USOO8872001 B2

(12) United States Patent (10) Patent No.: US 8,872,001 B2 Broglie et al. (45) Date of Patent: Oct. 28, 2014

(54) COMPOSITIONS AND METHODS FOR 2009,0188008 A1 7/2009 Lassner INSECTICDAL CONTROL OF STNKBUGS 2009,01921.16 A1 7/2009 Herrmann et al. 2009,01921, 17 A1 7/2009 Herrmann et al. (75) Inventors: Karen E. Broglie, Landenberg, PA (US); 2009,0265818 A1 10/2009 Herrmann et al. David C. Cerf, Palo Alto, CA (US); Rafael Herrmann, Wilmington, DE FOREIGN PATENT DOCUMENTS (US); Albert L. Lu, Newark, DE (US); EP 1818 405 A3 8, 2007 Brian McGonigle, Wilmington, DE WO WOO1,34815 A1 5, 2001 WO WOO1/37654 A2 5, 2001 (US); James K. Presnail, Avondale, PA WO WO O2/OO904 A2 1, 2002 (US) WO WOO3,052110 A2 6, 2003 WO WO 2005/049841 A1 6, 2005 (73) Assignee: Pioneer Hi Bred International Inc, WO WO 2005/077116 A2 8, 2005 Johnston, IA (US) WO WO 2005/110068 A2 11/2005 WO WO 2006/044480 A2 4/2006 WO WO 2006/045590 A2 5, 2006 (*) Notice: Subject to any disclaimer, the term of this WO WO 2006/047495 A2 5, 2006 patent is extended or adjusted under 35 WO WO 2007/OO3O23 A2 1, 2007 U.S.C. 154(b) by 351 days. WO WO 2007/087.153 A2 8, 2007 WO WO 2007/095469 A2 8, 2007 (21) Appl. No.: 13/152.795 OTHER PUBLICATIONS (22) Filed: Jun. 3, 2011 Thomas et al., 2001, Plant J., 25:417-425.* (65) Prior Publication Data Jagadeeswaran, G., et al., “Deep sequencing of Small RNA libraries reveals dynamic regulation of conserved and novel microRNA-stars US 2011 FO3O1223 A1 Dec. 8, 2011 during silkworm development.” BMC Genomics, 2010, vol. 11(52), pp. 1-18. Related U.S. Application Data Sindhu, A., et al., “Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces (60) Provisional application No. 61/351,405, filed on Jun. parasitic success,” Journal of Experimental Botany, 2009, vol. 60(1), 4, 2010. pp. 315-324. Tomoyasu, Y, et al., “Exploring systemic RNA interference in (51) Int. Cl. insects: a genome-wide survey for RNAi genes in Tribolium," CI2N IS/II3 (2010.01) Genome Biology, 2008, vol. 9(1), pp. R10-R10.22. CI2N 15/05 (2006.01) (Continued) CI2N 5/14 (2006.01) AOIH 5/00 (2006.01) AOIN 57/16 (2006.01) Primary Examiner — David H Kruse AOIN 65/00 (2009.01) Assistant Examiner — Jason DeVeau Rosen CI2N 15/82 (2006.01) (74) Attorney, Agent, or Firm — Pioneer Hi-Bred Int'l, Inc. (52) U.S. Cl. CPC ...... CI2N 15/8286 (2013.01); A0IN 57/16 (2013.01); A0IN 65/00 (2013.01); C12N (57) ABSTRACT 2310/531 (2013.01); C12N 15/113 (2013.01); CI2N 2310/14 (2013.01); CI2N 15/8218 Methods and compositions are provided which employ a (2013.01) silencing element that, when ingested by a pest, such as a USPC ...... 800/301; 536/24.5; 435/320.1; 435/419; Pentatomidae plant pest or a N. viridula, Acrosternum hilare, 435/415: 800/298 Piezodorus guildini, and/or Halymorpha haly's plant pest, (58) Field of Classification Search decrease the expression of a target sequence in the pest. In None specific embodiments, the decrease in expression of the target See application file for complete search history. sequence controls the pest and thereby the methods and com positions are capable of limiting damage to a plant. The (56) References Cited present invention provides various target polynucleotides set forth in any one of SEQID NOS: 1-292 or 302-304 or active U.S. PATENT DOCUMENTS variants and fragments thereof, wherein a decrease in expres sion of one or more the sequences in the target pest controls 7,560,542 B2* 7/2009 Andersen et al...... 536,236 7,745,391 B2* 6/2010 Mintz et al...... 514, 19.3 the pest (i.e., has insecticidal activity). Further provided are 8,067,671 B2 * 1 1/2011 Boukharov et al...... 800,285 silencing elements which when ingested by the pest decrease 8,080,413 B2 * 12/2011 Li ...... 435/320.1 the level of the target polypeptide and thereby control the 8,143,476 B2 * 3/2012 Meyer et al...... 800,278 pest. In specific embodiment, the pest is Pentatomidae. 2003/O1500 17 A1 8, 2003 Mesa et al. Plants, plant part, bacteria and other host cells comprising the 2005/OO95199 A1 5/2005 Whyard et al. 2006, 0021087 A1 1/2006 Baum et al. silencing elements or an active variant or fragment thereof of 2006.0075515 A1 4/2006 Luethy et al. the invention are also provided. 2006/0200878 A1 9/2006 Lutfiyya et al. 2006/0272049 A1 11/2006 Waterhouse et al. 2007/O1991OO A1 8, 2007 Michaeli et al. 36 Claims, 2 Drawing Sheets US 8,872,001 B2 Page 2

(56) References Cited Research Communications, 2004, pp. 428-434, vol. 320, No. 2, Elsevier Science Publishers Ltd., United Kingdom. Atkinson, H. J., et al., “Engineering Plants for Nematode Resis OTHER PUBLICATIONS tance.” Ann. Rev. Phytopathol. 2003, pp. 615-639, vol. 41. Boutla, A., et al., “Induction of RNA Interference in Caenorhabditis Zhang, Y, et al., “Insect-Specific microRNA Involved in the Devel Elegans by RNAs Derived From Plants Exhibiting Post-Transcrip opment of the Silkworm Bombyx mori.” PLoS ONE, 2009, vol.4(3), tional Gene Silencing. Nucleic Acids Research, 2002, pp. 1688 e4677, pp. 1-7. 1694, vol. 30, No. 7. Agrawal, N., et al., “siRNA-Directed Silencing of Transgene Expressed in Cultured Insect Cells'. Biochemical and Biophysical * cited by examiner U.S. Patent Oct. 28, 2014 Sheet 1 of 2 US 8,872,001 B2

x: x: xx xx x: « xx + xx + x : t xx ++++++++++++++

U.S. Patent Oct. 28, 2014 Sheet 2 of 2 US 8,872,001 B2

s. t it ++ -- t ++ Y.: i

+ -- xxx * ... x: x. US 8,872,001 B2 1. 2 COMPOSITIONS AND METHODS FOR may overcome that feeding behavior by relying on double INSECTICIDAL CONTROL OF STNKBUGS stranded RNAs rather than proteins. Thus, there is an imme diate need for alternative methods to control pests. CROSS-REFERENCE TO RELATED APPLICATION BRIEF SUMMARY OF THE INVENTION This application claims the benefit of U.S. Provisional Methods and compositions are provided which employ a Application Ser. No. 61/351,405, filed Jun. 4, 2010, which is silencing element that, when ingested by a pest, such as a herein incorporated by reference. Pentatomidae plant pest including for example, a N. viridula 10 (Southern green Stink bug), Acrosternum hilare (green Stink REFERENCE TO ASEQUENCE LISTING bug), Piezodorus guildini (redbanded Stinkbug), and/or Haly SUBMITTED ASATEXT FILE VIA EFS-WEB morpha haly's (Brown marmorated Stinkbug). plant pest, is capable of decreasing the expression of a target sequence in The official copy of the sequence listing is Submitted con the pest. In specific embodiments, the decrease in expression currently with the specification as a text file via EFS-Web, in 15 of the target sequence controls the pest and thereby the meth compliance with the American Standard Code for Informa ods and compositions are capable of limiting damage to a tion Interchange (ASCII), with a file name of plant. The present invention provides various target poly 402360SEQLIST.txt, a creation date of Jun. 2, 2011 and a size nucleotides as set forth in SEQID NOS: 1, 2, 3, 4, 5, 6, 7, 8, of 195 KB. The sequence listing filed via EFS-Web is part of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, the specification and is hereby incorporated in its entirety by 26, 27, 28, 29, 30, 31, 32,33, 34, 35,36, 37,38, 39, 40, 41, 42, reference herein. 43, 44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71,72, 73,74, 75,76, FIELD OF THE INVENTION 77,78, 79,80, 81, 82, 83, 84,85, 86, 87, 88,89,90,91, 92,93, 94, 95, 96, 97,98, 99, 100, 101, 102, 103,104,105,106, 107, The present invention relates generally to methods of 25 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, molecular biology and gene silencing to control pests. 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, BACKGROUND OF THE INVENTION 144, 145, 146, 147,148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, Insect pests are a serious problem in agriculture. They 30 168, 169, 170, 171, 172,173, 174, 175, 176, 177, 178,179, destroy millions of acres of Staple crops such as corn, Soy 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, beans, peas, and cotton. Yearly, these pests cause over S100 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, billion dollars in crop damage in the U.S. alone. In an ongoing 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, seasonal battle, farmers must apply billions of gallons of 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, synthetic pesticides to combat these pests. Other methods 35 228, 229, 230, 231, 232, 233,234, 235, 236, 237,238, 239, employed in the past delivered insecticidal activity by micro 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, organisms or genes derived from microorganisms expressed 252,253,254, 255, 256, 257, 258, 259, 260, 261, 262, 263, in transgenic plants. For example, certain species of micro 264, 265, 266, 267, 268, 269, 270, 271, 272,273, 274, 275, organisms of the genus Bacillus are known to possess pesti 276, 277,278, 279, 280, 281, 282,283, 284, 285, 286, 287, cidal activity against a broad range of insect pests including 40 288, 289,290, 291, 292,302,303 or 304 or active variants or Lepidoptera, Diptera, Coleoptera, Hemiptera, and others. In fragments thereof, wherein a decrease in expression of one or fact, microbial pesticides, particularly those obtained from more the sequences in the target pest controls the pest (i.e., Bacillus strains, have played an important role in agriculture has insecticidal activity). Further provided are silencing ele as alternatives to chemical pest control. Agricultural Scien ments, which when ingested by the pest, decrease the level of tists have developed crop plants with enhanced insect resis 45 expression of one or more of the target polynucleotides. tance by genetically engineering crop plants to produce insec Plants, plant parts, plant cells, bacteria and other host cells ticidal proteins from Bacillus. For example, corn and cotton comprising the silencing elements or an active variant or plants genetically engineered to produce Cry toxins (see, e.g., fragment thereof are also provided. Aronson (2002) Cell Mol. Life. Sci. 59(3):417-425; Schnepf In another embodiment, a method for controlling a pest, et al. (1998) Microbiol. Mol. Biol. Rev. 62(3):775-806) are 50 Such as a Pentatomidae plant pest, such as, for example, a N. now widely used in American agriculture and have provided viridula, Acrosternum hilare, Piezodorus guildini, and/or the farmer with an alternative to traditional insect-control Halymorpha haly's plant pest, is provided. The method com methods. However, these Bt insecticidal proteins only protect prises feeding to a pest a composition comprising a silencing plants from a relatively narrow range of pests. Moreover, element, wherein the silencing element, when ingested by the these modes of insecticidal activity provided varying levels of 55 pest, reduces the level of a target sequence in the pest and specificity and, in some cases, caused significant environ thereby controls the pest. Further provided are methods to mental consequences. protect a plant from a pest. Such methods comprise introduc Previous control of stinkbugs relied on broad spectrum ing into the plant or plant part a silencing element of the insecticides. With the adoption of transgenic controls for invention. When the plant expressing the silencing element is major lepidopteran pests in several crops, these insecticides 60 ingested by the pest, the level of the target sequence is are no longer used and Stinkbugs have become a major sec decreased and the pest is controlled. ondary pest. No Successful use of transgenic control of Stink bugs has been described or adopted. This may be due in part BRIEF DESCRIPTION OF THE DRAWINGS to the extra oral digestion employed by Stinkbugs where digestive enzymes are injected into the host plant prior to 65 FIG. 1 shows the Southern Green Stinkbug feeding assay feeding. This makes it difficult to find proteins that survive results with soybean embryo tissue transformed with hairpin long enough to manifest activity against these insects. RNAi RNA silencing contructs. US 8,872,001 B2 3 4 FIG. 2 shows the Southern Green Stinkbug feeding assay 236, 237,238,239, 240, 241, 242, 243, 244, 245, 246, 247, results with soybean embryo tissue transformed with 248, 249, 250, 251, 252,253, 254, 255, 256, 257, 258, 259, amiRNA silencing constructs. 260, 261, 262, 263,264, 265, 266, 267, 268,269, 270, 271, 272,273, 274, 275, 276, 277,278, 279, 280, 281, 282,283, DETAILED DESCRIPTION OF THE INVENTION 284, 285,286,287,288,289,290, 291, 292,302,303, or 304. or active variants and fragments thereof. Silencing elements The present inventions now will be described more fully designed in view of these target polynucleotides are provided hereinafter with reference to the accompanying drawings, in which, when ingested by the pest, decrease the expression of which some, but not all embodiments of the inventions are one or more of the target sequences and thereby controls the shown. Indeed, these inventions may be embodied in many 10 pest (i.e., has insecticidal activity). different forms and should not be construed as limited to the As used herein, by “controlling a pest” or “controls a pest' embodiments set forth herein; rather, these embodiments are is intended any affect on a pest that results in limiting the provided so that this disclosure will satisfy applicable legal damage that the pest causes. Controlling a pest includes, but requirements. Like numbers refer to like elements through is not limited to, killing the pest, inhibiting development of Out. 15 the pest, altering fertility or growth of the pest in Such a Many modifications and other embodiments of the inven manner that the pest provides less damage to the plant, tions set forth herein will come to mind to one skilled in the art decreasing the number of offspring produced, producing less to which these inventions pertain having the benefit of the fit pests, producing pests more Susceptible to predator attack, teachings presented in the foregoing descriptions and the or deterring the pests from eating the plant. associated drawings. Therefore, it is to be understood that the Reducing the level of expression of the target polynucle inventions are not to be limited to the specific embodiments otide or the polypeptide encoded thereby, in the pest results in disclosed and that modifications and other embodiments are the Suppression, control, and/or killing the invading patho intended to be included within the scope of the appended genic organism. Reducing the level of expression of the target claims. Although specific terms are employed herein, they are sequence of the pest will reduce the disease symptoms result used in a generic and descriptive sense only and not for 25 ing from pathogen challenge by at least about 2% to at least purposes of limitation. about 6%, at least about 5% to about 50%, at least about 10% I. Overview to about 60%, at least about 30% to about 70%, at least about Frequently, RNAi discovery methods rely on evaluation of 40% to about 80%, or at least about 50% to about 90% or known classes of sensitive genes (transcription factors, greater. Hence, the methods of the invention can be utilized to housekeeping genes etc.). In contrast, the target polynucle 30 control pests, particularly, Pentatomidae plant pest or a N. otide set forth herein were identified based solely on high viridula, Acrosternum hilare, Piezodorus guildini, and/or throughput screens of a library of over 1000 expressed Halymorpha haly's plant pest. sequence tags from N. viridula. This screen allowed for the Assays that measure the control of a pest are commonly discovery of many novel sequences, many of which have known in the art, as are methods to quantitate disease resis extremely low or no homology to known sequences. This 35 tance in plants following pathogen infection. See, for method provided the advantage of having no built in bias to example, U.S. Pat. No. 5.614.395, herein incorporated by genes that are frequently highly conserved across taxa. As a reference. Such techniques include, measuring over time, the result, many novel targets for RNAi as well as known genes average lesion diameter, the pathogen biomass, and the over not previously shown to be sensitive to RNAi have been all percentage of decayed plant tissues. See, for example, identified. 40 Thomma et al. (1998) Plant Biology 95:15107-15111, herein As such, methods and compositions are provided which incorporated by reference. See, also Baum et al. (2007) employ a silencing element that, when ingested by a pest, Nature Biotech 11:1322-1326 and WO 2007/035650 which Such as a Pentatomidae plant pest or, for example, a N. viri proved both whole plant feeding assays and corn root feeding dula, Acrosternum hilare, Piezodorus guildini, and/or Haly assays. Both of these references are herein incorporated by morpha haly's plant pest, is capable of decreasing the expres 45 reference in their entirety. See, also the examples below. sion of a target sequence in the pest. In specific embodiments, The invention is drawn to compositions and methods for the decrease in expression of the target sequence controls the protecting plants from a plant pest, Such as Pentatomidae pest and thereby the methods and compositions are capable of plant pests or N. viridula, Acrosternum hilare, Piezodorus limiting damage to a plant or plant part. The present invention guildini, and/or Halymorpha haly's plant pests or inducing provides target polynucleotides as set forth in SEQID NOS: 50 resistance in a plant to a plant pest, such as Pentatomidae plant 1,2,3,4,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, pests or N. viridula, Acrosternum hilare, Piezodorus guildini, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, and/or Halymorpha haly's plant pests. As used herein “Pen 38,39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, tatomidae plant pest” is used to refer to any member of the 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, Pentatomidae family. Accordingly, the compositions and 72, 73,74, 75,76, 77,78, 79,80, 81,82, 83, 84,85, 86, 87,88, 55 methods are also useful in protecting plants against any Pen 89, 90,91, 92,93, 94, 95, 96, 97,98, 99, 100, 101, 102, 103, tatomidae plant pest including representative genera and spe 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, cies such as, but not limited to, Acrocorisellus (A. Serraticol 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, lis), Acrosternum (A. adelpha, A. hilare, A. herbidum, A. 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, scutellatum), Agonoscelis (A. nubila), Alcaeorrhynchus (A. 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 60 grandis, A. phymatophorus), Amaurochrous (A. brevitylus), 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, Apateticus (A. anatarius, A. bracteatus, A. cynicus, A. lin 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, eolatus, A. marginiventris), Apoecilus, Arma (A. custos), 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186,187, Arvelius, Bagrada, Banasa (B. Calva, B. diniata, B. grisea, B. 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, induta, B. SOrdida), Brochymena (B. afinis, B. cariosa, B. 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 65 haedula, B. hoppingi, B. sulcata), Carbula (C. Obtusangula, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, C. Sinica), Chinavia, Chlorochroa (C. belfragii, C. kanei, C. 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,234, 235, norlandi, C. senilis, C. viridicata), Chlorocoris (C. distinctus, US 8,872,001 B2 5 6 C. flaviviridis, C. hebetatus, C. subrugosus, C. tau), Codo 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, phila (C. remota, C. sulcata, C. varius), Coenus (C. delius, C. 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, inermis, C. tarsalis), Cosmopepla (C. bimaculata, C. bino 167, 168, 169, 170, 171, 172,173, 174, 175, 176, 177, 178, tata, C. carnifex, C. decorata, C. intergressus), Dalpada (D. 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, Oculata), Dendrocoris (D. arizonesis, D. fruticicola, D. 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, humeralis, D. parapini, D. reticulatus), Dolycoris (D. bac 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, carum (sloe bug)), Dybowskyia (D. reticulata), Edessa, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, Erthesina (E. fillo), Eurydema (E. dominulus, E. gebleri 227, 228, 229, 230, 231, 232, 233,234, 235, 236, 237,238, (shieldbug), E. pulchra, E. rugosa), Euschistus (E. biformis, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, E. integer, E. quadrator, E. servus, E. tristigma), Euthyrhyn 10 251, 252,253, 254, 255, 256, 257, 258, 259, 260, 261, 262, chus (Efloridanus, E. macronemis), Gonopsis (G. coccinea), 263,264, 265, 266, 267, 268, 269, 270, 271, 272,273, 274, Graphosoma (G. lineatum (Stink bug), G. rubrolineatum), 275,276, 277,278, 279, 280, 281, 282,283, 284, 285, 286, Halyomorpha (H. halys (brown marmorated Stink bug)), 287,288,289,290,291,292,302,303, or 304. As exemplified Halys (H. Sindillus, H. Sulcatus), Holcostethus (H. abbrevia elsewhere herein, decreasing the level of expression of one or tus, H. filvipes, H. limbolarius, H. piceus, H. Sphacellatus), 15 more of these target sequences in a Pentatomidae plant pest or Homalogonia (H. Obtusa), Hymenarcy's (H. aequalis, H. a N. viridula, Acrosternum hilare, Piezodorus guildini, and/or crassa, H. nervosa, H. perpuncata, H. reticulata), Lelia (L. Halymorpha haly's plant pest controls the pest. decempunctata), Lineostethus, Loxa (L. flavicollis, L. viri III. Silencing Elements dis), Mecidea (M. indicia, M. major, M. minor), Megarrham By “silencing element' is intended a polynucleotide which phus (M. hastatus), Menecies (M. insertus, M. portacrus), when ingested by a pest, is capable of reducing or eliminating Mormidea (M. cubrosa, M. lugens, M. pama, M. pictiventris, the level or expression of a target polynucleotide or the M. Ypsilon), Moromorpha (M. tetra), Murgantia (M. angu polypeptide encoded thereby. The silencing element laris, M. tessellata, M. varicolor, M. violascens), Neotti employed can reduce or eliminate the expression level of the glossa (N. Californica, N. Cavi?ions, N. coronaciliata, N. sul target sequence by influencing the level of the target RNA cifions, N. undata), Nezara (N. Smaragdulus, N. viridula 25 transcript or, alternatively, by influencing translation and (Southern green Stink bug)), Oebalus (O. grisescens, O. insu thereby affecting the level of the encoded polypeptide. Meth laris, O. mexicanus, O. pugnax, O. typhoeus), Oechalia (O. ods to assay for functional silencing elements that are capable schellenbergii (spined predatory shield bug)), Okeanos (O. of reducing or eliminating the level of a sequence of interest quel partensis), Oplomus (O. catena, O. dichrous, O. tripus are disclosed elsewhere herein. A single polynucleotide tulatus), Palomena (P. prasina (green shieldbug)), Parabro 30 employed in the methods of the invention can comprise one or chymena, Pentatoma (Pangulata, P illuminata, P. japonica, more silencing elements to the same or different target poly P. kunmingensis, P. metallifera, P. parataibaiensis, P. rufipes, nucleotides. The silencing element can be produced in vivo P. semiannulata, P. viridicornuta), Perillus (P. bioculatus, P (i.e., in a host cell Such as a plant or microorganism) or in confluens, P Strigipes), Picromerus (P griseus), Piezodorus vitro. (P degeeri, P. guildinii, P lituratus (gorse shield bug)), 35 In specific embodiments, the target sequence is not endog Pinthaeus (P. humeralis), Plautia (P. crossota, P Stali enous to the plant. In other embodiments, while the silencing (brown-winged green bug)), Podisus (P. maculiventris), Pri element controls pests, preferably the silencing element has assus (P testaceus), Prionosoma, Proxys (Palbopunctulatus, no effect on the normal plant or plant part. P. punctulatus, P victor), Rhaphigaster (R. nebulosa), Scoti As discussed in further detail below, silencing elements nophara (S. horvathi), Stiretrus (S. anchorago, S. fimbriatus), 40 can include, but are not limited to, a sense Suppression ele Thyanta (T. accerra, T. calceata, T. casta, T. perditor, T. ment, an antisense Suppression element, a double stranded pseudocasta), Trichopepla (T. aurora, T. dubia, T. pilipes, T. RNA, a siRNA, an amiRNA, a miRNA, or a hairpin suppres semivittata, T. vandykei), Tvlospilus, and Zicrona. sion element. Non-limiting examples of silencing elements II. Target Sequences that can be employed to decrease expression of these target As used herein, a “target sequence' or “target polynucle 45 Pentatomidae plant pest sequences or N. viridula, Acroster otide' comprises any sequence in the pest that one desires to nun hilare, Piezodorus guildini, and/or Halymorpha haly's reduce the level of expression. In specific embodiments, plant pest sequences comprise fragments and variants of the decreasing the level of the target sequence in the pest controls sense or antisense sequence or consists of the sense or anti the pest. For instance, the target sequence can be essential for sense sequence of the sequence set forth in SEQID NOS: 1. growth and development. While the target sequence can be 50 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, expressed in any tissue of the pest, in specific embodiments, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, the sequences targeted for Suppression in the pest are 38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, expressed in cells of the gut tissue of the pest, cells in the 55, 56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, midgut of the pest, and cells lining the gut lumen or the 72, 73,74, 75,76, 77,78, 79,80, 81,82, 83, 84,85, 86, 87,88, midgut. Such target sequences can be involved in, for 55 89, 90,91, 92,93, 94, 95, 96, 97,98, 99, 100, 101, 102, 103, example, gut cell metabolism, growth or differentiation. Non 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, limiting examples of target sequences of the invention include 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, a polynucleotide set forth in SEQID NOS: 1, 2, 3, 4, 5, 6, 7, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 140, 141, 142, 143, 144, 145, 146, 147,148, 149, 150, 151, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41, 60 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 59, 60, 61, 62,63, 64, 65,66, 67,68, 69,70, 71, 72,73, 74, 75, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186,187, 76, 77,78, 79,80, 81, 82,83, 84,85,86, 87,88, 89,90,91, 92, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 93, 94, 95, 96, 97,98, 99, 100, 101, 102, 103, 104, 105,106, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 65 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233,234, 235, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 236, 237,238,239, 240, 241, 242, 243, 244, 245, 246, 247, US 8,872,001 B2 7 8 248, 249, 250, 251, 252,253,254, 255, 256, 257, 258, 259, 250-300, 300-350, 350-400, 450-500, 500-550, 550-600, 260, 261, 262, 263,264, 265,266, 267, 268,269, 270, 271, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 272,273, 274, 275, 276, 277,278, 279, 280, 281, 282,283, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1200, 284, 285, 286, 287,288, 289,290, 291, 292,302,303, or 304 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, or a biologically active variant or fragment thereof. Addi 1700-1800 nucleotides or longer of the target polynucleotides tional sequences that can be employed as silencing elements set forth in any of SEQID NO: 1-292 or 302-304. include, for example, SEQID NOS: 284, 285,286,287,288, ii. Antisense Suppression Elements 289, 290, 291, 292, 293, 294, 295, 296,297, 298, 299, 300, As used herein, an “antisense Suppression element com 301,305,306, 307, 308,309,310,311, 312,321, 322,323, prises a polynucleotide which is designed to express an RNA 324, 325, 326,327,328,329, 330,331,332,333,334,335, or 10 molecule complementary to all or part of a target messenger 336 or active variants or fragments thereof. The silencing RNA. Expression of the antisense RNA suppression element element can further comprise additional sequences that reduces or eliminates the level of the target polynucleotide. advantageously effect transcription and/or the stability of a The polynucleotide for use in antisense Suppression may resulting transcript. For example, the silencing elements can correspond to all or part of the complement of the sequence comprise at least one thymine residue at the 3' end. This can 15 encoding the target polynucleotide, all or part of the comple aid in stabilization. Thus, the silencing elements can have at ment of the 5' and/or 3' untranslated region of the target least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more thymine residues at the polynucleotide, all or part of the complement of the coding 3' end. As discussed in further detail below, enhancer Sup sequence of the target polynucleotide, or all or part of the pressor elements can also be employed in conjunction with complement of both the coding sequence and the untranslated the silencing elements disclosed herein. regions of the target polynucleotide. In addition, the antisense By “reduces” or “reducing the expression level of a poly suppression element may be fully complementary (i.e., 100% nucleotide or a polypeptide encoded thereby is intended to identical to the complement of the target sequence) or par mean, the polynucleotide or polypeptide level of the target tially complementary (i.e., less than 100% identical to the sequence is statistically lower than the polynucleotide level or complement of the target sequence) to the target polynucle polypeptide level of the same target sequence in an appropri 25 otide. In specific embodiments, the antisense Suppression ate control pest which is not exposed to (i.e., has notingested) element comprises at least 85%, 90%, 91%, 92%, 93%.94%, the silencing element. In particular embodiments of the 95%, 96%, 97%, 98%, or 99% sequence complementarity to invention, reducing the polynucleotide level and/or the the target polynucleotide. Antisense Suppression may be used polypeptide level of the target sequence in a pest according to to inhibit the expression of multiple proteins in the same the invention results in less than 95%, less than 90%, less than 30 plant. See, for example, U.S. Pat. No. 5,942,657. Further 80%, less than 70%, less than 60%, less than 50%, less than more, the antisense Suppression element can be complemen 40%, less than 30%, less than 20%, less than 10%, or less than tary to a portion of the target polynucleotide. Generally, 5% of the polynucleotide level, or the level of the polypeptide sequences of at least 15, 20, 22, 25, 50, 100, 200, 300, 400, encoded thereby, of the same target sequence in an appropri 450 nucleotides or greater of the sequence set forth in any of ate control pest. Methods to assay for the level of the RNA 35 SEQ ID NO: 1-292 or 302-304 may be used. Methods for transcript, the level of the encoded polypeptide, or the activity using antisense Suppression to inhibit the expression of of the polynucleotide or polypeptide are discussed elsewhere endogenous genes in plants are described, for example, in Liu herein. et at (2002) Plant Physiol. 129:1732-1743 and U.S. Pat. Nos. i. Sense Suppression Elements 5,759,829 and 5.942,657, each of which is herein incorpo As used herein, a 'sense Suppression element comprises a 40 rated by reference. polynucleotide designed to express an RNA molecule corre iii. Double Stranded RNA Suppression Element sponding to at least a part of a target messenger RNA in the A “double stranded RNA silencing element” or “dsRNA'. “sense' orientation. Expression of the RNA molecule com comprises at least one transcript that is capable of forming a prising the sense Suppression element reduces or eliminates dsRNA either before or after ingestion by a pest. Thus, a the level of the target polynucleotide or the polypeptide 45 “dsRNA silencing element includes a dsRNA, a transcript or encoded thereby. The polynucleotide comprising the sense polyribonucleotide capable of forming a dsRNA or more than Suppression element may correspond to all or part of the one transcript or polyribonucleotide capable of forming a sequence of the target polynucleotide, all or part of the 5' dsRNA. “Double Stranded RNA or “dsRNA refers to a and/or 3' untranslated region of the target polynucleotide, all polyribonucleotide structure formed either by a single self or part of the coding sequence of the target polynucleotide, or 50 complementary RNA molecule or a polyribonucleotide struc all or part of both the coding sequence and the untranslated ture formed by the expression of least two distinct RNA regions of the target polynucleotide. strands. The dsRNA molecule(s) employed in the methods Typically, a sense Suppression element has substantial and compositions of the invention mediate the reduction of sequence identity to the target polynucleotide, typically expression of a target sequence, for example, by mediating greater than about 65% sequence identity, greater than about 55 RNA interference “RNAi’ or gene silencing in a sequence 85% sequence identity, about 90%, 91%, 92%, 93%, 94%, specific manner. In the context of the present invention, the 95%, 96%, 97%, 98% or 99% sequence identity. See, U.S. dsRNA is capable of reducing or eliminating the level or Pat. Nos. 5.283,184 and 5,034.323; herein incorporated by expression of a target polynucleotide or the polypeptide reference. The sense Suppression element can be any length encoded thereby in a pest. So long as it allows for the Suppression of the targeted 60 The dsRNA can reduce or eliminate the expression level of sequence. The sense Suppression element can be, for the target sequence by influencing the level of the target RNA example, 15, 16, 17, 1819, 20, 22, 25, 30, 50, 100, 150, 200, transcript, by influencing translation and thereby affecting the 250, 300, 350, 400, 450, 500, 600, 700, 900, 1000, 1100, level of the encoded polypeptide, or by influencing expres 1200, 1300 nucleotides or longer of the target polynucle sion at the pre-transcriptional level (i.e., via the modulation of otides set forth in any of SEQ ID NO:1-292 or 302-304. In 65 chromatin structure, methylation pattern, etc., to alter gene other embodiments, the sense Suppression element can be, for expression). See, for example, Verdel et al. (2004) Science example, about 15-25, 25-100, 100-150, 150-200, 200-250, 303:672-676; Pal-Bhadra et al. (2004) Science 303:669-672: US 8,872,001 B2 9 10 Allshire (2002) Science 297: 1818-1819; Volpe et al. (2002) 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, Science 297:1833-1837; Jenuwein (2002) Science 297:2215 96%, 97%, 98%, 99%, up to and including 100% comple 2218; and Halletal. (2002) Science 297:2232–2237. Methods mentarity. to assay for functional dsRNA that are capable of reducing or The first and the third segment are at least about 1000, 500, eliminating the level of a sequence of interest are disclosed 5 400, 300, 200, 100, 50, 40, 30, 25, 22, 20, 19, 18, 17, 16, 15 elsewhere herein. Accordingly, as used herein, the term or 10 nucleotides in length. In specific embodiments, the “dsRNA is meant to encompass other terms used to describe length of the first and/or the third segment is about 10-100 nucleic acid molecules that are capable of mediating RNA nucleotides, about 10 to about 75 nucleotides, about 10 to interference or gene silencing, including, for example, short about 50 nucleotides, about 10 to about 40 nucleotides, about 10 10 to about 35 nucleotides, about 10 to about 30 nucleotides, interfering RNA (siRNA), double-stranded RNA (dsRNA), about 10 to about 25 nucleotides, about 10 to about 19 nucle micro-RNA (miRNA), hairpin RNA, short hairpin RNA otides, about 50 nucleotides to about 100 nucleotides, about (shRNA), post-transcriptional gene silencing RNA (ptg 100 nucleotides to about 150 nucleotides, about 150 nucle sRNA), and others. otides to about 200 nucleotides, about 200 nucleotides to In specific embodiments, at least one strand of the duplex 15 about 250 nucleotides, about 250 nucleotides to about 300 or double-stranded region of the dsRNA shares sufficient nucleotides, about 300 nucleotides to about 350 nucleotides, sequence identity or sequence complementarity to the target about 350 nucleotides to about 400 nucleotides, about 400 polynucleotide to allow for the dsRNA to reduce the level of nucleotide to about 500 nucleotides, about 600 nt, about 700 expression of the target sequence. As used herein, the Strand nt, about 800 nt, about 900 nt, about 1000 nt, about 1100 nt, that is complementary to the target polynucleotide is the about 1200 nt, 1300 nt, 1400 nt, 1500 nt, 1600 nt, 1700 nt, 'antisense Strand' and the Strand homologous to the target 1800 nt, 1900 nt, 2000 nt or longer. In other embodiments, the polynucleotide is the “sense strand.” length of the first and/or the third segment comprises at least In another embodiment, the dsRNA comprises a hairpin 10-19 nucleotides; 19-35 nucleotides; 30-45 nucleotides; RNA. A hairpin RNA comprises an RNA molecule that is 40-50 nucleotides; 50-100 nucleotides; 100-300 nucleotides: capable of folding back onto itself to form a double stranded 25 about 500-700 nucleotides; about 700-900 nucleotides; about structure. Multiple structures can be employed as hairpin 900-1100 nucleotides; about 1300-1500 nucleotides; about elements. In specific embodiments, the dsRNA suppression 1500-1700 nucleotides; about 1700-1900 nucleotides; about element comprises a hairpin element which comprises in the 1900-2100 nucleotides; about 2100-2300 nucleotides; or following order, a first segment, a second segment, and a third about 2300-2500 nucleotides. See, for example, International segment, where the first and the third segment share sufficient 30 Publication No. WO 0200904. In specific embodiments, the complementarity to allow the transcribed RNA to form a first and the third segment comprise at least 19 nucleotides double-stranded stem-loop structure. having at least 85% complementary to the first segment. In The “second segment of the hairpin comprises a “loop' or still other embodiments, the first and the third segments a "loop region. These terms are used synonymously herein which form the stem-loop structure of the hairpin comprises and are to be construed broadly to comprise any nucleotide 35 3' or 5' overhang regions having unpaired nucleotide residues. sequence that confers enough flexibility to allow self-pairing In specific embodiments, the sequences used in the first, to occur between complementary regions of a polynucleotide the second, and/or the third segments comprise domains that (i.e., segments 1 and 3 which form the stem of the hairpin). are designed to have sufficient sequence identity to a target For example, in Some embodiments, the loop region may be polynucleotide of interest and thereby have the ability to Substantially single stranded and act as a spacer between the 40 decrease the level of expression of the target polynucleotide. self-complementary regions of the hairpin stem-loop. In The specificity of the inhibitory RNA transcripts is therefore Some embodiments, the loop region can comprise a random generally conferred by these domains of the silencing ele or nonsense nucleotide sequence and thus not share sequence ment. Thus, in some embodiments of the invention, the first, identity to a target polynucleotide. In other embodiments, the second and/or third segment of the silencing element com loop region comprises a sense oran antisense RNA sequence 45 prise a domain having at least 10, at least 15, at least 19, at or fragment thereofthat shares identity to a target polynucle least 20, at least 21, at least 22, at least 23, at least 24, at least otide. See, for example, International Patent Publication No. 25, at least 30, at least 40, at least 50, at least 100, at least 200, WO 02/00904, herein incorporated by reference. In specific at least 300, at least 500, at least 1000, or more than 1000 embodiments, the loop region can be optimized to be as short nucleotides that share sufficient sequence identity to the tar as possible while still providing enough intramolecular flex 50 get polynucleotide to allow for a decrease in expression levels ibility to allow the formation of the base-paired stem region. of the target polynucleotide when expressed in an appropriate Accordingly, the loop sequence is generally less than 1000, cell. In other embodiments, the domain is between about 15 to 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 25, 20, 15, 10 50 nucleotides, about 19-35 nucleotides, about 25-50 nucle nucleotides or less. otides, about 19 to 75 nucleotides, about 40-90 nucleotides The “first” and the “third” segment of the hairpin RNA 55 about 15-100 nucleotides 10-100 nucleotides, about 10 to molecule comprise the base-paired stem of the hairpin struc about 75 nucleotides, about 10 to about 50 nucleotides, about ture. The first and the third segments are inverted repeats of 10 to about 40 nucleotides, about 10 to about 35 nucleotides, one another and share sufficient complementarity to allow the about 10 to about 30 nucleotides, about 10 to about 25 nucle formation of the base-paired stem region. In specific embodi otides, about 10 to about 19 nucleotides, about 50 nucleotides ments, the first and the third segments are fully complemen 60 to about 100 nucleotides, about 100 nucleotides to about 150 tary to one another. Alternatively, the first and the third seg nucleotides, about 150 nucleotides to about 200 nucleotides, ment may be partially complementary to each other so long as about 200 nucleotides to about 250 nucleotides, about 250 they are capable of hybridizing to one another to form a nucleotides to about 300 nucleotides, about 300 nucleotides base-paired stem region. The amount of complementarity to about 350 nucleotides, about 350 nucleotides to about 400 between the first and the third segment can be calculated as a 65 nucleotides, about 400 nucleotide to about 500 nucleotides or percentage of the entire segment. Thus, the first and the third longer. In other embodiments, the length of the first and/or the segment of the hairpin RNA generally share at least 50%, third segment comprises at least 10-19 nucleotides, 19-35 US 8,872,001 B2 11 12 nucleotides, 30-45 nucleotides, 40-50 nucleotides, 50-100 method can be used to determine sites on the target mRNA nucleotides, or about 100-300 nucleotides. that are in a conformation that is susceptible to RNA silenc In specific embodiments, the domain of the first, the sec ing. See, for example, Vickers et al. (2003) J. Biol. Chem. ond, and/or the third segment has 100% sequence identity to 278:7108-7118 and Yang et al. (2002) Proc. Natl. Acad. Sci. the target polynucleotide. In other embodiments, the domain USA99:9442-9447, herein incorporated by reference. These of the first, the second and/or the third segment having homol studies indicate that there is a significant correlation between ogy to the target polypeptide have at least 50%, 60%, 70%, the RNase-H-sensitive sites and sites that promote efficient 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, siRNA-directed mRNA degradation. 98%, 99%, or greater sequence identity to a region of the The hairpin silencing element may also be designed Such target polynucleotide. The sequence identity of the domains 10 that the sense sequence or the antisense sequence do not of the first, the second and/or the third segments to the target correspond to a target polynucleotide. In this embodiment, polynucleotide need only be sufficient to decrease expression the sense and antisense sequence flank a loop sequence that of the target polynucleotide of interest. See, for example, comprises a nucleotide sequence corresponding to all or part Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA of the target polynucleotide. Thus, it is the loop region that 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol. 129: 15 determines the specificity of the RNA interference. See, for 1723-1731: Waterhouse and Helliwell (2003) Nat. Rev. example, WO 02/00904, herein incorporated by reference. Genet. 4:29-38; Pandolfini et al. BMC Biotechnology 3:7, and In addition, transcriptional gene silencing (TGS) may be U.S. Patent Publication No. 20030175965; each of which is accomplished through use of a hairpin Suppression element herein incorporated by reference. A transient assay for the where the inverted repeat of the hairpin shares sequence iden efficiency of hpRNA constructs to silence gene expression in tity with the promoter region of a target polynucleotide to be vivo has been described by Panstruga et al. (2003) Mol. Biol. silenced. See, for example, Aufsatz et al. (2002) PNAS 99 Rep. 30:135-140, herein incorporated by reference. (Suppl. 4):16499-16506 and Mette et al. (2000) EMBOJ The amount of complementarity shared between the first, 19(19):5194-5201. second, and/or third segment and the target polynucleotide or While the various target sequences disclosed herein can be the amount of complementarity shared between the first seg 25 used to design any silencing element that encodes a hairpin ment and the third segment (i.e., the stem of the hairpin Suppression construct, non-limiting examples of such hairpin structure) may vary depending on the organism in which gene constructs are set forthin SEQID NO: 293 which targets SEQ expression is to be controlled. Some organisms or cell types ID NO: 278; SEQ ID NOS: 294, 295 and 296 which target may require exact pairing or 100% identity, while other SEQID NO: 279; SEQ ID NOS: 297 and 298 which target organisms or cell types may tolerate Some mismatching. In 30 SEQ ID NO:280: SEQ ID NO:299 which targets SEQ ID Some cells, for example, a single nucleotide mismatch in the NO:281; SEQ ID NO:300 which targets SEQ ID NO: 282; targeting sequence abrogates the ability to suppress gene and SEQ ID NO: 301 which targets SEQ ID NO: 283; or expression. In these cells, the Suppression cassettes of the active variants or fragments thereof. invention can be used to target the Suppression of mutant In other embodiments, the dsRNA can comprise a small genes, for example, oncogenes whose transcripts comprise 35 RNA (sRNA). SRNAs can comprise both micro RNA point mutations and therefore they can be specifically tar (miRNA) and short-interfering RNA (siRNA) (Meister and geted using the methods and compositions of the invention Tuschl (2004) Nature 431:343-349 and Bonetta et al. (2004) without altering the expression of the remaining wild-type Nature Methods 1:79-86). “MicroRNAs” or “miRNAs are allele. regulatory agents comprising about 19 to about 24 nucle Any region of the target polynucleotide can be used to 40 otides (nt) in length, which are highly efficient at inhibiting design the domain of the silencing element that shares suffi the expression of target polynucleotides. See, for example cient sequence identity to allow expression of the hairpin Javier et al. (2003) Nature 425: 257-263, herein incorporated transcript to decrease the level of the target polynucleotide. by reference. For miRNA interference, the silencing element For instance, the domain can be designed to share sequence can be designed to express a dsRNA molecule that forms a identity to the 5' untranslated region of the target polynucle 45 hairpin structure containing a 21 nucleotide sequence that is otide(s), the 3' untranslated region of the target polynucle complementary to the target polynucleotide of interest. The otide(s), exonic regions of the target polynucleotide(s), miRNA can be an “artificial miRNA or “amiRNA which intronic regions of the target polynucleotide(s), and any com comprises a miRNA sequence that is synthetically designed bination thereof. In specific embodiments, a domain of the to silence a target sequence. silencing element shares sufficient homology to at least about 50 When expressing an miRNA, the final (mature) miRNA is 15, 16, 17, 18, 19, 20, 22, 25 or 30 consecutive nucleotides presentina duplex in a precursor backbone structure, the two from about nucleotides 1-50, 25-75, 75-125, 50-100, 125 strands being referred to as the miRNA (the strand that will 175, 175-225, 100-150, 150-200, 200-250, 225-275, 275 eventually basepair with the target) and miRNA* (star 325, 250-300, 325-375, 375-425, 300-350, 350-400, 425 sequence). This final miRNA is a substrate for a form of dicer 475, 400-450, 475-525, 450-500, 525-575, 575-625, 550 55 that removes the miRNA/miRNA duplex from the precur 600, 625-675, 675-725, 600-650, 625-675, 675-725, 650 sor, after which, similarly to siRNAs, the duplex can be taken 700, 725-825, 825-875, 750-800, 875-925, 925-975, 850 into the RISC complex. It has been demonstrated that miR 900, 925-975,975-1025,950-1000, 1000-1050, 1025-1075, NAs can be transgenically expressed and be effective through 1075-1125, 1050-1100, 1125-1175, 1100-1200, 1175-1225, expression of a precursor form, rather than the entire primary 1225-1275, 1200-1300, 1325-1375, 1375-1425, 1300-1400, 60 form (Parizotto et al. (2004) Genes & Development 18:2237 1425-1475, 1475-1525, 1400-1500, 1525-1575, 1575-1625, 2242 and Guo et al. (2005) Plant Cell 17:1376-1386). 1625-1675, 1675-1725, 1725-1775, 1775-1825, 1825-1875, The silencing element for miRNA interference comprises a 1875-1925, 1925-1975, 1975-2025, 2025-2075, 2075-2125, miRNA precursor backbone. The miRNA precursor back 2125-2175, 2175-2225, 1500-1600, 1600-1700, 1700-1800, bone comprises a DNA sequence having the miRNA and star 1800-1900, 1900-2000 of the target sequence. In some 65 sequences. When expressed as an RNA, the structure of the instances to optimize the siRNA sequences employed in the miRNA precursor backbone is such as to allow for the for hairpin, the synthetic oligodeoxyribonucleotide/RNAse H mation of a hairpin RNA structure that can be processed into US 8,872,001 B2 13 14 a miRNA. In some embodiments, the miRNA precursorback after ingestion to allow the formation of the dsRNA. For bone comprises a genomic miRNA precursor sequence, example, a chimeric polynucleotide that can selectively wherein said sequence comprises a native precursor in which silence the target polynucleotide can be generated by express an heterologous (artificial) miRNA and Star sequence are ing a chimeric construct comprising the target sequence for a inserted. 5 miRNA or siRNA to a sequence corresponding to all or part of As used herein, a “star sequence' is the sequence within a the gene or genes to be silenced. In this embodiment, the miRNA precursor backbone that is complementary to the dsRNA is “formed” when the target for the miRNA or siRNA miRNA and forms a duplex with the miRNA to form the stem interacts with the miRNA present in the cell. The resulting structure of a hairpin RNA. In some embodiments, the star dsRNA can then reduce the level of expression of the gene or sequence can comprise less than 100% complementarity to 10 genes to be silenced. See, for example, US Application Pub the miRNA sequence. Alternatively, the Star sequence can lication 2007-0130653, entitled “Methods and Compositions comprise at least 99%, 98%, 97%, 96%. 95%, 90%, 85%, for Gene Silencing, herein incorporated by reference. The 80% or lower sequence complementarity to the miRNA construct can be designed to have a target for an endogenous sequence as long as the Star sequence has sufficient comple miRNA or alternatively, a target for a heterologous and/or mentarity to the miRNA sequence to form a double stranded 15 synthetic miRNA can be employed in the construct. If a structure. In still further embodiments, the star sequence heterologous and/or synthetic miRNA is employed, it can be comprises a sequence having 1,2,3,4, 5 or more mismatches introduced into the cell on the same nucleotide construct as with the miRNA sequence and still has sufficient complemen the chimeric polynucleotide or on a separate construct. As tarity to form a double stranded structure with the miRNA discussed elsewhere herein, any method can be used to intro sequence resulting in production of miRNA and Suppression 20 duce the construct comprising the heterologous miRNA. of the target sequence. While the various target sequences disclosed herein can be The miRNA precursorbackbones can be from any plant. In used to design any silencing element that encodes a miRNA, some embodiments, the miRNA precursor backbone is from non-limiting examples of Such miRNA constructs include a monocot. In other embodiments, the miRNA precursor SEQID NOS: 311, 312, 327, 328,335 or 336 which target backbone is from a dicot. In further embodiments, the back- 25 SEQID NO:304; SEQID NOS: 307, 308,323,324,331 or bone is from maize or soybean. MicroRNA precursor back 332 which target SEQID NO: 278; SEQID NOS: 309, 310, bones have been described previously. For example, 325,326,333 or 334 which target SEQID NO:303; and SEQ US200901.55910A1 (WO 2009/079532) discloses the fol ID NOS: 305,306,321,322,329 or 330 which target SEQID lowing soybean miRNA precursor backbones: 156c. 159, NO: 302; or active variants or fragments thereof. 166b, 168c, 396b and 398b, and US20090155909A1 (WO 30 IV. Variants and Fragments 2009/079548) discloses the following maize miRNA precur By "fragment' is intended a portion of the polynucleotide sor backbones: 159c. 164h, 168a, 169r, and 396h. Each of or a portion of the amino acid sequence and hence protein these references is incorporated by reference in their entirety. encoded thereby. Fragments of a polynucleotide may encode Thus, the miRNA precursor backbone can be altered to protein fragments that retain the biological activity of the allow for efficient insertion of heterologous miRNA and star 35 native protein. Alternatively, fragments of a polynucleotide sequences within the miRNA precursor backbone. In such that are useful as a silencing element do not need to encode instances, the miRNA segment and the star segment of the fragment proteins that retain biological activity. Thus, frag miRNA precursor backbone are replaced with the heterolo ments of a nucleotide sequence may range from at least about gous miRNA and the heterologous star sequences, designed 10, about 15, about 16, about 17, about 18, about 19, about 20 to target any sequence of interest, using a PCR technique and 40 nucleotides, about 22 nucleotides, about 50 nucleotides, cloned into an expression construct. It is recognized that there about 75 nucleotides, about 100 nucleotides, 200 nucleotides, could be alterations to the position at which the artificial 300 nucleotides, 400 nucleotides, 500 nucleotides, 600 nucle miRNA and star sequences are inserted into the backbone. otides, 700 nucleotides and up to the full-length polynucle Detailed methods for inserting the miRNA and star sequence otide employed in the invention. Alternatively, fragments of a into the miRNA precursor backbone are described elsewhere 45 nucleotide sequence may range from 1-50, 25-75, 75-125, herein (see, Example 8) and are also described in, for 50-100, 125-175, 175-225, 100-150, 150-200, 200-250, 225 example, US Patent Applications 20090155909A1 and 275, 275-325, 250-300, 325-375, 375-425, 300-350, 350 US200901.55910A1, herein incorporated by reference in 400, 425-475, 400-450, 475-525, 450-500, 525-575, 575 their entirety. 625, 550-600, 625-675, 675-725, 600-650, 625-675, 675 When designing a miRNA sequence and star sequence, 50 725, 650-700, 725-825, 825-875, 750-800, 875-925, 925 various design choices can be made. See, for example, 975, 850-900, 925-975, 975-1025, 950-1000, 1000-1050, Schwab R, et al. (2005) Dev Cell 8: 517-27. In non-limiting 1025-1075, 1075-1125, 1050-1100, 1125-1175, 1100-1200, embodiments, the miRNA sequences disclosed herein can 1175-1225, 1225-1275, 1200-1300, 1325-1375, 1375-1425, have a “U” at the 5'-end, a “C” or “G” at the 19 nucleotide 1300-1400, 1425-1475, 1475-1525, 1400-1500, 1525-1575, position, and an 'A' or “U” at the 10th nucleotideposition. In 55 1575-1625, 1625-1675, 1675-1725, 1725-1775, 1775-1825, other embodiments, the miRNA design is such that the 1825-1875, 1875-1925, 1925-1975, 1975-2025, 2025-2075, miRNA have a high free delta-G as calculated using the 2075-2125, 2125-2175, 2175-2225, 1500-1600, 1600-1700, ZipFold algorithm (Markham, N. R. & Zuker, M. (2005) 1700-1800, 1800-1900, 1900-2000 of any one of SEQ ID Nucleic Acids Res. 33: W577-W581.) Optionally, a one base NOS: 1-304 or 321-336. Methods to assay for the activity of pair change can be added within the 5' portion of the miRNA 60 a desired silencing element are described elsewhere herein. so that the sequence differs from the target sequence by one Encompassed herein are fragments of the various target nucleotide. sequences (i.e. SEQID NOS: 1-292 and 302-304) which are The methods and compositions of the invention employ useful as silencing elements and fragments of the various silencing elements that when transcribed “form a dsRNA silencing elements provided herein (i.e. SEQ ID NOS:293 molecule. Accordingly, the heterologous polynucleotide 65 301 or 321-336). Thus, fragments of a nucleotide sequence being expressed need not form the dsRNA by itself, but can that are useful as silencing elements may range from at least interact with other sequences in the plant cellor in the pest gut about 10, about 15, about 16, about 17, about 18, about 19, US 8,872,001 B2 15 16 about 20 nucleotides, about 22 nucleotides, about 50 nucle The following terms are used to describe the sequence otides, about 75 nucleotides, about 100 nucleotides, 200 relationships between two or more polynucleotides or nucleotides, 300 nucleotides, 400 nucleotides, 500 nucle polypeptides: (a) “reference sequence', (b) “comparison otides, 600 nucleotides, 700 nucleotides and up to the full window', (c) “sequence identity, and, (d) "percentage of length polynucleotide sequences of SEQID NOS: 1-304 or 5 sequence identity.” 321-336. Alternatively, fragments of a nucleotide sequence (a) As used herein, “reference sequence' is a defined that are useful as silencing elements may range from 1-50, sequence used as a basis for sequence comparison. A refer 25-75, 75-125,50-100,125-175, 175-225, 100-150, 150-200, ence sequence may be a Subset or the entirety of a specified 200-250, 225-275, 275-325, 250-300, 325-375, 375-425, sequence; for example, as a segment of a full-length cDNA or 300-350, 350-400, 425-475, 400-450, 475-525, 450-500, 10 gene sequence, or the complete cDNA or gene sequence. 525-575, 575-625, 550-600, 625-675, 675-725, 600-650, (b) As used herein, “comparison window' makes reference 625-675, 675-725, 650-700, 725-825, 825-875, 750-800, to a contiguous and specified segment of a polynucleotide 875-925,925-975, 850-900, 925-975,975-1025, 950-1000, sequence, wherein the polynucleotide sequence in the com 1000-1050, 1025-1075, 1075-1125, 1050-1100, 1125-1175, parison window may comprise additions or deletions (i.e., 1100-1200, 1175-1225, 1225-1275, 1200-1300, 1325-1375, 15 gaps) compared to the reference sequence (which does not 1375-1425, 1300-1400, 1425-1475, 1475-1525, 1400-1500, comprise additions or deletions) for optimal alignment of the 1525-1575, 1575-1625, 1625-1675, 1675-1725, 1725-1775, two polynucleotides. Generally, the comparison window is at 1775-1825, 1825-1875, 1875-1925, 1925-1975, 1975-2025, least 20 contiguous nucleotides in length, and optionally can 2025-2075, 2075-2125, 2125-2175, 2175-2225, 1500-1600, be 30, 40, 50, 100, or longer. Those of skill in the art under 1600-1700, 1700-1800, 1800-1900, 1900-2000 of any one of stand that to avoid a high similarity to a reference sequence SEQ ID NOS: 1-304 or 321-336. Methods to assay for the due to inclusion of gaps in the polynucleotide sequence a gap activity of a desired silencing element are described else penalty is typically introduced and is Subtracted from the where herein. Various, non-limiting examples of fragments of number of matches. SEQ ID NOS: 1-292 or 302-304 are provided herein and Unless otherwise stated, sequence identity/similarity val include, for example, SEQID NOS: 284-292 or 305-312. 25 ues provided herein refer to the value obtained using GAP “Variants’ is intended to mean substantially similar Version 10 using the following parameters: % identity and% sequences. Thus, further provided are variants of the various similarity for a nucleotide sequence using GAP Weight of 50 sequences set forth in SEQ ID NOS: 1-336. For polynucle and Length Weight of 3, and the nwsgapdna.cmp scoring otides, a variant comprises a deletion and/or addition of one or matrix; % identity and % similarity for an amino acid more nucleotides at one or more internal sites within the 30 sequence using GAPWeight of 8 and Length Weight of 2, and native polynucleotide and/or a Substitution of one or more the BLOSUM62 scoring matrix; or any equivalent program nucleotides at one or more sites in the native polynucleotide. thereof. By "equivalent program' is intended any sequence A variant of a polynucleotide that is useful as a silencing comparison program that, for any two sequences in question, element will retain the ability to reduce expression of the generates an alignment having identical nucleotide or amino target polynucleotide and, in Some embodiments, thereby 35 acid residue matches and an identical percent sequence iden control a pest of interest. As used herein, a “native' poly tity when compared to the corresponding alignment gener nucleotide or polypeptide comprises a naturally occurring ated by GAP Version 10. nucleotide sequence or amino acid sequence, respectively. (c) As used herein, “sequence identity” or “identity” in the For polynucleotides, conservative variants include those context of two polynucleotides or polypeptide sequences sequences that, because of the degeneracy of the genetic code, 40 makes reference to the residues in the two sequences that are encode the amino acid sequence of one of the polypeptides the same when aligned for maximum correspondence over a employed in the invention. Variant polynucleotides also specified comparison window. When percentage of sequence include synthetically derived polynucleotide. Such as those identity is used in reference to proteins it is recognized that generated, for example, by using site-directed mutagenesis, residue positions which are not identical often differ by con but continue to retain the desired activity. Generally, variants 45 servative amino acid substitutions, where amino acid residues of a particular polynucleotide of the invention (i.e., a silenc are substituted for other amino acid residues with similar ing element) will have at least about 40%, 45%, 50%, 55%, chemical properties (e.g., charge or hydrophobicity) and 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, therefore do not change the functional properties of the mol 94%. 95%, 96%, 97%, 98%, 99% or more sequence identity ecule. When sequences differ in conservative substitutions, to that particular polynucleotide as determined by sequence 50 the percent sequence identity may be adjusted upwards to alignment programs and parameters described elsewhere correct for the conservative nature of the substitution. herein. Sequences that differ by such conservative substitutions are Variants of a particular polynucleotide of the invention said to have “sequence similarity” or “similarity'. Means for (i.e., the reference polynucleotide) can also be evaluated by making this adjustment are well known to those of skill in the comparison of the percent sequence identity between the 55 art. Typically this involves scoring a conservative Substitution polypeptide encoded by a variant polynucleotide and the as a partial rather than a full mismatch, thereby increasing the polypeptide encoded by the reference polynucleotide. Per percentage sequence identity. Thus, for example, where an cent sequence identity between any two polypeptides can be identical amino acid is given a score of 1 and a non-conser calculated using sequence alignment programs and param Vative Substitution is given a score of Zero, a conservative eters described elsewhere herein. Where any given pair of 60 Substitution is given a score between Zero and 1. The scoring polynucleotides employed in the invention is evaluated by of conservative Substitutions is calculated, e.g., as imple comparison of the percent sequence identity shared by the mented in the program PC/GENE (Intelligenetics, Mountain two polypeptides they encode, the percent sequence identity View, Calif.). between the two encoded polypeptides is at least about 40%, (d) As used herein, "percentage of sequence identity” 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 65 means the value determined by comparing two optimally 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more aligned sequences over a comparison window, wherein the sequence identity. portion of the polynucleotide sequence in the comparison US 8,872,001 B2 17 18 window may comprise additions or deletions (i.e., gaps) as with a second plant comprising the second component. Prog compared to the reference sequence (which does not com eny plants from the cross will comprise both components. prise additions or deletions) for optimal alignment of the two The expression cassette can include 5' and 3' regulatory sequences. The percentage is calculated by determining the sequences operably linked to the polynucleotide of the inven number of positions at which the identical nucleic acid base or 5 tion. “Operably linked' is intended to mean a functional amino acid residue occurs in both sequences to yield the linkage between two or more elements. For example, an oper number of matched positions, dividing the number of able linkage between a polynucleotide of the invention and a matched positions by the total number of positions in the regulatory sequence (i.e., a promoter) is a functional link that window of comparison, and multiplying the result by 100 to allows for expression of the polynucleotide of the invention. yield the percentage of sequence identity. 10 Operably linked elements may be contiguous or non-contigu A method is further provided for identifying a silencing ous. When used to refer to the joining of two protein coding element from the target polynucleotides set froth in SEQID regions, by operably linked is intended that the coding regions NO: 1-292 or 302-304. Such methods comprise obtaining a are in the same reading frame. The cassette may additionally candidate fragment of any one of SEQ ID NO: 1-292 or contain at least one additional polynucleotide to be cotrans 302-304 which is of sufficient length to act as a silencing 15 formed into the organism. Alternatively, the additional element and thereby reduce the expression of the target poly polypeptide(s) can be provided on multiple expression cas nucleotide and/or control a desired pest; expressing said can settes. Expression cassettes can be provided with a plurality didate polynucleotide fragment in an appropriate expression of restriction sites and/or recombination sites for insertion of cassette to produce a candidate silencing element and deter the polynucleotide to be under the transcriptional regulation mining is said candidate polynucleotide fragment has the of the regulatory regions. The expression cassette may addi activity of a silencing element and thereby reduce the expres tionally contain selectable marker genes. sion of the target polynucleotide and/or controls a desired The expression cassette can include in the 5'-3' direction of pest. Methods of identifying Such candidate fragments based transcription, a transcriptional and translational initiation on the desired pathway for Suppression are known. For region (i.e., a promoter), a polynucleotide comprising the example, various bioinformatics programs can be employed 25 silencing element employed in the methods and compositions to identify the region of the target polynucleotides that could of the invention, and a transcriptional and translational termi be exploited to generate a silencing element. See, for nation region (i.e., termination region) functional in plants. In example, Elbahir et al. (2001) Genes and Development other embodiment, the double stranded RNA is expressed 15:188-200, Schwartz et al. (2003) Cell 115:199-208, from a Suppression cassette. Such a cassette can comprise two Khvorova et al. (2003) Cell 115:209-216. See also, siRNA at 30 convergent promoters that drive transcription of an operably Whitehead (jura.wi.mit.edu/bioc/siRNAext/) which calcu linked silencing element. "Convergent promoters' refers to lates the binding energies for both sense and antisense siR promoters that are oriented on either terminus of the operably NAS. See, also genscript.com/SS1-bin/app/rnail?op-known; linked silencing element such that each promoter drives tran Block-iTTM RNAi designer from Invitrogen and GenScript Scription of the silencing element in opposite directions, siRNA Construct Builder. 35 yielding two transcripts. In Such embodiments, the conver V. DNA Constructs gent promoters allow for the transcription of the sense and The use of the term “polynucleotide' is not intended to anti-sense Strand and thus allow for the formation of a limit the present invention to polynucleotides comprising dsRNA. DNA. Those of ordinary skill in the art will recognize that The regulatory regions (i.e., promoters, transcriptional polynucleotides can comprise ribonucleotides and combina 40 regulatory regions, and translational termination regions) tions of ribonucleotides and deoxyribonucleotides. Such and/or the polynucleotides employed in the invention may be deoxyribonucleotides and ribonucleotides include both natu native/analogous to the host cell or to each other. Alterna rally occurring molecules and synthetic analogues. The poly tively, the regulatory regions and/or the polynucleotide nucleotides of the invention also encompass all forms of employed in the invention may be heterologous to the host sequences including, but not limited to, single-stranded 45 cell or to each other. As used herein, "heterologous' in refer forms, double-stranded forms, hairpins, stem-and-loop struc ence to a sequence is a sequence that originates from a foreign tures, and the like. species, or, if from the same species, is substantially modified The polynucleotide encoding the silencing element or in from its native form in composition and/or genomic locus by specific embodiments employed in the methods and compo deliberate human intervention. For example, a promoteroper sitions of the invention can be provided in expression cas 50 ably linked to a heterologous polynucleotide is from a species settes for expression in a plant or organism of interest. It is different from the species from which the polynucleotide was recognized that multiple silencing elements including mul derived, or, if from the same/analogous species, one or both tiple identical silencing elements, multiple silencing ele are substantially modified from their original form and/or ments targeting different regions of the target sequence, or genomic locus, or the promoter is not the native promoter for multiple silencing elements from different target sequences 55 the operably linked polynucleotide. As used herein, a chi can be used. In this embodiment, it is recognized that each meric gene comprises a coding sequence operably linked to a silencing element can be contained in a single or separate transcription initiation region that is heterologous to the cod cassette, DNA construct, or vector. As discussed, any means ing sequence. of providing the silencing element is contemplated. A plant or The termination region may be native with the transcrip plant cell can be transformed with a single cassette compris 60 tional initiation region, may be native with the operably ing DNA encoding one or more silencing elements or sepa linked polynucleotide encoding the silencing element, may rate cassettes comprising each silencing element can be used be native with the plant host, or may be derived from another to transform a plant or plant cell or host cell. Likewise, a plant Source (i.e., foreign or heterologous) to the promoter, the transformed with one component can be Subsequently trans polynucleotide comprising silencing element, the plant host, formed with the second component. One or more silencing 65 or any combination thereof. Convenient termination regions elements can also be brought together by sexual crossing. are available from the Ti-plasmid of A. tumefaciens, such as That is, a first plant comprising one component is crossed the octopine synthase and nopaline synthase termination US 8,872,001 B2 19 20 regions. See also Guerineau et al. (1991) Mol. Gen. Genet. Chemical-regulated promoters can be used to modulate the 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfaconet expression of a gene in a plant through the application of an al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant exogenous chemical regulator. Depending upon the objec Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158: tive, the promoter may be a chemical-inducible promoter, Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and where application of the chemical induces gene expression, Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639. or a chemical-repressible promoter, where application of the Additional sequence modifications are known to enhance chemical represses gene expression. Chemical-inducible pro gene expression in a cellular host. These include elimination moters are known in the art and include, but are not limited to, of sequences encoding spurious polyadenylation signals, the maize In2-2 promoter, which is activated by benzene exon-intron splice site signals, transposon-like repeats, and 10 sulfonamide herbicide safeners, the maize GST promoter, other Such well-characterized sequences that may be delete which is activated by hydrophobic electrophilic compounds rious to gene expression. The G-C content of the sequence that are used as pre-emergent herbicides, and the tobacco may be adjusted to levels average for a given cellular host, as PR-1a promoter, which is activated by salicylic acid. Other calculated by reference to known genes expressed in the host 15 chemical-regulated promoters of interest include steroid-re cell. When possible, the sequence is modified to avoid pre sponsive promoters (see, for example, the glucocorticoid dicted hairpin secondary mRNA structures. inducible promoter in Schena et al. (1991) Proc. Natl. Acad. In preparing the expression cassette, the various DNA frag Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. ments may be manipulated, so as to provide for the DNA 14(2):247-257) and tetracycline-inducible and tetracycline sequences in the proper orientation and, as appropriate, in the repressible promoters (see, for example, Gatz et al. (1991) proper reading frame. Toward this end, adapters or linkers Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 may be employed to join the DNA fragments or other and 5,789,156), herein incorporated by reference. manipulations may be involved to provide for convenient Tissue-preferred promoters can be utilized to target restriction sites, removal of superfluous DNA, removal of enhanced expression within a particular plant tissue. Tissue restriction sites, or the like. For this purpose, in vitro 25 preferred promoters include Yamamoto et al. (1997) Plant J. mutagenesis, primer repair, restriction, annealing, resubstitu 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. tions, e.g., transitions and transversions, may be involved. 38(7):792-803; Hansen et al. (1997) Mol. Gen. Genet. 254 A number of promoters can be used in the practice of the (3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157 invention. The polynucleotide encoding the silencing ele 168; Rinehartet al. (1996) Plant Physiol. 112(3): 1331-1341; ment can be combined with constitutive, tissue-preferred, or 30 Van Camp et al. (1996) Plant Physiol. 112(2):525-535: other promoters for expression in plants. Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Such constitutive promoters include, for example, the core Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778: promoter of the Rsyn? promoter and other constitutive pro Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et moters disclosed in WO99/43838 and U.S. Pat. No. 6,072, al. (1993) Plant Mol. Biol. 23(6):1129-1138; Matsuoka et al. 050: the core CaMV35S promoter (Odellet al. (1985) Nature 35 (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and 313:810-812); rice actin (McElroy et al. (1990) Plant Cell Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. promoters can be modified, if necessary, for weak expression. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. In one embodiment, the various silencing elements dis Biol. 18:675-689); pEMU (Last et al. (1991) Theor: Appl. closed herein are expressed using a seed-preferred promoter. Genet. 81:581–588); MAS (Velten et al. (1984) EMBO J. 40 “Seed-preferred promoters include both “seed-specific' 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026); soy promoters (those promoters active during seed development bean elongation factor 1A (ACUP01009998), and the like. Such as promoters of seed storage proteins) as well as “seed Other constitutive promoters include, for example, U.S. Pat. germinating promoters (those promoters active during seed Nos. 5,608,149; 5,608, 1445,604,121 : 5,569,597; 5,466,785; germination). See Thompson et al. (1989) BioEssays 10:108, 5,399,680: 5,268,463; 5,608,142; and 6,177,611. 45 herein incorporated by reference. Such seed-preferred pro An inducible promoter, for instance, a pathogen-inducible moters include, but are not limited to, Cim1 (cytokinin-in promoter could also be employed. Such promoters include duced message); Kunitz trypsin inhibitor 3 (kti3) (Genbank those from pathogenesis-related proteins (PR proteins), accession AF233296); glycinin-1 genes (Genbank accession which are induced following infection by a pathogen; e.g., PR AB353075.1); cz19B1 (maize 19 kDa zein); milps (myo proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. 50 inositol-1-phosphate synthase) (see WO 00/11177 and U.S. See, for example, Redolfi et al. (1983) Neth, J. Plant Pathol. Pat. No. 6.225,529; herein incorporated by reference). 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Gamma-Zein is an endosperm-specific promoter. Globulin 1 Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO (Glb-1) is a representative embryo-specific promoter. For 99/43819, herein incorporated by reference. dicots, seed-preferred promoters include, but are not limited Additionally, as pathogens find entry into plants through 55 to, bean B-phaseolin, napin, B-conglycinin alpha (Genbank wounds or insect damage, a wound-inducible promoter may accession GU723691), soybean lectin, cruciferin, and the be used in the constructions of the invention. Such wound like. For monocots, seed-preferred promoters include, but are inducible promoters include potato proteinase inhibitor (pin not limited to, maize 15 kDa Zein, 22 kDa Zein, 27 kDa Zein, II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; gamma-Zein, waxy, shrunken 1, shrunken 2, Globulin 1, etc. Duan et al. (1996) Nature Biotechnology 14:494-498); wun1 60 See also WO00/12733, where seed-preferred promoters from and wun2, U.S. Pat. No. 5,428, 148; win1 and win2 (Stanford endl and end2 genes are disclosed; herein incorporated by et al. (1989) Mol. Gen. Genet. 215:200-208); systemin reference. (McGurl et al. (1992) Science 225: 1570-1573); WIP1 (Ro Leaf-preferred promoters are known in the art. See, for hmeier et al. (1993) Plant Mol. Biol. 22:783-792: Eckelkamp example, Yamamoto et al. (1997) Plant J. 12(2):255-265; et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok 65 Kwon et al. (1994) Plant Physiol. 105:357-67: Yamamoto et et al. (1994) Plant J. 6(2):141-150); and the like, herein al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. incorporated by reference. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. US 8,872,001 B2 21 22 Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. (2003) BioMedCentral (BMC) Biotechnology 3:7, (biomed Natl. Acad. Sci. USA 90(20):9586-9590. central.com/1472-6750/3/7); Grahametal. (1997) Plant Mol. Root-preferred promoters are known and can be selected Biol. 33:729-35; Guivarch et al. (1996); Almon et al. (1997) from the many available from the literature or isolated de Plant Physiol. 115:1599–607; the rolA gene promoter of novo from various compatible species. See, for example, Hire 5 Agrobacterium rhizogenes (Dehio et al. (1993) Plant Mol. et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root Biol. 23:1199-210); the promoter of the Agrobacterium tume specific glutamine synthetase gene); Keller and Baumgartner faciens T-DNA gene 5 (Korber et al. (1991) EMBO J. (1991) Plant Cell3(10): 1051-1061 (root-specific control ele 10:3983-91); the rice sucrose synthase RSS1 gene promoter ment in the GRP 1.8 gene of French bean); Sanger et al. (Shi et al. (1994) J. Exp. Bot. 45:623–31); the CoYMV or (1990) Plant Mol. Biol. 14(3):433-443 (root-specific pro 10 Commelina yellow mottle badnavirus promoter (Medberry et moter of the mannopine synthase (MAS) gene of Agrobacte al. (1992) Plant Cell 4:185-92; Zhou et al. (1998) Chin. J. rium tumefaciens); and Miao et al. (1991) Plant Cell3(1): 11 Biotechnol. 14:9-16); the CFDV or coconut foliar decay virus 22 (full-length cDNA clone encoding cytosolic glutamine promoter (Rohde et al. (1994) Plant Mol. Biol. 27.623-28; synthetase (GS), which is expressed in roots and root nodules Hehn and Rhode (1998) J. Gen. Virol. 79:1495-99); the of soybean). See also Bogusz et al. (1990) Plant Cell 207): 15 RTBV or rice tungro bacilliform virus promoter (Yin and 633-641, where two root-specific promoters isolated from Beachy (1995) Plant J. 7:969-80; Yin et al. (1997) Plant J. hemoglobin genes from the nitrogen-fixing nonlegume Para 12:1179-80); the pea glutamin synthase GS3A gene (Ed sponia andersonii and the related non-nitrogen-fixing nonle wards et al. (1990) Proc. Natl. Acad. Sci. USA 87:3459-63: gume Trema tomentosa are described. The promoters of these Brears et al. (1991) Plant J. 1:235-44); the inv CD111 and inv genes were linked to a B-glucuronidase reporter gene and CD141 promoters of the potato invertase genes (Hedley et al. introduced into both the nonlegume Nicotiana tabacum and (2000).J. Exp. Botany 51:817-21); the promoter isolated from the legume Lotus corniculatus, and in both instances root Arabidopsis shown to have phloem-specific expression in specific promoter activity was preserved. Leach and Aoyagi tobacco by Kertbunditetal. (1991) Proc. Natl. Acad. Sci. USA (1991) describe their analysis of the promoters of the highly 88:5212-16); the VAHOX1 promoter region (Tornero et al. expressed rolC and rolD root-inducing genes of Agrobacte 25 (1996) Plant J. 9:639-48); the pea cell wall invertase gene rium rhizogenes (see Plant Science (Limerick) 79(1):69-76). promoter (Zhang et al. (1996) Plant Physiol. 112:1111-17); They concluded that enhancer and tissue-preferred DNA the promoter of the endogenous cotton protein related to determinants are dissociated in those promoters. Teeri et al. chitinase of US published patent application 20030106097, (1989) used gene fusion to lacZ to show that the Agrobacte an acid invertase gene promoter from carrot (Ramloch rium T-DNA gene encoding octopine synthase is especially 30 Lorenz et al. (1993) The Plant J. 4:545-54); the promoter of active in the epidermis of the root tip and that the TR2 gene the sulfate transporter geneSultrl: 3 (Yoshimoto et al. (2003) is root specific in the intact plant and stimulated by wounding Plant Physiol. 131:1511-17); a promoter of a sucrose syn in leaf tissue, an especially desirable combination of charac thase gene (Nolte and Koch (1993) Plant Physiol. 101:899 teristics for use with an insecticidal or larvicidal gene (see 905); and the promoter of a tobacco sucrose transporter gene EMBO.J. 8(2):343-350). The TR1' gene, fused to mptII (neo 35 (Kuhn et al. (1997) Science 275-1298-1300). mycin phosphotransferase II) showed similar characteristics. Possible promoters also include the Black Chemy pro Additional root-preferred promoters include the VfBNOD moter for Prunasin Hydrolase (PHDL14 PRO) (U.S. Pat. No. GRP3 gene promoter (Kuster et al. (1995) Plant Mol. Biol. 6,797.859). Thioredoxin H promoter from cucumber and rice 29(4):759-772); and rolB promoter (Capana et al. (1994) (Fukuda Aetal. (2005). Plant Cell Physiol. 46(11):1779-86), Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 40 Rice (RSS1) (Shi, T. Wang et al. (1994). J. Exp. Bot. 45(274): 5,837,876; 5,750,386; 5,633,363; 5,459.252: 5,401,836; 623-631) and maize Sucrose synthese-1 promoters (Yang, 5,110,732; and 5,023,179. N-S. et al. (1990) PNAS87:4144-4148), PP2 promoter from In one embodiment of this invention the plant-expressed pumpkin Guo, H. et al. (2004) Transgenic Research 13:559 promoter is a vascular-specific promoter Such as a phloem 566). At SUC2 promoter (Truernit, E. et al. (1995) Planta specific promoter. A "vascular-specific' promoter, as used 45 196(3):564–70. At SAM-1 (S-adenosylmethionine syn herein, is a promoter which is at least expressed in Vascular thetase) (Mijnsbrugge KV. et al. (1996) Planr. Cell. Physiol. cells, or a promoter which is preferentially expressed in vas 37(8): 1108-1115), and the Rice tungro bacilliform virus cular cells. Expression of a vascular-specific promoter need (RTBV) promoter (Bhattacharyya-Pakrasi et al. (1993) Plant not be exclusively in vascular cells, expression in other cell J. 4(1):71-79). types or tissues is possible. A "phloem-specific promoter” as 50 The expression cassette can also comprise a selectable used herein, is a plant-expressible promoter which is at least marker gene for the selection of transformed cells. Selectable expressed in phloem cells, or a promoter which is preferen marker genes are utilized for the selection of transformed tially expressed in phloem cells. cells or tissues. Marker genes include genes encoding antibi Expression of a phloem-specific promoter need not be otic resistance. Such as those encoding neomycin phospho exclusively in phloem cells, expression in other cell types or 55 transferase II (NEO) and hygromycin phosphotransferase tissues, e.g., xylem tissue, is possible. In one embodiment of (HPT), as well as genes conferring resistance to herbicidal this invention, a phloem-specific promoter is a plant-express compounds, such as glufosinate ammonium, bromoxynil. ible promoter at least expressed in phloem cells, wherein the imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). expression in non-phloem cells is more limited (or absent) Additional selectable markers include phenotypic markers compared to the expression in phloem cells. Examples of 60 Such as 3-galactosidase and fluorescent proteins such as Suitable vascular-specific or phloem-specific promoters in green fluorescent protein (GFP) (Su et al. (2004) Biotechnol accordance with this invention include but are not limited to Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215 the promoters selected from the group consisting of the 28), cyan florescent protein (CYP) (Bolte et al. (2004).J. Cell SCSV3, SCSV4, SCSV5, and SCSV7 promoters (Schun Science 1 17:943-54 and Kato et al. (2002) Plant Physiol mann et al. (2003) Plant Functional Biology 30:453-60; the 65 129:913-42), and yellow florescent protein (PhiYFPTM from rolCgene promoter of Agrobacterium rhizogenes (Kiyokawa Evrogen, see, Bolte et al. (2004).J. Cell Science 1 17:943-54). et al. (1994) Plant Physiology 104:801-02: Pandolfini et al. For additional selectable markers, see generally, Yarranton US 8,872,001 B2 23 24 (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. It is recognized that the polynucleotides comprising (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. sequences encoding the silencing element can be used to (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. transform organisms to provide for host organism production 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177 of these components, and Subsequent application of the host 220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) organism to the environment of the target pest(s). Such host Cell 49:603-612: Figge et al. (1988) Cell 52:713-722: Deus organisms include baculoviruses, bacteria, and the like. In chle et al. (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; this manner, the combination of polynucleotides encoding the Fuerstetal. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; silencing element may be introduced via a suitable vector into Deuschle et al. (1990) Science 248:480-483; Gossen (1993) a microbial host, and said host applied to the environment, or 10 to plants or animals. Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) The term “introduced in the context of inserting a nucleic Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. acid into a cell, means “transfection' or “transformation' or (1990) Mol. Cell. Biol. 10:3343-3356; Zambrettietal. (1992) “transduction' and includes reference to the incorporation of Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) a nucleic acid into a eukaryotic or prokaryotic cell where the Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. 15 nucleic acid may be stably incorporated into the genome of (1991) Nucleic Acids Res. 19:4647-4653: Hillenand-Wiss the cell (e.g., chromosome, plasmid, plastid, or mitochondrial man (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb DNA), converted into an autonomous replicon, or transiently et al. (1991) Antimicrob. Agents Chemother: 35:1591-1595: expressed (e.g., transfected mRNA). Kleinschnidt etal. (1988) Biochemistry 27:1094-1104; Bonin Microbial hosts that are known to occupy the “phyto (1993) Ph.D. Thesis, University of Heidelberg: Gossen et al. sphere' (phylloplane, phyllosphere, rhizosphere, and/or (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. rhizoplana) of one or more crops of interest may be selected. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et These microorganisms are selected so as to be capable of al. (1985) Handbook of Experimental Pharmacology, Vol. 78 Successfully competing in the particular environment with the (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721 wild-type microorganisms, provide for stable maintenance 724. Such disclosures are herein incorporated by reference. 25 and expression of the sequences encoding the silencing ele The above list of selectable marker genes is not meant to be ment, and desirably, provide for improved protection of the limiting. Any selectable marker gene can be used in the components from environmental degradation and inactiva present invention. tion. VI. Compositions Comprising Silencing Elements Such microorganisms include bacteria, algae, and fungi. One or more of the polynucleotides comprising the silenc 30 Of particular interest are microorganisms such as bacteria, ing element can be provided as an external composition Such e.g., Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomo as a spray or powder to the plant, plant part, seed, a pest, oran nas, Streptomyces, Rhizobium, Rhodopseudomonas, Methy area of cultivation. In another example, a plant is transformed lius, Agrobacterium, Acetobacter, Lactobacillus, Arthro with a DNA constructor expression cassette for expression of bacter, Azotobacter; Leuconostoc, and Alcaligenes, fungi, at least one silencing element. In either composition, the 35 particularly yeast, e.g., Saccharomyces, Cryptococcus, silencing element, when ingested by an insect, can reduce the Kluyveromyces, Sporobolomyces, Rhodotorula, and Aure level of a target pest sequence and thereby control the pest Obasidium. Of particular interest are such phytosphere bac (i.e., a Pentatomidae plant pest including a N. viridula, terial species as Pseudomonas Syringae, Pseudomonas fluo Acrosternum hilare, Piezodorus guildini, and/or Halymorpha rescens, Serratia marcescens, Acetobacter xylinum, haly's. It is recognized that the composition can comprise a 40 Agrobacteria, Rhodopseudomonas spheroides, Xanthomo cell (such as plant cell or a bacterial cell), in which a poly nas campestris, Rhizobium melioti, Alcaligenes entrophus, nucleotide encoding the silencing element is stably incorpo Clavibacter xyli and Azotobacter vinlandir, and phytosphere rated into the genome and operably linked to promoters active yeast species such as Rhodotorula rubra, R. glutinis, R. in the cell. Compositions comprising a mixture of cells, some marina, R. aurantiaca, Cryptococcus albidus, C. difluens, C. cells expressing at least one silencing element are also 45 laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, encompassed. In other embodiments, compositions compris Sporobolomyces rosues, S. odorus, Kluyveromyces veronae, ing the silencing elements are not contained in a cell. In Such and Aureobasidium pollulans. Of particular interest are the embodiments, the composition can be applied to an area pigmented microorganisms. inhabited by a pest. In one embodiment, the composition is A number of ways are available for introducing the poly applied externally to a plant (i.e., by spraying a field or area of 50 nucleotide comprising the silencing element into the micro cultivation) to protect the plant from the pest. bial host under conditions that allow for stable maintenance The composition of the invention can further beformulated and expression of Such nucleotide encoding sequences. For as bait. In this embodiment, the compositions compriseafood example, expression cassettes can be constructed which Substance or an attractant which enhances the attractiveness include the nucleotide constructs of interest operably linked of the composition to the pest. 55 with the transcriptional and translational regulatory signals The composition comprising the silencing element can be for expression of the nucleotide constructs, and a nucleotide formulated in an agriculturally Suitable and/or environmen sequence homologous with a sequence in the host organism, tally acceptable carrier. Such carriers can be any material that whereby integration will occur, and/or a replication system the animal, plant or environment to be treated can tolerate. that is functional in the host, whereby integration or stable Furthermore, the carrier must be such that the composition 60 maintenance will occur. remains effective at controlling a pest. Examples of Such Transcriptional and translational regulatory signals carriers include water, Saline, Ringer's solution, dextrose or include, but are not limited to, promoters, transcriptional other Sugar Solutions, Hank’s solution, and other aqueous initiation start sites, operators, activators, enhancers, other physiologically balanced salt Solutions, phosphate buffer, regulatory elements, ribosomal binding sites, an initiation bicarbonate buffer and Tris buffer. In addition, the composi 65 codon, termination signals, and the like. See, for example, tion may include compounds that increase the half-life of a U.S. Pat. Nos. 5,039,523 and 4,853,331; EPO O480762A2; composition. Sambrook et al. (2000); Molecular Cloning: A Laboratory US 8,872,001 B2 25 26 Manual (3rd ed.: Cold Spring Harbor Laboratory Press, Pla aerosol, an impregnated granule, an adjuvant, a coatable inview, N.Y.); Davis et al. (1980) Advanced Bacterial Genet paste, and also encapsulations in, for example, polymer Sub ics (Cold Spring Harbor Laboratory, Cold Spring Harbor, StanceS. N.Y.); and the references cited therein. Such compositions disclosed above may be obtained by the Suitable host cells include the prokaryotes and the lower addition of a Surface-active agent, an inert carrier, a preser eukaryotes, such as fungi. Illustrative prokaryotes, both Vative, a humectant, a feeding stimulant, an attractant, an Gram-negative and Gram-positive, include Enterobacteri encapsulating agent, a binder, an emulsifier, a dye, a UV aceae. Such as Escherichia, Erwinia, Shigella, Salmonella, protectant, a buffer, a flow agent or fertilizers, micronutrient and Proteus; Bacillaceae; Rhizobiceae, such as Rhizobium; donors, or other preparations that influence plant growth. One Spirillaceae, such as photobacterium, Zymomonas, Serratia, 10 or more agrochemicals including, but not limited to, herbi Aeromonas, Vibrio, Desulfovibrio, Spirillum: Lactobacil cides, insecticides, fungicides, bactericides, nematicides, laceae; Pseudomonadaceae, such as Pseudomonas and molluscicides, acaracides, plant growth regulators, harvest Acetobacter, Azotobacteraceae and Nitrobacteraceae. aids, and fertilizers, can be combined with carriers, Surfac Among eukaryotes are fungi. Such as Phycomycetes and tants or adjuvants customarily employed in the art of formu Ascomycetes, which includes yeast, such as Saccharomyces 15 lation or other components to facilitate product handling and and Schizosaccharomyces; and Basidiomycetes yeast, such as application for particular target pests. Suitable carriers and Rhodotorula, Aureobasidium, Sporobolomyces, and the like. adjuvants can be solid or liquid and correspond to the Sub Characteristics of particular interest in selecting a host cell stances ordinarily employed in formulation technology, e.g., for purposes of the invention include ease of introducing the natural or regenerated mineral Substances, solvents, dispers coding sequence into the host, availability of expression sys ants, wetting agents, tackifiers, binders, or fertilizers. The tems, efficiency of expression, stability in the host, and the active ingredients of the present invention (i.e., at least one presence of auxiliary genetic capabilities. Characteristics of silencing element) are normally applied in the form of com interest for use as a pesticide microcapsule include protective positions and can be applied to the crop area, plant, or seed to qualities, such as thick cell walls, pigmentation, and intrac 25 be treated. For example, the compositions may be applied to ellular packaging or formation of inclusion bodies; leaf affin grain in preparation for or during storage in a grain bin or silo, ity; lack of mammalian toxicity; attractiveness to pests for etc. The compositions may be applied simultaneously or in ingestion; and the like. Other considerations include ease of Succession with other compounds. Methods of applying an formulation and handling, economics, storage stability, and active ingredient or a composition that contains at least one the like. 30 silencing element include, but are not limited to, foliar appli Host organisms of particular interest include yeast, such as cation, seed coating, and soil application. The number of Rhodotorula spp., Aureobasidium spp., Saccharomyces spp., applications and the rate of application depend on the inten and Sporobolomyces spp., phylloplane organisms such as sity of infestation by the corresponding pest. Pseudomonas spp., Erwinia spp., and Flavobacterium spp., Suitable surface-active agents include, but are not limited and other Such organisms, including Pseudomonas aerugi 35 to, anionic compounds such as a carboxylate of, for example, nosa, Pseudomonas fluorescens, Saccharomyces cerevisiae, a metal; carboxylate of a long chain fatty acid; an N-acylsar Bacillus thuringiensis, Escherichia coli, Bacillus subtilis, cosinate; mono- or di-esters of phosphoric acid with fatty and the like. alcohol ethoxylates or salts of such esters; fatty alcohol sul The sequences encoding the silencing elements encom 40 fates such as Sodium dodecyl sulfate, sodium octadecyl Sul passed by the invention can be introduced into microorgan fate, or sodium cetyl sulfate; ethoxylated fatty alcohol sul isms that multiply on plants (epiphytes) to deliver these com fates; ethoxylated alkylphenol sulfates; lignin Sulfonates; ponents to potential target pests. Epiphytes, for example, can petroleum Sulfonates; alkyl aryl Sulfonates such as alkyl be gram-positive or gram-negative bacteria. benzene Sulfonates or lower alkylnaphtalene Sulfonates, e.g., The silencing element can be fermented in a bacterial host 45 butyl-naphthalene sulfonate; salts of sulfonated naphthalene and the resulting bacteria processed and used as a microbial formaldehyde condensates; salts of Sulfonated phenol-form spray in the same manner that Bacillus thuringiensis strains aldehyde condensates; more complex Sulfonates Such as the have been used as insecticidal sprays. Any suitable microor amide Sulfonates, e.g., the Sulfonated condensation product ganism can be used for this purpose. Pseudomonas has been of oleic acid and N-methyl taurine; or the dialkyl sulfosucci used to express Bacillus thuringiensis endotoxins as encap 50 nates, e.g., the Sodium Sulfonate or dioctyl Succinate. Non Sulated proteins and the resulting cells processed and sprayed ionic agents include condensation products of fatty acid as an insecticide Gaertner et al. (1993), in Advanced Engi esters, fatty alcohols, fatty acid amides or fatty-alkyl- or alk neered Pesticides, ed. L. Kim (Marcel Decker, Inc.). enyl-substituted phenols with ethylene oxide, fatty esters of Alternatively, the components of the invention are pro polyhydric alcohol ethers, e.g., Sorbitan fatty acid esters, con duced by introducing heterologous genes into a cellular host. 55 densation products of Such esters with ethylene oxide, e.g., Expression of the heterologous sequences results, directly or polyoxyethylene Sorbitan fatty acid esters, block copolymers indirectly, in the intracellular production of the silencing ele of ethylene oxide and propylene oxide, acetylenic glycols ment. These compositions may then be formulated in accor such as 2.4.7.9-tetraethyl-5-decyn-4,7-diol, or ethoxylated dance with conventional techniques for application to the acetylenic glycols. Examples of a cationic Surface-active environment hosting a target pest, e.g., soil, water, and foliage 60 agent include, for instance, an aliphatic mono-, di-, or of plants. See, for example, EPA 0192319, and the references polyamine Such as an acetate, naphthenate or oleate; or oxy cited therein. gen-containing amine Such as an amine oxide of polyoxyeth In the present invention, a transformed microorganism can ylene alkylamine; an amide-linked amine prepared by the be formulated with an acceptable carrier into separate or condensation of a carboxylic acid with a di- or polyamine; or combined compositions that are, for example, a suspension, a 65 a quaternary ammonium salt. Solution, an emulsion, a dusting powder, a dispersible gran Examples of inert materials include, but are not limited to, ule, a wettable powder, and an emulsifiable concentrate, an inorganic minerals such as kaolin, phyllosilicates, carbon US 8,872,001 B2 27 28 ates, Sulfates, phosphates, or botanical materials such as cork, 5,981,840), direct gene transfer (Paszkowski et al. (1984) powdered corncobs, peanut hulls, rice hulls, and walnut EMBO.J. 3:2717-2722), and ballistic particle acceleration shells. (see, for example, U.S. Pat. No. 4,945,050; U.S. Pat. No. The compositions comprising the silencing element can be 5,879,918; U.S. Pat. No. 5,886,244; and, U.S. Pat. No. 5,932, in a suitable form for direct application or as a concentrate of 5 782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ primary composition that requires dilution with a suitable Culture. Fundamental Methods, ed. Gamborg and Phillips quantity of water or other dilutant before application. (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnol The compositions (including the transformed microorgan ogy 6:923-926); and Lec1 transformation (WO 00/28058). isms) can be applied to the environment of an insect pest (Such Also see Weissinger et al. (1988) Ann. Rev. Genet. 22:421 as a Pentatomidae plant pest or a N. viridula, Acrosternum 10 hilare, Piezodorus guildini, and/or Halymorpha haly's plant 477; Sanford et al. (1987) Particulate Science and Technol pest) by, for example, spraying, atomizing, dusting, scatter ogy 5:27-37 (onion); Christou et al. (1988) Plant Physiol. ing, coating or pouring, introducing into or on the Soil, intro 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology ducing into irrigation water, by seed treatment or general 6:923-926 (soybean): Finer and McMullen (1991) In Vitro application or dusting at the time when the pest has begun to 15 Cell Dev. Biol. 27P:175-182 (soybean): Singh et al. (1998) appear or before the appearance of pests as a protective mea Theor: Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Sure. For example, the composition(s) and/or transformed Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. microorganism(s) may be mixed with grain to protect the Natl. Acad. Sci. USA 85:4305-4309 (maize): Klein et al. grain during storage. It is generally important to obtain good (1988) Biotechnology 6:559-563 (maize): U.S. Pat. Nos. control of pests in the early stages of plant growth, as this is 5.240,855; 5,322,783; and, 5,324,646; Klein et al. (1988) the time when the plant can be most severely damaged. The Plant Physiol. 91:440-444 (maize): Fromm et al. (1990) Bio compositions can conveniently contain another insecticide if technology 8:833-839 (maize): Hooykaas-Van Slogteren et this is thought necessary. In an embodiment of the invention, al. (1984) Nature (London)311:763-764; U.S. Pat. No. 5,736, the composition(s) is applied directly to the Soil, at a time of 369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. planting, in granular form of a composition of a carrier and 25 USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The dead cells of a Bacillus strain or transformed microorganism Experimental Manipulation of Ovule Tissues, ed. Chapman et of the invention. Another embodiment is a granular form of a al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et composition comprising an agrochemical Such as, for al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. example, a herbicide, an insecticide, a fertilizer, in an inert (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated carrier, and dead cells of a Bacillus strain or transformed 30 transformation); DHalluin et al. (1992) Plant Cell 4:1495 microorganism of the invention. 1505 (electroporation); Li et al. (1993) Plant Cell Reports VII. Plants, Plant Parts, and Methods of Introducing 12:250-255 and Christou and Ford (1995) Annals of Botany Sequences into Plants 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology The methods of the invention involve introducing a poly 14:745-750 (maize via Agrobacterium tumefaciens); all of nucleotide into a plant. In one embodiment, a plant cell is 35 which are herein incorporated by reference. provided having stably incorporated into its genome a heter In specific embodiments, the silencing element sequences ologous polynucleotide comprising any of the various silenc of the invention can be provided to a plant using a variety of ing elements provided herein. It is recognized that the silenc transient transformation methods. Such transient transforma ing element, when ingested by a Pentatomidae plant pest, can tion methods include, but are not limited to, the introduction reduce the level of expression of any of the target sequences 40 of the protein or variants and fragments thereof directly into described herein (i.e. SEQ ID NOS: 1-292 or 302-304). the plant or the introduction of the transcript into the plant. “Introducing is intended to mean presenting to the plant the Such methods include, for example, microinjection or par polynucleotide in Such a manner that the sequence gains ticle bombardment. See, for example, Crossway et al. (1986) access to the interior of a cell of the plant. The methods of the Mol. Gen. Genet. 202:179-185: Nomura et al. (1986) Plant invention do not depend on a particular method for introduc 45 Sci. 44:53-58; Hepler et al. (1994) Proc. Natl. Acad. Sci. 91: ing a sequence into a plant, only that the polynucleotide or 2176-2180 and Hush et al. (1994) The Journal of Cell Science polypeptides gains access to the interior of at least one cell of 107:775-784, all of which are herein incorporated by refer the plant. Methods for introducing polynucleotides into ence. Alternatively, polynucleotides can be transiently trans plants are known in the art including, but not limited to, stable formed into the plant using techniques known in the art. Such transformation methods, transient transformation methods, 50 techniques include viral vector system and the precipitation and virus-mediated methods. of the polynucleotide in a manner that precludes Subsequent "Stable transformation' is intended to mean that the nucle release of the DNA. Thus, the transcription from the particle otide construct introduced into a plant integrates into the bound DNA can occur, but the frequency with which it is genome of the plant and is capable of being inherited by the released to become integrated into the genome is greatly progeny thereof. “Transient transformation' is intended to 55 reduced. Such methods include the use of particles coated mean that a polynucleotide is introduced into the plant and with polyethylimine (PEI: Sigma #P3143). does not integrate into the genome of the plant or a polypep In other embodiments, the polynucleotide of the invention tide is introduced into a plant. may be introduced into plants by contacting plants with a Transformation protocols as well as protocols for introduc virus or viral nucleic acids. Generally, such methods involve ing polypeptides or polynucleotide sequences into plants may 60 incorporating a nucleotide construct of the invention within a vary depending on the type of plant or plant cell, i.e., monocot viral DNA or RNA molecule. Further, it is recognized that or dicot, targeted for transformation. Suitable methods of promoters of the invention also encompass promoters utilized introducing polypeptides and polynucleotides into plant cells for transcription by viral RNA polymerases. Methods for include microinjection (Crossway et al. (1986) Biotechniques introducing polynucleotides into plants and expressing a pro 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. 65 tein encoded therein, involving viral DNA or RNA mol Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated ecules, are known in the art. See, for example, U.S. Pat. Nos. transformation (U.S. Pat. No. 5,563,055 and U.S. Pat. No. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and US 8,872,001 B2 29 30 Porta et al. (1996) Molecular Biotechnology 5:209-221; cashew (Anacardium Occidentale), macadamia (Macadamia herein incorporated by reference. integrifolia), almond (Prunus amygdalus), Sugar beets (Beta Methods are known in the art for the targeted insertion of a vulgaris), Sugarcane (Saccharum spp.), oats, barley, Veg polynucleotide at a specific location in the plant genome. In etables, ornamentals, and conifers. one embodiment, the insertion of the polynucleotide at a 5 Vegetables include tomatoes (Lycopersicon esculentum), desired genomic location is achieved using a site-specific lettuce (e.g., Lactuca sativa), green beans (Phaseolus vul recombination system. See, for example, WO99/25821, garis), lima beans (Phaseolus limensis), peas (Lathyrus spp.), WO99/25854, WO99/25840, WO99/25855, and WO99/ and members of the genus Cucumis Such as cucumber (C. 25853, all of which are herein incorporated by reference. sativus), cantaloupe (C. cantalupensis), and muskmelon (C. Briefly, the polynucleotide of the invention can be contained 10 melo). Ornamentals include azalea (Rhododendron spp.), in transfer cassette flanked by two non-recombinogenic hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus recombination sites. The transfer cassette is introduced into a rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffo plant having stably incorporated into its genome a target site dils (Narcissus spp.), petunias (Petunia hybrida), carnation which is flanked by two non-recombinogenic recombination (Dianthus caryophyllus), poinsettia (Euphorbia pulcher sites that correspond to the sites of the transfer cassette. An 15 rima), and chrysanthemum. appropriate recombinase is provided and the transfer cassette Conifers that may be employed in practicing the present is integrated at the target site. The polynucleotide of interest is invention include, for example, pines such as loblolly pine thereby integrated at a specific chromosomal position in the (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pi plant genome. nus ponderosa), lodgepole pine (Pinus contorta), and The cells that have been transformed may be grown into Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga plants in accordance with conventional ways. See, for menziesii); Western hemlock (Tsuga Canadensis); Sitka example, McCormicket al. (1986) Plant Cell Reports 5:81– spruce (Picea glauca); redwood (Sequoia sempervirens); true 84. These plants may then be grown, and either pollinated firs such as silver fir (Abies amabilis) and balsam fir (Abies with the same transformed strain or different strains, and the balsamea); and cedars Such as Western red cedar (Thuja resulting progeny having constitutive expression of the 25 plicata) and Alaska yellow-cedar (Chamaecyparis nootkat desired phenotypic characteristic identified. Two or more ensis). In specific embodiments, plants of the present inven generations may be grown to ensure that expression of the tion are crop plants (for example, corn, alfalfa, Sunflower, desired phenotypic characteristic is stably maintained and Brassica, Soybean, cotton, safflower, peanut, Sorghum, inherited and then seeds harvested to ensure expression of the wheat, millet, tobacco, etc.). In other embodiments, corn and desired phenotypic characteristic has been achieved. In this 30 Soybean plants and Sugarcane plants are optimal, and in yet manner, the present invention provides transformed seed other embodiments corn plants are optimal. (also referred to as “transgenic seed') having a polynucle Other plants of interest include grain plants that provide otide of the invention, for example, an expression cassette of seeds of interest, oil-seed plants, and leguminous plants. the invention, stably incorporated into their genome. Seeds of interest include grain seeds, such as corn, wheat, As used herein, the term plant also includes plant cells, 35 barley, rice, Sorghum, rye, etc. Oil-seed plants include cotton, plant protoplasts, plant cell tissue cultures from which plants Soybean, safflower, Sunflower, Brassica, maize, alfalfa, palm, can be regenerated, plant calli, plant clumps, and plant cells coconut, etc. Leguminous plants include beans and peas. that are intact in plants or parts of plants such as embryos, Beans include guar, locust bean, fenugreek, soybean, garden pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, beans, cowpea, mungbean, lima bean, fava bean, lentils, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. 40 chickpea, etc. Grain is intended to mean the mature seed produced by com In specific embodiments, the plants/plant cells and/or mercial growers for purposes other than growing or reproduc seeds comprising an expression construct comprise a silenc ing the species. Progeny, variants, and mutants of the regen ing element directed to a target sequence provided herein (i.e. erated plants are also included within the scope of the SEQ ID NOS: 1-292 or 302-304) operably linked to a seed invention, provided that these parts comprise the introduced 45 preferred promoter. polynucleotides. VIII. Methods of Use The present invention may be used for transformation of The methods of the invention comprise methods for con any plant species, including, but not limited to, monocots and trolling a pest (i.e., a Pentatomidae plant pest, Such as, N. dicots. Examples of plant species of interest include, but are viridula, Acrosternum hilare, Piezodorus guildini, and/or not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, 50 Halymorpha haly's plant pest). The method comprises feeding B. rapa, B. juncea), particularly those Brassica species useful to a pest a composition comprising a silencing element of the as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza invention, wherein said silencing element, when ingested by sativa), rye (Secale cereale), Sorghum (Sorghum bicolor, Sor a pest (i.e., a Pentatomidae plant pest including N. viridula, ghum vulgare), millet (e.g., pearl millet (Pennisetum glau Acrosternum hilare, Piezodorus guildini, and/or Halymorpha cum), proso millet (Panicum miliaceum), foxtail millet (Se 55 halys), reduces the level of a target polynucleotide of the pest taria italica), finger millet (Eleusine coracana)), Sunflower and thereby controls the pest. The pest can be fed the silencing (Helianthus annuus), Safflower (Carthamus tinctorius), element in a variety of ways. For example, in one embodi wheat (Triticum aestivum), soybean (Glycine max), tobacco ment, the polynucleotide comprising the silencing element is (Nicotiana tabacum), potato (Solanum tuberosum), peanuts introduced into a plant. As the Pentatomidae plant pest or N. (Arachis hypogaea), cotton (Gossypium barbadense, Gos 60 viridula, Acrosternum hilare, Piezodorus guildini, and/or sypium hirsutum), Sweet potato (Ipomoea batatus), cassava Halymorpha haly's plant pestfeeds on the plant or part thereof (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos expressing these sequences, the silencing element is deliv nucifera), pineapple (Ananas comosus), citrus trees (Citrus ered to the pest. When the silencing element is delivered to the spp.), cocoa (Theobroma Cacao), tea (Camellia sinensis), plant in this manner, it is recognized that the silencing ele banana (Musa spp.), avocado (Persea americana), fig (Ficus 65 ment can be expressed constitutively or alternatively, it may Casica), guava (Psidium guajava), mango (Mangifera be produced in a stage-specific manner by employing the indica), olive (Olea europaea), papaya (Carica papaya), various inducible or tissue-preferred or developmentally US 8,872,001 B2 31 32 regulated promoters that are discussed elsewhere herein. In (e.g., U.S. Pat. No. 5,602,321; beta-ketothiolase, polyhy one embodiment, the silencing element is operably linked to droxybutyrate synthase, and acetoacetyl-CoA reductase a seed-preferred promoter. In specific embodiments, the (Schubert etal. (1988).J. Bacteriol. 170:5837-5847) facilitate silencing element expressed in the roots, stalk or stem, leaf expression of polyhydroxyalkanoates (PHAs)); the disclo including pedicel, Xylem and phloem, fruit or reproductive 5 sures of which are herein incorporated by reference. One tissue, silk, flowers and all parts therein or any combination could also combine the polynucleotides of the present inven thereof. tion with polynucleotides providing agronomic traits such as In another method, a composition comprising at least one male sterility (e.g., see U.S. Pat. No. 5,583,210), stalk silencing element of the invention is applied to a plant. In Such strength, flowering time, or transformation technology traits embodiments, the silencing element can be formulated in an 10 Such as cell cycle regulation or gene targeting (e.g., WO agronomically suitable and/or environmentally acceptable 99/61619, WO 00/17364, and WO99/25821); the disclosures carrier, which is preferably, suitable for dispersal in fields. In of which are herein incorporated by reference. addition, the carrier can also include compounds that increase These stacked combinations can be created by any method the half life of the composition. In specific embodiments, the including, but not limited to, cross-breeding plants by any composition comprising the silencing element is formulated 15 conventional or TopCross methodology, or genetic transfor in Such a manner Such that it persists in the environment for a mation. If the sequences are stacked by genetically transform length of time sufficient to allow it to be delivered to a pest. In ing the plants, the polynucleotide sequences of interest can be Such embodiments, the composition can be applied to an area combined at any time and in any order. For example, a trans inhabited by a pest. In one embodiment, the composition is genic plant comprising one or more desired traits can be used applied externally to a plant (i.e., by spraying a field) to as the target to introduce further traits by Subsequent trans protect the plant from pests. formation. The traits can be introduced simultaneously in a In certain embodiments, the constructs of the present co-transformation protocol with the polynucleotides of inter invention can be stacked with any combination of polynucle est provided by any combination of transformation cassettes. otide sequences of interest in order to create plants with a For example, if two sequences will be introduced, the two desired trait. A trait, as used herein, refers to the phenotype 25 sequences can be contained in separate transformation cas derived from a particular sequence or groups of sequences. settes (trans) or contained on the same transformation cas For example, the polynucleotides of the present invention sette (cis). Expression of the sequences can be driven by the may be stacked with any other polynucleotides encoding same promoter or by different promoters. In certain cases, it polypeptides having pesticidal and/or insecticidal activity, may be desirable to introduce a transformation cassette that Such as other Bacillus thuringiensis toxic proteins (described 30 will suppress the expression of the polynucleotide of interest. in U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723, This may be combined with any combination of other Sup 756; 5,593.881; and Geiseretal. (1986) Gene 48:109), lectins pression cassettes or overexpression cassettes to generate the (Van Damme et al. (1994) Plant Mol. Biol. 24:825, pentin desired combination of traits in the plant. It is further recog (described in U.S. Pat. No. 5,981,722), and the like. The nized that polynucleotide sequences can be stacked at a combinations generated can also include multiple copies of 35 desired genomic location using a site-specific recombination any one of the polynucleotides of interest. The polynucle system. See, for example, WO99/25821, WO99/25854, otides of the present invention can also be stacked with any WO99/25840, WO99/25855, and WO99/25853, all of which other gene or combination of genes to produce plants with a are herein incorporated by reference. variety of desired trait combinations including, but not lim Methods and compositions are further provided which ited to, traits desirable for animal feed Such as high oil genes 40 allow for an increase in RNAi produced from the silencing (e.g., U.S. Pat. No. 6.232.529); balanced amino acids (e.g., element. In Such embodiments, the methods and composi hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885, tions employ a first polynucleotide comprising a silencing 802; and 5,703.409); barley high lysine (Williamson et al. element for a target pest sequence operably linked to a pro (1987) Eur: J. Biochem. 165:99-106; and WO 98/20122) and moter active in the plant cell; and, a second polynucleotide high methionine proteins (Pedersen et al. (1986) J. Biol. 45 comprising a Suppressor enhancer element comprising the Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and target pest sequence or an active variant or fragment thereof Musumura et al. (1989) Plant Mol. Biol. 12:123)); increased operably linked to a promoter active in the plant cell. The digestibility (e.g., modified storage proteins (U.S. application combined expression of the silencing element with Suppres Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins Sor enhancer element leads to an increased amplification of (U.S. application Ser. No. 10/005,429, filed Dec. 3, 2001)); 50 the inhibitory RNA produced from the silencing element over the disclosures of which are herein incorporated by reference. that achievable with only the expression of the silencing The polynucleotides of the present invention can also be element alone. In addition to the increased amplification of stacked with traits desirable for disease or herbicide resis the specific RNAi species itself, the methods and composi tance (e.g., fumonisin detoxification genes (U.S. Pat. No. tions further allow for the production of a diverse population 5,792.931); avirulence and disease resistance genes (Jones et 55 of RNAi species that can enhance the effectiveness of dis al. (1994) Science 266:789; Martin et al. (1993) Science 262: rupting target gene expression. As such, when the Suppressor 1432: Mindrinos et al. (1994) Cell 78:1089); acetolactate enhancer element is expressed in a plant cell in combination synthase (ALS) mutants that lead to herbicide resistance such with the silencing element, the methods and composition can as the S4 and/or Hra mutations; inhibitors of glutamine Syn allow for the systemic production of RNAi throughout the thase Such as phosphinothricin or basta (e.g., bar gene); and 60 plant; the production of greater amounts of RNAi than would glyphosate resistance (EPSPS gene)); and traits desirable for be observed with just the silencing element construct alone; processing or process products such as high oil (e.g., U.S. Pat. and, the improved loading of RNAi into the phloem of the No. 6.232.529); modified oils (e.g., fatty acid desaturase plant, thus providing better control of phloem feeding insects genes (U.S. Pat. No. 5,952,544; WO 94/11516)); modified by an RNAi approach. Thus, the various methods and com starches (e.g., ADPG pyrophosphorylases (AGPase), starch 65 positions provide improved methods for the delivery of synthases (SS), starch branching enzymes (SBE), and starch inhibitory RNA to the target organism. See, for example, U.S. debranching enzymes (SDBE)); and polymers or bioplastics application Ser. No. 12/351,093, entitled “Compositions and US 8,872,001 B2 33 34 Methods for the Suppression of Target Polynucleotides'. priate control. In other embodiments, the increase in the level filed Jan. 9, 2009 and herein incorporated by reference in its of RNAi in the plant, plant part, plant cell, or phloem can entirety. comprise at least about a 1 fold, about a 1 fold-5 fold, about a As used herein, a 'suppressor enhancer element com 5 fold-10 fold, about a 10 fold-20 fold, about a 20 fold-30 prises a polynucleotide comprising the target sequence to be fold, about a 30 fold-40 fold, about a 40 fold-50 fold, about a Suppressed or an active fragment or variant thereof. It is 50 fold-60 fold, about 60 fold-70 fold, about 70 fold-80 fold, recognize that the Suppressor enhancer element need not be about a 80 fold-90 fold, about a 90 fold-100 fold or greater identical to the target sequence, but rather, the Suppressor increase in the level of RNAi in the plant, plant part, plant cell enhancer element can comprise a variant of the target orphloem when compared to an appropriate control. Methods sequence, so long as the Suppressor enhancer element has 10 to assay for an increase in the level of RNAi are discussed Sufficient sequence identity to the target sequence to allow for elsewhere herein. an increased level of the RNAi produced by the silencing Non-limiting examples of methods and compositions are element over that achievable with only the expression of the disclosed herein. An example of methods and compositions silencing element. Similarly, the Suppressor enhancer ele comprise an isolated polynucleotide comprising a nucleotide ment can comprise afragment of the target sequence, wherein 15 sequence selected from the group consisting of: (a) the nucle the fragment is of Sufficient length to allow for an increased otide sequence comprising any one of SEQ ID NOS: 279, level of the RNAi produced by the silencing element over that 302, 281,304, 280, 283, 282,303, 278, 284, 285, 286, 287, achievable with only the expression of the silencing element. 288,289,290,291,292, 14, 18, 263, 17, 30, 34,337,338,339, Thus, in specific embodiments, the Suppressor enhancer ele 340, 341, 342, 343, 344, 305, 306, 307, 308,309, 310, 311, ment comprises a polynucleotide set forth in SEQ ID NO: 312, 293, 294, 295, 296,297, 298, 299, 300, 301,321, 322, 1-292, or 302-304 or an active variant or fragment thereof. 323,324,325, 326,327 or 328 or a complement thereof; (b) It is recognized that multiple Suppressor enhancer elements the nucleotide sequence comprising at least 90% sequence from the same target sequence or from different target identity to any one of SEQID NOS: 279,302, 281,304, 280, sequences, or from different regions of the same target 283, 282,303, 278, 284, 285, 286, 287, 288, 289, 290, 291, sequence can be employed. For example, the Suppressor 25 292, 14, 18, 263, 17, 30, 34,337,338,339,340,341,342,343, enhancer elements employed can comprise fragments of the 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, target sequence derived from different region of the target 296, 297, 298, 299, 300, 301,321, 322, 323,324, 325, 326, sequence (i.e., from the 3'UTR, coding sequence, intron, and/ 327 or 328 or a complement thereof, wherein said polynucle or 5' UTR). Further, the suppressor enhancer element can be otide encodes a silencing element having insecticidal activity contained in an expression cassette, as described elsewhere 30 against a Pentatomidae plant pest; (c) the nucleotide sequence herein, and in specific embodiments, the Suppressor enhancer comprising at least 19 consecutive nucleotides of any one of element is on the same or on a different DNA vector or SEQID NOS: 279, 302, 281,304, 280, 283, 282,303, 278, construct as the silencing element. The Suppressor enhancer 284, 285,286, 287,288,289,290, 291,292, 17, 30, 34, 14, 18 element can be operably linked to a promoter as disclosed or 263 or a complement thereof, wherein said polynucleotide herein. It is recognized that the Suppressor enhancer element 35 encodes a silencing element having insecticidal activity can be expressed constitutively or alternatively, it may be against a Pentatomidae plant pest, and, (d) the nucleotide produced in a stage-specific manner employing the various sequence that hybridizes understringent conditions to the full inducible or tissue-preferred or developmentally regulated length complement of the nucleotide sequence of a), wherein promoters that are discussed elsewhere herein. said stringent conditions comprise hybridization in 50% for In specific embodiments, employing both a silencing ele 40 mamide, 1 MNaCl, 1% SDS at 37°C., and a washin 0.1xSSC ment and the Suppressor enhancer element the systemic pro at 60° C. to 65° C., wherein said polynucleotide encodes a duction of RNAi occurs throughout the entire plant. In further silencing element having insecticidal activity against a Pen embodiments, the plant or plant parts of the invention have an tatomidae plant pest. A Pentatomidae plant pest may be a N. improved loading of RNAi into the phloem of the plant than viridula plant pest. would be observed with the expression of the silencing ele 45 An example of methods and compositions comprise an ment construct alone and, thus provide better control of expression cassette comprising a heterologous polynucle phloem feeding insects by an RNAi approach. In specific otide disclosed herein operably linked to a seed-preferred embodiments, the plants, plant parts, and plant cells of the promoter. An expression cassette may express a polynucle invention can further be characterized as allowing for the otide disclosed herein as a double stranded RNA. An expres production of a diversity of RNAi species that can enhance 50 sion cassette comprising a heterologous polynucleotide dis the effectiveness of disrupting target gene expression. closed herein, wherein said polynucleotide comprises a In specific embodiments, the combined expression of the silencing element which is expressed as a hairpin RNA. An silencing element and the Suppressor enhancer element expression cassette may comprise a silencing element that increases the concentration of the inhibitory RNA in the plant comprises, in the following order, a first segment, a second cell, plant, plant part, plant tissue orphloem over the level that 55 segment, and a third segment, wherein a) said first segment is achieved when the silencing element is expressed alone. comprises at least about 19 nucleotides having at least 90% As used herein, an “increased level of inhibitory RNA sequence complementarity to a target sequence set forth in comprises any statistically significant increase in the level of SEQ ID NOS: 279, 302, 281,304, 280, 283, 282,303, 278, RNAi produced in a plant having the combined expression 284, 285,286, 287,288,289,290, 291,292, 17, 30, 34, 14, 18 when compared to an appropriate control plant. For example, 60 or 263; b) said second segment comprises a loop of sufficient an increase in the level of RNAi in the plant, plant part or the length to allow the silencing element to be transcribed as a plant cell can comprise at least about a 1%, about a 1%-5%, hairpin RNA; and, c) said third segment comprises at least about a 5%-10%, about a 10%-20%, about a 20%-30%, about about 19 nucleotides having at least 85% complementarity to a 30%-40%, about a 40%-50%, about a 50%-60%, about the first segment. A target sequence for an expression cassette 60-70%, about 70%–80%, about a 80%-90%, about a 90%- 65 may comprises the sequences set forth any one of SEQ ID 100% or greater increase in the level of RNAi in the plant, NOS: 284, 285,286, 287,288, 289,290, 291, 292,337,338, plant part, plant cell, or phloem when compared to an appro 339, 340,341, 342, 343 or 344 or a sequence having at least US 8,872,001 B2 35 36 90% sequence identity to SEQID NOS: 284, 285, 286, 287, An example of methods and compositions comprise a plant 288, 289,290, 291, 292,337,338,339, 340,341, 342, 343 or cell that is from a monocot. A monocot may be maize, barley, 344. An expression cassette may comprise any one of SEQID millet, wheat or rice. An example of methods and composi NOS: 293, 294, 295, 296,297, 298, 299, 300, 301,321,322, tions comprise a plant cell that is from a dicot. A dicot may be 323,324, 325, 326, 327 or 328. Soybean, canola, alfalfa, Sunflower, safflower, tobacco, Ara An expression cassette, wherein said may comprise a poly bidopsis, or cotton. nucleotide that is flanked by a first operably linked convergent An example of methods and compositions comprise a plant promoter at one terminus of the polynucleotide and a second or plant part comprising a plant cell disclosed herein. An operably linked convergent promoter at the opposing termi example of methods and compositions comprise a transgenic nus of the polynucleotide, wherein the first and the second 10 seed from a plant disclosed herein, wherein said transgenic convergent promoters are capable of driving expression of the seed comprises said heterologous polynucleotide comprising polynucleotide. said silencing element. An example of methods and compositions comprises a host An example of methods and compositions comprise a cell comprising a heterologous expression cassette disclosed method of controlling a Pentatomidae plant pest comprising herein. 15 feeding to a Pentatomidae plant pest a composition compris An example of methods and compositions comprises a ing a silencing element, wherein said silencing element, when plant cell having stably incorporated into its genome a heter ingested by said Pentatomidae plant pest, reduces the level of ologous polynucleotide comprising a silencing element oper expression of any one of the target Pentatomidae plant pest ably linked to a seed-preferred promoter, wherein said silenc sequences set forth in SEQID NOS: 279,302, 281,304, 280, ing element, when ingested by a Pentatomidae plant pest, 283, 282,303, 278, 284, 285, 286, 287, 288, 289, 290, 291, reduces the level of expression of any one of the target 292, 17, 30, 34, 14, 18 or 263 and thereby controls the Pen sequences set forth in SEQID NOS: 279,302,281,304, 280, tatomidae plant pest. In a method, said silencing element 283, 282,303, 278, 284, 285, 286, 287, 288, 289, 290, 291, comprises a) a fragment of at least 19 consecutive nucleotides 292, 14, 18, 263, 17, 30, 34,337,338,339,340,341,342, 343, of SEQID NOS: 279,302,281,304, 280,283,282,303, 278, 344, 305, 306, 307, 308, 309, 310, 311, 312, 293, 294, 295, 25 284, 285,286, 287,288,289,290, 291,292, 17, 30, 34, 14, 18 296, 297, 298, 299, 300, 301,321, 322, 323,324, 325, 326, or 263 or a complement thereof; or, b) the nucleotide 327 or 328 in said Pentatomidae plant pest and thereby con sequence comprising at least 90% sequence identity to any trols the Pentatomidae plant pest. A plant cell may comprise one of SEQID NOS: 279,302,281,304, 280, 283,282,303, a silencing element comprising a) a fragment of at least 19 278,284, 285,286,287,288, 289,290, 291, 292, 14, 18, 263, consecutive nucleotides of SEQID NOS: 279,302,281,304, 30 17, 30, 34,337,338,339, 340,341, 342, 343,344, 305,306, 280, 283, 282,303, 278, 284, 285, 286, 287, 288, 289, 290, 307, 308,309, 310, 311, 312, 293, 294, 295, 296,297, 298, 291, 292, 17, 30, 34, 14, 18 or 263 or a complement thereof; 299, 300,301,321,322,323,324, 325,326,327 or 328 or a or, b) the nucleotide sequence comprising at least 90% complement thereof, wherein said silencing element, when sequence identity to any one of SEQID NOS: 279,302, 281, ingested by a Pentatomidae plant pest, reduces the level of a 304, 280, 283, 282,303, 278, 284, 285, 286, 287, 288, 289, 35 target sequence in said Pentatomidae plant pest and thereby 290,291,292, 14, 18, 263, 17, 30, 34,337,338,339,340,341, controls the Pentatomidae plant pest. In a method, a Pentato 342, 343, 344, 305, 306, 307, 308, 309, 310,311, 312, 293, midae plant pest comprises a N. viridula plant pest. In a 294, 295, 296,297, 298, 299, 300, 301,321,322, 323, 324, method, said silencing element comprises the sequence set 325, 326, 327 or 328 or a complement thereof, wherein said forth in any one of SEQ ID NOS: 284, 285, 286, 287, 288, silencing element, when ingested by a Pentatomidae plant 40 289, 290, 291, 292, 305,306, 307, 308, 309,310, 311, 312, pest, reduces the level of a target sequence in said Pentatomi 17.30, 34, 337, 338, 339, 340, 341, 342, 343 or 344 or a dae plant pest and thereby controls the Pentatomidae plant complement thereof. In a method, said composition com pest. For such a plant cell the Pentatomidae plant pest may be prises a plant or plant part having stably incorporated into its a N. viridula plant pest. In a plant cell of any one of embodi genome a polynucleotide comprising said silencing element, ment 11, 12 or 13, wherein said silencing element comprises 45 wherein said silencing element is operably linked to a seed the sequences set forth in any one of SEQID NOS: 284, 285, preferred promoter. In a method, said silencing element com 286, 287,288, 289, 290, 291, 292, 305, 306, 307, 308,309, prises a) a polynucleotide comprising the sense or antisense 310, 311, 312, 17, 30, 34, 337, 338,339, 340,341, 342, 343 sequence of the sequence set forth in SEQID NOS: 284, 285, or 344 or a complement thereof. A plant cell may comprise an 286,287,288,289,290,291,292, 17, 30,34, 14, 18, 263,337, expression cassette disclosed herein. A plant cell may com 50 338,339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, prise a silencing element that expresses a double stranded 310, 311 or 312 or a complement thereof; or, b) a polynucle RNA. A plant cell may comprise a silencing element that otide comprising the sense or antisense sequence of a expresses a hairpin RNA. Such a plant cell comprises said sequence having at least 95% sequence identity to the polynucleotide comprising the silencing element comprises, sequence set forth in SEQID NOS: 284, 285,286, 287,288, in the following order, a first segment, a second segment, and 55 289,290,291,292, 17, 30, 34, 14, 18, 263,337,338,339,340, a third segment, wherein a) said first segment comprises at 341, 342, 343,344, 305,306, 307, 308,309, 310,311 or 312 least about 19 nucleotides having at least 90% sequence or a complement thereof. In a method, said silencing element complementarity to a target sequence set forth in SEQ ID expresses a double stranded RNA. In a method, said silencing NOS: 279, 302, 281,304, 280, 283, 282,303, 278, 284, 285, element comprises a hairpin RNA. In a method, said poly 286,287,288,289,290,291,292, 14, 18, 263, 17, 30, 34,337, 60 nucleotide comprising the silencing element comprises, in 338,339, 340, 341, 342, 343, 344, 305, 306, 307, 308, 309, the following order, a first segment, a second segment, and a 310,311, 312, 293, 294, 295, 296,297, 298, 299, 300, 301, third segment, whereina) said first segment comprises at least 321, 322, 323, 324, 325, 326, 327 or 328; b) said second about 20 nucleotides having at least 90% sequence comple segment comprises a loop of Sufficient length to allow the mentarity to the target polynucleotide; b) said second seg silencing element to be transcribed as a hairpin RNA; and, c) 65 ment comprises a loop of sufficient length to allow the silenc said third segment comprises at least about 19 nucleotides ing element to be transcribed as a hairpin RNA; and, c) said having at least 85% complementarity to the first segment. third segment comprises at least about 20 nucleotides having US 8,872,001 B2 37 38 at least 85% complementarity to the first segment. In a TABLE 1-continued method, said silencing element is flanked by a first operably linked convergent promoter at one terminus of the silencing 6 day SCOe element and a second operably linked convergent promoter at clone name Gene ID #dead 10 the opposing terminus of the polynucleotide, wherein the first and the second convergent promoters are capable of driving inv1c.pk004.h21.f cyclint 10 inv1c.pk004.h23.f similar to complement component 1 q 9 expression of the silencing element. In a method, said plant is Subcomponent binding protein-like a monocot. In a method, said monocot is maize, barley, millet, protein wheat or rice. In a method, said plant is a dicot. In a method, inv1c.pk004.h24.f similar to prefoldin subunit 10 10 inv1c.pk004.i.1.f hsp70 10 said plant is soybean, canola, alfalfa, Sunflower, safflower, inv1c.pk004. i4.f serine/threonine kinase 9 tobacco, Arabidopsis, or cotton. inv1c.pk004.it.f no hits 9 The following examples are offered by way of illustration inv1c.pk004.i.14.f cytochrome P450 10 inv1c.pk005.f6.f U6 snRNA-associated Sm-like protein 7 and not by way of limitation. inv1c.pk005.f3.f NADH dehydrogenase subunit 2 10 inv1c.pk005.f2O.f apolipprotein D 7 15 inv1c.pk005.h1.f similar to Gag protein 10 EXPERIMENTAL inv1c.pk005.i.21.f no hits 8 inv1c.pk005. 11.f no hits 8 inv1c.pk005.17.f Homo sapiens 3 BACRP11-666A9 9 Example 1 inv1c.pk005.k12.f no hits 7 inv1c.pk005.13.f no hits 10 inv1c.pk005.m.5.f no hits 10 In Vitro Transcription dsRNA Screening Method inv1c.pk005.m.16.f similar to translation initiation factor 3, 8 subunit S8 inv1c.pk006. 24.f no hits 9 A high throughput Survey of candidate genes from the inv1c.pk006.ka.f no hits 7 stinkbug Nezara viridula was performed for their potential inv1c.pk006.k18.f acyl-CoA binding protein 7 25 inv1c.pk006.k20.f E3 ubiquitin ligase? zinc finger protein 9 utility as a target for RNAi leading to mortality (insecticidal inv1c.pk006.k21.f no hits 8 activity of RNAi). A library of over 1000 expressed sequence inv1c.pk006.7.f nervana 3 similar to 7 tags was subjected to in vitro transcription and individual Sodium/potassium-dependent atpase samples tested against 2nd instar nymphs of N. viridula. The beta-2 subunit inv1c.pk006.m2.f no hits 10 insects were fed the sample in an insect assay format. After 6 30 inv1c.pk006.m13.f no hits 10 days, the number of dead nymphs was recorded. Table 1 inv1c.pk006.o14.f no hits 10 provides the blast homology (Gene ID) of the various silenc inv1c.pk006.p4.f ubiquinol-cytochrome c reductase 10 ing elements (clone name) disclosed herein and also provides complex 11 kDa protein bioassay data demonstrating the insecticidal activity of the inv1c.pk006.p8.f similar to ATPase inhibitor-like protein 10 various sequences when fed to N. viridula. inv1c.pk006. p11.f 40S ribosomal protein S7 9 35 inv1c.pk006.p14.f similar to Drosophila and pea aphid 10 sequences TABLE 1. inv1c.pk007.a5.f homology to insect sequences 8 (Nasonia, Triboium, Drosophila 6 day inv1c.pk007.b6.f no hits 9 inv1c.pk007.co.f no hits 10 SCO clone name Gene ID #dead 10 inv1c.pk007.c9.f conserved hypothetical protein 10 40 inv1c.pk007.d17.f putative ferritin 10 inv1c.pk008.f3.f no hits 10 inv1c.pk007.e5.f atty acyl-CoA elongase 10 inv1c.pk003.n13. conserved hypothetical protein 10 inv1c.pk007.e21.f aldehyde dehydrogenase 9 inv1c.pk003.o24. conserved hypothetical protein 7 inv1c.pk007.fl.f no hits 10 inv1c.pk004.a3.f cathepsin L1 precursor 9 inv1c.pk007.f.if beta-tubulin 10 inv1c.pk004.a23. no hits 9 inv1c.pk007.fl. 2.f no hits 10 inv1c.pk004.b4.f forked protein 8 45 inv1c.pk007.fl.9.f mitochondrial import receptor subunit 10 inv1c.pk004.b6.f ribosomal protein L24e 9 om40 Aedes aegypti inv1c.pk004.b17. no hits 8 inv1c.pk007.f24.f no hits 9 inv1c.pk004.b23. nonspecific lipid transfer proteinsterol 9 inv1c.pk007.g6.f no hits 10 carrier protein inv1c.pk007.g17.f putative odorant-binding protein 10 inv1c.pk004.c11. Soldier specific protein 7 (CSO inv1c.pk004.c12. no hits 10 50 inv1c.pk007.h7.f no hits 7 inv1c.pk004.d4.f no hits 8 inv1c.pk007.h11.f no hits 8 inv1c.pk004.d16. oligomycin sensitivity conferral 10 inv1c.pk007.h19.f no hits 7 protein ATP synthase inv1c.pk007.17.f transposase 10 inv1c.pk004.d17. no hits 10 inv1c.pk007.i.16.f venom prophenoloxidase-activating 10 inv1c.pk004.d19. no hits 7 O(8Se. inv1c.pk007. 14.f no hits 10 inv1c.pk004.d20. no hits 9 55 inv1c.pk004.e6.f mitochondrial protein PTCD3 10 inv1c.pk007.19.f no hits 10 inv1c.pk004.e11. adapter molecule Crk 10 inv1c.pk007.i.21.f conserved hypothetical protein 9 inv1c.pk004.e24. cytochrome P450 10 inv1c.pk007. 23.f Succinate dehydrogenase, 7 inv1c.pk004.f2.f no hits 8 cytochrome B Small subunit inv1c.pk004.f10 no hits 7 inv1c.pk007.i.24.f no hits 8 inv1c.pk004.f12 no hits 8 inv1c.pk007.k17.f conserved hypothetical protein 9 inv1c.pk004.f17. similar to dipteran sequences 7 60 inv1c.pk007.15.f no hits 9 inv1c.pk004.f24. no hits 8 inv1c.pk007.18.f transmembrane protein, putative 9 inv1c.pk004.g13.f no hits 8 inv1c.pk007.11.f no hits 10 inv1c.pk004.g20.f vertebrate homology 9 inv1c.pk007.m6.f conserved hypothetical protein 10 inv1c.pk004.g22.f no hits 10 inv1c.pk007.m21.f no hits 9 inv1c.pk004.g23.f no hits 8 inv1c.pk007.o14.f proteasome beta subunit 7 inv1c.pk004.h18.f salivary protein 10 65 inv1c.pk007.p17.f no hits 7 inv1c.pk004.h20.f lin-52 homolog 8 inv1c.pk008.c8.f ribosomal protein L35Ae 7 US 8,872,001 B2 39 40 TABLE 1-continued Example 2 6 day Sequences Having Insecticidal Activity SCO clone name Gene ID #dead 10 5 DNA sequences which encode double stranded RNAs inv1c.pk008.c15.f similar to prohibitin 8 which were shown to have insecticidal activity against N. inv1c.pk008.c17.f no hits 7 viridula using the assay described in Example 1 are set forth inv1c.pk008.d1.f conserved hypothetical protein 9 inv1c.pk008.d3.f conserved hypothetical protein 7 in SEQID NOS: 1-139. inv1c.pk008.e11.f no hits 10 inv1c.pk008.e15.f no hits 10 10 Example 3 inv1c.pk008.f3.f conserved hypothetical protein 9 inv1c.pk008.f5.f no hits 8 Transformation of Maize inv1c.pk008.f3.f no hits 10 inv1c.pk008.f23.f no hits 10 Immature maize embryos from greenhouse donor plants inv1c.pk008. g7.f no hits 7 15 inv1c.pk008.g22.f no hits 7 are bombarded with a plasmid containing the silencing ele inv1c.pk008.h23.f putative ribosomal protein S26 10 ment of the invention operably linked to either a tissue spe inv1c.pk008.h24.f similar to mevalonate kinase 10 cific, tissue selective, or constitutive promoter and the select inv1c.pk008.i.10.f no hits 9 able marker gene PAT (Wohleben et al. (1988) Gene 70:25 inv1c.pk008.i.21.f putative accessory gland protein 9 37), which confers resistance to the herbicide Bialaphos. In inv1c.pk008.i.20.f similar to eukaryotic translation 8 one embodiment, the promoter employed is a seed-preferred initiation factor 3 subunit 2 beta inv1c.pk008.k24. no hits 7 promoter. In one embodiment, the constructs will express a inv1c.pk008.11.f similar to phosphatase and actin 9 long double stranded RNA or a miRNA of the target sequence regulator set forth in SEQ ID NOS: 1-292 or 302-304 or a fragment inv1c.pk008.p18 no hits 9 thereof. In specific embodiments, the target sequence com inv1c.pk009.b14. no hits 8 25 prises the sequences set forth in SEQID NOS: 278,279, 280, inv1c.pk009.b21. ribosomal protein S20 7 inv1c.pk009.e.9.f no hits 9 281,282,283,302,303 or 304. Such a construct can be linked inv1c.pk009.e10 similar to sarco(endo)plasmic 7 to a promoter active in maize. Alternatively, the selectable reticulum-type calcium ATPase marker gene is provided on a separate plasmid. Transforma inv1c.pk009.e17. similar to serine/threonine protein 9 tion is performed as follows. Media recipes follow below. kinase death domain protein, pelle 30 Preparation of Target Tissue like The ears are husked and surface sterilized in 30% Clorox inv1c.pk009.f12. no hits 10 inv1c.pk009.f17. no hits 7 bleach plus 0.5%. Micro detergent for 20 minutes, and rinsed inv1c.pk009.f19. no hits 9 two times with sterile water. The immature embryos are inv1c.pk009.g2.f no hits 8 excised and placed embryo axis side down (scutellum side inv1c.pk009.g21.f no hits 8 35 up), 25 embryos per plate, on 560Y medium for 4 hours and inv1c.pk009.h.21.f no hits 10 then aligned within the 2.5 cm target Zone in preparation for inv1c.pk009.i.13. no hits 10 bombardment. inv1c.pk009.i.24. no hits 7 inv1c.pk009.ka.f no hits 8 A plasmid vector comprising the silencing element of inv1c.pk009.k8.f conserved hypothetical protein 10 interest operably linked to either the tissue specific, tissue inv1c.pk010.al3.f no hits 7 40 selective, or constitutive promoter is made. This plasmid inv1c.pk010.al6.f arginyl-tRNA synthetase 7 DNA plus plasmid DNA containing a PAT selectable marker inv1c.pk010.b7.f similar to tar RNA binding protein 10 is precipitated onto 1.1 Lum (average diameter) tungsten pel inv1c.pk010.e5.f no hits 7 inv1c.pk010.n9.f no hits 7 lets using a CaCl2 precipitation procedure as follows: 100 ul inv1c.pk010.n24.f no hits 10 prepared tungsten particles in water, 10ul (1 lug) DNA in Tris inv1c.pk010.p16.f cytochrome c oxidase subunit II 7 45 EDTA buffer (1 lug total DNA): 100 ul 2.5 M CaCl; and, 10 inv1c.pk010.p20.f no hits 8 ul 0.1 M spermidine. inv1c.pk011.a2O.f no hits 7 Each reagent is added sequentially to the tungsten particle inv1c.pk011.b11.f no hits 7 suspension, while maintained on the multitube vortexer. The final mixture is sonicated briefly and allowed to incubate 50 under constant Vortexing for 10 minutes. After the precipita Sequences displaying insecticidal activity are advanced to tion period, the tubes are centrifuged briefly, liquid removed, confirmation and further evaluation of activity against other washed with 500 ml 100% ethanol, and centrifuged for 30 Stinkbug pests. The assay is scored for activity 6 days post seconds. Again the liquid is removed, and 105ul 100% etha infestation. The possible scores are dead, severely stunted nol is added to the final tungsten particle pellet. For particle (little or now growth but alive), stunted (growth to second 55 gun bombardment, the tungsten/DNA particles are briefly instar but not equivalent to controls), or no activity. Samples Sonicated and 10 ul spotted onto the center of each macrocar demonstrating mortality or severe stunting are advanced to rier and allowed to dry about 2 minutes before bombardment. confirmation. The sample plates are bombarded at level #4 in a particle gun. All samples receive a single shot at 650 PSI, with a total Following confirmation, a simple dose response assay is 60 often aliquots taken from each tube of prepared particles/ performed with N. viridula. Samples for dose response assays DNA. is produced in the same manner with the following modifica Following bombardment, the embryos are kept on 560Y tion; samples is further purified using column purification medium for 2 days, then transferred to 560R selection prior to enzymatic treatment. Samples is also normalized to medium containing 3 mg/liter Bialaphos, and Subcultured 0.5ugful and all samples are evaluated by gel electrophoresis. 65 every 2 weeks. After approximately 10 weeks of selection, Dose response assays is performed with the following rates; selection-resistant callus clones are transferred to 288J 50, 25, 12, 6, 3, and 1.5 ppm medium to initiate plant regeneration. Following Somatic US 8,872,001 B2 41 42 embryo maturation (2-4 weeks), well-developed somatic is employed (U.S. Pat. No. 5,981,840, and PCT patent pub embryos are transferred to medium for germination and trans lication WO98/32326; the contents of which are hereby ferred to the lighted culture room. Approximately 7-10 days incorporated by reference). Such a construct can, for later, developing plantlets are transferred to 272V hormone example, express along double stranded RNA or a miRNA of free medium in tubes for 7-10 days until plantlets are well established. Plants are then transferred to inserts in flats the target sequence set forth in SEQID NOS: 1-292 or 302 (equivalent to 2.5" pot) containing potting soil and grown for 304. In one embodiment, the promoter employed is a seed 1 week in a growth chamber, Subsequently grown an addi preferred promoter. In specific embodiments, the target tional 1-2 weeks in the greenhouse, then transferred to classic sequence comprises the sequence set forth in SEQID NOS: 600 pots (1.6 gallon) and grown to maturity. 278, 279, 280, 281, 282,283, 302, 303 or 304. Such a con Plants are monitored and scored for the appropriate marker, 10 struct can be linked to the dMMB promoter. Briefly, immature Such as the control of a Pentatomidae plant pest, Such as a N. embryos are isolated from maize and the embryos contacted viridula plant pest. For example, Ro maize plants are fed to N. with a suspension of Agrobacterium, where the bacteria are viridula 2nd instar nymphs. Contamination and larval quality capable of transferring the polynucleotide comprising the are monitored. Larval mass and Survivorship are recorded for analysis. A one-way ANOVA analysis and a Dunnett's test is 15 silencing element to at least one cell of at least one of the performed on the larval mass data to look for statistical sig immature embryos (step 1: the infection step). In this step the nificance compared to an untransformed negative control immature embryos are immersed in an Agrobacterium Sus maize plant diet. N. viridula 2" instar nymph stunting is pension for the initiation of inoculation. The embryos are measured after feeding on two events and compared to growth co-cultured for a time with the Agrobacterium (step 2: the of larvae fed on negative control plants. co-cultivation step). The immature embryos are cultured on In other assays, transgenic corn plants (Ro) generated are solid medium following the infection step. Following this planted into 10-inch pots containing Metromix soil after co-cultivation period an optional “resting step is contem reaching an appropriate size. After allowing the N. viridula plated. In this resting step, the embryos are incubated in the 2" instar nymphs to feed on the plant, plants are removed presence of at least one antibiotic known to inhibit the growth from the soil and washed so that the relevant plant parts can be 25 evaluated for larval feeding. Plant damage is rated using of Agrobacterium without the addition of a selective agent for routine methods to score the level of damage. plant transformants (step 3: resting step). The immature Bombardment medium (560Y) comprises 4.0 g/l N6 basal embryos are cultured on solid medium with antibiotic, but salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix without a selecting agent, for elimination of Agrobacterium (1000xSIGMA-1511), 0.5 mg/l thiamine HCl, 120.0 g/1 and for a resting phase for the infected cells. Next, inoculated Sucrose, 1.0 mg/l 2,4-D, and 2.88 g/l L-proline (brought to 30 embryos are cultured on medium containing a selective agent volume with D-I HO following adjustment to pH 5.8 with and growing transformed callus is recovered (step 4: the KOH); 2.0 g/l Gelrite (added after bringing to volume with selection step). The immature embryos are cultured on Solid D-I HO); and 8.5 mg/l silver nitrate (added after sterilizing medium with a selective agent resulting in the selective the medium and cooling to room temperature). Selection growth of transformed cells. The callus is then regenerated medium (560R) comprises 4.0 g/l N6 basal salts (SIGMA 35 into plants (step 5: the regeneration step), and calli grown on C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000xSIGMA 1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, and 2.0 selective medium are cultured on Solid medium to regenerate mg/12,4-D (brought to volume with D-I HO following the plants. Assays for insecticidal activity can be performed adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after as described above in Example 3. bringing to volume with D-I HO); and 0.85 mg/l silver 40 nitrate and 3.0 mg/l bialaphos (both added after sterilizing the medium and cooling to room temperature). Example 5 Plant regeneration medium (288J) comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solu Soybean Embryo Transformation tion (0.100 g nicotinic acid, 0.02 g/l thiamine HCl, 0.10 g/1 pyridoxine HCl, and 0.40 g/l glycine brought to volume with 45 polished D-I HO) (Murashige and Skoog (1962) Physiol. Culture Conditions Plant. 15:473), 100 mg/l myo-inositol, 0.5 mg/l Zeatin, 60 g/1 Soybean embryogenic suspension cultures (cv. Jack) are sucrose, and 1.0 ml/l of 0.1 mM abscisic acid (brought to maintained in 35 ml liquid medium SB196 (see recipes volume with polished D-I HO after adjusting to pH 5.6): 3.0 below) on rotary shaker, 150 rpm, 26°C. with cool white g/l Gelrite (added after bringing to volume with D-I HO); 50 fluorescent lights on 16:8 hr day/night photoperiod at light and 1.0 mg/l indoleacetic acid and 3.0 mg/l bialaphos (added intensity of 60-85 g/m2/s. Cultures are subcultured every 7 after sterilizing the medium and cooling to 60°C.). Hormone days to two weeks by inoculating approximately 35 mg of free medium (272V) comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g/1 tissue into 35 ml of fresh liquid SB196 (the preferred subcul nicotinic acid, 0.02 g/l thiamine HCl, 0.10 g/l pyridoxine 55 ture interval is every 7 days). HCl, and 0.40 g/l glycine brought to volume with polished Soybean embryogenic Suspension cultures are trans D-IHO), 0.1 g/1 myo-inositol, and 40.0 g/l sucrose (brought formed with a plasmid containing the silencing element of the to volume with polished D-I HO after adjusting pH to 5.6); invention operably linked to either a tissue specific, tissue and 6 g/l bacto-agar (added after bringing to Volume with selective, or constitutive promoter by the method of particle polished D-I HO), sterilized and cooled to 60° C. 60 gunbombardment (Kleinet al. (1987) Nature, 327:70). In one embodiment, the promoter employed is a seed-preferred pro Example 4 moter. In one embodiment, the constructs will express a long double stranded RNA or a miRNA of the target sequence set Agrobacterium-Mediated Transformation of Maize forth in SEQ ID NOS: 1-292 or 302-304 or a fragment 65 thereof. In specific embodiments, the target sequence com For Agrobacterium-mediated transformation of maize prises the sequences set forth in SEQID NOS: 278,279, 280, with a silencing element of the invention, the method of Zhao 281, 282,283, 302,303 or 304. US 8,872,001 B2 43 44 Soybean Embryogenic Suspension Culture Initiation green tissue is removed and inoculated into multiwell plates Soybean cultures are initiated twice each month with 5-7 to generate new, clonally propagated, transformed embryo days between each initiation. genic suspension cultures. Pods with immature seeds from available soybean plants Chlorsulfuron (ALS) Selection 45-55 days after planting are picked, removed from their 5 Following bombardment, the tissue is divided between 2 shells and placed into a sterilized magenta box. The Soybean flasks with fresh SB196 media and cultured as described seeds are sterilized by shaking them for 15 minutes in a 5% above. Six to seven days post-bombardment, the SB196 is Clorox solution with 1 drop of ivory soap (95 ml of auto exchanged with fresh SB196 containing selection agent of claved distilled water plus 5 ml Clorox and 1 drop of soap). 100 ng/ml Chlorsulfuron. The selection media is refreshed Mix well. Seeds are rinsed using 2 1-liter bottles of sterile 10 distilled water and those less than 4 mm are placed on indi weekly. Four to six weeks post selection, green, transformed vidual microscope slides. The small end of the seed are cut tissue may be observed growing from untransformed, and the cotyledons pressed out of the seed coat. Cotyledons necrotic embryogenic clusters. Isolated, green tissue is are transferred to plates containing SB1 medium (25-30 coty removed and inoculated into multiwell plates containing ledons per plate). Plates are wrapped with fiber tape and 15 SB196 to generate new, clonally propagated, transformed stored for 8 weeks. After this time secondary embryos are cut embryogenic Suspension cultures. and placed into SB196 liquid media for 7 days. Regeneration of Soybean Somatic Embryos into Plants Preparation of DNA for Bombardment In order to obtain whole plants from embryogenic Suspen Either an intact plasmid or a DNA plasmid fragment con sion cultures, the tissue must be regenerated. taining the genes of interest and the selectable marker gene Embryo Maturation are used for bombardment. Plasmid DNA for bombardment Embryos are cultured for 4-6 weeks at 26° C. in SB196 are routinely prepared and purified using the method under cool white fluorescent (Phillips cool white Econowatt described in the PromegaTM Protocols and Applications F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 Guide, Second Edition (page 106). Fragments of the plasmids watt) on a 16:8 hr photoperiod with light intensity of 90-120 carrying the silencing element of interest are obtained by gel 25 uE/m2s. After this time embryo clusters are removed to a isolation of double digested plasmids. In each case, 100 ug of solid agar media, SB 166, for 1-2 weeks. Clusters are then plasmid DNA is digested in 0.5 ml of the specific enzyme mix subcultured to medium SB 103 for 3 weeks. During this that is appropriate for the plasmid of interest. The resulting period, individual embryos can be removed from the clusters DNA fragments are separated by gel electrophoresis on 1% and screened for the appropriate marker or the ability of the SeaPlaque GTG agarose (BioWhitaker Molecular Applica 30 plant, when injected with the silencing elements, to control tions) and the DNA fragments containing silencing element the Pentatomidae plant pest or the N. viridula plant pest. of interest are cut from the agarose gel. DNA is purified from Embryo Desiccation and Germination the agarose using the GELase digesting enzyme following the Matured individual embryos are desiccated by placing manufacturer's protocol. them into an empty, small petridish (35x10 mm) for approxi A 50 ul aliquot of sterile distilled water containing 3 mg of 35 mately 4-7 days. The plates are sealed with fiber tape (creat gold particles (3 mg gold) is added to 5 ul of a lug/ul DNA ing a small humidity chamber). Desiccated embryos are Solution (either intact plasmid or DNA fragment prepared as planted into SB71-4 medium where they were left to germi described above), 50 ul 2.5M CaCl and 20 ul of 0.1 M nate under the same culture conditions described above. Ger spermidine. The mixture is shaken 3 min on level 3 of a vortex minated plantlets are removed from germination medium and shaker and spun for 10 sec in a bench microfuge. After a wash 40 rinsed thoroughly with water and then planted in Redi-Earth with 400 ul 100% ethanol the pellet is suspended by sonica in 24-cell pack tray, covered with clear plastic dome. After 2 tion in 40 ul of 100% ethanol. Five ul of DNA suspension is weeks the dome is removed and plants hardened off for a dispensed to each flying disk of the Biolistic PDS1000/HE further week. If plantlets looked hardy they are transplanted instrument disk. Each 5 ul aliquot contains approximately to 10" pot of Redi-Earth with up to 3 plantlets per pot. 0.375 mg gold per bombardment (i.e. per disk). 45 Media Recipes Tissue Preparation and Bombardment with DNA Approximately 150-200 mg of 7 day old embryonic sus pension cultures are placed in an empty, Sterile 60x15 mm SB 196 - FN Lite liquid proliferation medium (per liter) - petri dish and the dish covered with plastic mesh. Tissue is MS FeFDTA - 100x Stock 1 10 ml bombarded 1 or 2 shots per plate with membrane rupture 50 MS Sulfate - 100x Stock 2 10 ml pressure set at 1100 PSI and the chamber evacuated to a FN Lite Halides - 100x Stock 3 10 ml vacuum of 27-28 inches of mercury. Tissue is placed approxi FN Lite P, B, Mo - 100x Stock 4 10 ml mately 3.5 inches from the retaining/stopping screen. B5 vitamins (1 ml/L) 1.0 ml 2,4-D (10 mg/L final concentration) 1.0 ml Selection of Transformed Embryos KNO3 2.83 gm Transformed embryos were selected either using hygro 55 (NH4)2SO4 0.463 gm mycin (when the hygromycin phosphotransferase, HPT, gene Asparagine 1.0 gm was used as the selectable marker) or chlorsulfuron (when the Sucrose (1%) 10 gm acetolactate synthase, ALS, gene was used as the selectable pH 5.8 marker). Hygromycin (HPT) Selection 60 FN Lite Stock Solutions Following bombardment, the tissue is placed into fresh SB196 media and cultured as described above. Six days post bombardment, the SB196 is exchanged with fresh SB196 Stock # 1000 ml 500 ml containing a selection agent of 30 mg/L hygromycin. The 1 MS Fe EDTA 100x Stock selection media is refreshed weekly. Four to six weeks post 65 Na, EDTA* 3.724g 1.862 g selection, green, transformed tissue may be observed growing FeSO 7H2O 2.784g 1.392 g from untransformed, necrotic embryogenic clusters. Isolated, US 8,872,001 B2

-continued element and the closest homology for the target sequence (gene name). Table 3 provides the clone name, the target Stock # 1000 ml 500 ml cDNA, the sense and antisense siRNA sequence, and the 2 MS Sulfate 100x stock respective SEQ ID NOS. Table 4 provides the bioassays for MgSO 7H2O 37.0 g 18.5g 5 each of the siRNAs shown in Table 3. MnSO-H2O 1.69g 0.845g ZnSO 7H2O 0.86 g 0.43g CuSO 5H2O 0.0025g 0.0012.5g TABLE 2 3 FN Lite Halides 100x Stock Q S Title (ID) CaCl2—2H2O 30.0 g 15.0 g uery Sequence 11tle gene name KI O.083 0.0715 10 CoCl2–6H2O O.OO2S O.OO12S inv C. pk003.16.f conserved protein of unknown function 4 FN Lite P, B, Mo 100x Stock inv1c.pk003.j16.f conserved protein of unknown function KH2PO 18.5g 9.25 g inv1c.pk004.b7.f cathepsin L. HBO 0.62g 0.31 g inv1c.pk004.b7.f cathepsin L. Na-MoO-2H2O 0.025g 0.0125g inv1c.pk004.b7.f cathepsin L. 15 inv1c.pk004.b7.f cathepsin L. *Add first, dissolve in dark bottle while stirring inv1c.pk004.c4.f mitochondrial porin inv1c.pk004.c4.f mitochondrial porin SB1 solid medium (per liter) comprises: 1 pkg. MS salts inv1c.pk004.c4.f mitochondrial porin (Gibco/BRL-Cath11117-066); 1 ml B5 vitamins 1000x inv1c.pk004.c4.f mitochondrial porin stock; 31.5 g sucrose; 2 ml 2,4-D (20 mg/L final concentra- inve-pk00.cf. mitochondrial porin tion); pH 5.7; and, 8 9. TC agar. 2O inv c.pk004.c4.f mitoc hondrial porn SB 166 solid medium (perp liter) comprises:p 1 ppkg. g. MS salts inv1c.pk004.c4.f mitochondrial porin (Gibco/BRL-Cath11117-066); 1 ml B5 vitamins 1000x inv1c.pk004.c4.f mitochondrial porin stock; 60 g maltose; 750 mg MgCl2 hexahydrate; 5 g acti- inv1c.pk004.c4.f mitochondrial porin vated charcoal; pH 5.7; and, 2 9. gelrite. inv1c.pk004.f4.f reverse transcriptase SB 103 solid medium (per liter) comprises: 1 pkg. MS salts 25 inv E. reverse transcriptase (Gibco/BRL Cath11117-066); 1 ml B5 vitamins 1000x E title R 9. maltose; 750 ng MgCl2 hexahydrate; pH 5.7; and, inv1c.pk004.k.9.f glutathiones transferase g gelrite. inv1c.pk004.k.9.f glutathiones transferase SB 71-4 solid medium (per liter) comprises: 1 bottle Gam- inv1c.pk004.k.9.f glutathiones transferase borg's B5 salts w/sucrose (Gibco/BRL Cath21153-036); 30 inv1c.pk005.a24f cathepsin L-like protease pH 5.7; and, 5 9. TC agar. inv E. cathepsin L-like protease 2,4-D stock is obtained premade from Phytotech cathi D inv1c.pk005.b16.fInvic-pKUU).o.o. synapsin 295 concentration is 1 mg/ml. - 0 inv1c.pk005.b16.f synapsin B5Vitamins Stock (per 100 ml) which is stored in aliquots inv1c.pk005.b16.f synapsin at -20C comprises: 10g myo-inositol; 100 mg nicotinic acid; inv1c.pk005,b16.f synapsin 100 mg pyridoxine HCl; and, 1 g thiamine. If the solution inv1c.pk005, 20f Apolipoprotein D precursor does not dissolve quickly enough, apply a low level of heat via invle.pk005.20.f Apolipoprotein D precursor the hot stir plate. Chlorsulfuron Stock comprises 1 mg/ml in inv1c.pk005.f2O.f Apollipoprotein D precursor e not surp p 9. W. C.KUU.2.OOS.f2Of Apolipolipoprotein in D precursor 0.01 N. Ammonium Hydroxide inv1c.pk005.h1.f nucleic acid binding protein 40 inv1c.pk005.h1.f nucleic acid binding protein Example 6 inv1c.pk005.h1.f nucleic acid binding protein inv1c.pk005.h1.f nucleic acid binding protein Expression of Silencing Elements Comprising inv1c.pk005.h1.f nucleic acid binding protein siRNAs inv1c.pk005.h1.f nucleic acid binding protein 45 inv1c.pk005.hl.f nucleic acid binding protein inv1c.pk005.h.23.f chitin Synthase 1 SiRNAs were generated to target the cDNA sequence set inv1c.pk005.19.f conservedy hypothetical protein forth in SEQID NOS: 140,143,146, 149, 152, 155, 158, 161, inv1c.pk005.19.f conserved hypothetical protein 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, in 100s,24f cathepsin B 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, inv1c.pk005.k24.f cathepsin B 236, 239, 242, 245, 248, 251, 254, 257, 260,263,266, 269, 50 273, and 276. Table 2 provides the clone name of the silencing TABLE 3

SEO ID NOS Approx. Target cDNA/ Query Target Sense AntiSense sense siRNA/ siRNA Sequence No. Target Location Target cDNA Strand siRNA antisense number Title (ID) Bases Location (thirds) Sequence & CG siRNA Sequence siRNA 1. inv1c.pk003. 16.f 656 227 2 AATCAAGGTGTGGA 34.8 UCAAGGUGUG UUUUCAGUCCA 14 OA141/142 CTGAAAATT GACUGAAAA CACCUUGA

2 inv1c.pk003. 16.f 656 490 3 AATTGGTTGCTACAT 3 O. 4 UUGGUUGCUA GAGAAUAUGUA 143/144/145 ATTCTCTT CAUAUUCUC GCAACCAA

3 inv1c.pk004.b7. f 603 15 O 1. AAGAACGTCTTAGG 34.8 GAACGUCUUA UAUGCAUCCUA 146/147/148 ATGCATATT GGAUGCAUA. AGACGUUC

US 8,872,001 B2 51 52 TABLE 4-continued Bioassay-1 Bioassay-1 Bioassay-2 Bioassay-3 100 ppm 100 ppm 100 ppm 100 ppm Bioassay-4 siRNA Query Sequence (4 day (5 day (5 day (5 day 25 ppm Bioassay-5 Bioassay-6 number Title (ID) score) score) score) Comment score) 5 day 25 ppm 50 ppm 6 inv1c.pk004.b7.f 5/11 3.10 7 inv1c.pk004.c4.f 3.9 1,10 8 inv1c.pk004.c4.f 3.10 Of 10 9 inv1c.pk004.c4.f 410 4/10 (5 stunted) Of 10 10 inv1c.pk004.c4.f 3.10 5/10 (3 stunted) 1,10 11 inv1c.pk004.c4.f 410 2.10 12 inv1c.pk004.c4.f 5.9 Of 10 13 inv1c.pk004.c4.f 710 1,10 14 inv1c.pk004.c4.f 410 2.10 15 inv1c.pk004.c4.f 5.9 1,10 16 inv1c.pk004.c4.f 6.10 Of 10 17 inv1c.pk004.f4.f 5/10 3/10 (2 stunted) 18 inv1c.pk004.f4.f 211 3/10 (2 stunted) 19 inv1c.pk004.f4.f 6.9 Of 10 2O inv1c.pk004. 14.f 6.10 Of 10 21 inv1c.pk004.k9.f 10.10 Of 10 22 inv1c.pk004.k9.f 611 1,10 23 inv1c.pk004.k9.f 3.10 2,10 24 inv1c.pk005.a24f 10.10 Of 10 25 inv1c.pk005.a24f Of 10 26 inv1c.pk005.b16.f Of 10 Significant growth in survivors 27 inv1c.pk005.b16.f 5/10 Significant growth in survivors 28 inv1c.pk005.b16.f 5/10 Significant growth in survivors 29 inv1c.pk005.b16.f 410 Significant growth in survivors 30 inv1c.pk005.b16.f Of 10 31 inv1c.pk005.f20.f 9,10 No growth 1,10 32 inv1c.pk005.f20.f 10.10 Some growth 1,10 before death 33 inv1c.pk005.f20.f 10.10 Growth 2/10 (survivors 410 8.10 before death stunted) 34 inv1c.pk005.f20.f 410 Growth before death 35 inv1c.pk005.h1.f 710 Growth 1/10 (some before death stunting) 36 inv1c.pk005.h1.f 10.10 some growin 1,10 before death 37 inv1c.pk005.h1.f 10.10 Growth Of 10 before death 38 inv1c.pk005.h1.f 10.10 no growth 1,10 39 inv1c.pk005.h1.f 1,10 40 inv1c.pk005.h1.f 8.10 little growth Of 10 41 inv1c.pk005.h1f 6.10 some growin 42 inv1c.pk005.h.23.f 710 No growth Of 10 43 inv1c.pk005.19.f 10.10 No growth 2.10 44 inv1c.pk005.19.f 1,10 45 inv1c.pk005.k24.f Of 10 46 inv1c.pk005.k24.f Of 10 5/10

Example 7 NO: 142. It is recognized that any of the siRNA described in Example 6 can be generated employing a similar construct 55 design. Constructs Expressing siRNAs Example 8 siRNAs designed to target the cDNA sequence set forth in SEQID NOS: 140, 143, 146, 149, 152, 155, 158, 161, 164, Generation of Silencing Constructs for In Vivo 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 60 Testing Experiments 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233,236, 239, 242, 245, 248, 251, 254, 257, 260, 263,266, 269, 272, The activity of 9 dsRNAs listed in Table 1, was confirmed and 275 can be engineered to be expressed in planta. The on repeated testing and the target genes advanced for further construct can comprise, for example, the maize ubiquitin evaluation in in planta assays. For this purpose, 2 different promoter/5'UTR/1 intron operably linked to a sequence 65 types of constructs were assembled. In one, 2 SGSB target comprising SEQID NO: 141 which is operably linked to the gene fragments, separated by a spiceosomal intron, were ADH1 intron followed by the sequence comprising SEQID assembled in opposite orientations with respect to each other US 8,872,001 B2 53 54 to produce a hairpin RNA. In planta produced hairpin RNAs the vector PHP25224. The former destination vector contains are expected to be processed to yield siRNAs which upon the 193 bp intron2 fragment of the potato LS1 gene flanked by uptake into insects, mediate RNAi inhibition of SGSB target attR4-R3 sites at the 5' end and attR3-R4 sites at the 3' end. LR gene expression. In the second, Small 21-mer SGSB gene recombination yields a hairpin segment comprised of sense sequences are incorporated into a micro RNA backbone to and antisense target gene fragments separated by an intron produce an artificial pre-miRNA. Processing of the pre loop. In planta expression is regulated by placement of the miRNA in vivo releases the 21-int miRNA that targets the appropriate regulatory elements, promoter sequences SGSB gene for silencing. Hairpin constructs for in vivo upstream and termination sequences downstream, of the hair expression and testing of dsRNAs were assembled via Gate pin segment. In this particular example, promoter sequences way technology using procedures and practices well known 10 are provided by a 1946 bp soybean ubiquitin promoter-5 to those skilled in the art of molecular biology. Target gene UTR-Intron1 fragment and termination sequences are pro fragments were generated by PCR using gene specific sense vided by an 888bp3' fragment of the Arabidopsis ubiquitin10 and antisense primers containing Gateway attB4 gene. Other promoter sequences providing constitutive or (CAACTTTGTATAGAAAAGTTG (SEQID NO:345)) and appropriate tissue specific expression may additionally be attB3 (CAACTTTGTATAATAAAGTTG (SEQIDNO:346)) 15 used. The final plant expression construct is produced by a sequences, respectively. The amplified DNA fragments were second LR reaction in which the entire hairpin cassette is recombined into the pDONR vector, PHP36164 containing moved into a vector (PHP25224) which provides a plant attP4-attP3 sites in a reaction catalyzed by BP Clonase. The selectable marker (herbicide resistant acetolactate synthase resultant entry clones containing target gene fragments gene) for stable transformation experiments. In Table 5, the 9 flanked by atti, 4 and atti 3 sites were then used to generate an entries correspond to hairpin constructs that were assembled expression construct by performing 2 sequential LR recom and tested in Soybean embryos for efficacy against Southern bination reactions, first with the vector pKB499 and then with Green Stinkbug (SGSB). TABLE 5 Hairpin constructs for SGSB target gene silencing

Construct SEQID NO SEQID Fragment Fragment (without Gene ID SEQ length (bp) NO Location SEQID NO Construct promoter) 1054 278 2-537 284 PHP49713 293 861 279 72-677 285 PHP48181 294 861 279 72-834 286 pKB505 295 861 279 72-439 287 pKB506 296 992 28O 27-511 288 PHP481.83 297 992 28O 488-938 289 pKB508 298 858 281 2-800 290 PHP4945O 299 792 282 19-594 291 PHP49451 3OO 643 283 4-785 292 PHP4948O 301

40 Silencing constructs encoding artificial microRNAS (amiRNAs) that would have the ability to silence Southern Green Stinkbug genes were designed largely according to rules described in Schwab R, et al. (2005) Dev Cell 8:517-27. To Summarize, microRNA sequences are 21 nucleotides in 45 length, start at their 5'-end with a “U”, display 5' instability relative to their star sequence which is achieved by including a C or Gat position 19, and their 10th nucleotide is either an “A” or an “U”. An additional requirement for artificial microRNA design was that the amiRNA have a high free 50 delta-Gas calculated using the Zipfold algorithm (Markham, N. R. & Zuker, M. (2005) Nucleic Acids Res. 33: W577 W581.) Optionally, a one base pair change was added to the 5' portion of the amiRNA so that the sequence differed from the target sequence by one nucleotide. The amiRNAs that were used to silence SGSB genes are given in Table 6. TABLE 6 amiRNA Sedulences Target amiRNA SEQ SEO ID amiRNA precursor GENE ID ID NO amiRNA. Sequence NO Nv-MCS Frg1 inv1c.pk005.h23. f 3O2 taagtaccatgtccaacgc.ca 305 Nv-MCS Frg2 inv1c.pk005.h23. f 3O2 tattacaataactgaccaccc 306

Nv-MMitpro2 inv1c.pk004. e6. f : fis 278 toc tactacatattitccaccc. 3. Of US 8,872,001 B2 55 56 TABLE 6-continued amiRNA Sedulences Target amiRNA SEQ SEO ID amiRNA precursor GENE ID ID NO amiRNA. Sequence NO Nv-MitprotcD3 inv1c.pk004. e6. f : fis 278 tatt cottctatottct coca 308 Nv-Madapmol2 inv1c.pk004. e11. f : fis 3O3 taaagtat attaataattctt 3 O9 Nv-MadadapCRK1 inv1c.pk004. e11. f : fis 3O3 titactatott Cocttacacaa 310 NW-MNH1A. inv1c.pk004. d.17. f : fis 3O4 tacgaagagataacacaagat 311 NW-MNH1B inv1c.pk004. d.17. f : fis 3O4 taacaaaacaaaaaaaaactg. 312

"Star sequences' are those that base pair with the amiRNA with the exact reverse complement of the amiRNA. Changes sequences in the precursor RNA, to form imperfect stem in the artificial star sequence were introduced so that the structures. To form a perfect stem structure the star sequence structure of the stem would remain the same as the endog would be the exact reverse complement of the amiRNA. The enous structure. The altered sequence was then folded with Soybean precursor sequence miR159 as described in Zhang, mfold and the original and altered structures were compared B. at al. (2008) Planta 229:161-182 was folded with MFold by eye. If necessary, further alternations to the artificial star (M. Zuker (2003) Nucleic Acids Res. 31:3406-15; and D. H. sequence were introduced to maintain the original structure. Mathews, J. et al. (1999).J. Mol. Biol. 288: 911-940). The The DNA sequences corresponding to the artificial star miRNA sequence was then replaced with the amiRNA sequences that were used to silence the desired target genes sequence and the endogenous star sequence was replaced are shown in Table 7. TABLE F amiRNA Star Sequences SEO ID amiRNA precursor GENE ID amiRNA. Sequence NO Nv-MCS Frg1-Star inv1c.pk005.h23.f tggcgttggact agg tactitt 313 Nv-MCS Frg2-Star inv1c.pk005.h23.f gggtggtcagtatttgtaatt 314 Nv-MMitpro2-Star inv1c.pk004. e6. f : fis gggtggaaataattagtaggt 315 Nv-MitprotcD3-Star inv1c.p.k004. e6. f : fis tgggagaagatcaaaggaatt 316 Nv-Madapmol2-Star inv1c.pk004. e11. f : fis aagaattattataatacttitt 317 Nv-MadadapCRK1-Star inv1c.pk004. e11. f : fis ttgttgtaagggttgatagitat 318 NW-MNH1A-Star inv1c.pk004. d.17. f : fis atc.ttgttgttaaatctitcgtt 319 NW-MNH1B-Star inv1c.pk004. d.17. f : fis cagtttitttittgcttttgttt 320

The soybean genomic miRNA precursor gene, miR159, was converted to amiRNA precursors by DNA synthesis (Genscript: Piscataway, N.J.). DNA fragments were synthe 50 sized with flanking Avril and HpaI sites and were cloned by restriction enzyme digestion followed by DNA ligation downstream of the Gmubiquitin promoter-5' UTR-Intron1 fragment in the UBQ-Kozack OXOXalt7 vector. LR recom bination reaction between this intermediate and the vector QC479i produced the eight final plant expression constructs given in Table 8. TABLE 8 amiRNA Precursors and Expression Constructs amiRNA Target Construct amiRNA precursor Sequence SEO ID precursor SEQ ID SEQ ID Expression NO (with GENE ID length NO Target Sequence NO Construct promoter) inv1c.pk005.h23. f 976 bp 321 tggcgttgga catgg tactta 337 PHP44230 329

inv1c.pk005.h23. f 977 bp 322 gggtggtcagttattgtaata 338 PHP4 4231 330 US 8,872,001 B2 57 58 TABLE 8- continued amiRNA Precursors and Expression Constructs amiRNA Target Construct amiRNA precursor Sequence SEO ID precursor SEQ ID SEQ ID Expression NO (with GENE ID length NO Target Sequence NO Construct promoter) inv1c.pk004. e6. f : fis 966 bp 323 gggtggaaatatgtag tagga 339 PHP44770 331 inv1c.pk004. e6. f : fis 966 bp 324 tgggagaagatagaaggaata 34 O PHP44771 332 inv1c.pk004. e11. f : fis 966 bp 3.25 aagaattattaatatactitta 341 PHP44772 333 inv1c.pk004. e11. f : fis 966 bp 326 ttgttgtaagggaagatagtaa 342 PHP4.4773 334 inv1c.pk004. d.17. f : fis 966 bp 327 at cittgttgttatctott cqta 343 PHP4.4789 335 inv1c.pk004. d.17. f : fis 966 bp 328 cagtttitttitttgttttgtta 344 PHP4479 O 336

The SEQID NOS for the various target genes advanced for 2O further evaluation in in planta assays are Summarized in Table 9. TABLE 9

Fragments Target of Target Sequences Encoding Silencing SEQID Sequences Silencing Constructs for Target Elements for Target Sequence Clone NO SEQID NO Sequence SEQID NO SEQID NO inv1c.pk004.d17.ffis 3O4 14, 343, 344 335 (amiRNA precursor sequence with 311 (miRNA) promoter) 312 (miRNA) 336 (amiRNA precursor sequence with 327 (miRNA precursor sequence) promoter) 328 (miRNA precursor sequence) inv1c.pk004.e6.ffis 278 17, 284,339, 293 (hairpin RNA construct without 284 (hairpin RNA) 340 promoter) 307 (miRNA) 331(amiRNA precursor sequence with 308 (miRNA) promoter) 323 (miRNA precursor sequence) 332 (amiRNA precursor sequence with 324 (miRNA precursor sequence) promoter) inv1c.pk004.e11.ffis 303 18, 341, 342 333 (amiRNA precursor sequence with 309 (miRNA) promoter) 310 (miRNA) 334 (amiRNA precursor sequence with 325 (miRNA precursor sequence) promoter) 326 (miRNA precursor sequence) inv1c.pk004.h20.ffis 279 30, 285,286, 294 (hairpin RNA construct without 285 (hairpin RNA) 287 promoter) 286 (hairpin RNA) 295 (hairpin RNA construct without 287 (hairpin RNA) promoter) 296 (hairpin RNA construct without promoter) inv1c.pk004.i1.f:fis 28O 34, 288, 289 297 (hairpin RNA construct without 288 (hairpin RNA) promoter) 289 (hairpin RNA) 298 (hairpin RNA construct without promoter) inv1c.pk005.h23.f 3O2 263,337, 329 (amiRNA precursor sequence with 264 (sense siRNA, RNA sequence) 338 promoter) 265 (anti-sense siRNA, RNA sequence) 330 (amiRNA precursor sequence with 305 (miRNA) promoter) 306 (miRNA) 321 (miRNA precursor sequence) 322 (miRNA precursor sequence) inv1c.pk008.m9.f:fis 281 290 299 (hairpin RNA construct without 290 (hairpin RNA) promoter) inv1c.pk010.g13.ffis 283 292 301 (hairpin RNA construct without 292 (hairpin RNA) promoter) inv1c.pk011.f6.ffis 282 291 300 (hairpin RNA construct without 291 (hairpin RNA) promoter) US 8,872,001 B2 59 60 Example 9 Selection of Transformed Embryos: Transformed embryos were selected using hygromycin as Transformation of Somatic Soybean Embryo the selectable marker. Specifically, following bombardment, Cultures the tissue was placed into fresh SB196 media and cultured as Culture Conditions: described above. Six to eight days post-bombardment, the Soybean embryogenic suspension cultures (cv. Jack) were SB196 is exchanged with fresh SB196 containing 30 mg/L maintained in 35 mL liquid medium SB196 (infra) on a rotary hygromycin. The selection media was refreshed bi-weekly. shaker, 150 rpm, 26°C. with cool white fluorescent lights on Four to six weeks post-selection, green, transformed tissue 16:8 hr day/night photoperiod at light intensity of 60-85 10 was observed growing from untransformed, necrotic embryo uE/m2/s. Cultures were sub-cultured every 7 days to two genic clusters. Isolated, green tissue was removed and inocu weeks by inoculating approximately 35 mg of tissue into 35 lated into multi-well plates to generate new, clonally propa mL of fresh liquid SB196 (the preferred subculture interval is gated, transformed embryogenic suspension cultures. every 7 days). Embryo Maturation: Soybean embryogenic Suspension cultures were trans 15 formed with the soybean expression plasmids described in Transformed embryogenic clusters were cultured for 1-3 Example 8 by the method of particle gun bombardment weeks at 26°C. in SB196 under cool white fluorescent (Phil (Klein et al., Nature, 327:70 (1987)) using a DuPont Biolistic lips cool white Econowatt F40/CW/RS/EW) and Agro (Phil PDS1000/HE instrument (helium retrofit) for all transforma lips F40 Agro) bulbs (40 watt) on a 16:8 hr photoperiod with tions. light intensity of 90-120 uE/ms. Embryo clusters were then Soybean Embryogenic Suspension Culture Initiation: removed to SB228 (SHaM) liquid media, 35 ml in 250 ml Soybean cultures were initiated twice each month with 5-7 Erlenmeyer flask, for 2-3 weeks. Tissue cultured in SB228 days between each initiation. Pods with immature seeds from was maintained on a rotary shaker, 130 rpm, 26°C. with cool available soybean plants 45-55 days after planting were white fluorescent lights on 16:8 hr day/night photoperiod at picked, removed from their shells and placed into a sterilized 25 light intensity of 60-85 uE/m2/s. After this time, embryos magenta box. The Soybean seeds were sterilized by shaking were harvested and used in Stinkbug feeding assays. them for 15 min in a 5% Clorox solution with 1 drop of ivory Media Recipes: soap (i.e., 95 mL of autoclaved distilled water plus 5 mL Clorox and 1 drop of soap, mixed well). Seeds were rinsed using 21-liter bottles of sterile distilled water and those less 30 than 4 mm were placed on individual microscope slides. The SB 196 - FN Lite Liquid Proliferation Medium, pH 5.8 (per liter) small end of the seed was cut and the cotyledons pressed out of the seed coat. Cotyledons were transferred to plates con MS FeFDTA - 100x Stock 1 10 mL. taining SB199 medium (25-30 cotyledons per plate) for 2 MS Sulfate - 100x Stock 2 10 mL. FN Lite Halides - 100x Stock 3 10 mL. weeks, then transferred to SB1 for 2-4 weeks. Plates were 35 wrapped with fiber tape. After this time secondary embryos FN Lite P, B, Mo - 100x Stock 4 10 mL. were cut and placed into SB 196 liquid media for 7 days. B5 vitamins (1 mL/L) 1.0 mL. Preparation of DNA for Bombardment: 2,4-D (10 mg/L final concentration) 1.0 mL. Either an intact plasmid or a DNA plasmid fragment con KNO, 2.83 gm taining the genes of interest and the selectable marker gene 40 (NH4)2SO 0.463 gm may be used for bombardment. In the present example, asparagine 1.0 gm pDNAs were isolated from bacterial transformants using a sucrose (1%) 10 gm Qiagen mini-prep kit. DNA concentrations were determined by UV absorbance. Each silencing construct and hygromycin selectable marker plasmid (PHP18956) were combined in a 45 9:1 weight ratio to give a 1 ug/ul DNA solution. FN Lite Stock Solutions A 50LL, aliquot of sterile distilled water containing 1 mg of gold particles was added to 5 L, of a 1 ug/uL DNA Solution (intact silencing and selectable marker plasmids as described above), 50 LL, 2.5M CaCl and 20 uL., of 0.1 M 50 Stock spermidine. The mixture was pulsed 5 times on level 4 of a Number 1000 mL. 500 mL. Vortex shaker and spun for 5 sec in a bench microfuge. After 1 MS Fe EDTA 100x Stock a wash with 150 uL., of 100% ethanol, the pellet was sus Na, EDTA* 3.724g 1.862 g pended by sonication in 85 ul of 100% ethanol. Five uL., of FeSO 7H2O 2.784g 1.392 g DNA suspension was dispensed to each flying disk of the 55 2 MS Sulfate 100x stock MgSO 7H2O 37.0 g 18.5g Biolistic PDS1000/HE instrument disk. Each 5 uL, aliquot MnSO-H2O 1.69g 0.845g contained approximately 0.058 mg gold particles per bom ZnSO 7H2O 0.86 g 0.43g bardment (i.e., per disk). CuSO 5H2O 0.0025g 0.0012.5g Tissue Preparation and Bombardment with DNA: 3 FN Lite Halides 100x Stock CaCl2—2H2O 30.0 g 15.0 g Approximately 100-150 mg of 7 day old embryonic sus 60 KI 0.083g 0.0715 g pension cultures were placed in an empty, Sterile 60x15 mm CoCl2–6H2O 0.0025g 0.0012.5g petri dish and the dish was placed inside of an empty 150x25 4 FN Lite P, B, Mo 100x Stock KH2PO 18.5g 9.25 g mm Petri dish. Tissue was bombarded 1 shot per plate with HBO 0.62g 0.31 g membrane rupture pressure set at 650 PSI and the chamber Na2MoC)—2H2O 0.025g 0.0125g was evacuated to a vacuum of 27-28 inches of mercury. Tissue 65 was placed approximately 2.5 inches from the retaining/stop *Add first, dissolve in dark bottle while stirring ping screen. US 8,872,001 B2 61 SB1 Solid Medium, pH5.7 (per liter) -continued 1 package MS salts (Gibco/BRL Cat. No. 11117-066) MgSO 7H2O (Magnesium Sulfate Heptahydrate) 3.7g 1 mL B5 vitamins 1000x stock KH2PO (Potassium Phosphate, Monobasic) 1.85g 31.5 g glucose 2 mL 2,4-D (20 mg/L final concentration) Bring to volume 8 gTC agar Autoclave SB199 Solid Medium (per liter) MS Micro 1000x Stock #2 (per 1 Liter) 1 package MS salts (Gibco/BRL Cat. No. 11117-066) 10 1 mL B5 vitamins 1000x stock 30g Sucrose HBO (Boric Acid) 6.2g MnSOHO (Manganese Sulfate Monohydrate) 16.9 g 4 ml 2,4-D (40 mg/L final concentration) ZnSO4*7H2O (Zinc Sulfate Heptahydrate) 8.6 g. pH 7.0 Na-Mo.O2H2O (Sodium Molybdate Dihydrate) 0.25 g 15 CuSO4.5H2O (Copper Sulfate Pentahydrate) 0.025g 2 gm Gelrite CoCl2*6H2O (Cobalt Chloride Hexahydrate) 0.025g KI (Potassium Iodide) 0.8300 g SB 71-4 Solid Medium (per Liter) Bring to volume Autoclave 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRL. Cat. No. 21153-036) FeEDTA 100x-Stock #3 (per Liter) pH 5.7 5 gTC agar Na-EDTA* (Sodium EDTA) 3.73 g 25 FeSO 7H2O (Iron Sulfate Heptahydrate) 2.78 g 2,4-D Stock *EDTA must be completely dissolved before adding iron Bring to Volume Obtain premade from Phytotech Cat. No. D 295—concentra tion 1 mg/mL Solution is photosensitive. Bottle(s) should be wrapped infoil 30 to omit light. B5 Vitamins Stock (per 100 mL) Autoclave Ca100x—Stock #4 (per Liter) Store aliquots at -20°C. 10 g myo-inositol 35 100 mg nicotinic acid CaCl2*2H2O (Calcium Chloride Dihydrate) 44g 100 mg pyridoxine HC1 Bring to Volume 1 g thiamine Autoclave If the solution does not dissolve quickly enough, apply a low 40 level of heat via the hot stir plate. B5 Vitamin 1000x Stock #5 (per Liter)

Thiamine HCI 10 g SB 228 - Soybean Histodifferentiation & Maturation (SHaM) (per liter) Nicotinic Acid 1 g Pyridoxine HCI 1 g DDIH2O 6 00 ml 45 Myo-Inositol 100 g FN-Lite Macro Salts for SHaM1OX 1 00 ml MS Micro Salts 1000x 1 ml Bring to Volume MS FeBDTA 1 OOx 10 ml Store frozen CaCl 100x 6. 82 ml B5Vitamins 1000x 1 ml L-Methionine O.1 49 g 50 4% Glutamine Stock #6 (per Liter) Sucrose 30 g Sorbitol 30 g DDI water heated to 30° C. 900 ml L-Glutamine 40 g Adjust volume to 900 ml 55 Gradually add while stirring and applying low heat, pH 5.8 Do not exceed 35°C. Autoclave Bring to Volume Filter Sterilize Add to cooled media (s30 C): Store frozen *Glutamine (Final conc. 30 mM) 4%. 110 ml *Note: *Note: Final volume will be 1010 ml after glutamine addi 60 Warm thawed stock in 31°C, bath to fully dissolve crystals tion. It is recognized that the experiments set forth in example 9 FN-lite Macro for SHAM 10x Stock #1 (per Liter) can be employed with silencing elements operably linked to a seed-preferred promoter. Such as, for example, those pro (NH4)2SO4 (Ammonium Sulfate) 4.63g 65 vided by the b-conglycinin-alpha (Genbank accession KNO (Potassium Nitrate) 28.3g GU723691), Kunitz trypsin inhibitor 3 (AF233296), or the glycinin-1 (AB353075.1) genes. US 8,872,001 B2 63 64 Example 10 mation experiments. For assembly of tissue specific miRNA constructs, the procedure outlined in Example 8 would be Assay of Transgenic Soybean Embryos for Efficacy followed with final cloning of the artificial miR159 segment Against Southern Green Stinkbug into a suitable plant expression vector that provides regula tory sequences of any one of the above seed storage protein Cultures of SHaM maturated embryos, as described in Example 9, were harvested by filtration and used in feeding promoters. bioassays with 2" instar southern green stinkbugs. A typical For biolistic transformation of soybean embryos as soy embryo transformation experiment yielded 20 to 30 inde described in Example 5, a single DNA fragment containing pendent events that were each evaluated in 4 replicate assays. 10 both the trait gene and the plant selectable marker gene is Each assay was set up in a 35 mm petri dish that contained a prepared by restriction enzyme digestion followed by gel moistened Whatman filter disc and a H2O soaked cotton purification of restricted plNA. In the case of both constitu pellet along with 450-500 mg of soy embryo tissue. Embryo tive and tissue specific silencing constructs, 10ug of plasmid samples were infested with 5-2" instar SGSBs, and the petri DNA is used in 0.15 mL of the specific enzyme mix described plate was covered and incubated at 27 C, 65% RH for 4 days. 15 below. Plasmids are digested with AscI (100 units) in NEB At this time, the sample was replenished with fresh tissue and uffer 4 (20 mM Tris-acetate, 10 mM magnesium acetate, 50 the incubation was continued for 4 additional days at which mM potassium acetate, 1 mM dithiothreitol, pH 7.9), 100 time, the assays were scored for insect stunting and mortality. ug/mL BSA, and 5 mM beta-mercaptoethanol at 37° C. for 3 FIGS. 1 and 2 show the results of insect feeding assays hrs. The resulting DNA fragments are separated by gel elec performed using embryo tissue transformed with the silenc trophoresis on 1% agarose gel and the DNA fragment con ing construct DNAS listed in Tables 5 and 8. Each symbol taining the trait gene-selectable marker gene cassettes are cut corresponds to insect mortality Scores averaged over the 4 from the agarose gel. DNA is purified from the agarose using replicate assays for each event. Controls correspond to feed Qiagen's Quick Spin extraction method following the manu ing assays conducted using non-transgenic Soybean embryo 25 facturer's Suggested protocol. Gold particles are coated with tissue. For all of the constructs, several transgenic events purified DNA fragments and used for biolistic introduction of could be found which gave insect mortality scores greater DNA into soybean embryo cultures using the procedure out than the controls. For some constructs, more than 50% of the lined in Example 5. events produced insect mortality at a rate significantly greater First generation transgenic plants can be assayed for insec than controls. Variation in apparent efficacy from event to 30 ticidal activity in individual plant cages. When the plant has event is to be expected due to variation in construct expres started to produce green pods approximately 1-2 inches in sion with random integration of the construct DNA in the length, plants are removed to individual bug tent cages (Bio Soybean genome. Quip, CA). The cage is infested with 50 newly emerged Example 11 second instar Southern green Stinkbugs (Nezara viridula). 35 The nymphs are allowed to feed for 1 week at which time a Assay of Transgenic Soybean Plants for Efficacy count of Surviving insects is performed. Counts are facilitated Against Southern Green Stinkbug by using an aspirating device with removable vials and caps to collect insects and a hand held counting device to count each Silencing constructs can be stably expressed in insectfeed insect as it is aspirated. Counts can later be verified by freez ing tissue for efficacy testing of transgenic plants against 40 ing the sample and counting again under magnification where southern green stinkbug. The DNA constructs described in a measure of growth can also be performed on collected Example 8 can be used for this purpose. These consist of trait insects. Fully grown insects equivalent to controls are given a gene hairpin or miRNA gene cassettes both of which are score of 0. Insects demonstrating 20-60% stunting are given a constitutively regulated by a Soybean ubiquitin promoter 45 score of 1. Insects demonstrating 60-100% stunting (size 5' UTR-Intron1 fragment. Similar constructs can be built equivalent to original infested insects) are given a score of 2 using other constitutive promoters as provided for example and dead insects are scored 3. Selected plants demonstrating by soybean elongation factor 1 alpha (ACUP01009998) or high insecticidal activity are recovered from the tents, treated arabidopsis ubiquitin (L05399.1) genes. Alternatively, tissue with Marathon insecticide, and returned to growth chambers 50 or greenhouses to complete the reproductive phase and seed specific expression and in Some embodiments seed-preferred production. promoters can be produced by the use of seed storage protein The article “a” and “an are used herein to refer to one or promoters including those provided by the beta-conglycinin more than one (i.e., to at least one) of the grammatical object alpha (Genbank accession GU723691), Kunitz trypsin of the article. By way of example, “an element’ means one or inhibitor 3 (AF233296), or the glycinin-1 (AB353075.1) 55 more element. genes. To produce seed specific hairpin constructs (i.e. long All publications and patent applications mentioned in the dsRNA constructs and miRNA constructs), entry clones, gen specification are indicative of the level of those skilled in the erated as described in Example 8 above, are combined in an art to which this invention pertains. All publications and LR clonase reaction with a variant of the destination vector, patent applications are herein incorporated by reference to the pKB499, modified to contain a seed storage protein promoter 60 same extent as if each individual publication or patent appli cation was specifically and individually indicated to be incor in place of the Gm-Ubiquitin promoter. This first LR reaction porated by reference. generates the promoter-hairpin-terminator cassette. The final Although the foregoing invention has been described in plant expression construct is produced by a second LR reac Some detail by way of illustration and example for purposes tion in which the entire hairpin cassette is moved into a vector 65 of clarity of understanding, it will be obvious that certain (PHP25224) which provides a plant selectable marker gene changes and modifications may be practiced within the scope (herbicide resistant acetolactate synthase) for stable transfor of the appended claims. US 8,872,001 B2 65

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 346

<210s, SEQ ID NO 1 &211s LENGTH: 272 212. TYPE : DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 1 gggt attaat ttt tatttgt ttatcCatala attagct citt ttaalaccalat tactittgatt 6 O ttttcttgat agittat catg ttagcigacitt Cattalacatt cactaat cag gaaagacagt 12 O ttacgaaatc tgitatic taga ttgaagaaat tcc.gtatgat ttittaataca ttgaaaaaat 18O atggcc atta atcgaattag aaaaacgttt ttctact aca acaat aggcg cagactitt.cc 24 O attt cqctitt gggagagggg aggtgaagaa cc. 272

<210s, SEQ ID NO 2 &211s LENGTH: 529 212. TYPE : DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 476 223 OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 2 gggitat caat tataCatata aagtag catt acct tcc tatt ttacaaagaa aataaataca 6 O agttgattica aattattgaa Ctaalactatt totttaatca ttagtaatat gctaaaaaaa 12 O ttaa Cattac ttctgtaacg Catticaaaat ttaaaaaaac aaaagacagg atata accitt 18O tccagtagaa Catataaaaa. aaact agaga CCatatattt gct cotaatt citctgattitt 24 O aacgattatt tttttgttitt t caggaaatt cc.gtaaattit tgaaaaacac aaatc.cgitat 3OO actittittgag ttatt cqgaa tittaattgta c catc cct cq taact t t t t t cctagottct 360 titt.cgttgaa gtatgttata tagataaatt tagaaggagt tgagaaattg attittagcga agttt cattg aaatcggtac att cqtttag acgctacagt ctgtagcaac t caganttitt tttcccc.gtt attittaaaag taalaaggcga ataataatgt cgatgaagc 529

<210s, SEQ ID NO 3 &211s LENGTH: 574 212. TYPE : DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 3 ggggaaggag citcaagattit accctgct ct gcgagtttac tgagtggaag titt at cit tot 6 O titt.ccaagtt att catcgac ttctagaaga t ct citat cac tcaaacaagg gcgtaagtcC 12 O actictatotic c caaagacat taact Cat Ca tcggtagatc agacggcaga agcacagt cc 18O actggaaaga gaactactica atc.ca.gtgat attgttgaaa atgttaaggc taact cattt 24 O t cat cit to to gtaaaggaag acgat citctt agtataccaa atgg tagttc ctittgaaaaa 3OO aatcatttga tgcagt catc agaat Caggit tccagtgatt tattgaatat taccalatgaa 360 aag cacaata gaagttgttga tacaaatcat ttctgat citc. ccittaaatga cact titat ct aggagtaagt tcgttgattg taat attagt Cagaaaggct taaatggttc atc.tt cagat gtgtcagttt titt citctggg ttct t t taat tott cittatc. ataaaagtaa aagtgatggit 54 O gatagittitat Cttitat caca agctactgat gtaa

US 8,872,001 B2 73 74 - Continued cattgttt co agagcc ctitt ggcct cotgt ttt tatgtaa togaactgttc actgcattaa 24 O atatt catta taactic ctac cctitt cocat titt catttag aagtttaata ttittcaacat 3OO t caataacac at atctaa.ca ccattagtta agtag to cqt acagttc cat tatgtcatta 360 tatagott co tattgacacc cat cact cac ttagttittat ttaattctgc tatag tagtt 42O aggtaactat caaaattatc ttgtacttitt ttittcttittg g tattgctga aaaatctatt 48O acgactitcac atttct coaa atc.ttctgtc atctitat citc tdtgttgttta aatcttaaac 54 O attgtttaca agaaac attg titt coaagat taatatattgtttaacgaaa goattattgg 6OO cc caaatgat aatgtact tc ctataggitat tdtggttgac aggttgcctt cac catgact 660 tcqagcttitt at acccatct c 681

<210s, SEQ ID NO 13 &211s LENGTH: 674 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 13 ggggagctga taaaaaataa togttcaagt caact cacca acttgcagoa aaatgcc ct c 6 O aaatcaaatt ttgagtattg ttagaaatta tdottctgct gcc.gctgcaa aatct attaa 12 O accacctgtt caagtatttg gattagaagg togttatgcc acago actitt attctgctgc 18O agtgaaattgaaacaactag atgttgtaga aaaggattta aaaaatatac agagtacatt 24 O gaaaaatgat accaaactitc gaacttitt at tdaaaatcca accattalaga gcaatctgaa 3OO gatcgatgct ttcaaggatgttcaaataa aattaagttg agtgcac Cat C Cacaaacct 360 t cittggtc.tt ttagctgaga atgg taggct caatagacitt gaccaagttt togaatgctitt 42O ttct acaatt atggctggcc acagaggtga t ctitcgatgt gaggttacga Ctgcaaa.gc.c 48O attggatgag gaaacaaaaa aacaactaga gactgtattgaaagcatttg Ctaaaaaggg 54 O tgaaaatatt attitcggagc tigaaggttga accagct atc attggtggala tdatcgt cag 6OO tattggtgat aactatgttg acatgagtgt ttctagdaag attaagaagt atacagatat 660 catcacagag gctg 674

<210s, SEQ ID NO 14 &211s LENGTH: 687 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 14 actcaaaatgatagdactitt gtgatttatt ctatatgtca tocaatctitt aatttactgg 6 O acgattgcta aaataagttt cagaaatatt tdtctgtaat aac attaatt gct caattat 12 O agaaataaag c tactaatta gcc tataata t citaa catat atctaaaaaa ttagatatat 18O gttgaaccct aag tattgta aac at cagca tottatacaa taaattaata acagaaaa.ca 24 O ttct tact tc taalacagaat gaaaatatag agtacttgtg atttagc.cgg togcc titcgg 3OO acctacct tc titat cittgtg titat citctitc gitat cqctica totctgctta gttacttgttg 360 cgttcttctt gttatt caat tattitt cagt tttitttttgt tttgttattt tittatttaaa 42O atggittacaa taacactitta ggaattactg. tctitcggaag aagactatat tatat attag 48O acaggt caac taaaaaaatt ggagggtcta aaaaagttgt taaataga C ggalagtottt 54 O tittctaaacg aaaaaatcat gtagggagag to tct cqga ataatggatgtttggcagag 6OO tttgtc.gaga aacagatgag tdttt cattg taaaaataaa agaaacgcaa caattictatt 660 US 8,872,001 B2 75 - Continued tactaattga taatat ct ct citt citat 687

<210s, SEQ ID NO 15 &211s LENGTH: 494 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 15 ggggittaatgttataatcta at atttgaat tittatggagt aataaatggit actgtagaaa 6 O atgaatticta aatttittaag ataaaataat agactgtcga at agtacttic tta acct taa 12 O catttaaaat coaagtatat tataa.cagta atatagg taa tatatttgga atcaaataca 18O agttittataa tattaactica ttitt attata aatgaattaa tattagaaaa ataaataaat 24 O cct attattt ctaaaaggag titttittttitt atcgg tacgt cataactitcg tdaattic ct c 3OO atcaaatcca acgattgacc gct cattttg aagat attct gct cotacac atgtgaaaaa 360 tagt coaatc. tcc ccgaaat ttctggaaaa aaagttatgg aggaaaagaa actittatttg 42O cgaataactic aaaaagtatg catttttgtt totggattgt acccacgata attacaaaga 48O ttactalaatt acct 494

<210s, SEQ ID NO 16 &211s LENGTH: 1.OO &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 16 gggg.tcagag ttgggtagag aaactictaala acaaatagaa aatactaaaa ggcgtttaca 6 O attaatgaaa at agcagaaa agaaagtgta agcagaalacc 1OO

<210s, SEQ ID NO 17 &211s LENGTH: 693 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 17 gggtggaaat atgtag tagg aacaaaagtic agittaagtag tatgctict ct gcaatcttgg 6 O actataccag caataaaaac tittat catta gagataaaaa agatatat catttittittcta 12 O aagctatoga agtttgtagt aaact caaag ataaggat.ct tct ctacagg citt catgaat 18O tattgttgac cqgaaacaat tataatttga t cqgagattic atttagtgaa toggtgtatt 24 O accott attt ttttittattt gct tactgat actgaagaac ttagtaaagt aatggaattic 3OO tatgatgacc ttgtaccalaa cqtttatgtt coaga.gc.cat cagtgaccala togctatattg 360 aaagctgttt gtaacaa.cat gigcatgggac cittct tcc.ca agctittggcc agacatact a 42O ttgtttgagc agtatgaagt titc.cggtgtc. citggaaaata ttittagatat togcatct caa 48O aatgaaggca agaatttgat ggaagggatgtctaaaattig catggtctgc atgggagaag 54 O atagaaggaa taalagaggga gcgatccaac titt caatggit Ctgcgagtgc attgggaaac 6OO attatt ct cattttgttgaa atctggtgaa aaa.gctaagg cqaatttggit tatgaataaa 660 ttaattcaac taggaagttctgc catgaat gaa 693

<210s, SEQ ID NO 18 &211s LENGTH: 654 212. TYPE : DNA <213> ORGANISM: Nezara viridula US 8,872,001 B2 77 - Continued

<4 OOs, SEQUENCE: 18 ggggaggitta ttgactgtg ttacatcgag tittgatattg ttitt cattgt gaagttgttga 6 O ttagttctgt attact tcga agtttaaaga attattaata tactittagaa atgttgaatt 12 O ttggittataa togctagaaga tatatt tatgttitt catatt tactatogcct cittact tagt 18O actgatgtta Cataggaaaa tagagittaa aaaat atttg cct gatgtgt acatttgttgg 24 O aagaaaattit aattictagaa aatggctgct ctdtttgacc caaatgacag aag cagg taa 3OO gttcatgaaa ttgg tattitt ggtcaaatgt caaggcaaga tigccactgat cittittaatgg 360 gagaaaagga gggtggcgta titt Cttgtcc gtgatagitat Ctcaatt cat ggtgattatg 42O ttctttgttgt aagggaagat agtaaagtaa goc attatat tat caacaaa attcagoaga 48O atgatcaaat taagtacaga attggtgatc aaa catttaa tdatttgcc c agittagctat 54 O

Ctttctataa attgcact at ttagatacta cacct ctaat tccaccago a ccaaagaga.g 6OO ttgaaaaagt gatagotaaa tittgact tca atggaagtga t caagatgat ttac 654

<210s, SEQ ID NO 19 &211s LENGTH: 635 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 19 ggggtttgca cctaatccaa totttggatt ctittatt atg agagtaccala togttgcaaat 6 O cagagatcca gaact tatt c gacittatact tacaaaggaa ttitt cacatt titcgaga cag 12 O gatgtt tatt aaattaagtgaaaaagat at t ct caat caa Catctgttca atctggaagg 18O cgaaaggtgg agagccttac gtgtgaaact caccc.calaca tttacaagtg ggaaaatgaa 24 O agctatgttc ccactic tttgtcaattgttgc tigaggcc titt gaatc.tttga t cqtgtcaaa 3OO aattgg tagt gacgtagaca t caaagaatt agtaggit ca Cttacga cag at attatctg 360 Cagctgtgct tttggactitg atgctaatac aatcgaagag ccagat cata agctaaggca 42O aatcc.cagcc caact tacta aaatggggitt tattgataaa gtgataatag caat catgca 48O agctatgcca Caagttgcca gcaaatttaa agc.caggttc act cotaaag agcttgagga 54 O citat attgta ggit cittgtag aaaacacatt ggagtataga gaaaagaata at attaaaag 6OO aaatgatttic ctagattitat taattgagct gaaga 635

<210s, SEQ ID NO 2 O &211s LENGTH: 682 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 2O ggggttcCtt agc aggttitt Cttgagttitt Cattaaaaaa aaaaaaaagc act agta agg 6 O aaaacaataa tataaact at atata cattt ataaaactat at actgtc.gc tattittgcta 12 O atacat citat ttittaattaa caatatatat tttittaaata tittctgcct c tictat caaag 18O atataacgaa gttittaagtg totagatggit cagataccaa titt cq attaa ttittatcaat 24 O actittitt citt acggatgcgc aagtg tattt tottagatat gctaatattt cagaaactgt 3OO

Cagttcgatt teccCaaat ttggattaaa gatgggcatt ataaaatagt gggtaaaaaa 360 aaaat catac aattittitt at taattictato ttaaaattta cittgaaatgg agtattggat 42O atcagaagaa tt cataatcg agaaaatgaa aatacattcc acaagacaaa aagga cataa 48O atactaattit aaggtaatag gtt attaatgttattatgtt togaaataatg gag cacgc.ca 54 O

US 8,872,001 B2 81 - Continued aacaaaaatt agagagagag gacacaaatt at agt catgg ttgtc.tc.ttt tdtcgtcaga 48O ttatagagcc cacaagat ct gaatatttga titcacct ttcaacacagcac aatttacaat 54 O tagggaaacc agaaaacctic gtt tatgttg atgaactaat tdaaatcttg gaacaaaaaa 6OO tggaaaagtt gcaatgcatt ttttgttgaac gaactittcaa agacagaaat gtcct caaag 660 agcatatgag aaaaaaga 678

<210s, SEQ ID NO 24 &211s LENGTH: 103 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 24 gggggg.tcala C9g.cgggggg gC9gggtggc C9aat aggct aaag.cgtgag taa.ca.gc acc 6 O gctagttgcc tigcaa.ccgg atalacagaga tittgagacga tag 103

<210s, SEQ ID NO 25 &211s LENGTH: 613 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 489 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 25 agtic caataa goggtgctaca tttitttttitt gatcggacaa goggggctitat aaa catctitt 6 O agatacct ga aaagagtacc atgaaaaaaa aaatgaaaac cactgtc.tta ttaalacc tag 120 acagcagtaa totaaagatt gatatt cata actggtc.ttt aaaaagtttg acaacaaaat 18O atgtct attt gtgaaattitt ctaaaggttt ttitt cacaaa atcaaagct g g togaggttgg 24 O tccattgttga ttct caaaat ttataattitt caaatataca acaatttaag aattittittaa 3OO aaaagttaat aaatggatgt atttittt cac cct gttaaaa gtttalacgta aatctittatt 360 gttataattt tttitttittga citgatt tact at cittaattt tdatgaatca aattataatt 42O ttaattittat at attattgt aaagttgaaa ttgtagaagit togc ctittaaa agaataaaat 48O aatattittnt toctitcttaa cccaaaaa.ca attgttattt agataattag attat catt c 54 O gatatgataa atgaaaaaga ttatttagga aaaaatatgt tacgatattgttaaact act 6OO aaattittaca aat 613

<210s, SEQ ID NO 26 &211s LENGTH: 682 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 26 gggatgctaa alacatcctgc taatcgttac agaattittaa ttatacgaca tttittaaaat 6 O acagtatt.ca cctatott cq t ctaattact ataac aggaa ataaataaat taaatttagt 12 O ttittaaaaag togcagacaat tittagagatt aatacaaaag aaagtttaaa atgaact tag 18O taacggcacg gctgtc.ttitt cqgttgatta aaaaacttitt ctaacgttct gttcc catct 24 O caaattitcca atgatagggit agtacaatta tdgttcggaa tittaattaaa gattaattta 3OO tittaagaaag taccaattat tittatgtact ttatttgttg acatttittat agtacaatta 360 taaaagaaat cqtctaattt tdaatctaaa citatt caaag titatic ctitat tagtgtc.ca.g 42O tittaaaac cc ticcict cactt agctaaatat at atttgtta taataagtat gtgtactitat 48O

US 8,872,001 B2 91 92 - Continued ggggatt.cgt gitat cagttt gcaatacaag c tacttittaa atttaatatic at cactggtg 6 O tttittaaatt toaatcataa attactittaa tacacaagtt atttgaagtt gttittaattit 12 O attt caggcc acataaat at ttaataaaat atgtctgggg accaaaaaga aagaaaaagg 18O aaggaaagta t cittagattt gttcaaaat at ttaga caaag citat cagagt caaattittct 24 O ggcggaagag aagctgctgg tt attaaag ggatatgat C Cacttctgaa tittggittitta 3OO gatgatacaa cagaatatat gagagacc cc gatgaccctt ataagttaac tdatgaaaca 360 aggatgcttg gtttggttgt gtgcc.gtgga acatcggttgttcttatatgtc.cagttgat 42O gg tatggaga gtataccalaa ccctitt.cgtt coacaagaat cataaataat gigactaattic 48O taagtttaag aagattaagt tottt cotac titatgaaaat gaaaagaatt tactittattt 54 O aggtttaaaa aactgtttgt ttataaacat gtatatatat taaaaatct c catttitta 598

<210s, SEQ ID NO 39 &211s LENGTH: 689 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 39 gggattaaaa aaagaaattig attattitt at tttitt attaa ttataagaac attaattaca 6 O attt cagota ataactgaat aagaatatga at aggtottgaactaaa.cat aatat cattt 12 O attic ctittaa ttttacaaaa aaaatagitaa atcaagatcc gaggcagcta taatt tactt 18O tctaattcaa agaattagaa gaattatcct atttataata attacaatta atttattaaa 24 O attattaaat tatt caaatt ttattaatat attaattaca attagaattic taataaaatt 3OO gggagctgca ccattt cata agtgaatacc tdaaattata acaaaaataa gatgaataaa 360 atgtataatt ttaataa.cat gacaaaaaat agc cc catta ataataattt gtaatttaaa 42O tagaagtaga at attaatta aattatcaat tatttgatca gttggagttg gaagaatcqg 48O aggaattaac caatcatcat tacgaaaatt aatagoatat t catcaatta accatttagg 54 O atgaatacta gcc attaata aaaaaaatta atttatgatt agtatattga ataatttata 6OO gaataattat ctittataatt tdtctaat at ttaataatta taaattatta ttcttaaatc 660 aaattagcag atccaatata aataatcca 689

<210s, SEQ ID NO 4 O &211s LENGTH: 662 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 4 O ggggagttga ggtttggcaa ccgacttgtt tagagat cot gcaagaaaat gagagctacg 6 O tactgcttaa toctagotgc tigcagttctt gcagtggctg cagct cacac ttaccatct c 12 O ggaaattgcc ccatcgtaga accitatgtct ggttitt caga tigt caaagtt tittaggttta 18O tgg tatgcca toc agaagac ttcaa.caggt agcagatgct toga catacaa citt cact citt 24 O ggggalaga.gc Caggcgaata caacttggag caagtttctgaac atccagt cttaggagta 3OO gcatcagttg acaacaaata ccattacaca gga catttaa aggccaattic togacgttcca 360 tccaaaatga cagtgaaatt toctittaagt gttgctggaa catcaagttt cacagtc.ttic 42O atgacagatt acgaaactta togctggaatt tacacgtgcc aaaaact acc tdcagctaat 48O agaagat cag ctaccatcct ttctaggacg aagacattgg ataagatggit gattgataag 54 O

US 8,872,001 B2 95 96 - Continued

<210s, SEQ ID NO 44 &211s LENGTH: 669 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 44 gggggtttct cagagtagt gttcCaggcc tictgattaag aatacataga tigaagacagc 6 O acgt.ccc.cgt tottgaaaaa at cacttctt caaatgtgga ttcaactgaa gaaaatgttt 12 O tgatt cattt gagatttgtt catcaatticc atttatat ca atgcc actitt titccaaaaac 18O attittcaa.gc agtgtact tc ataatttcta agtat cqtct tcaagaaggt gig tacaaatc 24 O tgctacatac ctaaaaaaat aaatagatat cagittattgt tt cattataa taaattgtta 3OO tattagataa gtttittaaaa attacaaatt ctittataaat aaatacattt aaatactittg 360 ttgttctata caaaaggctt ttittaaaatt tattitttgta taaaa.ca.gca ttgagttagt 42O aagtatgatt tttgaaattt ttatttcaat tittgcattat ccagttccaa ttactaccag 48O aaagttagtt atatacagtt ttctittattt ttaagaatca attittctagt tattagaaat 54 O ttittaagtag aatatt caac at agtaggac aaatc tact t t cittattgtt citagat citct 6OO cagat.cgatt gcatttgttg tatgattgag caa.catttta ttataagcag aaat attata 660 aatgacaaa 669

<210s, SEQ ID NO 45 &211s LENGTH: 134 & 212 TYPE DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 45 ggggagtgtt gaagggaccg tcc.gtctggg ttgtgagtag tittcticgt.c gcc.gttctica 6 O t caccatt at aatticggaag atggcagagg to Caagag titgaatgala gtcatggaat 12 O cagttacaac agitt 134

<210s, SEQ ID NO 46 &211s LENGTH: 225 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 46 gggggit cqca aaaggagtaa talactatgc aaggtgatag cccatatatg gtaagaagaa 6 O tgttgtacccg aaaaatggaa gtgat cocac agagtgaaat gaaaatattt ttittatt atc 12 O ctgggactgt tdtcc ctitta ggacaaatta catatacaaa ataaatgccc g tattgc cat 18O acataaaatt aattatttac aattattatt aaaattalaga ttittg 225

<210s, SEQ ID NO 47 &211s LENGTH: 664 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: 557, 610 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 47 ggggggagtic gagtgttgaca toccgc.ctg agactitt atg Ctggcaggcc cagtatgac 6 O tgtgcttaaa ttgc.cccaga tiggaagagcg Caagt cqc.cc gaagcggcca aagggat cag 12 O

US 8,872,001 B2 119 120 - Continued agattacatt ttgttittaat tttaccaaat agcacaaaca tatctgtgaa actgcaaaaa 54 O gtgt attaag togcaattittg toga atttitta tdgg tatt co tocaatgata atttatctot 6OO Ctttctttgt gigagc 615

<210s, SEQ ID NO 81 &211s LENGTH: 53 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 81 ggggtggagg totgatgcac cccagtgtca taaactgtt aatggtaaaa cag 53

<210s, SEQ ID NO 82 &211s LENGTH: 604 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 467 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 82 tgatgacatt coattaagta ttittatttga cittatattgt tt catgact a tittaaaaaat 6 O aaaaataaaa taattic atta tttittaaaaa citgcattgta ataatt cata tittatatto a 12 O cittcttittgc atatgattica tdatag tatt tatt attaaa taaaatagga atacaagtat 18O tttact taat agggittataa aattgtaatgaaatatttgg aatttgaaag aaatttittaa 24 O taataagttc tacaataaaa titt acttaca tdttt tatgt aatagaaaat aattatgtgt 3OO aatggagctic aatatt tatg togtaaataaa taacttaagt ccagt cagtic cittaagaatt 360 taaaattittgttgtag tatt tag tatttgg aaatat caca aagatgcaga attaaagaaa 42O aagaagaaaa gttgggagaa ttitt Cataat taga caaaa agaaggntaa atgaagagaa 48O gagataagaa aaaaaaaaga acttgaatag tatt aaaga gagataattit aaaataaaac 54 O at catgtaag taaaatcaaa aagctgaaaa catt cattac atatgtttitt totacaaata 6OO ttitt 6O4

<210s, SEQ ID NO 83 &211s LENGTH: 623 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 83 cgg.ccggggg agittaaaaga cacatgttct atatat catg cct ctittgct attctitt cqt 6 O tgaaaatgaaaattgataga atgcc.gtgat aagtagt cac togttgctago ttt acttcaa 12 O aatttgaatt cqaatatgtc ctacagdatc attct cagtic atttgagtag gttcc cacta 18O ttct ct tact caagaggata tagtgtcatt accagotcaaa atgtgaaaaa tat coctdtg 24 O agtttcagat attatt catc toggtggaagg aggcc taatt ttittct c cca atttatagaa 3OO aatgttaggc aagacittggc aaaaagtaaa gagatgaaag aaagtttgaa aaagtttagg 360 gaagaa.gc.gc agaaattaga acaatcc.gala gCtttacaga aagcaagatg attgttgttg 42O cagagccaag titt catactg ttgaatcaga agcatcgaaa ggtggtgaag titt to aagga 48O gaaattggac Cacattaaag ataaagttcag tatgtgctg gaggaag cag caaaat Caga 54 O aatcgggaaa aaagticagot gggagcagaa attggaaaga Ctgcgagggg agctgctgaa 6OO

US 8,872,001 B2 125 126 - Continued

&211s LENGTH: 492 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 90 gggggagcca ccggtaactt citcttctitat tdcatttgttg tdtgtatgtt ccattgttaa 6 O tccggctt at gtgg tactitt gttgcacgaa c cagtgaaaa agatact titt aggcaagacg 12 O tt catt cocq aac aggtott cqatgaat at ttaaatggitt tagcc gaatc agaatticagg 18O ggtgat catt acgacctt cit aaag.cacaac togcaataact titt cagacaa tot cagt cqc 24 O tittct cqt cq gcaacggaat accagaatac attittgaaac tacct gagga aatacttagc 3OO acgc.catttg gacagagatt t caaggattg attgaacaga t cagc.ca.gala ttctic.cgaac 360 ttgcagccta cccaacggag agcc.gc.ctica cct gaattct accaattgaa titcagatatt 42O gaagctgcta gacat cattc ttctic ttctgagggaaaaac gitaatgctct gtgtgaaaaa 48O ttagcaaag.c at 492

<210s, SEQ ID NO 91 &211s LENGTH: 503 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 91 aattatt cag tat cotggat aaa catagt c gactgtatat aaatcaaaat gtatattitta 6 O gattittaatt gttittattta ttittctttitt toagatgatt cattaagttt ttitta acata 12 O aataattgaat catactaaa tttctgaaga gtgcc.gagtt tatgaatgta Cttittaaata 18O atgggctgta t tatgattga aacaagtatg agcctataac taaagaaata taccatcatt 24 O tittgaagtaa cittgatgcat citcaattitt c taactitt coa caagaataaa aaaaact agt 3OO caat attt at ttataact at aaaatatatg tattittattt ggatt catta tattaattta 360 aattgttgtta aattaatatt totttaggat gttittgaata aaatgatgtg tatat cittga 42O tittctacago tatgatatat taatgat citc atttattaac aaaagtaatt cittittcaaat 48O atalaattt Ca taaatctoca taa SO3

<210s, SEQ ID NO 92 &211s LENGTH: 647 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 92 ggggaaaaac gttggt catt Cttggggtgg Cttagttgtt tattgaaatt attt Cttitta 6 O aaatggcaat gccaagaagt tatggtggct tatctgatta cagaaccott cotgcaccitt 12 O

Cttt tagt cc at attctgaa aatggaggga gtgtagtagc tigtagctggc gatgactitcg 18O caattatago atctgataca cqtttaagta caggttittcaaattitat acc agaaaccagt 24 O caaaattatt taaattgtct gacaaaacaa ttcttgg tag tactggttgt tdgtgtgatg 3OO ttctitt ct ct tact aggctt gttcaaac cc ggataaaaat gitat cagtac gat cataata 360 aagttatgtc. cacticcagca gttgcc.caaa tdct citctgt act acttitat tataaacgct 42O ttitt cocata ctatgtagcc aat attcttg Ctggaataga tigataatggit aaaggagtgg 48O tttacagtta catcCaatc ggt catcatgaaagctcaaa attcagagct ggaggalacag 54 O ctggagctitt attacaacca citgttagaca at cagotcgg tatgttgaat caagaaaatg 6OO ttcaagacaa alacatacact ttggaaaaag cc catgcaat totaaaa 647

US 8,872,001 B2 141 142 - Continued tactgtttgt aactttgttt gtatatattt tatatatata togaaaatata taaataatat 6OO aacatatggit accatt coat aattagggat ggittaa 636

<210s, SEQ ID NO 114 &211s LENGTH: 450 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 414 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 114 gggcagactg agattittatt tat atttatc titatgcagta tacaatticga gggtgagagc 6 O aattacagtt titt cataaaa ataaaaaaaa caaacaaaaa taacttgtca ttittgatgat 12 O c caataaaaa taact tagta aatat cattt titatgg tatgaatttaaaaa atgtattaat 18O tgtaaaat at ttaatttgtc. aattic actta atagaaatac ttggat.c cat ttittatttgt 24 O cagottt cac cagtgctgta atgttataaa tdtgatctgt toaaaggaga titt coattgg 3OO aaatgt atta ttatttittitt atttittctitt Ctttittitttgtttaatttac agcatgitatg 360 ttgctgtcaa tataaattgc cqttgttcga aacct tcaaa gtc.ttgatgt agcnacaatt 42O ttitt attaat aaaattggat ttgaaaatct 450

<210s, SEQ ID NO 115 &211s LENGTH: 467 &212s. TYPE: DNA <213> ORGANISM; Nezara viridula

<4 OOs, SEQUENCE: 115 gggcaccalat cittacc catt cacat citcgt tagcaa.gcag ccaccaccac aatgccaa.ca 6 O ctgcaataat acacttacag ccagt cacaa gttacaggaa tottatttitt acatat caaa 12 O tctaaatagt gtaggacitta caccitataat atcaaacatt ttaagttatg acgaaga cag 18O tataatgtta gtgttagatt tottaaaatc aaacaatttgttaaataaaa tittaaaattg 24 O atgcagagac C9ttgatata atatgagaag gagttgatcg gggggtgcgg tdaaattaat 3OO actaaattaa act attatta ttaaaaaa.ca ctittatt cag aaatattaca atttgtcaca 360 gttaaggaca cittataatag agttcagaga ttgcatt cat accqtatata caaaaatata 42O aataaataaa gtaataacaa aagaataaga agaaagaaca aaagagc 467

<210s, SEQ ID NO 116 &211s LENGTH: 363 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 116 ggggat.cc at aggat.ccgca talacacttac ttctaaaaac atgaagt cqt tagagaaagt 6 O gtgtgctgat Ctaataaatg gagctaagaa ggaaaatct c cqtgtcaagg gacccat cag 12 O gatgcc catc aaaattctgaggattacgac togtaaaac C C Cttgcggag aaggttctaa 18O gacttgggat cattccaaa tdaggat.cca caagagggitt atcgatcttic attct cott c 24 O tgaagttgttgaaacagataa Cttcaatttic ticttgaacct ggtgttgaag tdgaagt cac 3OO cattgc.cgaa taattactitt gtttitt atta tdtgataatt atataaaaaa aattatataa 360 tag 363 US 8,872,001 B2 143 144 - Continued

<210s, SEQ ID NO 117 &211s LENGTH: 632 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 117 gggcagaggg aaagttaaaa gtatttagala aatgc Cacta t cact tagtg tacatagata 6 O aact agggitt acataggttc ttgatagaat tdaatttatt act atggitat aaccotcttg 12 O taaactitt ca tat caaactg ttttaccagt gcatacacca cacct cactt cacttataaa 18O taagtagcta tittaaaaaaa aaaatgttitt tattattitta taattitt coc ttctgatagt 24 O tttactgtca tataacatgt attaaaac at aaaatct cot tattittctat tcc tataaaa 3OO aaaagaaaaa aaaaaagaaa ttgtaaataa gaaggatgca tttgttcatt coatttatta 360 gttgttaatc aggtgctatt toagtttitta ttittagaagc attagtttac gigatgttgta 42O tittct cattt tagctic titat gtgtcatact gctggttgtt citcc cataaa aatctaactg 48O tgcatttaaa ttaatcataa tagctatgc taaggcc titt taaatttaaa caaaagataa 54 O gttaagtgta t tatgtaata totattgtag aagaa.gcatgaatat cittat aagagaacaa 6OO taaattattt tattittaata tagtt tact t t c 632

<210s, SEQ ID NO 118 &211s LENGTH: 690 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature & 222. LOCATION: 627 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 118 gggtgttgat gagtggctga C9gtgatgaa gttct caatc Cctgttgtac totagatga 6 O gacattgaag tttgttgcaa ggaagat.cgc catgttcaa CCttcaatcc agatalagata 12 O Ctgagaggga ccaccalagac attcaaaaga gggitt tatgt gct tctagta gaataaataa 18O aatgcc tata tittaaaatct cataggatga t cacaaattig tataaaagag gtgtatagaa 24 O cc catttgtc ct attacgcg gagaaatgtc atttic ct atc tag to tattt tdgttct cqa 3OO tttitta acct attagaatta tattttittat aattitttittg attatttitat tagattittitt 360 ttatatatac acatcc tittt toaacataca acgcct citaa ccaataa.cat ttittatt aga 42O ttcttataaa ccgt.ca catt tdatggaacc caa.ca.gctgg ctgaagggtg totatt ctitt 48O aatactaa.ca tdtcqcgtga ttitt cattca cct ct catta tacctgtaca ttct caatta 54 O at attaattit aatctt catc taat attact ttacattctg toggtott cot tttittataaa 6OO agattatat c aaaattt cac tagtagncta taaat attitt atttattitt c tdttgtatat 660 atgaaaatac totacattca cittatgtatic 69 O.

<210s, SEQ ID NO 119 &211s LENGTH: 690 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 119 ggggaagtta taagttgtta cagtatccaa agatt ct citt actatgtatgtttacgattit 6 O gccatacaat gaaagaaagc aaatttgcag aattittggat ttgaataaag Cttgggagca 12 O attaggtgga agttacatga aatttgatgt gacaactitta aag cattttg aggaagc acc 18O US 8,872,001 B2 145 146 - Continued ttcaagaaat cactict coaa citgatgaatt attaact tca togggg tactic ggaat cataa 24 O tgttittggaa citgttcgt at togctttctaa aatgcagcac tat caggcta tdaatgtact 3OO caaagattitt gttgatgtaa agtat catcg gct catatat gaaggagaag aaaatttgtc 360 talagat attg gaggataaag gaaatcCttt ttcaaaat accagtgcat Cagtcgggaa 42O ttataaaaaa gaggaagtaa atggaaactt aaat attaat cqaaaaggac aagacattcc 48O acctgataag gatatgcaga aaaataaaat gtttataaat gagaaaatag ttaacaaaaa 54 O agaaactgat Cttggtgtcg aaggccttitt gagaatggala aatggacagt ctaaattgga 6OO tgaaaatact cqtgatagitt cqagtictatt gattt catat gctgaac tag aacgagctac 660 tggttcttgg gacaaaaaga at attittagg 69 O.

<210s, SEQ ID NO 120 &211s LENGTH: 250 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 120 ggga catgtg ttattgtttic acaagattica attatcc titc titcgtaagga ataaagg to a 6 O ttgactggtc. tcgcatagac tatgtaacta cataactata taatggtata gttattgatt 12 O agittattt at tatttact ct tactt cagtggggaacgttgaac attagag acagattaat 18O gtttgaggca cct tagaaaa taaaaataaa got aagacaa tttittgagta aaaacataaa 24 O cgttittaaag 25 O

<210s, SEQ ID NO 121 &211s LENGTH: 138 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 121 gggcaaaggg aacaattaca aaaacaagaa cccttaccat Cagtagctac agaatgtgat 6 O agccaccaac catttittgat ggattcaact atgttaatcc ctagtgaagt caagtctgaa 12 O aagaagaaag atgatc.cg 138

<210s, SEQ ID NO 122 &211s LENGTH: 363 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: 65. 243, 34 O <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 122 aaat accqigt tttgag actg gtttittcaac cqt catalacc tacattattt gcct cittaca 6 O ttgangcaag gactaacaat tttitttitt catcgaacaatt tttgaaagat ttcttataaa 12 O taaaacattt Ctttittatat titt cactgtt act acttctt togact agtga gttaaatata 18O acat atttaa alacat cagtg gattct coaa aaattittatt aat cagottt tittatacaat 24 O gcng tat cag tatgtttaaa ataattctac atttaatact tittatggitat accataacta 3OO cggcttcaaa atataagttg atacggaaaa gogattggtin attaaaaaaa aaactittata 360 aac 363

<210s, SEQ ID NO 123 &211s LENGTH: 547

US 8,872,001 B2 149 150 - Continued tgcact catt cocatalaccc atcaattatt gttaaattga agggcaaaaa aac tacttitt 48O tt 482

<210s, SEQ ID NO 126 &211s LENGTH: 535 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 126 gggataagag agtgcaacaa gttctggtaa ggittaaatgt agtaact tca totactalact 6 O taaaac agta caactittaga tigittaggtgt taaatgttgt agt caattct atgattittct 12 O acaggaattic gtacaattta aaaattatt c tatgaattaa ttctaaaata aaaagtc.gat 18O tttitt catag aggaactgat ttcaaaaggg ttgccataac acaagttitat ttattitt acc 24 O cataaatago aagggaaata gctaalacatg gattatttitt aagaattgca aatatttitta 3OO titatgactgt agattt atta taacttittaa tttittaaaat aattatctag totatatact 360 c cattagaat aagttgtc.tt tdtgatgtaa alactaattitt aagaataggit titatgtcaat 42O aaggatgtac ttacgittata ttagtaggta ttgaatataa tag attctgt ataattacct 48O aatagaataa gttcagtgct attgt atctg ttaacaataa atgtgaattt attat 535

<210s, SEQ ID NO 127 &211s LENGTH: 94 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

< 4 OO SEQUENCE: 127 ggggttcatt gaactgttaa gtggtaaagt taatcatata acatatatta attct tattt 6 O at attgtcat ttgtc.ttata cct ct cqaat gttt 94

<210s, SEQ ID NO 128 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 128 gggcatctat agaaat attc titactitatica gaatcttacc tictaaatata aataaacaaa 6 O gaagaagtgg 70

<210s, SEQ ID NO 129 &211s LENGTH: 688 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 129 gggggactta t caaacgttg atgaagacta attat actica C9gattacat Ctgtgagttg 6 O acaaacatat atttgtcacc ctaatgtact taccactitta ttaggittitt c taaacaactt 12 O gaaaacaa at ttittct cittg ctittaact at gacattgttt caattitcgat ggctg.cgt.cg 18O acttataagg agtaatacca agcc catt Co. aatggataaa gcagagittat ggaaagaacg 24 O t ctitt cagtt gcttatatgt ttgttt catt aaat atcctt gg tactataa tittatttitta 3OO ttacaaagga aaacct gatt tagctgaata t tatggit citt aaaactgagg aagagataaa 360 caaaaaacca gcaatatatt atgcagagct cittaggaatt aaaaaaacac atgttataag 42O gtataaaggg tttcaaaaag tagaagaatt tatt atgaa aalaccagcag acagtgaaaa 48O agtgaaaact gatacagagt agaattitttgttctttittat ttataattag tdttatattt 54 O US 8,872,001 B2 151 152 - Continued aaaaaaatgg taa.gc.cagtg tdaattgtaa atctotaaat acaataatac tdttagtaaa 6OO ggacaatticc ataaataaat aaatgitat ct at caatacag at atttittat tatttittaca 660 tatatttgtt attaattgca ttaaataa 688

<210s, SEQ ID NO 130 &211s LENGTH: 214 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 130 gggccaccat catacgatag acgtgtaatt totggaggca gtggit coaga gtctaagc.ca 6 O actalaggt ca tacctgatga tigaagg tagt gatgatgatt C catcgactg gggcagtggit 12 O t cagagticta gttcggaatc gagtgatgat gaaggacagt accaatcgat cagagaaaga 18O tttittgaaaa aaacaacaga t cagaagaa gaag 214

<210s, SEQ ID NO 131 &211s LENGTH: 496 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 131 ggggaatgaa tdagaatcgt taagagctag toaatcc titt aactgttatgttt catctoa 6 O agcaaatgaa titccttgtac titatgttcat tdttaccctic attaccacag got acaggtg 12 O atacaggaag taalactgcag tatact cact gtcgattgttg cagct tagala gaalaattgcg 18O gtgttcttitt gcc caaagag attaatgcaa cagttct cat ggaac caatt gtgtttgaac 24 O titatgtatga attgacaagg titt caggatgttatcaatag ctgccaaaat gaattagagt 3OO cittct tactt agtgaattat g tatttaa at tatgtaacac tdtgaatcqt tdtttaaaaa 360 atttgc.cagt aaagggacag cct tcagata ttgctgagca acgattgtta cittitt coat a 42O ctgctaaaac gtttctacat t catcaatga agatt cittgg tttacagcct cittaataaaa 48O tgtagattitt act cag 496

<210s, SEQ ID NO 132 &211s LENGTH: 632 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 122 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 132 gggagatgtt cct ttaatga aatggacago Ctt tatgctic ggaga.gcaaa actgaatcgg 6 O actgcaa.gag cacatatggc taatgaagca ggcgttactt aggcgtagga aaaaaaaaaa 12 O antt atttitc ttagattact ggtttaattt ctittaatago tttittaatgt agg tactggc 18O aaatcgaaaa aaattgcc aa gaggittagca gcacataaaa ttggatgag actgaaagac 24 O ttaccctg.cg aaa.gcaacac catt Cattac ggcttggatg atgaagatga gg tatgcgta 3OO attaaattgt ttatctacta ttatc.tttitt ttaaaaatgc titgatttaaa tittatgattg 360 attatt agtt at acttgttgt agittaattac aaattaatta atatagtaat tagttttitta 42O citgattittitt c tattittaat ttattittatt ggct cqattt aagttittata gctggctata 48O aaaaatacca agtttctata ct cagtaaga atatattitta togggcattgg aaatcCaggc 54 O US 8,872,001 B2 153 154 - Continued tatt cocaaa citcgittatga acctataaaa gcaattaaag g tatt cottt attcatcatt ggattgttga tagtttgctt ttgggat caa t 632

<210s, SEQ ID NO 133 &211s LENGTH: 422 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 133 ggggattggit tatgaaata ttctacctgt tacagtatg gttggggitat tgctctgttt 6 O t catcagtaa ttttacgttt catctgcaaa at agtttitta tittgcataag aaatgaacat 12 O cgaacatalaa atgaaact ct ttittgctgtt gttattocct tctictatgtg c ct cit cattt 18O ttgtc.cat cq aggcattact ggagtaaagc ticatagtaaa tgcttggaat gtaaa.ca.gtg 24 O c catgtaa.ca cittatt cott gtacagotaa gatgaattica atttgtgc.ca at atc catga 3OO aaaaaatcac cacttic caaa aatat cqtat t caattittitt gatgatggga atgaagatga 360 gcttgacaaa caagtagatt ctacagggca catacacaaa gatgatctgt at Ctt CCaCa tg 422

<210s, SEQ ID NO 134 &211s LENGTH: 134 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 134 gggcCCCtga tigt catata atc.cgaaaag ttacaaaaag. tcaggcaact galacactat 60 citcaaatttg atat catttt cataaaaag.c gcc cc cc caa alacat catag togac cctoga 12 O tat cattta atcc 134

<210s, SEQ ID NO 135 &211s LENGTH: 68 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 135 gggggggagg tacgatgtgt CCCtgtgtca totactgtac atcgattctg tdt acaacaa 6 O taaaatac 68

<210s, SEQ ID NO 136 &211s LENGTH: 82 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 136 tatataaaac ctdcaaatga aattaaacca gaagaatttic gattactaga tigtagataat 6 O cgtacagtat taccaataaa ta 82

<210s, SEQ ID NO 137 &211s LENGTH: 691 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: 532 <223> OTHER INFORMATION: n = A, T, C or G

<4 OOs, SEQUENCE: 137 gggg taattt agg taaaaat cagtaagaat aaatgcattg attcactitat ttgaaaatta 6 O US 8,872,001 B2 155 156 - Continued aataagaatt aaataaactt ttgaaataga acaattcaat cqttgcc citt taagtaagat 12 O aag.cggttcc at attcgttt gtaagaacaa aggaattgat agattagctg. tcaaagctta 18O tagat.cgatt gagatgitatic titccaact ct taaggtgatg act tatt caa agttttitt ct 24 O tacagaaagt aatgaagctt ttcaaattta attaaaactt ttittct citt c agatagt caa 3OO tataaaaagt ccataacaat caatttataa tatagaggta tat citt cata cccaatcgta 360 atttatt citt coctittttitt tatt attatt tacaggctitt gct gacctitt tatttcttitt 42O attattittat attatattitc tattatagitt taataaatta tittatt tatgaatagatgta 48O cgagcttgta aagttittaag taggcttittg attaalacata ccatacaatg gnacgaaatt 54 O tittaataagc tacaaaacaa agcaaaaaga tigaatgaaat aagttgaaaa aagt cct gga 6OO atgtcc taaa cqaat attag taaaaattitt acatttatca totatgtaag attgcatgtg 660 cittgtag cat gtgttagaaa taaattattt c 691

<210s, SEQ ID NO 138 &211s LENGTH: 172 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 138 ggggcattca agt cctgtaa agitta catca acagggacaa gatctaaatg atataaaaac 6 O cacttaatta taaatc cata cactaagttt aatcaaaatc gttggagcca ttittgaaaaa 12 O atcttaaaaa totttittaat cqattctgtt aagtgtcatt toagattatic cc 172

<210s, SEQ ID NO 139 &211s LENGTH: 645 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 139 gggtgt attc atatataatt tttcaattitc aaaaattggg tdtttgttgg atggttcaac 6 O tittattaata ttgaaaaa.ca aaattgg.cgc ataaagctag ttgat ct tcc aaaaatatgg 12 O aacctaggitt toagtaatag gatttggtgt cattaagttg tat caattga tigcattttac 18O c catct citaa aat attaa.ca taaaaatticc aatagataca tactattgct ttagaaatat 24 O atttaalacat attaaatgtg ataat attitt cittaatatat gtttitttittt tottt cittgt 3OO tittatt catg cqtgtattitt aatgttittaa caaatataaa tattittagat agataaatat 360 ttittgatago gtgttgatatt gatgaactga citagaaaata tittaattatt titatgat citt 42O atttgagtta ttagacctta attitcgaaca cattt tagga aaaaaaaa.ca tttataaaga 48O aaaaaaaaaa aggaaaagaa atgagtaaac tdaaaac agit ttaaagttta atttalactitt 54 O at catgtgtc. aataatacca tdatatattgttatatt cat gatatattgt tatat caaat 6OO aaaaagttat atagactitat aaa.gcattat aatacatgta togaaa 645

<210s, SEQ ID NO 140 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 140 aatcaaggtg tdgactgaaa att 23

<210s, SEQ ID NO 141 US 8,872,001 B2 157 158 - Continued

&211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 141 ulcaaggugug gaclugaaaa 19

<210s, SEQ ID NO 142 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 142 uuuucagucc acaccuuga 19

<210s, SEQ ID NO 143 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 143 aattggttgc tacatatt ct citt 23

<210s, SEQ ID NO 144 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 144 uluggllugcla Callalullculc 19

<210s, SEQ ID NO 145 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 145 gagaauaugu agcaac Caa 19

<210s, SEQ ID NO 146 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 146 aagaacgt.ct taggatgcat att 23

<210s, SEQ ID NO 147 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 147 gaacguiculua ggalugcaula 19

<210s, SEQ ID NO 148 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 148 ulaugcaucCu aagacgullic 19 US 8,872,001 B2 159 160 - Continued

<210s, SEQ ID NO 149 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 149 aagcaa.gcac ctacct tcac att 23

<210s, SEQ ID NO 150 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 150 gcaa.gcaccu accuucaca 19

<210s, SEQ ID NO 151 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 151 luguga agglla glugclugc 19

<210s, SEQ ID NO 152 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 152 aalaccalaggt agctgtggat Ctt 23

<210s, SEQ ID NO 153 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 153 accalaggulag cluguggaluc 19

<210s, SEQ ID NO 154 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 154 gauccacagc ulaccuuggu 19

<210s, SEQ ID NO 155 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OO > SEQUENCE: 155 aataatggat gtggtggcgg att 23

<210s, SEQ ID NO 156 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 156 laauggalugu gruggcgga 19 US 8,872,001 B2 161 162 - Continued

<210s, SEQ ID NO 157 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OO > SEQUENCE: 157 uccgccacca cauccaulua 19

<210s, SEQ ID NO 158 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 158 aaaaggatac cactittggac titt 23

<210s, SEQ ID NO 159 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 159 aaggallacca Cululuggacul 19

<210s, SEQ ID NO 160 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

< 4 OO SEQUENCE: 16 O aguccalaagu ggulaucculu. 19

<210s, SEQ ID NO 161 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 161 aaaggatacc actittggact titt 23

<210s, SEQ ID NO 162 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 162 aggallaccac ululuggacuu. 19

<210s, SEQ ID NO 163 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 163 aaguccaaag lugguauccul 19

<210s, SEQ ID NO 164 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 164 aalaccalagac ccagactgga gtt 23 US 8,872,001 B2 163 164 - Continued

<210s, SEQ ID NO 165 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 165 accalagaccc agacluggag 19

<210s, SEQ ID NO 166 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 166

Cuccaguclug ggluculuggu 19

<210s, SEQ ID NO 167 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 167 alagacccaga Ctggagttga att 23

<210s, SEQ ID NO 168 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 168 gaccCalgacu ggaguugaa 19

<210s, SEQ ID NO 169 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 169 uluca acucca glucuggguc 19

<210s, SEQ ID NO 170 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 170 alaccaagaala Ctgggaaagt gtt 23

<210s, SEQ ID NO 171 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 171 cCaagaaacu gggaaagug 19

<210s, SEQ ID NO 172 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 172

US 8,872,001 B2 169 170 - Continued

<4 OOs, SEQUENCE: 188 aaaactitt ct caaagaacca gtt 23

<210s, SEQ ID NO 189 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 189 aacuuucuca aagaac Cag 19

<210s, SEQ ID NO 190 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 190 cluggullcululu gagaaaguu 19

<210s, SEQ ID NO 191 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 191 aaagaaccag titccaaatgc att 23

<210s, SEQ ID NO 192 & 211 LENGTH 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 192 agaaccagulu C caaaugca 19

<210s, SEQ ID NO 193 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 193 lugcaululugga acugglulucu. 19

<210s, SEQ ID NO 194 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 194 aatgcatt co cittcaatcto att 23

<210s, SEQ ID NO 195 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 195 ugcauucccu. ulcalaucuca 19

<210s, SEQ ID NO 196 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

US 8,872,001 B2 179 180 - Continued

<210s, SEQ ID NO 228 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 228 uaculucagag ulacggcgula 19

<210s, SEQ ID NO 229 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 229 ulacgc.cgulac ulculgaagua 19

<210s, SEQ ID NO 230 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 23 O aaaatgagag ctacgtactg. Ctt 23

<210s, SEQ ID NO 231 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 231 aaugagagcu acguaculgc 19

<210s, SEQ ID NO 232 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 232 gCaguacgua gcucucaulu. 19

<210s, SEQ ID NO 233 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 233 aaataccatt acacaggaca titt 23

<210s, SEQ ID NO 234 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 234 allaccaluulac acaggacau. 19

<210s, SEQ ID NO 235 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 235 augucclugug ulaaluggualu. 19 US 8,872,001 B2 181 182 - Continued

<210s, SEQ ID NO 236 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 236 aagtgttgct ggalacatcaa gtt 23

<210s, SEQ ID NO 237 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 237 gugu lugclugg aacaucaag 19

<210s, SEQ ID NO 238 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 238 cuugauguuc Cagcaa.cac 19

<210s, SEQ ID NO 239 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

< 4 OO SEQUENCE: 239 aatgcc cago agaaac caac citt 23

<210s, SEQ ID NO 24 O &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 240 lugcc.ca.gcag aalaccalacc 19

<210s, SEQ ID NO 241 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 241 ggulugglululuc lugclugggca 19

<210s, SEQ ID NO 242 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 242 aaataccaca gccagdaata att 23

<210s, SEQ ID NO 243 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 243 aulaccacago cagcaauaa 19 US 8,872,001 B2 183 184 - Continued

<210s, SEQ ID NO 244 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 244 ullalulugclugg Cuguggllall 19

<210s, SEQ ID NO 245 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 245 aataccacag cca.gcaataa titt 23

<210s, SEQ ID NO 246 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 246 ulaccacagcc agcaauaalu 19

<210s, SEQ ID NO 247 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 247 alullalulugclug gCugugglla 19

<210s, SEQ ID NO 248 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 248 aagcct cogg tacct caagg titt 23

<210s, SEQ ID NO 249 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 249 gccuccggua Cculcaaggu 19

<210s, SEQ ID NO 250 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 250 accuugaggu accggaggc 19

<210s, SEQ ID NO 251 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 251 US 8,872,001 B2 185 186 - Continued aatctitat cq gacaaaccag titt 23

<210s, SEQ ID NO 252 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 252 ulcuuaucgga caaaccagul 19

<210s, SEQ ID NO 253 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 253 a clugglululugu cc.gallaaga 19

<210s, SEQ ID NO 254 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 254 aaaaat atco attgcc actg titt 23

<210s, SEQ ID NO 255 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM; Nezara viridula

<4 OO > SEQUENCE: 255 aaaulauccalul lugccaclugu. 19

<210s, SEQ ID NO 256 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 256 acaguggcaa luggallaluulu. 19

<210s, SEQ ID NO 257 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OO > SEQUENCE: 257 aaaat atcca ttgccactgt titt 23

<210s, SEQ ID NO 258 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 258 aalualuccalulu gccaculgulu 19

<210s, SEQ ID NO 259 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 259 US 8,872,001 B2 187 188 - Continued alacaguggca aluggallalulu. 19

<210s, SEQ ID NO 260 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 260 aaatat coat tdccactgtt titt 23

<210s, SEQ ID NO 261 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 261 alualuccalulug C calculgululu. 19

<210s, SEQ ID NO 262 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 262 aaacaguggc aaluggalualu. 19

<210s, SEQ ID NO 263 &211s LENGTH: 23 & 212 TYPE DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 263 aaggatggga tigtgttc.cga gtt 23

<210s, SEQ ID NO 264 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 264 ggalugggalug lugull.ccgag 19

<210s, SEQ ID NO 265 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 265 cucggalacac aucccalucc 19

<210s, SEQ ID NO 266 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 266 aagatggggg gatgatgtac gtt 23

<210s, SEQ ID NO 267 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula US 8,872,001 B2 189 190 - Continued

<4 OOs, SEQUENCE: 267 galugggggga ugalugulacg 19

<210s, SEQ ID NO 268 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 268 cguacaucau ccc.cccaulic 19

<210s, SEQ ID NO 269 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 269 aagaac atcc acaggagaac citt 23

<210s, SEQ ID NO 270 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 270 gaac auccac aggagalacc 19

<210s, SEQ ID NO 271 & 211 LENGTH 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 271 ggullcucclug luggallgullic 19

<210s, SEQ ID NO 272 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 272 aagactictat taatat coag citt 23

<210s, SEQ ID NO 273 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 273 gacuculaulua alualuccagc 19

<210s, SEQ ID NO 274 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Nezara viridula

<4 OOs, SEQUENCE: 274 gcluggallalulu aaluagagluc 19

<210s, SEQ ID NO 275 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Nezara viridula