicity and apoptosis 20 mgmlÀ 1 concentration of cycloheximide and harvested at different time points by clomipramine and lithium chloride in human neuroblastoma cancer cell line for the analysis by western blotting. Proteosomal inhibitor MG132 was used at SH-SY5Y. J. Neurooncol. 100, 385–395 (2010). 10 mM in MEFs. 11. Yang, J. L. & Friedlander, M. L. Effect of nifedipine in metastatic colon cancer with DNA mismatch repair gene defect. Lancet 357, 1767–1768 (2001). 12. Meng, F., Sun, G., Zhong, M., Yu, Y. & Brewer, M. A. Anticancer efficacy of PTEN and CK2 mRNA levels in human prostate cancer data sets. Expression values for PTEN, CK2 and STAT3 were downloaded for Wallace46 and Singh47 cisplatin and trichostatin A or 5-aza-2’-deoxycytidine on ovarian cancer. Br. J. prostate cancer data sets from Oncomine database48. Expression values for PTEN Cancer 108, 579–586 (2013). and CK2, as well as clinical information and follow-up was downloaded for Setlur49 13. Vigushin, D. M. et al. Trichostatin A is a histone deacetylase inhibitor with and Glinsky50 data sets from Oncomine database. PTEN/CK2 mRNA ratio was potent antitumor activity against breast cancer in vivo. Clin. Cancer Res. 7, calculated per each sample and patients were stratified into three groups by 971–976 (2001). dividing the dataset into four percentiles (from highest to lowest value). Patients 14. Li, F. et al. Garcinol sensitizes human head and neck carcinoma to cisplatin in a with lowest ratio values (1st percentile) were ascribed to group low (L), patients xenograft mouse model despite downregulation of proliferative biomarkers. with intermediate values (2nd and 3rd percentiles) were ascribed to group Oncotarget 6, 5147–5163 (2015). intermediate (I) and patients with highest values (4th percentile) were ascribed to 15. Cozza, G. et al. Cell-permeable dual inhibitors of protein kinases CK2 and group high (H). Statistical analysis such as t-test, Pearson correlation and Kaplan– PIM-1: structural features and pharmacological potential. Cell. Mol. Life Sci. 71, Meier curves were done using Stata 12.1 software. 3173–3185 (2014). 16. Martins, L. R. et al. Activity of the clinical-stage CK2-specific inhibitor CX-4945 Differential expression of TFs. Expression values for TFs in Ptenpc þ / þ normal against chronic lymphocytic leukemia. Leukemia 28, 179–182 (2014). prostates and Ptenpc À / À tumours was downloaded from Gene Expression 17. Mateo, A. A.. et al. Synthesis of phenazine derivatives for use as precursors to Omnibus database under the GSE24691 identifier, and the data have been electrochemically generated bases. A. Org. Biomol. Chem. 3, 2832–2841 (2005). previously reported51. t-test analysis was done to extract TFs with significant 18. Roberson, R. S., Kussick, S. J., Vallieres, E., Chen, S. Y. & Wu, D. Y. Escape from differential expression between mouse genotypes. therapy-induced accelerated cellular senescence in p53-null lung cancer cells and in human lung cancers. Cancer Res. 65, 2795–2803 (2005). 19. Dabrowska, M., Mosieniak, G., Skierski, J., Sikora, E. & Rode, W. Methotrexate- Treatment with CK2 inhibitors . CK2 inhibitors used were CK2i-Q quinalizarin induced senescence in human adenocarcinoma cells is accompanied by (Sigma Aldrich), CK2i-CX (CX-4945 (Selleckchem)), K156 and K164 (ref. 15). induction of p21(waf1/cip1) expression and lack of polyploidy. Cancer Lett. CK2i-S (obtained in collaboration with Siena Biotech spa). CX-4945 sodium salt 284, 95–101 (2009). inhibitor administered in vivo treatment was synthesized by Shanghai Biochempartner Co. Ltd. Ptenpc À / À mice at 8 weeks of age were treated by oral 20. Orsini, M. J. et al. Metastin (KiSS-1) mimetics identified from peptide gavage with 75 mg kg À 1 of CX-4945 or vehicle twice daily. CX-4945 was diluted in structure-activity relationship-derived pharmacophores and directed small a solution with 25 mM NaH2PO4 buffer. After 4 weeks of treatment, prostate molecule database screening. J. Med. Chem. 50, 462–471 (2007). tumours were assessed for the size, number of PIN-affected gland and IHC. 21. Yip, K. W. et al. Benzethonium chloride: a novel anticancer agent identified by using a cell-based small-molecule screen. Clin. Cancer Res. 12, 5557–5569 (2006). Functional annotation of targets and pro-senescence compounds. All targets of 22. Chien, W. et al. Activation of protein phosphatase 2A tumor suppressor as the pro-senescence compounds were converted to HGNC compliant symbols and potential treatment of pancreatic cancer. Mol. Oncol. 9, 889–905 (2015). functionally annotated with experimentally biological processes comprised in gene 23. Sengupta, T. K. et al. Cytotoxic effect of 5-aminoimidazole-4-carboxamide-1- ontology (GO; 14.10.2014) and Reactome (18.10.2014) using ClueGO 2.1.4 (ref. 52) beta-4-ribofuranoside (AICAR) on childhood acute lymphoblastic leukemia and CluePedia 1.1.4 (ref. 52) within Cytoscape 3.1.1 (ref. 53). ClueGO analysis (ALL) cells: implication for targeted therapy. Mol. Cancer 6, 46 (2007). settings were set as follows: (i) Hierarchy levels ¼ 4 to 20, (ii) number of targets member of a biological process for the term to be mapped Z1, (iii) percentage of a 24. Cozza, G. et al. Quinalizarin as a potent, selective and cell-permeable inhibitor term covered by the targets Z3%, (iv) GO-term fusion was applied and GO-term- of protein kinase CK2. Biochem. J. 421, 387–395 (2009). grouping based on kappa score of 0.4 (similarity measure between the biological 25. Siddiqui-Jain, A. et al. CX-4945, an orally bioavailable selective inhibitor of processes). For each group of terms and for terms that could not be grouped, the protein kinase CK2, inhibits prosurvival and angiogenic signaling and exhibits biological process that accommodated the largest number of targets was selected as antitumor efficacy. Cancer Res. 70, 10288–10298 (2010). overview term. All other settings were used as per default. Senescence pathways 26. Alimonti, A. et al. A novel type of cellular senescence that can be enhanced in were extracted from a total of 25,517 gene sets (GSs) (http:// mouse models and human tumor xenografts to suppress prostate download.baderlab.org/EM_Genesets/May_14_2014/Human/symbol/ tumorigenesis. J. Clin. Invest. 120, 681–693 (2010). Human_GO_AllPathways_with_GO_iea_May_14_2014_symbol.gmt; 14.05.2014 27. Kim, J. S. et al. Mechanistic analysis of a DNA damage-induced, PTEN- and all curated GSs comprised in MSigDB v4.0 http://www.broadinstitute.org) by dependent size checkpoint in human cells. Mol. Cell. Biol. 31, 2756–2771 filtering the GSs’ names for senescence and senescent. Any senescence pathway that (2011). had targets of a pro-senescence compound as members was mapped on the 28. Niefind, K., Guerra, B., Ermakowa, I. & Issinger, O. G. Crystal structure of network. Thus, the network maps all pro-senescence compounds, the targets they human protein kinase CK2: insights into basic properties of the CK2 inhibit, and the biological processes and senescence pathway. holoenzyme. EMBO J. 20, 5320–5331 (2001). 29. Trembley, J. H., Wang, G., Unger, G., Slaton, J. & Ahmed, K. Protein kinase Statistical analysis. Data analysis was performed using a two-tailed unpaired CK2 in health and disease: CK2: a key player in cancer biology. Cell. Mol. Life Student’s t-test. Data are represented as mean±s.d. Sci. 66, 1858–1867 (2009).

NATURE COMMUNICATIONS | 6:7227 | DOI: 10.1038/ncomms8227 | www.nature.com/naturecommunications 11 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8227

30. Di Maira, G. et al. Protein kinase CK2 phosphorylates and upregulates 50. Glinsky, G. V., Glinskii, A. B., Stephenson, A. J., Hoffman, R. M. & Gerald, W. Akt/PKB. Cell Death Differ. 12, 668–677 (2005). L. Gene expression profiling predicts clinical outcome of prostate cancer. 31. Miklossy, G., Hilliard, T. S. & Turkson, J. Therapeutic modulators of STAT J. Clin. Invest. 113, 913–923 (2004). signalling for human diseases. Nat. Rev. Drug Discov. 12, 611–629 (2013). 51. Carver, B. S. et al. Reciprocal feedback regulation of PI3K and androgen 32. Baffert, F. et al. Potent and selective inhibition of polycythemia by the receptor signaling in PTEN-deficient prostate cancer. Cancer Cell 19, 575–586 quinoxaline JAK2 inhibitor NVP-BSK805. Mol. Cancer Ther. 9, 1945–1955 (2011). (2010). 52. Bindea, G., Galon, J. & Mlecnik, B. CluePedia Cytoscape plugin: pathway 33. Yang, J. et al. Reversible methylation of promoter-bound STAT3 by histone- insights using integrated experimental and in silico data. Bioinformatics 29, modifying enzymes. Proc. Natl Acad. Sci. USA 107, 21499–21504 (2010). 661–663 (2013). 34. Scaglioni, P. P. et al. A CK2-dependent mechanism for degradation of the PML 53. Smoot, M. E., Ono, K., Ruscheinski, J., Wang, P. L. & Ideker, T. Cytoscape 2.8: tumor suppressor. Cell 126, 269–283 (2006). new features for data integration and network visualization. Bioinformatics 27, 35. Scaglioni, P. P. et al. CK2 mediates phosphorylation and ubiquitin-mediated 431–432 (2011). degradation of the PML tumor suppressor. Mol. Cell. Biochem. 316, 149–154 (2008). 36. Gurrieri, C. et al. Loss of the tumor suppressor PML in human cancers of Acknowledgements multiple histologic origins. J. Natl Cancer Inst. 96, 269–279 (2004). We thank members of the IRB animal core facility for technical assistance and the animal 37. Kang, T. W. et al. Senescence surveillance of pre-malignant hepatocytes limits work. We are grateful to Erica Montani for her help with microscopy. We thank all liver cancer development. Nature 479, 547–551 (2011). the members of Dr A. Alimonti laboratory and Dr Carlo Catapano for their scientific 38. Braumuller, H. et al. T-helper-1-cell cytokines drive cancer into senescence. discussions. We thank Dr Ramon Parsons for being generous in providing the reagents. Nature 494, 361–365 (2013). This work was supported by Swiss National Science Foundation (SNF) grant Ambizione 39. Hemann, M. T. et al. Evasion of the p53 tumour surveillance network by (PZ00P3_136612/1), European Society for Medical Oncology (ESMO) translational tumour-derived MYC mutants. Nature 436, 807–811 (2005). research award, Swiss Bridge Award and European research council starting grant to 40. Tovar, C. et al. MDM2 small-molecule antagonist RG7112 activates p53 A.A. (ERCsg 261342). I.J.F. was supported by (ERCsg 260316). The work of L.A.P. was signaling and regresses human tumors in preclinical cancer models. Cancer Res. supported by AIRC grant IG-14180. 73, 2587–2597 (2013). 41. Rader, J. et al. Dual CDK4/CDK6 inhibition induces cell-cycle arrest and senescence in neuroblastoma. Clin. Cancer Res. 19, 6173–6182 (2013). Author contributions 42. Toso, A. et al. Enhancing chemotherapy efficacy in pten-deficient prostate A.A., A.T., M.K. and I.F. originally developed the concept, further elaborated on it and tumors by activating the senescence-associated antitumor immunity. Cell Rep. designed the experiments. A.P., Le.M., La.M., F.M. and Al.T. performed selection of 9, 75–89 (2014). compounds for the screening campaign and analysed screening data. M.K., A.T., J.C., 43. Filhol, O. & Cochet, C. Protein kinase CK2 in health and disease: Cellular A.R. and C.D. performed experiments. R.G.E and R.K.R.K. performed bioinformatics functions of protein kinase CK2: a dynamic affair. Cell. Mol. Life Sci. 66, analysis. M.S. and S.P. performed immunohistochemistry. L.A.P., M.R. and G.C. 1830–1839 (2009). provided valuable reagents and technical advice. M.K., A.T., I.F. and A.A. interpreted the 44. Kim, J. & Hwan Kim, S. CK2 inhibitor CX-4945 blocks TGF-beta1-induced data and wrote the paper. epithelial-to-mesenchymal transition in A549 human lung adenocarcinoma cells. PLoS ONE 8, e74342 (2013). 45. Cozza, G., Pinna, L. A. & Moro, S. Protein kinase CK2 inhibitors: a patent Additional information review. Expert Opin. Ther. Pat. 22, 1081–1097 (2012). Supplementary Information accompanies this paper at http://www.nature.com/ 46. Wallace, T. A. et al. Tumor immunobiological differences in prostate cancer naturecommunications between African-American and European-American men. Cancer Res. 68, 927–936 (2008). Competing financial interests: The authors declare no competing financial interests. 47. Singh, D. et al. Gene expression correlates of clinical prostate cancer behavior. Reprints and permission information is available online at http://npg.nature.com/ Cancer Cell 1, 203–209 (2002). reprintsandpermissions/ 48. Rhodes, D. R. et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 6, 1–6 (2004). How to cite this article: Kalathur, M. et al. A chemogenomic screening identifies CK2 as 49. Setlur, S. R. et al. Estrogen-dependent signaling in a molecularly distinct a target for pro-senescence therapy in PTEN-deficient tumours. Nat. Commun. 6:7227 subclass of aggressive prostate cancer. J. Natl Cancer Inst. 100, 815–825 (2008). doi: 10.1038/ncomms8227 (2015).