Infection Strategies of Clade V Nematode Parasites by Way of Specific Effectors in Heterorhabditis Bacteriophora

Infection Strategies of Clade V Nematode Parasites by way of Specific Effectors in Heterorhabditis bacteriophora

by Eric Kenney

B.A. in Biology, May 2011, University of Maryland M.S. in Biological Sciences, August 2013, University of Maryland, Baltimore County

A Dissertation submitted to

The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

January 8, 2021

Dissertation directed by

Ioannis Eleftherianos Associate Professor of Biology

The Columbian College of Arts and Sciences of The George Washington University certifies that Eric Timothy Kenney has passed the final examination for the degree of

Doctor of Philosophy as of September 11, 2020. This is the final and approved form of the dissertation.

Infection Strategies of Clade V Nematode Parasites by way of Specific Effectors in Heterorhabditis bacteriophora

Eric Kenney

Dissertation Research Committee:

Ioannis Eleftherianos, Associate Professor of Biology, Dissertation Director

John Hawdon, Associate Professor of Microbiology, Immunology, and Tropical Medicine, Committee Member

Damien O’Halloran, Associate Professor of Biology, Committee Member

iii

Acknowledgments

First and foremost, I would like to thank my research advisor, Dr. Ioannis

Eleftherianos, for his continuous support and dedication to this project. His knowledge, work ethic, and professionalism have been a source of inspiration, and his mentorship has made the time I’ve spent in his lab deeply valuable to me.

I have also long been grateful for the support of Dr. Damien O’Halloran and Dr.

John Hawdon, not only for their invaluable input in shaping the experimental arc of this work, but also for their stalwart efforts in making this text more precise and effective.

The depth and quality of their commentary on this project illustrate an uncommon level of care that is very much appreciated. In the same vein, I would also like to thank Dr.

James Lok for agreeing to be a member of my dissertation committee and providing feedback on this thesis.

A high level of gratitude is also owed to Dr. Leon Grayfer, Dr. L. Courtney

Smith, and Dr. Mollie Manier for offering their expertise and material support. Their involvement has vastly improved this work, and I feel fortunate to have had the chance to learn from them and attempt to absorb a measure of their admirable research acumen.

For contributing to a research community and support system that I could not have completed this project without, I thank past and present members of the

Eleftherianos Lab as well as family and friends. Their kind words and actions have been a constant reminder to be a person as well as a scientist.

Abstract

Infection Strategies of Clade V Nematode Parasites by way of Specific Effectors in Heterorhabditis bacteriophora

The entomopathogenic nematode Heterorhabditis bacteriophora is uniquely positioned to serve as a model for understanding the genetic basis of parasitism. Its close relationship to the model organism C. elegans provides a strong framework for interpreting genetic information and free-living nematode background. Additionally, H. bacteriophora has evolutionary proximity to a number of vertebrate-parasitic nematodes, so the information gleaned from the entomopathogen can be compared to these species to identify common virulence motifs. These aspects of the phylogenetic placement of H. bacteriophora have prompted a number of genomic and transcriptomic studies meant to highlight potential virulence factors, but the information gained from bioinformatic analyses is not always sufficient for understanding the contribution of a gene. The function of a given protein can often have equally plausible roles in regulating the parasite’s own physiology or interfering with that of the host, and this ambiguity calls for in vivo study of each candidate virulence factor’s ability to contribute to an infection.

Before developing a system for characterizing virulence factors, the toxic or immunomodulatory effects of the parasite as a whole must first be examined. To this end, we injected concentrated H. bacteriophora excreted-secreted (ES) products from host- exposed nematodes into Drosophila melanogaster larvae and flies. We found that these products suppressed the expression of the antimicrobial peptide (AMP) Diptericin, and that the products were lethal to a subpopulation of flies. Notably, the finding that the nematode itself can produce lethal factors demonstrates that H. bacteriophora does not

v rely entirely on the products of its bacterial symbiont, Photorhabdus luminescens, to kill the host. Following this foundational depiction of Heterorhabditis virulence, individual proteins that were predicted to be secreted were expressed in recombinant form and similarly injected into Drosophila to determine whether they might contribute to the observed effects. A putative UDP-glycosyltransferase (Hb-ugt-1), invertebrate-type lysozyme (Hb-ilys-1), and serine carboxypeptidase (Hb-sc-1) were examined in this manner, and each was shown to function as a virulence factor in vivo. Among other effects, Hb-ugt-1 and Hb-sc-1 were found to limit the upregulation of AMPs, Hb-ilys-1 suppressed the activity of phenoloxidase, and both Hb-sc-1 and Hb-ilys-1 contributed to the advancement of an infection by P. luminescens.

These findings show that H. bacteriophora likely carries a rich and complex virulence arsenal, and understanding how individual effectors contribute to an infection could inform a variety of applications. Heterorhabditis nematodes are already commercially available as a means of biocontrol for insect pests, and enhanced trains could be developed by modulating the expression of known virulence factors.

Additionally, information about H. bacteriophora effectors could be used to predict analogous roles for homologs in vertebrate-infective species, highlight those that are likely to be immunomodulatory, and guide the process of developing new treatments for helminth infections or inflammatory diseases.

Table of Contents

Acknowledgments ...... iv Abstract ...... v List of Figures ...... viii List of Supplementary Material ...... x Introduction ...... 1 Chapter 1: Heterorhabditis bacteriophora excreted-secreted products enable infection by Photorhabdus luminescens through suppression of the Imd pathway ...... 20 Chapter 2: A putative UDP-glycosyltransferase from Heterorhabditis bacteriophora suppresses antimicrobial peptide gene expression and factors related to ecdysone signaling...... 60 Chapter 3: A putative lysozyme and serine carboxypeptidase from Heterorhabditis bacteriophora show differential virulence capacities in Drosophila melanogaster...... 93 Discussion ...... 124 References ...... 131

vii

List of Figures

Chapter 1 Figure 1. Exposure of Heterorhabditis bacteriophora infective juveniles (IJs) to host hemolymph induces the secretion of unique proteins ...... 51 Figure 2. Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products elicit differential Diptericin responses that are consistent across Drosophila melanogaster life stages ...... 52 Figure 3. Differential Diptericin responses to ES products originate at or prior to transcriptional activation ...... 53 Figure 4. Activated Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products are lethal to adult Drosophila melanogaster ...... 54 Figure 5. Triple-concentration of the Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products exacerbates Diptericin responses, but fails to elicit responses from other antimicrobial peptides ...... 55 Figure 6. Co-injection of Escherichia coli with activated Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products results in fly mortality...... 56 Figure 7. The onset of mortality evoked by Photorhabdus luminescens infection is significantly advanced by Heterorhabditis bacteriophora nematode Excreted/Secreted activated products, but delayed by non-activated products ...... 57 Figure 8. Activated Heterorhabditis bacteriophora ES products enable the rapid proliferation of Photorhabdus luminescens during the early phase of an infection...... 58 Figure 9. Heterorhabditis bacteriophora nematode activated Excreted/Secreted (ES) products provoke a stronger phagocytic response...... 59

Chapter 2 Figure 1. Hb-ugt-1 is upregulated in response to host-associated factors, but not development-inducing symbiotic bacteria ...... 85 Figure 2. Hb-ugt-1 is a putative UDP glycosyltransferase (UGT) ...... 86 Figure 3. Heterorhabditis bacteriophora activated ES products glycosylate 20- hydroxyecdysone and contain a GTDC1 domain-containing protein ...... 87 Figure 4. Recombinant Hb-UGT-1 suppresses a subset of antimicrobial peptide genes in Drosophila melanogaster ...... 88 Figure 5. Hb-ugt-1 recombinant protein suppresses Broad-Complex expression in Drosophila melanogaster adults and larvae ...... 89

viii

Figure 6. Hb-UGT-1 reduces the pupation rate of third instar Drosophila melanogaster larvae ...... 90

Chapter 3 Figure 1. Heterorhabditis bacteriophora candidate virulence factors respond dynamically to infection-related stimuli ...... 117 Figure 2. Phylogenetic reconstruction and alignment of Heterorhabditis bacteriophora Hb-ILYS-1 with nematode invertebrate-type lysozymes and Hb-SC-1 with serine carboxypeptidases ...... 118 Figure 3. Heterorhabditis bacteriophora Hb-ILYS-1 and Hb-SC-1 both hasten mortality induced by Photorhabdus luminescens, but only Hb-ilys-1 is associated with a higher bacterial load ...... 119 Figure 4. Drosophila antimicrobial peptide upregulation is diminished following exposure to rHb-SC-1...... 120 Figure 5. Heterorhabditis bacteriophora Hb-ILYS-1 and Hb-SC-1 inhibit phenoloxidase activity ...... 121 Figure 6. Heterorhabditis bacteriophora Hb-SC-1 suppresses phagocytosis...... 122

List of Supplementary Materials

Chapter 2 Figure S1. Hb-ugt-1 shows sequence similarity to other ecdysone glycosyltransferases. 91 Figure S2. The GTDC1 antibody labels rHb-ugt-1...... 92

Chapter 3 Table S1. List of primers used for expression analyses and cloning ...... 123

Introduction

I. The research significance of Heterorhabditis bacteriophora

The entomopathogenic nematode H. bacteriophora

H. bacteriophora is as an obligate parasite of arthropod hosts, which it infects in conjunction with the symbiotic bacterium Photorhabdus luminescens. The host range of the nematode is quite broad, including a variety of insect hosts across multiple orders, and in at least in one case, terrestrial crustaceans (de Doucet et al., 1998; Poinar & Paff,

1985). Heterorhabditis bacteriophora also infects frog tadpoles, though the nematode will not develop and Photorhabdus cannot induce septicemia in this host (Poinar and

Thomas, 1988). To locate a host, Heterorhabditis actively moves through the environment, a behavior often described as ‘cruising’ in contrast to the ‘ambushers’ like

Steinernema species that wait in place to strike at a mobile host (Brivio and Mastore,

2018). After burrowing through the cuticle with a buccal tooth and migrating to the hemocoel, H. bacteriophora expels P. luminescens from its gut and feeds on the bacteria that propagate from this initial population in order to sustain its growth and development

(Johnigk and Ehlers, 1999). The life cycle consists of four juvenile stages that each last approximately 8 to 12 hours and culminates in hermaphroditic egg-laying adults; the adults give rise to several new generations until the food source is exhausted (Figure 1).

In response to the accumulation of a conspecific ascaroside pheromone (Zioni et al.,

1992; Noguez et al., 2012), larvae arrest at the infective juvenile (IJ) stage that subsequently disperses from the host. Importantly, this pheromone response indicates that the IJ is not inert, but actively engaged in surveying its environment, potentially even

1 detecting other entomopathogenic nematodes (EPNs) through this same system (Kaplan et al., 2020).

Figure 1. The lifecycle of Heterorhabditis bacteriophora. A simplified version of the infection process is shown, where infective juveniles (IJs) enter the hemocoel by penetrating through the cuticle. In some cases, the insect immune response is successful while in others, the nematode evades encapsulation and releases Photorhabdus luminescens into the hemolymph. The bacteria then replicate and release factors that suppress insect immune mechanisms. By feeding on Photorhabdus, H. bacteriophora progresses through the successive molts (J1 through J4) of its lifecycle several times before arresting at the IJ stage and dispersing from the expended host.

Evolutionary relationships with other nematodes

Understanding the manner in which the nematode interprets environmental cues to invoke virulence pathways is one way of highlighting conserved mechanisms that exist across the free-living and vertebrate-parasitic relatives of H. bacteriophora. For instance, developmental arrest of the IJ, analogous to the dauer stage of the free-living microbivore

C. elegans, is believed to be a foundation for the development of a parasitic lifestyle, due in part to increased resistance to environmental stress (Crook, 2014). Some physiological commonalities exist that lend support for this theory not only in reference to C. elegans and EPNs, but also between EPNs and nematode parasites of vertebrates. The sensory

ASJ amphid neurons are necessary for exit from the dauer and IJ stage in C. elegans and

H. bacteriophora, and cGMP has been found to stimulate the emergence of the larva from its arrest in both Heterorhabditis and the vertebrate-infective hookworm

Ancylostoma caninum (Hallem et al., 2007; Hawdon and Datu, 2003). Dauer exit is also modulated by signaling through the nuclear receptor DAF-12 in both C. elegans and hookworm species, and a homolog of this receptor has been identified in the H. bacteriophora genome (Wang et al., 2009; Bai et al., 2013). These common pathways may give rise to similar downstream activation states, which would allow virulence factor roles demonstrated in H. bacteriophora to be generalized to predict similar roles for factors produced by its vertebrate-infective relatives. The phylogenetic position of

Heterorhabditis makes it particularly useful in this regard. Across the five phylogenetic clades of Nematoda, animal parasitism is believed to have developed independently at least four times (Blaxter et al., 1998), and the comparison of free-living nematodes to parasites will therefore likely be more relevant if performed between organisms in the same clade (Viney, 2018). As a member of Clade V, H. bacteriophora allows for bridging comparisons with members of Strongylida such as hookworms and the relatively well-defined, free-living background provided by C. elegans (Blaxter et al., 1998).

Furthermore, while phytoparasitic nematode genomes indicate possible horizontal gene transfer events, this is not the case for animal parasitic nematodes (Blaxter and

Koutsovoulos, 2014), so the origins of parasitic genes should be present in free-living ancestors. Genomic and transcriptomic studies of H. bacteriophora have already begun to describe the potential effectors that might be deployed by the nematode. Between approximately 100 and 600 secreted proteins have been predicted through various

3 analyses (Bai et al., 2013; Adhikari et al., 2009), and certain families like lectins and proteases have been implicated in parasitism (Hao et al., 2012). The genome also appears to contain an abnormally high number of unique proteins, though this may be rooted in problems with the accuracy of gene set prediction, which is evident from the abundance of single exon genes (McLean et al., 2018). Progress in defining the transcriptome has been made by applying empirical characterizations of genes to train gene models specifically for H. bacteriophora (Vadnal et al. 2018). As this work progresses, knowledge of Heterorhabditis virulence factors can be used to narrow the pool of factors that should be targeted for the treatment of nematode infections in vertebrates, like the widespread morbidity-associated infections of humans, by highlighting those that are most central to virulence.

Use for the biocontrol of insect pests

In a more immediate sense, a description of the molecular components of an H. bacteriophora infection could also advance the biocontrol of insect pests by facilitating the development of parasites that are more virulent to a collection of target species.

Heterorhabditis has shown distinct promise as a means of controlling a number of insect pests, including the western corn rootworm (Diabrotica virgifera), and Japanese beetle

(Popillia japonica) while having no substantial effect on beneficial species like the honey bee (Apis mellifera) (Modic et al., 2020; Wang et al., 1994; Baur et al., 1995). One distinct problem with isolating and raising nematodes for this purpose is the surprising amount of variability in virulence, even among those nematodes of the same species isolated from roughly the same geographic region (Rosa and Simoes, 2004), and

4 differential susceptibility of insect populations to exotic and endemic nematodes of the same species (Berry et al., 1997). These cases indicate a plasticity in virulence that doesn’t inspire confidence in the idea that the widespread deployment of an existing nematode species could be universally effective, even if a relatively virulent strain were initially selected. Furthermore, the latter case highlights the important consideration that virulence is not a physical attribute of a nematode, but a description of a relationship between two organisms. If a nematode strain is tested against a laboratory population of insects, is it likely to have the same degree of virulence against a wild population of the same species? Additionally, continuous propagation in a lab setting can diminish the virulence of a strain of nematodes (Shapiro-Ilan and Raymond, 2016), so the mass production required for biocontrol would probably result in a less effective strain than that which was tested. Instead of selecting an existing strain then, a reasonably effective base strain of H. bacteriophora could be genetically manipulated to a more robust state that would be effective even if attenuated or challenged by local conditions. This is at least fundamentally possible in that Heterorhabditis is amenable to transformation via microinjection into the gonad (Hashmi et al., 1995; Hashmi et al., 1997). Eventually, engineered nematodes could also be paired with engineered Photorhabdus, which is an effective means of enhancing virulence (Machado et al., 2020).

II. The EPN infection process

Host detection and entry

Prior to the initiation of an infection, the infective juvenile (IJ) must first identify and contact a suitable host. The best described mechanism of host-seeking behavior in H.

5 bacteriophora is its chemoattraction to certain chemical cues, including the host metabolite CO2 (O’Halloran and Burnell, 2003). Carbon dioxide is apparently a primary cue for H. bacteriophora, as removal of CO2 from host emissions with soda lime will eliminate the nematode’s response to a natural Lepidopteran host like Galleria mellonella. However, CO2 is not the only cue, given that a similar treatment of emissions from the cricket Acheta domesticus will still allow for a chemotactic response from the nematode (Hallem et al., 2011). Furthermore, Heterorhabditid nematodes are attracted to a terpene released from herbivore-damaged plant roots (Rasmann et al., 2005), and the IJs are more attracted to damaged roots than undamaged roots (Van Tol et al., 2001).

Already, this arrangement of cues presents a conflict with the host range of

Heterorhabditis, as cues like 4-methylphenol derived from mole crickets and propanol in house cricket exudates are attractive to the nematode even though it is not capable of reproducing in these species (Dillman et al., 2012). From the perspective of manipulating nematodes to develop enhanced parasites, this relatively indiscriminate system is malleable to a degree and can even be adjusted based on previous environmental exposure or experience (Ruiz et al., 2017). In Steinernema carpocapsae, chemotactive differences have also been identified between strains of the same species, where the

Breton strain is more attracted to G. mellonella than are the ALL and UK1 strains, behavior attributed to the upregulation of four chemosensory G protein-coupled receptor

(GPCR) genes (Warnock et al., 2019).

Once the IJ has identified and contacted an insect larva, the interplay between host and parasite begins, even before the nematode reaches the hemolymph. Drosophila larvae are known to adapt their behavior based on the presence of EPNs, which indicates

6 that at least in this case, the host is likewise capable of detecting the parasite.

Specifically, Drosophila larvae increase their velocity when exposed to H. bacteriophora as opposed to S. carpocapsae, which may reflect the respective cruiser and ambusher strategies of H. bacteriophora and S. carpocapsae, though importantly, this response is also not consistent across different genetic backgrounds of Drosophila (Kunc et al.,

2017). Evasive behaviors in response to H. bacteriophora have also been documented in the Coleopteran Popillia japonica, where aggressive behaviors including leg rubbing were observed, resulting in the removal of approximately 60% of attacking nematodes and the further killing of a third of those attackers (Gaugler et al., 1994). For those nematodes that do successfully attach to a host, the IJ can enter through the mouth, anus, spiracles, or by burrowing directly through the cuticle, the mode of entry for which H. bacteriophora appears to be especially well suited (Koppenhöfer et al., 2007). Prior to penetrating through the host cuticle, Heterorhabditis will also exsheath and abandon its own outer cuticle to the exterior of the host (Bedding and Molyneux, 1982). Once through the cuticle of the insect, a new phase of cellular and molecular host-parasite interactions begins.

The release of Photorhabdus and its relationship with the nematode

One aspect of H. bacteriophora biology that sets it apart from many other nematode parasites is its relationship with its bacterial symbiont, Photorhabdus luminescens. Carried in the gut of the IJ, P. luminescens is a Gram-negative bioluminescent bacterium that the nematode releases into the host hemolymph (Ghazal et al., 2016), where it contributes to host mortality and supports the growth and

7 development of the nematode. Some evidence has shown that P. luminescens may be capable of existing independently in the soil environment rhizosphere (Regaiolo et al.,

2020), but its roles in a Heterorhabditis infection make the relationship obligate for the nematode.

Following penetration of the IJ through the cuticle of the host, Photorhabdus can be detected in the hemolymph following a lag that may be as short as 30 minutes (Wang et al., 1995). Importantly, the time-frame of this interval does not appear to be perfectly consistent or essential for the success of an infection. In Drosophila, symbiont release generally occurred within an hour, but in one instance, septicemia was observed six hours after infection despite the fact that at 2 hours, the nematode had still not released its bacteria (Dziedziech et al. 2020a). While the degree to which host species affect the timing of release is not known, IJs have been found to release their payload of ~50 colony forming units (CFU) in response to a wide variety of arthropod hemolymph preparations, but not in response to Photorhabdus cell culture supernatants or human blood (Ciche & Ensign, 2003). This number of bacteria is generally more than sufficient for overwhelming the host, as an LD50 of less than 10 cells has been recorded for

Photorhabdus injected directly into the hemolymph of Galleria mellonella (Milstead,

1979). The effective population of bacteria may also be much smaller, as virulence is believed to stem from a subpopulation that is capable of antimicrobial peptide (AMP) resistance (Mouammine et al., 2017). The array of host-active factors that make this degree of virulence possible includes a large assortment of lipases, proteases, and toxin complexes (Li et al., 2007), though a number of products or strategies can be highlighted.

Two Photorhabdus compounds that have been studied in comparatively more detail are

8 the pH-sensitive red pigment anthraquinone and the antibiotic hydroxystilbene

(Richardson et al., 1988). Based on activity in the Lepidopteran Manduca sexta, hydroxystilbene is capable of suppressing the insect phenoloxidase response

(Eleftherianos et al., 2007), and alternatively functions as an antibiotic. There has been some debate about whether the antibiotic activity of hydroxystilbene is responsible for the generation of a monoculture in the insect carcass, but regardless, the compound can be detected in wet Galleria mass at a concentration that is sufficient for the inhibition of relevant soil bacteria and fungi (Hu and Webster, 2000). Anthraquinone may similarly play multiple roles, as anthraquinones have been implicated in the repulsion of ants and birds, antimicrobial activity, cytostatic activity, and the inhibition of the oxidation reaction required for phenoloxidase activity (Pankewitz and Hilker 2008; Zeng et al.,

2020). Additionally, Photorhabdus can directly suppress the insect immune system through interference with the activity of phospholipase A2 (PLA2), which is responsible for the synthesis of eicosanoid precursors (Kim et al., 2005). Eicosanoids participate in the regulation of both the cellular and humoral immune responses (Stanley and Kim,

2019), so the interruption of eicosanoid production could limit the ability of the insect to respond to both the nematode and its symbiont.

The entomopathogenicity of Photorhabdus is in some cases crucial to infection success, where axenic nematodes have been found incapable of killing Galleria larvae when applied at a rate of 30 IJs per larva, even when approximately half of those IJs reach the hemocoel (Han and Ehlers, 2000). In other contexts, the omission of bacteria has a less dire result, and in both M. sexta and Drosophila larvae, axenic nematodes are capable of killing the host, even if less reliably or quickly (Eleftherianos et al., 2010;

Hallem et al., 2007). These types of studies are, however, mainly useful for making statements about the virulence capacities of the nematode without its symbiont, as the ability of an axenic nematode to kill the host becomes irrelevant in light of the fact that it cannot complete its life cycle in the absence of Photorhabdus (Akhust et al., 1996).

While axenic Heterorhabditis nematodes will reproduce to a limited degree, they will not develop beyond L1 larvae (Han and Ehlers, 2000). In this regard, H. bacteriophora is inseparable from Photorhabdus, but the host-parasite interactions between Drosophila and the nematode itself cannot be ignored, given that the IJ must survive without the benefit of Photorhabdus virulence factors during the early phase of the infection.

Host detection and immune signaling

The mechanism by which the host recognizes the nematode and mobilizes an immune response appears to be more complex than the activity of a dedicated pattern recognition receptor. Identifying the mode of recognition has proven difficult, due in part to the diffuse signaling activity induced by nematode infection. To a degree however, the question of how exactly a nematode is recognized is obviated by the fact that sterile injury alone is sufficient for the differentiation of lamellocytes, which are responsible for parasite encapsulation (Márkus et al., 2005). Alternatively, insects are likely to be capable of nematode recognition, even in a general sense, based on findings showing the upregulation of c-type lections, peptidoglycan recognition protein (PGRP), and a chitin- binding protein in response to nematode infection (Aliota et al., 2007; Yadav et al.,

2017). Furthermore, in the mosquito Armigeres subalbatus, a beta 1-3 glucan recognition protein that is upregulated following exposure to the nematode Dirofilaria immitis, binds

10 to the nematode, and promotes its melanotic encapsulation (Wang et al., 2005). Notably, this binding was non-specific, and if this generalist approach to immune activation is common among insects, it is likely that there does not exist a response directed specifically at nematodes as much as a response to non-self. Regardless, the branches of immunity that are activated in response to a nematode can be described and their efficacy against the parasite evaluated.

The two most thoroughly described immune pathways in Drosophila are the immune deficiency (Imd) and Toll pathways, which are primarily responsible for the production of antimicrobial peptides in response to Gram-negative and Gram-positive bacteria, respectively (Myllymäki et al., 2014; Valanne et al., 2011). The AMPs produced by these pathways are unlikely to have significant effects against a multicellular parasite, but their impact on an infection can still be considered with regard to their effect on

Photorhabdus. As mentioned previously, the effective population of bacteria released by the nematode is resistant to antibiotics, but the degree of AMP production may impact what proportion of the initial bacterial population survives and how rapidly septicemia is achieved. Based on studies of the Drosophila transcriptional response following exposure to H. bacteriophora, the fly upregulates Diptericin, Metchnikowin, and Cecropin in response to both axenic and symbiotic nematodes (Castillo et al., 2013). Notably however, M. sexta Cecropin is expressed at lower levels in response to axenic nematodes than symbiotic (Eleftherianos, 2010), indicating that the insect does not extrapolate or anticipate the presence of bacteria from the presence of a nematode alone. The contribution of these pathways is also not limited to the production of AMPs. They appear to be intertwined with other branches of the immune response in ways that are not

11 yet fully understood, including, for example, the interaction between the Imd pathway and eicosanoid signaling (Yajima et al., 2003). With this in mind, the AMP-regulating pathways can also be considered in relation to their ability to support the activity of the other branches of the immune response. One example of this effect is that for infections of Drosophila larvae with symbiotic H. bacteriophora, mutants lacking both phenoloxidase and Imd activity are more susceptible than those lacking either individually (Hyrsl et al., 2011). The Toll pathway is likewise linked to melanization in that gain-of-function mutations in Toll result in spontaneous melanization (Ligoxygakis et al., 2002).

Aside from Imd and Toll, some pathways relevant to both immunity and development are upregulated in response to nematode infection, namely Wnt and Janus kinase (JAK)-signal transducer and activator of transcription (STAT)(Arefin et al., 2014;

Castillo et al., 2013). Presently, little can be said of Wnt other than that it regulates intestinal stem cell proliferation following damage (Cordero et al., 2012), but more can be attributed to JAK/STAT by virtue of work describing the Drosophila response to endoparasitoid wasps. The JAK/STAT pathway is also activated in that context, and furthermore if mutated, the lack of proper JAK/STAT signaling results in a reduced encapsulation response (Yang et al., 2015; Sorrentino et al., 2004). Following the injection of parasitoid eggs, upd2 and upd3 are expressed in circulating hemocytes, which activates JAK/STAT signaling in the somatic musculature and then the differentiation of lamellocytes (Yang and Hultmark, 2016). The activation of JAK/STAT in circulating hemocytes alone is also sufficient for lamellocyte production (Zettervall et al., 2004).

Interestingly, Toll pathway activity appears to enhance this process, and while it is not

12 necessary for lamellocyte formation, the contribution of Toll signaling does decrease the success of parasitoid infection (Schmid et al., 2014).

The cellular host response against nematode parasites

The Drosophila response to large foreign bodies is a hemocyte-based encapsulation process in which plasmatocyte and lamellocyte hemocytes bind to the invading organism, enclose it in a capsule, and expose it to the toxic byproducts of prophenoloxidase (PPO) activation (Lavine and Strand, 2008). Successfully encapsulating an EPN is of dire importance for the survival of the insect. The Colorado potato beetle, Leptinotarsa decemlineata, shows increased resistance to some EPNs and is capable of surviving hemocoel invasion by up to 9 S. carpocapsae IJs, but if a single IJ escapes encapsulation, the host succumbs to infection (Thurston et al., 1994).

Importantly, it is unlikely that the targeting of encapsulation is based on specific recognition of parasitic nematodes, as this response will also target free-living nematodes as well as synthetic beads (Ono and Yoshiga, 2019; Mastore and Brivio, 2008).

Formation of the melanotic capsule is a fairly rapid response that can begin within 30 minutes, initiated in Lepidopterans by opsonic factors and chemotractic plasmatocyte- spreading peptides (PSPs) that promote the recruitment of plasmatocytes and their adhesion to the foreign body (Brivio and Mastore, 2018). The activity of PSPs also receives regulatory inputs from both eicosanoid and ecdysone signaling, indicating coordination with other branches of immunity (Srikanth et al., 2011) and potential targets for immune suppression by the parasite. Here, the ability of PSPs to initiate spreading may be of particular interest during a Heterorhabditis infection due not only to their role

13 in encapsulation, but also because interfering with PSP expression in M. sexta is sufficient to accelerate killing by Photorhabdus (Eleftherianos et al., 2009). Less information is available about the initiation of this process in Drosophila, though the cytokine growth-blocking peptide (GBP) appears to play a similar role in promoting plasmatocyte spreading and likewise in response to eicosanoid signaling (Tsuzuki et al.,

2014). Better understood in Drosophila is the activity of phenoloxidase, which oxidizes phenols into the quinones that subsequently polymerize to form melanin (Binggeli et al.,

2014). The deposition of this melanin onto the hemocyte capsule containing the pathogen creates a more established physical barrier and a means of locally sequestering toxic compounds with the pathogen (Dudzic et al., 2015). Evidence has shown that this process is relevant to EPN infections. The Drosophila prophenoloxidase genes PPO1 and PPO3 are both upregulated in response to S. carpocapsae infection, and both contribute to the survival of the insect (Cooper et al., 2019). Interestingly, the melanization process may also be synchronized to the initiation of plasmatocyte spreading. The release of prophenoloxidase from crystal cells requires the c-Jun N-terminal kinase (JNK) pathway and GBP activates JNK signaling through an association with Imd (Bidla et al., 2007;

Tsuzuki et al., 2012). More work is required to confirm this link, but findings support that encapsulation and melanization are both crucial for the insect immune response to EPNs and rich with potential targets for interference.

The outcome of an encapsulation response may depend on a number of other immune effectors, including clotting factors like transglutaminase (Hyrsl et al., 2011), but their ultimate value is still likely their capacity to enable encapsulation, especially if this prevents release of the symbiotic bacteria. Regardless, the entirety of factors contributing

14 to encapsulation may be targets for suppression by the nematode, and there is evidence that Heterorhabditis is capable of suppression or evasion. It bears mentioning that while

S. carpocapsae is susceptible to encapsulation by L. decemlineata, Heterorhabditis marelatus kills prepupae of these beetles with near certainty and IJs are encapsulated in only 1.6% of cases (Armer et al., 2004).

Evasion of immunity by the nematode

A number of lines of evidence indicate that entomopathogenic nematodes produce both toxic and immunosuppressive factors. Some of this evidence is indirect yet fundamental, including host-based differences in how the encapsulation of an IJ is initiated. In the vine weevil Otiorhynchus sulcatus, the encapsulation of two Steinernema species is initiated at the head and tail of the nematode, presumably in order to prevent the release of the symbiotic bacteria (Steiner, 1996). In L. decemlineata however, hemocyte binding begins at the esophageal region, which is more likely due to that being the location of the secretory-excretory pore, and by physically blocking it, the hemocytes may prevent the release of secretions by the nematode (Ebrahimi et al., 2011). Another line of indirect evidence is the variation in host susceptibility to individual species of nematode, as well as the virulence disparities between strains of the same species (Rosa and Simoes, 2003). If recognition by the host is more or less indiscriminate and the immune response is uniform, then virulence should be the same except in the presence of variable immunosuppressive or virulence repertoires.

The available catalog of immunomodulatory factors from EPNs is not meager, though it does tend to overrepresent effectors from Steinernematids. Largely, this follows

15 understandably from observations that nematodes of this genus are more virulent against commercially available or experimentally relevant hosts, including G. mellonella and D. melanogaster (Han and Ehlers, 2000; Peña et al., 2015). These differences in virulence almost certainly indicate that Steinernematids and Heterorhabditids employ different immunomodulatory arsenals, but regardless, knowledge of effectors from S. carpocapsae and related species can provide general information about the kinds of mechanisms that succeed in an insect host. One general strategy is curation of the surface coat (Blaxter et al., 1992). In particular, interactions between the surface of the IJ and the hemolymph environment appear to be particularly important for both Steinernema glaseri and

Steinernema feltiae. The surface coat protein SCP3a from S. glaseri impeded encapsulation of the IJ in the Japanese beetle Popillia japonica, and interestingly it also protected H. bacteriophora when co-injected into the hemocoel (Wang and Gaugler,

1999). Surface cuticular lipids from S. feltiae also associate with components of host hemolymph and likewise prevent recognition by hemocytes, possibly due to a camouflage effect (Mastore and Brivio, 2008). Furthermore, the removal of low molecular weight compounds from the hemolymph by S. feltiae cuticular lipids was associated with an incapacity of the host to clear bacteria from the hemolymph, and treatment of the nematodes with lipase eliminated both of these effects (Brivio et al.,

2006). The injection of cuticle fragments from the IJ were also shown to inhibit phenoloxidase activity (Brivio et al., 2002), demonstrating that immune suppression by S. feltiae is impressively broad, spanning the major immune mechanisms of insect hosts.

Alternatively, another set of studies focused on S. carpocapsae have outlined properties of products secreted from the nematode. The exudates of IJs prevent hemocyte adhesion,

16 increase dissociation from hemocyte monolayers, and inhibit the hemolymph-based clearance of bacteria (Walter et al., 2008). Concentrated excretory-secretory (ES) products are also lethal, showing that the nematode does not rely entirely upon its symbiont to kill the host (Lu et al., 2017), and mass spectrometry identified a proportion of ES products that are shared between S. carpocapsae and S. feltiae (Chang et al., 2019).

Though most work on EPN virulence factors has been conducted on

Steinernematids, the inclusion of H. bacteriophora may be of benefit the field given that in some agriculturally relevant hosts, H. bacteriophora shows more potential for biocontrol than its Steinernema counterparts (Toepfer et al., 2005). Heterorhabditids may also have unique virulence mechanisms, based on the particular way they advance through an infection. In L. decemlineata for instance, while encapsulated S. carpocapsae appear to be killed by the immune response within 4 hours, H. bacteriophora are encapsulated, but survive the process through 48 hours (Ebrahimi et al., 2011). This would require an ability to resist or prevent the generation of reactive oxygen species stemming from phenoloxidase activity, possibly by way of an effector similar to the disulfide isomerases produced by the phytoparasite Meloidogyne graminicola (Tian et al.,

2019). Recently, H. bacteriophora ES products have also been shown to inhibit phenoloxidase activity in G. mellonella larvae (Eliáš et al., 2020), showing that an examination of these products for effectors is likely to be fruitful.

Dissertation overview and structure

The work presented in this thesis was designed to generate fundamental descriptions of the virulence capacities of the entomopathogenic nematode

Heterorhabditis bacteriophora. In particular, I sought to characterize the immunomodulatory properties of parasite excreted-secreted products in a Drosophila melanogaster model host and determine whether these effects could be attributed to individual factors from the H. bacteriophora transcriptome. Three experimental chapters have been included to elaborate on the progress made toward these aims.

Chapter 1: ‘Heterorhabditis bacteriophora excreted-secreted products enable infection by Photorhabdus luminescens through suppression of the Imd pathway’

Here we provide evidence that the bulk excreted-secreted products of H. bacteriophora impede the proper activation of the Drosophila Imd pathway. We then show this suppression is severe enough to allow an infection by Photorhabdus to progress more rapidly. The completed manuscript has been published in Frontiers in

Immunology (Kenney et al. 2019)

Chapter 2: A putative UDP-glycosyltransferase from Heterorhabditis bacteriophora suppresses antimicrobial peptide gene expression and factors related to ecdysone signaling

The work presented in this chapter demonstrates that a UDP-glycosyltransferase

(UGT) from the hemolymph-activated transcriptome of H. bacteriophora functions as a virulence factor in a manner similar to UGTs from entomopathogenic baculoviruses. This chapter has been published in Scientific Reports (Kenney et al. 2020)

Chapter 3: A putative lysozyme and serine carboxypeptidase from Heterorhabditis bacteriophora show differential virulence capacities in Drosophila

This chapter consists of a characterization of two putative virulence factors from

H. bacteriophora based on their effects on the immune response of Drosophila.

Furthermore, the ability of this group of assays to distinguish between immune effects of these virulence factors is presented as a means of categorizing groups of virulence gene candidates for downstream application. This chapter has been accepted for publication at

Developmental and Comparative Immunology

Chapter 1: Heterorhabditis bacteriophora excreted-secreted products enable infection by Photorhabdus luminescens through suppression of the Imd pathway*

ABSTRACT

Upon entering the hemocoel of its insect host, the entomopathogenic nematode

Heterorhabditis bacteriophora releases its symbiotic bacteria Photorhabdus luminescens, which is also a strong insect pathogen. P. luminescens suppresses the insect immune response independently following its release, but the nematode appears to enact its own immunosuppressive mechanisms during the earliest phases of an infection. H. bacteriophora was found to produce a unique set of excreted-secreted proteins in response to host hemolymph, and while basal secretions are immunogenic with regard to

Diptericin expression through the Imd pathway, host-induced secretions suppress this expression to a level below that of controls in Drosophila melanogaster. This effect is consistent in adults, larvae, and isolated larval fat bodies, and the magnitude of suppression is dose-dependent. By reducing the expression of Diptericin, an antimicrobial peptide active against Gram-negative bacteria, the activated excreted- secreted products enable a more rapid propagation of P. luminescens that corresponds to more rapid host mortality. The identification and isolation of the specific proteins responsible for this suppression represents an exciting field of study with potential for enhancing the biocontrol of insect pests and treatment of diseases associated with excessive inflammation.

*This Chapter has been published in Frontiers in Immunology (2019), 10: 2372 20

INTRODUCTION The early steps of a Heterorhabditis bacteriophora infection are well described with regard to the physical actions of the parasite. Upon migration to a host, the majority of the infective juveniles (IJ) enter the insect through natural openings, although the IJ can generate tears in the intersegmental membrane to gain entry (Poinar and Georgis,

1990). Once the parasite enters the hemocoel environment, the nematode slowly releases, following a 30-minute lag time, the bacterial endosymbiont Photorhabdus luminescens that it maintains as a secondary phase in its gut (Ciche and Ensign, 2003). When considering the molecular host-parasite interactions that determine the success of an infection after IJ entry, Photorhabdus often draws a substantial amount of interest due to its assortment of proteases and other factors that can suppress the insect immune response and lead to rapid death. However, it is crucial to recall that axenic nematodes are still capable of inciting insect mortality without their symbiont (Hallem et al., 2007).

Furthermore, numerous reports have shown that the immune-based neutralization of the nematode is possible. While IJs evade encapsulation in Tipula oleracea, Popillia japonica, and Cyclocephala borealis (Peters et al., 1997; An et al., 2012), the Colorado potato beetle Leptinotarsa decemlineata prevents IJ development through encapsulation, in which the process of hemocyte attachment to the parasite begins as quickly as 15 minutes after entry, a period comfortably preceding the release of bacteria (Ebrahimi et al., 2011). Generally, the degree of melanization and encapsulation of the IJ correlates with the survival of the insect (Li et al., 2007), so the nematode must to some degree fare for itself in terms of immune suppression during the early phase of an infection.

Additionally, Heterorhabditis has a vested interest in promoting Photorhabdus survival,

21 so some early IJ-based immune suppression may also be targeted toward developing a more hospitable hemolymph environment for its symbiont.

Much of the work centered on the entomopathogenic nematode infection process has used Steinernema carpocapsae. A pair of serine protease inhibitors from this nematode impair hemocyte aggregation, prevent clotting fibers from forming properly, inhibit the digestive enzymes of the host, and prevent the inclusion of melanin into clots formed in the hemolymph (Toubarro et al. 2013a; Toubarro et al. 2013b). The bulk secreted proteins are also lethal when injected into Drosophila melanogaster adult flies

(Lu et al., 2017), clearly indicating that the nematode plays a strong role in the molecular aspect of the infection aside from merely releasing its symbiotic bacteria. Less is known about the activity of the specific molecules produced by H. bacteriophora, but genome and transcriptome studies have predicted a variety of secreted factors (Vadnal et al.,

2017; Bai et al., 2013) and genes for a putative metalloprotease, enolase, and chitinase have been implicated in parasitism specifically (Hao et al., 2012). Genes for C-type lectin and catalase are upregulated upon activation of the nematode, where the former is believed to function in immune evasion and the latter in protecting the parasite from free radicals. Both are expressed in other parasitic helminths, with the lectin being found in a range of nematodes from Meloidogyne javanica to Ancylostoma ceylanicum (Moshayov et al., 2013).

The molecular effects of an H. bacteriophora infection are likely the product of a collection of these effectors fulfilling a variety of roles, each of which is important for understanding the host-parasite relationship, but a number of practical applications await the identification of specific individual factors. Autoimmune disease, for instance, is

22 believed to be exacerbated by the loss of natural associations with helminth parasites, and individual immunosuppressive factors isolated from nematodes could be effective treatments for conditions like Crohn’s disease, asthma, or multiple sclerosis due to their specificity of action and tolerability (Shepherd et al., 2015). Entomopathogenic nematodes (EPNs) including H. bacteriophora are also currently used as biocontrol agents against insect pests (Labaude and Griffin, 2018), and manipulating these nematodes to make them more effective parasites could increase their efficacy. Other

EPNs including S. carpocapsae are also viable options for biocontrol, but it is important to consider that not every EPN is as successful as others against a given host. When infecting the carob moth Ectomyelois ceratoniae, S. carpocapsae is dramatically more adept at overwhelming the host, with an LC50 of 2.02 IJs per larva as opposed to the

426.92 IJs required for the same activity by H. bacteriophora (Memari et al., 2016).

When infecting the tomato leaf miner Tuta absoluta, however, H. bacteriophora is just as effective if not more so than S. carpocapsae (Kamali et al., 2018). With this in mind, an optimal approach to developing strong biocontrol would not ignore either species.

Here we examine the immunosuppressive effects of H. bacteriophora bulk secretions on the Drosophila melanogaster immune system, and depict the degree to which this suppression compromises the insect with regard to susceptibility to a bacterial infection. Because the nematode’s symbiont P. luminescens is such a strong pathogen, we hypothesize that the organisms have polarized each other’s role in the infection and H. bacteriophora has become more specialized for immune suppression during the early phases of an infection for the benefit of the nematode as well as its symbiont.

MATERIALS AND METHODS

Insect and bacterial strains Galleria mellonella larvae were acquired from Petco and Manduca sexta from

DBDPet. Fly stocks were maintained on a cornmeal-soy-based diet (Meidi laboratories) with added baker’s yeast and incubated at 25°C on a 12-hour day-night cycle. The

Drosophila melanogaster lines used included Oregon R for P. luminescens survival experiments, phagocytosis assays, and gene expression analyses, w1118 for survival experiments with triple-concentrated ES product and Escherichia coli co-injections,

RelE20 for the E. coli co-injection assays, and the Diptericin(Dpt)-GFP line T4202 (III) for the transcriptional activation assay. Bacterial strains included Photorhabdus luminescens subspecies laumondii, strain TT01, the E. coli strain K12, and the RET16 derivative of the Photorhabdus temperata strain NC1. Photorhabdus strains were cultured on

MacConkey Agar (Sigma) at 28°C for a period of 48 hours at which point a single colony was used to inoculate an overnight liquid culture in 10 mL of Lysogeny Broth (LB) media (VWR) incubated at 28°C in a rotary shaker set to 220 rpm. E. coli was cultured in a similar fashion, but initial growth on agar was carried out on LB agar at 37°C overnight.

Culturing axenic Heterorhabditis bacteriophora infective juveniles Infective juveniles of the rhabditid nematode Heterorhabditis bacteriophora strain

TT01 were maintained axenically through propagation in G. mellonella larvae carrying well-established infections of RET16. To establish the infection, 1 mL of an overnight

RET16 culture was centrifuged for 3 mins at 13,000 x g, the supernatant discarded, and

24 the pellet washed once with sterile phosphate buffered saline (PBS). The resulting bacterial suspension was centrifuged again and resuspended, at which point the suspension was diluted 1:10 with sterile PBS, to a final volume sufficient for the injection of 50 µL of bacterial solution into the desired number of 5th to 6th instar G. mellonella larvae. To perform larval injections, G. mellonella larvae were surface-sterilized by brief submersion in a 70% solution of ethanol. The larvae were placed on ice for a period of 20 mins in a 100 x 15 mm petri dish furnished with moistened 90 mm filter paper. Injections were performed with a 1 mL tuberculin syringe and 22G needle inserted in the intersegmental region at as shallow an angle as possible. Larvae were left on ice for 5 mins post-injection and then kept at room temperature for one week. Successful RET16 infection caused the larva to die and turn the brick red color typical of a Photorhabdus infection. Those that did not display the appropriate color were discarded. After one week, H. bacteriophora IJs were pelleted, surface sterilized with a 3% bleach solution for

5 mins, and washed twice with sterile water prior to their liberal application onto the infected G. mellonella at a concentration of approximately 500 IJs per larva. This secondary infection was allowed to progress in the dark at room temperature for 8 days at which point the larvae were transferred to white traps for the collection of emerging IJs in autoclaved water supplemented with 0.01% Tween 20 (White, 1927). To confirm that the

IJs were axenic, an aliquot of the surface-sterilized, putatively axenic IJs was used to infect G. mellonella larvae, and the larvae monitored for coloration indicative of an infection and support for the growth and reproduction of the IJs. IJs were considered axenic if they failed to produce red pigmentation in larvae or propagate successfully as compared to a surface-sterilized symbiotic IJ control.

Preparation of hemolymph from Manduca sexta Approximately 500 µL of raw hemolymph was collected from each 5th instar

Manduca sexta larva. Prior to extraction, each larva was placed on ice for a period of 20 mins. The area surrounding the posterior horn of the insect was treated with a 70% alcohol wipe just prior to the severing of the horn with microdissection scissors. This was performed directly over a 1.5 mL autoclaved microcentrifuge tube, as the release of hemolymph from the site of injury is rapid and immediate. To prevent melanization, an aliquot of 20 mM phenylthiourea dissolved in PBS was added to each aliquot of hemolymph to a final concentration of 0.33 mM. The extracted hemolymph was centrifuged for 5 min at 4000 x g and 500 µL of the resulting supernatant was added to

500 µL of ice-cold Ringer’s buffer (100 mM NaCl, 1.8 mM KCl, 2mM CaCl2, 1mM

MgCl2, and 5 mM HEPES adjusted to a pH of 6.9) in a separate sterile 1.5 mL microcentrifuge tube. For long-term storage, samples were frozen at -80°C. Before use, hemolymph was thawed on ice, diluted 1:1 in ice-cold Ringer’s buffer, and filtered with a

0.45 µm syringe filter. Ampicillin and kanamycin were added to diluted hemolymph plasma solutions at concentrations of 100 µg/mL and 50 µg/mL, respectively.

Hemolymph activation of infective juveniles and isolation of concentrated ES products Prior to activation, IJs were sedimented in aliquots of 200,000 and surface- sterilized with 3% commercial bleach in 10 mL of 0.01% Tween 20, resulting in a final hypochlorite concentration of 0.26%. Bleach-treated IJs were pelleted by centrifugation for 30 seconds at 1300 x g and washed twice with sterile Ringer’s solution containing

0.01% Tween 20. After the second wash step, IJs were pelleted and resuspended in either

10 mL of the 25% hemolymph plasma solution (activated) or 10 mL of Ringer’s-Tween

(non-activated) containing antibiotics. The IJ suspensions were transferred to T75 tissue culture flasks, which were subsequently wrapped in foil and placed in a shaking incubator at 27°C and 200 RPM. Following a 20-hour incubation, the IJs were transferred to 15 mL conical tubes, centrifuged, and washed ten times with 10 mL of Ringer’s-Tween 20 solution. Following the final wash, the IJs were resuspended in 10 mL of Ringer’s solution without Tween 20. These tubes were wrapped in foil and returned to the incubator for 5-hours at 27°C and 200 RPM to collect ES products. After incubation, the supernatants were removed and placed in a separate sterile 15 mL conical tube. The collected ES products were either stored at -80°C or immediately concentrated. To concentrate the collected products, ES products were filtered through a 0.2 µm low protein-binding syringe filter (Millex) and transferred to a new sterile 15 mL conical tube. Filtered products were added to a Vivaspin 6 tube (GE Healthcare) with a 3 kDa molecular weight cutoff, with aliquots of each treatment being added sequentially to the tube as sufficient volumes of solution cleared the filter. Concentration was allowed to continue until the volume of the retentate fell below 100 µL, at which point the solution was collected and supplemented with additional sterile Ringer’s buffer to a final volume of 100 µL. For the triple-concentration of ES products, the same protocol was followed except that the ES products were initially distributed between two Vivaspin tubes, and the final 500 µL from each tube pooled and concentrated in a single tube until the volume was below 100 µL. ES concentrations were expressed as larval equivalents (LE/µL) by dividing the number of IJs used by the final volume of ES products.

Protein electrophoresis Protein concentration of the ES products was quantified using a Pierce BCA

Protein Assay Kit (Thermo Scientific) according to the manufacturer’s instructions. For samples that produced a readable concentration of protein above the threshold sensitivity of the BCA assay, 6 µg of protein were loaded into a Novex WedgeWell 4-20% Tris-

Glycine Gel (Invitrogen) following reduction in 50 mM DTT. For samples not producing a readable signal for protein concentration, the maximum volume was added to the gel.

The final volume added to each well included 26 µL of sample and water, 4 µL of the reducing agent, and 10 µL of Laemmli buffer. Protein size was demarcated with

PageRuler Plus Prestained Protein Ladder (Thermo Scientific) and gels were stained with a Pierce Silver Stain for Mass Spectrometry kit (Thermo Scientific).

Injection of Drosophila melanogaster adults and larvae For survival and gene expression analyses, treatments were loaded into an oil-filled pulled glass capillary mounted on a Drummond Nanoject III Programmable Nanoliter

Injector. Adult flies aged seven to ten days were anesthetized with carbon dioxide and injected intramesothoracially with 69.0 nL of ES products or buffer, corresponding to 138

IJ equivalents of ES products, or 414 for triple-concentrated products. Injected flies were returned to vials containing instant Drosophila medium (Carolina Biological) and kept at

25°C on a 12-hour day-night cycle. Flies injected for gene expression analysis at a 6-hour time point were consistently injected in the late morning to alleviate effects attributable to natural variability arising from the circadian cycle. Wandering 3rd instar larvae were

28 injected with 50.2 nL of ES products, representing approximately 100 IJ equivalents.

Each insect was washed once with Ringer’s solution upon removal from their original vial. Larvae were anesthetized with carbon dioxide for 2-3 mins before transfer to moist filter paper for injection. In order to ensure accurate, consistent injections, larvae were secured at the posterior end with forceps and injected at a shallow angle in an intersegmental region of the dorsal side of the abdomen to avoid damage to the organs or imaginal discs. Larvae were returned to a fresh petri dish furnished with filter paper moistened with Ringer’s solution and incubated under the same conditions.

qRT-PCR analysis for immune gene expression At the indicated time points, 5 adult flies (3 males and 2 females) or 5 larvae were collected in duplicate and total RNA was extracted using TRIzol reagent (Ambion, Life

Technologies). Reverse transcription was carried out using a High-Capacity cDNA

Reverse Transcription Kit (Applied Biosystems) and 1 µg of RNA template. The subsequent RT-PCR reactions were performed in a CFX96 Real-Time System, C1000

Thermal Cycler. The reactions themselves consisted of 10 µL of GreenLink No-ROX qPCR Mix (BioLink), 40 ng of cDNA template, forward and reverse primers at a final concentration of 200 nM, and ultrapure water to a final volume of 20 µL. Cycle conditions were as follows: 95°C for 2 min, 40 repetitions of 95°C for 15 s followed by

61°C for 30 s, and then one round of 95°C for 15 s, 65°C for 5 s, and finally 95°C for 5 s.

The primer sets used for amplification included those for Diptericin (F: 5'

GCTGCGCAATCGCTTCTACT 3'; R: 5' TGGTGGAGTTGGGCTTCATG 3'),

Cecropin (F: 5' TCTTCGTTTTCGTCGCTCTC 3'; R: 5'

CTTGTTGAGCGATTCCCAGT 3'), Drosomycin (F: 5' GACTTGTTCGCCCTCTTCG

3'; R: 5' CTTGCACACACGACGACAG 3'), mcf1 (F: 5'

AAGGAGGTCAATGCTCGCTAC 3'; R: 5' GACACAACTAATCTGCCGTTCTC 3'),

P. luminescens 16S rRNA (F: 5' ACAGAGTTGGATCTTGACGTTACCC 3'; R: 5'

AATCTTGTTTGCTCCCCACGCTT 3'), and the constitutively-expressed ribosomal protein-encoding gene rp49 (F: 5' GATGACCATCCGCCCAGCA 3'; R: 5'

-ΔΔC CGGACCGACAGCTGCTTGGC 3'). Fold change was calculated using the 2 T method (Livak and Schmittgen, 2001; Schmittgen and Livak 2008) with all values being normalized to rp49. Graphs show fold change for each treatment over 0-hour expression and error bars represent standard error applied to ΔΔCt values prior to conversion to a log scale. Statistical analysis was performed with a one-way ANOVA for ΔΔCt values accumulated from 3 biological replicates with two technical replicates each.

Fat body dissection and imaging for ES-injected Dpt-GFP larvae Larvae of the Dpt-GFP Drosophila line were injected with 50.2 nL of non-activated or activated ES products according to the aforementioned injection protocol. Following the 6-hour incubation period, the fat body was dissected out of the insect, but left attached to the body while the gut was removed completely. Tissues were fixed in PBT

(PBS containing 0.2% Triton X-1000) with 4% paraformaldehyde for a period of 30 min.

Three 10-minute washes in PBT were performed followed by a 30-minute incubation with TRITC (Molecular Probes) diluted 1:100 in PBS. After washing once with PBS, the fat body tissues were removed from the insect carcass, cut into pieces small enough to lie flat on a slide, and mounted with Antifade mounting medium with DAPI (Molecular

Probes). Images were acquired with a Zeiss LSM 510 confocal microscope and corrected total fluorescence measurements were processed for isolated green channels using ImageJ software. Ten images were analyzed per treatment for each trial.

Co-injection of ES products with Escherichia coli and Photorhabdus luminescens Co-injection solutions were prepared by mixing ES products and bacterial suspensions such that each injection contained 310 larval equivalents of ES products and either approximately 8 x 104 CFUs of E. coli or 50 CFUs of P. luminescens. This was achieved by diluting cultures of E. coli (OD600 of 3.0) or P. luminescens (OD600 of 0.4)

1:4 in the triple-concentrated ES products. All solutions were mixed immediately prior to use and injected using the same injection protocol. For consistency, control treatments were likewise comprised of PBS diluted 1:4 in Ringer’s solution.

Quantification of phagocytic activity Phagocytic activity was assessed by measuring fluorescence following the injection of pHrodo Red E. coli BioParticles Conjugate for Phagocytosis (Molecular Probes). A 4 mg/mL suspension of pHrodo particles was diluted 1:4 in ES products such that each co- injection contained 310 larval equivalents in a 1 mg/mL solution of pHrodo particles.

Upon injection, flies were incubated at 25°C for 1 hour at which time the dorsal side of the abdomen associated with the pericardial nephrocytes was imaged using a Nikon

ECLIPSE Ni microscope at 10x magnification with a Zyla (ANDOR) 5.5 camera.

Corrected total fluorescence was measured using ImageJ software.

Statistical analysis All statistical analyses were performed using GraphPad Prism 5 software. Gene expression analyses and CTF measurements for the phagocytosis assay were compared using a one-way ANOVA and Bonferroni multiple comparisons test to determine differences between specific treatments. Significance for CTF measurements for the Dpt-

GFP assay was determined with a Student’s t-test, and survival curves were assessed using a Log-Rank (Mantel-Cox) test. All analyses were performed on data accumulated through three independent experiments.

RESULTS

Exposure of Heterorhabditis bacteriophora infective juveniles (IJs) to host hemolymph induces the secretion of unique proteins To investigate the proteins secreted in response to host stimulus, groups of 200,

100, or 25 thousand (k) H. bacteriophora IJs were activated as previously described

(Vadnal et al., 2017). IJs were activated for 20 hours by incubation in 25% Manduca sexta hemolymph diluted in Ringer’s buffer, washed several times, and transferred into fresh Ringer’s buffer without hemolymph to collect ES products. This activation time point was selected based on preliminary experiments in order to optimize as closely as possible an in vitro activation that may be only minimally informed by knowledge of in vivo activation kinetics. Filtered collection buffer was subsequently concentrated by ultrafiltration through a 3 kDa cutoff membrane, which restricts the analysis to proteins rather than small molecules. Activated batches of 200, 100, and 25k IJs yielded 286, 216, and 39 ng/μL of protein, respectively, whereas protein was undetectable in ES products collected from similar numbers of non-activated IJs incubated in Ringer’s throughout. To

32 visualize proteins present in the ES products, 6 μg of activated ES products were separated by SDS-PAGE and silver stained (Figure 1). The maximum volume of non- activated ES products (26 μl) were used because protein was undetectable. A comparison of the lanes shows that certain species of protein are unique to the ES products of activated nematodes, with two conspicuous examples in the activated 200K lane at estimated molecular weights of 21.2 and 18.9 kDa. Importantly, these proteins are absent from the M. sexta hemolymph, confirming that the extensive washes following the 20- hour incubation removed residual hemolymph. This indicates that H. bacteriophora IJs specifically release a unique suite of proteins in response to hemolymph exposure.

Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products elicit differential Diptericin responses that are consistent across Drosophila melanogaster life stages The effects of concentrated ES products on the immune response of Drosophila were first examined in the context of the antimicrobial peptide (AMP) response. Imd and

Toll pathway activity was assessed in flies by examining the expression of Diptericin and

Drosomycin, respectively, following the injection of 69.0 nL of the highest concentration of ES products, a volume equivalent to the excretory/secretory output of 138 IJ.

Expression was also assessed in larvae though with a lower injection volume of 50.2 nL, corresponding to approximately 100 IJ equivalents. Both adult flies and larvae were collected at a 6-hour time point following ES injection, which was chosen to capture expression during peak Imd activity. Drosomycin transcript, as measured by qPCR, was not significantly altered by the injection of activated or non-activated ES products, and notably the products also failed to elicit a response at the 24-hour time point known to

33 correlate to peak Toll pathway activity (data not shown). Conversely, Diptericin was significantly upregulated by injection of non-activated ES products compared to the

Ringer’s buffer control injection. However, injection of activated ES products failed to increase Diptericin expression above the Ringer’s buffer control injection, suggesting the presence of suppressive or non-immunogenic components in activated ES (Figure 2).

This pattern was observed in both adult flies and larvae, though on a slightly larger scale through all three treatments in larvae, possibly due to the primary immune organ, the fat body, being proportionally larger relative to body size in larvae. The immune response to a nematode infection minimally includes a strong Imd response, which is apparent through Diptericin expression, and the H. bacteriophora countermeasures to this activity are clearly capable of neutralizing the effect to levels associated with mere injury rather than infection.

Excretory-secretory product-based differential Diptericin responses originate at or prior to transcriptional activation To more precisely describe the effects of ES products on the regulation of

Diptericin, larvae of a Drosophila line carrying GFP under the control of the Diptericin promoter were injected with approximately 100 IJ equivalents of either activated or non- activated products, and collected for observation at a 6-hour time point. The fat body was dissected and imaged by confocal microscopy at 40x magnification. Fluorescence was clearly visible in all samples, though on average fat body samples that had been exposed to non-activated products were substantially brighter than those treated with activated ES products. This observation was confirmed by corrected total fluorescence (CTF) measurements of isolated green channels for each image (Figure 3). Because

34 fluorescence is a measure of promoter activation, the specific interaction that mediates the differential responses to activated and non-activated ES products can be posited to take place either at or upstream of transcriptional activation. These measurements also confirm that the differences seen in Diptericin expression are mediated at least in part by cells of the fat body.

Triple-concentrated activated Heterorhabditis bacteriophora nematode ES products are lethal to adult Drosophila melanogaster While the activated ES products clearly do not provoke as strong a Diptericin response as the non-activated products, the relative equivalence of the responses to

Ringer’s buffer and activated ES products makes it impossible to determine whether the activated nematode is secreting factors that suppress immunity or simply eliminating the production of factors that are immunogenic in the host. In an attempt to resolve this ambiguity, three separate batches of ES products produced with 200,000 IJs were concentrated together such that suppressive effects would be stronger, but the absence or masking of immunogenic compounds would not have compounding effects on Diptericin expression to limit upregulation below that evoked by a control injection. The increased potency of these products was immediately apparent, as injection of 414 IJ equivalents resulted in approximately 70% mortality over a period of 6 hours (Figure 4). Flies that survived the injection at the 6-hour time point were collected and Diptericin transcript levels measured. The 3x concentrated ES products significantly decreased the Diptericin response below that of the Ringer’s buffer alone, (Figure 5A), thus indicating that H. bacteriophora secretes factors capable of the specific suppression of Diptericin upregulation. The specificity of Diptericin suppression was examined by assessing the

35 response of a second Imd-responsive AMP, Cecropin, as well as the Toll pathway AMP

Drosomycin to the concentrated activated ES products. Injection of 414 IJ equivalents had no effect on either Cecropin (Figure 5B) or Drosomycin (Figure 5C) expression in adult flies.

Heterorhabditis bacteriophora nematode ES products promote mortality driven by both pathogenic and non-pathogenic bacteria While the specific suppression of Diptericin is significant, this result does not allow conclusions about whether the ES products released by H. bacteriophora are sufficiently immunosuppressive to augment a bacterial infection. To explore this possibility, adult flies were co-injected with a high inoculum of non-pathogenic Escherichia coli (8 x 104

CFUs) and approximately 310 IJ equivalents of activated ES products, non-activated ES products, or an equivalent volume of Ringer’s buffer. Tracking mortality every 12 hours for a period of 72 hours revealed that while Ringer’s buffer or non-activated ES products co-injected with E. coli were not lethal to flies, the injection of activated products and E. coli together (A+Ec) resulted in approximately fifty percent mortality in the first 24 hours

(Figure 6). Notably, this reduced dose (310 versus the lethal 414 IJ equivalents) of activated ES products no longer induces mortality, so the observed decrease in survival cannot be attributed to the previously noted lethality stemming from the products alone.

In the context of a natural H. bacteriophora infection, the bacteria of interest would be the natural symbiont of the nematode, Photorhabdus luminescens. The bacteria are released from the gut of the IJ shortly after entry into the hemolymph, and the possibility exists that the ES products may serve in part to prepare the hemolymph environment for a more successful infection by P. luminescens. This possibility was tested by similarly co-

36 injecting adult flies with approximately 310 IJ equivalents of ES products or an equivalent volume of Ringer’s buffer and 50 cells of P. luminescens. Time points were at

12 hours, then every hour from 24 to 33 hours, in order to capture the majority of mortality, and then once again at 48 hours. Survival curves revealed a slightly protective effect imparted by the non-activated ES products relative to the control injection, and when compared to co-injections with activated ES products, the lethality produced by the activated ES products and P. luminescens was significantly different from and effected earlier than that produced by the non-activated ES product co-injections (Figure 7). Even at a sublethal dose, the ES products of H. bacteriophora are sufficiently immunosuppressive to negatively impact the AMP response and to enhance the virulence of a bacterial infection.

Photorhabdus luminescens proliferates more rapidly in adult Drosophila when co- injected with activated ES products The delay in the onset of mortality for populations of flies co-injected with ES products and P. luminescens (Figure 7) demonstrates that this mortality initiated by

Photorhabdus requires an accumulation of bacteria beyond the initial inoculum. To test whether the influence of activated ES products is capable of accelerating this accumulation, the co-injections of ES products and Photorhabdus were repeated under the same conditions and surviving flies were collected at a 14-hour time point for the assessment of relative bacterial growth, as measured by RT-qPCR targeting the P. luminescens 16S rRNA and mcf1 genes. Subsequent analysis of expression for both genes revealed that bacterial proliferation is significantly higher in the presence of activated ES products, which supported an approximately 100-fold transcript increase for each gene

(Figure 8). Those treated with either Ringer’s buffer or non-activated products showed increases between 3- and 10-fold for the same genes. This difference in bacterial survival and proliferation is therefore likely responsible for the approximately 12-hour decrease in the time to mortality onset for flies co-injected with activated ES products as compared to those injected with non-activated products.

H. bacteriophora ES products provoke a more active phagocytic response Another possible mechanism causing increased mortality when flies are challenged simultaneously with activated nematode ES products and bacteria is interference with the normal activity of phagocytic hemocytes. To determine whether this effect is also contributing to the enhanced success of bacteria in ES-treated flies, adult D. melanogaster were co-injected with approximately 310 IJ equivalents of ES products or an equal volume of Ringer’s buffer and pHrodo E. coli conjugates that fluoresce when engulfed by a phagocyte. CTF measurements of images captured with fluorescence microscopy showed that phagocytic activity around the pericardium, where the highest degree of activity is observed, is significantly elevated in flies co-injected with activated

ES products (Figure 9). The immunosuppressive effect of the ES products is not mediated by the phagocytic response, and may in fact provoke more phagocytic activity. Despite this compensatory phagocytic response, the effects on AMP production or other systems are still potent enough to enhance a bacterial infection.

DISCUSSION

With the entirety of the observed effects relying on the in vitro activation of IJs, the degree to which the collected ES products align with those of an in vivo infection should be addressed. For Steinernema species, activation is influenced by host species, the age of the IJs being activated, the homogenate concentration used for activation, and the duration of exposure to host components (Lu et al., 2017a; Alonso et al., 2018). These factors could similarly affect the activation of H. bacteriophora, which is able to infect lepidopterans, dipterans, coleopterans, hymenopterans, anoplurans, orthopterans, homopterans, and hemipterans to varying degrees of lifecycle completion (de Doucet et al., 1999). Each of these hosts may provoke a slightly different response from the IJs, possibly even a different assortment of ES products. Furthermore, H. bacteriophora inhibits IJ development in a conspecific manner through a small-molecule pheromone termed C11 EA (Noguez et al., 2007), indicating that the concentration of IJs could tune the activation state based on the ratio of suppressive conspecific signal to activating host signal. Laboratory propagation of the nematodes can also be a factor in that

Heterorhabditis virulence can be affected by not only the number of generations that have been propagated in laboratory conditions, but also the number of IJs used to infect a host during each passage (Shapiro-Ilan and Raymond, 2016). It is therefore immediately crucial to concede that any collection of ES products from entomopathogens activated in vitro will likely not contain the ES products of the nematode in a universal sense, but rather a subset of products specific to a given activation and collection protocol. This fact does nothing however to diminish the practical or informative value of effects stemming from an isolation of ES products provided they accurately represent at least some subset of the virulence arsenal of the nematode. For the products used in this set of assays, our

39 results demonstrate an effective activation through the emergence of a unique protein profile. The subsequent assays serve to identify functions of these proteins that are produced specifically in response to host hemolymph.

The first effect of the ES products to be observed was the capacity of non- activated ES products to provoke higher expression of the antimicrobial peptide gene

Diptericin following injection into adult Drosophila. This gene was selected by virtue of its role as a readout of the Imd pathway, for which the best described function is the production of antimicrobial peptides in response to Gram-negative bacteria (Myllymäki et al., 2014). The Imd pathway is relevant because the bacterial symbiont of H. bacteriophora, Photorhabdus luminescens, is a Gram-negative bacterium, but also because of the pathway’s association with septic injury in general (Brun et al., 2006), which would imply that Imd activation could also occur during penetration of the nematode into the cuticle. Additionally, the Imd pathway appears to have a larger role in inflammation and immunity based on its contribution to the viral response (Zakovic and

Levashina, 2018; Palmer et al., 2019), which further asserts that Gram-negative bacterial pathogen-associated molecular patterns (PAMPs) are not its sole activating inputs. The initial expression changes observed here imply that basally expressed components of non-activated nematode secretions are also capable of directly or indirectly promoting

Imd activity, and possibly in a specific manner. This is supported by the data shown here, as expression of Diptericin is believed to be regulated solely by the Imd pathway as opposed to having a regulatory mode like that of Attacin, which is thought to receive inputs from both the Toll and Imd pathways (Yajima et al., 2003). After demonstrating the immunogenicity of non-activated products in adults, the effect was confirmed in

40 whole larvae, the stage more commonly associated with IJ infection, as well as specifically in the fat body. Importantly, the latter provides the additional information that the immunogenic effect of the non-activated products involves a systemic response from the fat body, a crucial distinction given that Diptericin can be expressed locally in sections of the digestive tract, specifically the proventriculus and midgut (Tzou et al.,

2000). Results from the Dpt-GFP assay also provide an assurance that differences stem from activity taking place at or before transcription, but additional work will be required to specify a mechanistic point of interference beyond that simple binary.

To determine whether the activated products simply lacked immunogenicity or were instead carrying out targeted suppression, the products were triple-concentrated by combining the secretions of three separate activations of 200,000 IJs. These more concentrated products were lethal through early timepoints following injection into adult flies, although less so than the secretions of Steinernema carpocapsae (Lu et al., 2017a).

This is consistent with previous findings regarding the in vivo virulence of axenic IJs of these two species (Han and Ehlers, 2000). When the effect on Diptericin expression was reassessed with this higher 414 IJ equivalent dose, the upregulation induced by the activated products was significantly lower than that of the Ringer’s buffer injection, while the non-activated products continued to display consistent immunogenicity.

Because a loss of immunogenicity would do nothing to eliminate Imd activity induced by the vehicle control, the 414 IJ equivalent injections reveal targeted immune suppression by the activated ES products. The argument could be made here that H. bacteriophora might generate antibiotic compounds during an infection and that these are reducing the population of Imd-activating microbes introduced by the injection. While P. luminescens

41 is known to produce antibiotics (Hu and Webster, 2000), no such activity has been attributed to H. bacteriophora, and this scenario would be in stark contrast to the results of the bacterial co-injection survival assays, especially that of E. coli. If the ES products contain antibiotics, they should be strongly protective after co-injection. The suppressive capacity of the ES products was then tested for two other antimicrobial peptide genes,

Cecropin and Drosomycin, which are regulated by the Imd and Toll pathways respectively. Neither of these genes showed any significant differences between the three treatments, indicating that the transcriptional suppression observed in the case of

Diptericin may be specific for that gene, though other gene products may be affected at different levels of host-parasite interactions. An infection by the filarial nematode Brugia pahangi can be inhibited by Cecropins (Chalk et al., 1995), but if this is also the case for

Heterorhabditis, H. bacteriophora has mediated this threat through the synthesis of a proteinase capable of degrading Cecropins (Jarosz, 1998), effectively eliminating the pressure to suppress Cecropin transcriptionally. The absence of a Drosomycin response may simply be the product of irrelevance given that neither S. carpocapsae nor H. bacteriophora nematodes induce Drosomycin expression in Drosophila larvae if the nematodes are axenic (Hallem et al., 2007; Peña et al., 2015). Generally though, the lack of activity on other antimicrobial peptide genes does at least demonstrate that the suppression of Diptericin is a more subtle, targeted effect than broad interference with immune gene transcription.

Having demonstrated that H. bacteriophora IJs respond to a host by secreting a unique set of proteins possessing immunomodulatory activity, the ES products were then tested for their contribution to infection outcome, particularly one instigated by Gram-

42 negative bacteria due to their susceptibility to Imd outputs. Flies that were injected with activated ES products and non-pathogenic E. coli (McCormack et al., 2016) displayed significantly increased mortality as compared to controls, which showed that this dose of

E. coli is not lethal by itself. Mortality occurred predominantly within 24 hours of injection, after which point the rate of mortality declined sharply, implying that the active proteins in the ES products are degraded or otherwise buffered by the fly at later time points. Relish mutant flies were also injected with E. coli or Ringer’s buffer in order to serve as a comparison for the magnitude of suppression. Relish is the terminal transcription factor in the Imd pathway and accordingly, these flies are highly susceptible to infection by Gram-negative bacteria (Hedengren et al., 1999). If these flies and those treated with activated ES products are equally susceptible, this would imply a nearly complete suppression of the Imd pathway by activated ES products. Interestingly, the trajectory of the E. coli and activated ES products co-injection survival curve does most closely resemble the Relish mutant E. coli injection curve at the earliest time point, but the treatments then diverge. Generally, this effect is illustrative of the immunosuppressive capacities of the ES products, but this is still more or less inconsequential in a natural infection unless the ES products can also support the H. bacteriophora symbiont P. luminescens. The Imd pathway has been previously implicated in the immune response to P. luminescens in that Diptericin is strongly upregulated following bacterial injection, and the avirulent phoP strain of Photorhabdus is restored to full pathogenicity in Imd pathway mutants (Aymeric et al., 2010). The

Diptericin-specific suppression facilitated by the activated ES products is thus likely relevant to the survival of Photorhabdus in Drosophila. Co-injections with ES products

43 were repeated with a far less concentrated, approximately 50 CFU inoculum of P. luminescens, which is representative of the average bacterial load of an H. bacteriophora

IJ (Ciche and Ensign, 2003). The co-injection of activated ES products led to a significantly earlier onset of mortality as compared to non-activated products while the latter also displayed a slightly protective effect as compared to Ringer’s buffer, potentially due to the elevated induction of Diptericin expression. Populations of injected flies were also stable until after the 12-hour time point, reaffirming the specific role of the bacteria in the mortality of co-injected flies. Furthermore, this delay compared to the E. coli co-injections implies that the injected Photorhabdus needed to replicate substantially to achieve a lethal concentration. Other findings have shown that the population responsible for eventual septicemia in an insect originates from a small subpopulation that is resistant to antimicrobial peptides (Mouammine et al., 2017), so part of the role of nematode ES products might be to bolster this subpopulation as much as possible. Our data support this idea in that relative Photorhabdus abundance at a 14-hour time point, just after the onset of mortality, was an order of magnitude higher in flies co-injected with activated ES products. Other time points could be examined to more fully enunciate the relationship between the presence of activated ES products and Photorhabdus growth kinetics, but this time point was considered the most critical and sufficient for demonstrating the practical capacity of ES-based suppression. Furthermore, this system could also eventually be used to examine the interplay between Heterorhabditis and

Photorhabdus virulence factors with regard to AMP suppression through different phases of the infection.

Finally, to eliminate the possibility that survival differences were stemming from the phagocytic response, H. bacteriophora ES products were co-injected with pHrodo E. coli conjugates to measure overall phagocytic activity. Activated products were found to significantly increase ingestion of the conjugates, but this increase in phagocytosis was clearly unable to promote survival during infection, which is consistent with findings that knock-down of the phagocytic receptor Nimrod C1 has no effect on the survival of

Drosophila during an infection by symbiotic H. bacteriophora (Hyrsl et al., 2011).

Although this is not a comprehensive assessment of the cellular response or related immune mechanisms, our future work will focus on analyzing the effects of the ES products on several other processes including melanization, encapsulation, and clot formation.

Much of the immune response has been left uninvestigated by this set of assays, in particular the immune response specifically against the nematode, but the pattern observed here reveals a cohesive image of specific immune gene suppression that could play a crucial role in the infection process. Together, the current results support the conclusion that H. bacteriophora secretes a unique protein profile in response to a host and that this collection of proteins suppresses the expression of the antimicrobial peptide- encoding gene Diptericin. The results also suggest that the suppressive capacity of the secreted products allows a small subpopulation of P. luminescens to propagate and overwhelm a host more quickly. This represents a fundamental component of nematobacterial bipartite virulence and provides a strong justification for exploring the individual components of the secreted products produced by the nematode in order to identify specific immunosuppressive proteins that could be employed in a variety of

45 applications. The interaction of these individual proteins with host immune mediators can then be observed in the context of the effects described here, with the aim of providing a mechanistic explanation for Heterorhabditis-based immunosuppression. Given the wealth of molecular components that could be targeted to interfere with Imd responses, even outside the signaling components of the Imd pathway, it would be premature to suggest a mechanism from the effects observed here, but potential avenues of research can be suggested. One well-supported field of inquiry would be to examine the ability of these

ES products to interfere with eicosanoid production. In insects, eicosanoid production relies on the ability of phospholipase A2 (PLA2) to synthesize eicosanoid precursor lipids like arachidonic acid (AA), and interference with this pathway can have strong immunosuppressive effects based on the role of eicosanoids in the regulation of cellular and humoral responses, including Diptericin expression through the Imd pathway

(Yajima et al., 2003; Stanley and Kim, 2018). Photorhabdus is known to inhibit PLA2

(Kim et al., 2005), but a variety of parasitic nematodes also secrete proteins that could similarly interfere with eicosanoid synthesis through their ability to bind fatty acids, including arachidonic acid, which could sequester necessary eicosanoid precursors

(Kennedy, 2000). Similar proteins have also been found in the ES products of

Steinernema carpocapsae (Lu et al., 2017b) and the transcriptome of activated H. bacteriophora (Moshayov et al., 2013). Interference with this pathway would be consistent with the findings presented here and an efficient way for the parasite to simultaneously suppress multiple immune responses.

FIGURE LEGENDS

Figure 1. Exposure of Heterorhabditis bacteriophora infective juveniles (IJs) to host hemolymph induces the secretion of unique proteins (arrow). Concentrated ES products were loaded for groups of 200,000 (200), 100,000 (100), and 25,000 (25) nematodes that were either activated (A) in Manduca sexta hemolymph or left non- activated (N) in Ringer’s buffer. Activation took place over a period of 20 hours, at which point IJs were washed, transferred to fresh ringers, and incubated for 5 hours to collect ES products. Lanes 1,3, and 7 carry 6 µg of protein while all others were loaded with a maximum volume, as protein could not be detected using the BCA assay. Lane H contains 6 µg of M. sexta hemolymph.

Figure 2. Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products elicit differential Diptericin responses that are consistent across Drosophila melanogaster life stages. D. melanogaster adults (A) and 3rd instar larvae (B) were injected with 69.0 and 50.2 nl of non-activated (N) or activated (A) concentrated ES products, representing 138 and 100 infective juvenile equivalents respectively. An equivalent volume of Ringer’s buffer (R) served as a control. Flies and larvae were homogenized at a 6-hour time point before RNA isolation, cDNA conversion, and transcript abundance quantification of the antimicrobial peptide Diptericin by qPCR.

Fold change is relative to zero-hour expression immediately following injection with each treatment and values represent data from three trials at two technical replicates per trial, where replicate measurements are drawn from the pooled cDNA of five flies or larvae. (*p<0.05, **p<0.01).

Figure 3. Differential Diptericin responses to ES products originate at or prior to transcriptional activation. (A) Larvae of a Drosophila melanogaster line carrying GFP under the control of the antimicrobial peptide Diptericin promoter were injected with

50.2 nl of non-activated (N) or activated (A) products. The fat body was extracted at a 6- hour time point and imaged via confocal microscopy. One representative image from each of the three trials is shown for both treatments. (B) Corrected total fluorescence was assessed for isolated green channels with Image J software (***p<0.001). Values were calculated for 10 images per treatment per trial.

Figure 4. Activated Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products are lethal to adult Drosophila melanogaster. Drosophila adults were injected with 69.0 nl of Ringer’s buffer (R) or 414 IJ-equivalent dose triple-concentrated ES products, either activated (A) or non-activated (N) and monitored for mortality every hour for six hours, at which point injected populations typically stabilized and no additional deaths were observed up to a 24-hour time point. Each curve is comprised of measurements for three trials of 10 male and 10 female flies (***p<0.001).

Figure 5. Triple-concentration of the Heterorhabditis bacteriophora nematode

Excreted/Secreted (ES) products exacerbates Diptericin responses, but fails to elicit responses from other antimicrobial peptides. Adult Drosophila melanogaster were injected with 69.0 nl of triple-concentrated ES products prior to homogenization for RNA extraction at a 6-hour time point. Gene expression normalized to rp49 expression was assessed for the antimicrobial peptides Diptericin (A), Cecropin (B), and Drosomycin

(C). Bars represent fold change over the 0-hour measurement for each treatment.

Averages with standard error are shown for three trials performed in duplicate such that each trial produced two measurements for pooled cDNA from five flies (*p<0.05,

**p<0.01, ***p<0.001).

Figure 6. Co-injection of Escherichia coli with activated Heterorhabditis bacteriophora nematode Excreted/Secreted (ES) products results in fly mortality.

Adult Drosophila melanogaster were injected with 69.0 nl of a 1:4 mixture of OD 3.0 E. coli (+Ec) and activated ES products (A), non-activated ES products (N), or Ringer’s buffer (R). After mixing, solutions contained 310 IJ equivalents of ES products and 8 x

104 CFUs of E. coli as applicable. Relish mutant flies (Rel) were also injected in order to compare the magnitude of ES-suppression to that of Immune deficiency pathway ablation. Survival was assessed every 12 hours for a total of 72 hours. Three trials were performed, each consisting of 10 male and 10 female flies per treatment. Where bars are omitted, standard error was negligible (ns p>0.05, **p<0.01, ***p<0.001).

Figure 7. The onset of mortality evoked by Photorhabdus luminescens infection is significantly advanced by Heterorhabditis bacteriophora nematode

Excreted/Secreted activated products, but delayed by non-activated products. Adult

Drosophila melanogaster were injected with 69.0 nl of a 1:4 mixture of OD 0.4 P. luminescens bacteria and activated ES products (A), non-activated ES products (N), or

Ringer’s buffer (R), conveying 310 IJ equivalents of ES products and 50 CFUs of

Photorhabdus. Survival was observed at 12 hours and then every hour after 24 hours

49 until 33 hours in order to capture the majority of mortality events at a higher resolution.

A final time point was assessed at 48 hours (A). Mortality in injected flies between 24 and 36 hours is shown in (B). Curves depict average values collected over three trials of

20 flies, 10 males and 10 females, per treatment (*p<0.05, ***p<0.001).

Figure 8. Activated Heterorhabditis bacteriophora ES products enable the rapid proliferation of Photorhabdus luminescens during the early phase of an infection. A

1:4 mixture of OD 0.4 P. luminescens and Ringer’s buffer (R), non-activated ES products

(N), or activated ES products (A) was injected into the thorax of adult Drosophila, which were then incubated for a period of 14 hours. Following RNA extraction, gene expression was measured by RT-qPCR for P. luminescens 16S rRNA (A) as well as mcf (B), both of which were normalized to rp49. Each graph shows fold change in expression between the

0 and 14 hour time points. Three trials of two replicates with five flies per replicate were performed (*p<0.05, **p<0.01).

Figure 9. Heterorhabditis bacteriophora nematode activated Excreted/Secreted (ES) products provoke a stronger phagocytic response. Adult Drosophila melanogaster were injected with 69.0 nl of a 1:4 mixture of 4 mg/mL pHrodo E. coli conjugates and activated ES products (A), non-activated ES products (N), or Ringer’s buffer (R). (A)

Images were captured by fluorescence microscopy at 10x magnification and (B) the area associated with pericardial nephrocytes was analyzed with ImageJ software. Values are shown for measurements collected over three trials of three replicates each. (**p<0.01).

Figure 1

Figure 2

Figure 3

100 R N 90 *** A

70 Percent Percent Survival

60 0 1 2 3 4 5 6 Hours

Figure 4

Figure 5

100 R ns 80 R+Ec N 60 N+Ec ** A 40 A+Ec *** Rel ** Percent Percent Survival 20 Rel+Ec 0 0 12 24 36 48 60 72 Hours

Figure 6

Figure 7

Figure 8

Figure 9

Chapter 2: A putative UDP-glycosyltransferase from Heterorhabditis bacteriophora suppresses antimicrobial peptide gene expression and factors related to ecdysone signaling*

ABSTRACT

Insect pathogens have adopted an array of mechanisms to subvert the immune pathways of their respective hosts. Suppression may occur directly at the level of host- pathogen interactions, for instance phagocytic capacity or phenoloxidase activation, or at the upstream signaling pathways that regulate these immune effectors. Insect pathogens of the family Baculoviridae, for example, are known to produce a UDP- glycosyltransferase (UGT) that negatively regulates ecdysone signaling. Normally, ecdysone positively regulates both molting and antimicrobial peptide (AMP) production, so the inactivation of ecdysone by glycosylation results in a failure of host larvae to molt, and probably a reduced antimicrobial response. Here, we examine a putative ecdysteroid glycosyltransferase, Hba_07292 (Hb-ugt-1), which was previously identified in the hemolymph-activated transcriptome of the entomopathogenic nematode Heterorhabditis bacteriophora. Injection of recombinant Hb-ugt-1 (rHb-UGT-1) into Drosophila melanogaster flies resulted in diminished upregulation of antimicrobial peptides associated with both the Toll and Immune deficiency pathways. Ecdysone was implicated in this diminution by a reduction in Broad Complex expression and reduced pupation rates in rHb-UGT-1-injected larvae. In addition to the finding that H. bacteriophora excreted-secreted products contain glycosyltransferase activity, these results demonstrate that Hb-ugt-1 is an immunosuppressive factor and that its activity likely involves the inactivation of ecdysone.

* This chapter has been published in Scientific Reports (2020) 10: 12312 60

INTRODUCTION

Baculoviruses that infect insects, such as Autographa californica, have been shown to express a UDP-glycosyltransferase (UGT) that acts as a virulence factor through interference with ecdysone signaling (O’Reilly and Miller, 1989). The baculovirus UGT is proposed to have been acquired from Lepidopteran spp. through horizontal gene transfer (Hughes, 2013), which implies that it should be ideally suited for activity in an insect host. During an infection, the A. californica UGT conjugates UDP- glucose present in the host with the ecdysteroid hormone 20-hydroxyecdysone (20E), effectively eliminating the molecule’s ability to activate its receptor (Evans and O’Reilly,

1998). Because 20E is the primary molting signal in insects, infected larvae will not molt, but instead continue to feed and accumulate mass that will be converted to higher viral output (Kaplanis et al., 1979; Yamanaka et al., 2013; O’Reilly., 1995). The set of effects controlled by 20E is broader than molting alone, however. Ecdysone also regulates the immune response in Drosophila melanogaster (Verma and Tapadia, 2015). In S2 cell cultures, 20E enables Imd signaling and sensitizes cells to the Toll pathway ligand

Spätzle, in both cases promoting antimicrobial peptide (AMP) expression (Rus et al.,

2013; Tanji et al., 2007).

Here, we examined a putative ecdysteroid glycosyltransferase Hba_07292 (Hb- ugt-1), from Heterorhabditis bacteriophora, that shares amino acid sequence similarity to baculovirus and insect UGTs. Further, we hypothesize that this glycosyltransferase functions in a manner similar to viral UGT virulence factors. A nematode UGT is unlikely to have been acquired by horizontal gene transfer, but nematodes do share an ecdysozoan lineage with insects, and therefore likely regulate molting in a similar way

(Aguinaldo et al., 1997). Interestingly, there is evidence that 20E regulates molting in a number of helminths. In the filarial parasite Brugia malayi, 20E elicits a transcriptional response featuring genes related to embryogenesis, and a homolog of the insect ecdysone receptor has been identified in its genome (Liu et al., 2012). The genome of the nematode

Pristionchus pacificus also contains a putative ecdysone receptor homolog, and another has been postulated in H. bacteriophora, though this has yet to be confirmed (Parihar et al., 2010). If this is indeed the case, H. bacteriophora would require a negative regulatory element that is active against 20E to moderate its own development. Alternatively, this molecule could function as a virulence factor similar to that of baculoviruses if it were secreted and diminished host 20E signaling. It is currently not possible to indicate whether Hb-ugt-1 participates in development, but the known relationships between nematodes and 20E does allow for a plausible explanation of why the H. bacteriophora genome would contain a UGT active against 20E.

To further examine whether Hb-ugt-1 functions as a virulence factor, we performed a number of assays related to its expression and in vivo activity in the model host D. melanogaster. In agreement with the RNA sequencing assay that initially identified this glycosyltransferase (Vadnal et al., 2017), Hb-ugt-1 was upregulated by H. bacteriophora infective juveniles (IJs) in response to hemolymph from multiple insect species, including D. melanogaster, though interestingly not in response to the nematode’s symbiotic bacterium Photorhabdus luminescens. A recombinant version of

Hb-ugt-1 (rHb-UGT-1) suppressed the upregulation of AMP gene expression following microinjection, as do total excreted-secreted (ES) products of H. bacteriophora (Kenney et al., 2019). ES products also contained in vitro glycosyltransferase activity. Expression

62 of the transcription factor Broad Complex and molting ability were subsequently characterized following rHb-UGT-1 injection to determine whether ecdysone signaling might play a role in the observed AMP suppression. Both were significantly diminished, suggesting a decreased amount of active insect 20E after exposure to rHb-UGT-1.

Generally, this collection of evidence is consistent with a role for Hb-ugt-1 as an ecdysone-inactivating virulence factor.

RESULTS

Hb-ugt-1 is upregulated in response to host factors. Originally, Hb-ugt-1 was identified as part of the transcriptomic response to Manduca sexta hemolymph following a 9-hour exposure (Vadnal et al., 2017). To further explore the transcriptional response and examine expression in response to a variety of insect factors or cues, we measured

Hb-ugt-1 transcript levels in response to 25% hemolymph plasma from D. melanogaster and M. sexta, as well as an in vivo exposure to Galleria mellonella through injection of infective juveniles (IJs) directly into the hemocoel. Each of these treatments resulted in the upregulation of Hb-ugt-1 between 1 and 9 hours (Fig. 1A-C), indicating that the transcript is broadly upregulated in response to insect factors. Additionally, to distinguish between a role for the glycosyltransferase in infection rather than development, IJs were exposed to a lawn of P. luminescens. This treatment sustains the growth and development of H. bacteriophora but should not induce the expression of virulence factors if these are responsive strictly to insect host signals. Interestingly, P. luminescens induced a downregulation of Hb-ugt-1 through 24 hours, after which expression returned to a level comparable to 0-hour expression (Fig. 1D). It should be noted as well that while

63 expression of Hb-ugt-1 is significantly higher at 48 hours as compared to 24 hours, the

48-hour expression level is not statistically discernable from 0-hour expression. Together, these results indicate that Hb-ugt-1 is upregulated upon exposure to an insect host, but is unlikely to play a role in recovery of the nematode IJ from its diapause state.

Hb-ugt-1 contains a conserved ecdysteroid glycosyltransferase domain. Using BlastP search, we identified Hb-ugt-1 as a putative glycosyltransferase containing an ecdysteroid glycosyltransferase domain (Interpro domain: IPR016224). An alignment of Hb-ugt-1 with several related glycosyltransferases indicates a substantial degree of similarity between the proteins, especially with reference to the signature sequence associated with the binding of the nucleotide sugar (Fig. 2A). The maximum likelihood phylogenetic tree

(Fig. 2B) for these sequences produces an intuitive clustering of insects, nematodes, and viruses. This is likely due to stretches of low-similarity in the full-length alignment

(Supplementary Fig. S1) that are nonetheless more similar for species within the same phylum. Because of the marked conservation across relevant groups of organisms and the known function of the included viral UGTs, this was considered a sufficient justification for investigating whether Hb-ugt-1 might function similarly.

Activated H. bacteriophora excreted-secreted (ES) products facilitate glycosylation in the presence of 20-hydroxyecdysone and a UDP-glucose donor molecule. The presence of a secretion signal at the N-terminus of Hb-ugt-1, as determined by SignalIP-

5.0, suggests that the molecule may be secreted. Therefore, ES products of hemolymph- activated IJs were assessed for glycosyltransferase activity using a commercially

64 available assay that detects phosphate liberated from the UDP donor molecule (UDP- glucose) following transfer of the UPD sugar to an acceptor molecule, which was 20E in this case. Glycosyltransferase activity was significantly higher (p< 0.001) in activated products as compared to both non-activated products and a Ringer’s buffer control (Fig.

3A). As a negative control, no signal was detected from activated products in the absence of 20E substrate. To further confirm the presence of a glycosyltransferase, the activated products, which contain a variety of proteins (Kenney et al., 2019), were assayed by western blot with a polyclonal antibody that recognizes human GTDC1 (Fig. 3B). A single band of approximately 60-70-kDa was detected in these activated products, consistent with the approximately 60-kDa molecular weight calculated from the Hb-ugt-1 predicted protein sequence (Fig. 3B). Additionally, the GTDC1 antibody was assessed for its ability to bind rHb-UGT-1, and this western blot was found to be positive

(Supplementary Fig. S2). These results indicate that H. bacteriophora secretes a glycosyltransferase when exposed to an insect host, and that the activity is likely the result of a single protein, but more work is required to confirm that this protein is Hb-

UGT-1.

Recombinant Hb-ugt-1 suppresses the upregulation of antimicrobial peptide (AMP) genes. Recombinant Hb-UGT-1 produced via an Sf9 expression system was used to examine immune-related effects in D. melanogaster. Adult flies injected with approximately 7 ng of rHb-UGT-1 or BSA in PBS were collected at 6-hours post- injection to determine the expression of AMP genes representing both the Toll and Imd pathways by qPCR analysis. The H. bacteriophora putative i-type lysozyme

65 rHba_19909, which was expressed and purified according to the same protocol as Hb- ugt-1, and BSA were injected separately as controls. The upregulation of Diptericin,

Attacin, and Metchnikowin were all significantly lower following an injection of rHb-

UGT-1 as compared to BSA, whereas injection of rHba_19909 had no effect (Figs 4A,

4C, and 4E). Although Hba_19909 does appear to have a mild inhibitory effect on the upregulation of Diptericin as compared to BSA, this difference was not statistically significant (p = 0.08).

To further examine the physiological significance of the rHb-UGT-1-reduced

AMP gene expression, rHb-UGT-1 was injected into D. melanogaster Relish mutants, which are incapable of mounting an Imd-based response due to a lack of the terminal transcription factor in the Imd pathway (Hedengren et al., 1999). While these mutants were capable of surviving a BSA injection at a rate comparable to wild type, an injection of rHb-UGT-1 resulted in significantly lower survival over a six-day period (Fig. 4F).

Conversely, wild type flies injected with rHb-UGT-1 survived at a similar rate as buffer- injected controls. The suppressed AMP upregulation demonstrates that rHb-UGT-1 has immunosuppressive effects, and the mortality seen in the recombinant-injected mutants indicates that the degree of this immunosuppression is consequential to the survival of the insect.

Hb-ugt-1 suppresses the expression of Broad-Complex, an ecdysone-responsive transcription factor. The binding of 20E to its receptor induces the expression of several transcription factors, including Broad-Complex (Br-C), which subsequently upregulates components of the immune response, including the Peptidoglycan Recognition Protein

LC (PGRP-LC) and some AMPs, even in the absence of Imd pathway activity (Rus et al.,

2013). To assess whether ecdysone signaling might be impaired in rHb-UGT-1-injected

D. melanogaster, larvae and adult flies were injected with 5 ng and 7 ng of rHb-UGT-1, respectively. They were then processed for Br-C expression measurements via qPCR

(Fig. 5). In both cases, Br-C expression was significantly reduced, at a 6-hour time point in adult flies (Fig. 5A) and at a 30-minute time point in larvae (Fig. 5B). Because of the closely associated transcriptional response of Br-C to 20E signaling, this suggests that

20E signaling is diminished in insects injected with the recombinant protein. This reduction may also be responsible for the decreased upregulation of AMPs seen in response to injection of rHb-UGT-1, as disruption of Br-c alone is sufficient for a significant reduction in upregulation of AMPs, including Diptericin (Rus et al., 2013).

Pupation is delayed in larvae injected with rHb-ugt-1. To support the observed effect on Br-C expression, we injected D. melanogaster third-instar larvae (Fig. 6C) with 5 ng of rHb-UGT -1 or BSA and measured the timing of their commitment to pupation, as this process is regulated positively by ecdysone signaling. Commitment to pupation, based on immobility and spiracle inversion (Fig. 6B), was approximately 50 percent lower following injection of rHb-UGT-1 as compared to BSA (Fig. 6A) at 8-hours post injection. The total rate of pupation at a 24-hour time point and the rate of eclosion were unaffected (Supplementary Fig. S3). This effect on pupation further implicates ecdysone signaling as a target of Hb-ugt-1. The fact that pupation is delayed, but not disabled also agrees with the prediction that a transient injection of rHb-UGT-1 will temporarily decrease the concentration of active 20E signaling hormone.

DISCUSSION

Based on its protein sequence, the candidate virulence factor gene Hb-ugt-1 was predicted to possess a conserved ecdysteroid glycosyltransferase domain. This by itself does not necessarily indicate that this glycosyltransferase functions as a virulence factor, as glycosyltransferases are involved in a wide variety of processes (Huang et al., 2008).

Still, targeting ecdysone signaling with a glycosyltransferase is apparently such an effective strategy for undermining a host that most baculoviruses maintain an ecdysteroid

UGT in their genome (Ahn et al., 2012). With this in mind, the possibility of a similar role for Hb-ugt-1 warrants further investigation.

Typically, pathogens upregulate the expression of their virulence factors in response to host entry or physiological cues. Notably, we found that Hb-ugt-1 gene expression is rapidly increased and sustained in response to insect hemolymph, both in vitro and in vivo. The magnitude of this increase varied between treatments, but this is to be expected given that the degree of IJ activation in other entomopathogenic nematodes depends on a collection of factors, including host species (Lu et al., 2017b; Alonso et al.,

2018). Each treatment showed significant upregulation by one hour, which by itself indicates that Hb-ugt-1 could be involved in either virulence or the growth and development of the nematode, although the latter is made less likely by the observed downregulation following exposure to P. luminescens bacteria. Interestingly, the expression level of Hb-ugt-1 on P. luminescens returns to a level comparable to the 0- hour time point at 48 hours. This time point is developmentally relevant in that this is approximately when H. bacteriophora nematodes will transition from recovering

68 juveniles to fourth stage pre-hermaphrodites (Johnigk and Ehlers, 1999) and at which point they will cease development without their symbiotic bacteria (Han and Ehlers,

2000). This developmental stage is also the point at which ecdysteroids reach their highest concentration in Haemonchus contortus (Fleming, 1993). An important avenue of future research would be to examine a potential role for UGTs in H. bacteriophora development and uncover the modes of regulation that make this possible.

Another important characteristic of a virulence factor is that it is secreted to the exterior of the nematode so that it can interact with the host environment, as documented in other species (Chang et al., 2019). To this end, we tested H. bacteriophora ES products for glycosyltransferase activity using UDP-glucose as a sugar donor and 20E as the acceptor molecule, as these are the prevalent substrates for glycosyltransferases of invertebrates and plants (Caradoc-Davies et al., 2001; Bock, 2016). Glycosyltransferase activity was observed only from the ES products of hemolymph-activated IJs, indicating that H. bacteriophora does produce and externally secrete a glycosyltransferase in response to host exposure. It should be noted, however, that while this assay does demonstrate glycosyltransferase activity, additional work is required to confirm 20E as the substrate due to the fact that glycosyltransferases can act on other proteins and lipids present in the ES products (Breton et al., 2012). The presence of glycosyltransferase activity was further supported by the identification of a GTDC1-labeled protein in the activated ES products of H. bacteriophora. While this protein is larger than the predicted size, it is within a range that could be attributed to post-translational modification. Other helminths also produce multiple isoforms of UDP-glycosyltransferases (Matoušková et

69 al., 2018), which may be the case with H. bacteriophora and could alternatively explain the size discrepancy.

To test the immunosuppressive capacity of the recombinant protein, we examined the induction of AMP encoding genes following injection of rHb-UGT-1, where the tissue damage caused by injection alone is known to activate both the humoral and cellular immune responses (Kenmoku et al., 2017; Márkus et al., 2005). The AMP genes

Diptericin, Attacin, and Metchnikowin were upregulated to a significantly lower degree following rHb-UGT-1 injection as compared to BSA injections. Drosomycin and

Defensin (Figs 4D and 4B) were induced at comparable levels for each treatment, but this may be at least partially due to a lower baseline responsiveness to injection injury. In the case of Defensin, this AMP would also not be expected to have an impact on the course of an infection as neither Steinernema nor Heterorhabditis nematodes induce Defensin expression in D. melanogaster larvae (Hallem et al., 2007; Peña et al., 2015). With regard to toxicity, rHb-UGT-1 failed to induce mortality in wild type flies, but the lower survival rate in immunocompromised flies injected with recombinant protein does indicate that the immune or otherwise physiological effects are relevant to the survival of the fly. An exact cause of mortality in these flies unfortunately cannot be determined from these data alone, but this question represents an important point to resolve in future work.

Two separate ecdysone-responsive factors were tested to determine if the immunosuppressive effect of rHb-UGT-1 was related to ecdysone signaling. Expression of the transcription factor Br-C was selected due to its documented role as a link between ecdysone signaling and innate immunity (Xiong et al., 2016; Zheng et al., 2018; Ma et al.,

2019), and concordantly its expression was reduced in both D. melanogaster adults and

70 larvae following injection of rHb-UGT-1. Furthermore, a delay in the onset of pupation was observed in third-instar larvae injected with the recombinant, similarly indicating diminished ecdysone signaling, as 20E is the primary signal for this process (Kaieda et al., 2017). This indicates that the H. bacteriophora glycosyltransferase may be acting in a manner similar to the baculovirus UGTs, namely that its observed effects appear to stem from a capacity to deactivate 20E.

Additional work must be done to fully elucidate the role of Hb-ugt-1 as a virulence factor with activity against 20E, but the findings presented here offer strong foundational support for this notion. Future work could expand on the information presented here by further clarifying the role of Hb-ugt-1 as it pertains to development within the nematode as well as virulence, and also the collection of immune impacts Hb- ugt-1 might have, given that ecdysone is involved in a variety of immune mechanisms, including the nodulation response (Sorrentino et al., 2002; Franssens et al., 2006). The in vitro reaction properties of the recombinant enzyme may also be examined to investigate how this protein participates in the dynamics of a natural infection. These questions are of great interest for the description of host-parasite interactions, but this knowledge could have broader impacts as well. Information about individual virulence factors can be used to develop stronger parasites for the biocontrol of insect pests, which is a widespread application of Heterorhabditis species (Labaude et al., 2018), and to combat nematode virulence strategies, as steroid hormones likewise play a role in vertebrate immunity

(Benagiano et al., 2019), and may be targeted by glycosyltransferases of vertebrate- infective nematode parasites.

METHODS AND MATERIALS

Infective juvenile activation for Hb-ugt-1 expression analysis. For in vitro activation experiments in insect hemolymph, 20 third-instar D. melanogaster larvae were collected, rinsed with water, and pinched with forceps near the mouth hooks to create a small incision. Before releasing the forceps, larvae were submerged in a 5 μl aliquot of a 2.5

μg/ml solution of phenylthiourea (PTU) in PBS, contained in a 0.5 ml centrifuge tube nested in a 1.5 ml centrifuge tube. Critically, the 0.5 ml tube featured an incision at the bottom of the tube allowing for passage of fluid, but not larvae from the 0.5 ml tube to the 1.5 ml tube. Hemolymph was collected from the larva by centrifugation at 4°C for 30 sec at 17,900 x g. The resulting approximately 10 μl of extracted hemolymph was diluted two-fold with PTU-PBS, filtered with a 10 μm polyethylene filter, and kept on ice to prevent melanization. This process was repeated three times to produce a sufficient volume of hemolymph for each activation trial. To collect Manduca sexta hemolymph, the posterior horn of a fifth instar larvae was surface sterilized with 70% ethanol and cut to release the hemolymph. The extracted hemolymph was diluted 1:4 in ice-cold Ringer’s buffer (100 mM NaCl, 1.8 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 5 mM HEPES, pH

6.9) supplemented with PTU to a final concentration of 0.33 mM. Before use, M. sexta hemolymph was centrifuged for 5 min at 4,000 x g and filtered with a 0.45 μm syringe filter. Approximately 1,000 H. bacteriophora IJs were transferred to a 1.5 ml centrifuge tube and washed twice with water by centrifugation for 30 sec. After the second wash, the supernatant was discarded and a 40 μl aliquot of the extracted hemolymph solution was pipetted into the pellet of IJs and mixed before incubating at 28°C for the specified time points. Axenic IJs for these experiments were generated as previously described

(Kenney et al., 2019), where IJs were propagated in fifth or sixth instar G. mellonella larvae that had been infected with the RET16 derivative of P. temperata NC1.

In vivo activation of IJs was carried out by the injection of IJs directly into G. mellonella larvae. The injected aliquot of IJs was prepared by pelleting 5,000 nematodes as in the in vitro experiments, though with the addition of a 5-min axenization step using a 3% hypochlorite solution. These surface-sterilized IJs were washed three times with

PBS and concentrated into a 100 μl volume of PBS. Nematodes were injected into

Galleria larvae using an 18.5G needle and 1 ml syringe after the larvae had been surface- sterilized with 70% ethanol and anesthetized on ice for 15 min. The injected larvae were returned to the ice for a period of five minutes before being transferred onto slightly moist filter paper in a petri dish. After the allotted incubation time, the injected Galleria were dissected in PBS and an average of approximately 2,000 IJs were collected from the solution by pipette.

Gene expression changes in response to P. luminescens exposure were measured by directly exposing H. bacteriophora IJs to a bacterial lawn. Photorhabdus luminescens subspecies laumondii, strain TT01, was grown overnight in LB at 28°C with shaking at

220 rpm. A 50 μl aliquot of overnight culture was spread in the center of LB agar plates, and the plates were incubated for 48 hours at 28°C. Approximately 2,000 washed H. bacteriophora IJs in a 100 μl aliquot of water were applied to the P. luminescens lawn and allowed to incubate at room temperature in the dark on a moist paper towel until the desired time point. In order to recover nematodes from the plate, 5 ml of M9 buffer were pipetted directly onto the plate and swirled gently before being collected and dispensed

73 into a 15 ml Falcon tube. This process was performed three times in total for each plate to ensure optimal recovery.

Sequence alignment and phylogenetics. The sequence alignment was produced with

BioEdit software (version 7.2.5) following the ClustalW algorithm and organized graphically with JalView software (version 2.11.0). The gap opening and extension penalties for pairwise alignments were set to 1 and 0.1, respectively, while the corresponding penalties for the multiple alignment were 3 and 0.2. Minor manual adjustment was permitted where the alignment could be improved unambiguously. The phylogenetic tree was constructed using MEGA software (version 10.1.5) according to the Maximum Likelihood method with 200 bootstrap replicates.

Glycosyltransferase activity in H. bacteriophora secreted products. Excretory- secretory products were collected from axenic H. bacteriophora IJs as described previously (Kenney et al., 2019). Briefly, 200,000 IJs were soaked in 25% M. sexta hemolymph for a period of 20 hours, washed in Ringer’s buffer, and placed in fresh

Ringer’s buffer for a 5-hour ES product collection period. The resulting supernatants were filtered and concentrated such that supernatants from three preparations of 200,000

IJs each were pooled and concentrated to a final volume of 100 μl. This allowed standardization of ES products to equal numbers of IJs so that despite activated and non- activated products containing different concentrations of protein, they both contain 2,000

IJ equivalents/μl. Glycosyltransferase activity was assayed with a colorimetric assay specific for phosphate-coupled glycosyltransferase reactions (R&D Systems

Glycosyltransferase Activity Kit EA001) according to the manufacturer’s instructions.

The glycosyltransferase activity of 10,000 IJ equivalents (5 μl) was measured using 5 mM UDP-glucose (Abcam) and 5 mM 20-hydroxyecdysone (Sigma) in DMSO as the sugar donor and acceptor for the reaction, respectively. Reactions were incubated at 37°C for 3 hours, at which point the samples were diluted with 100 μl of deionized water in a

96-well flat bottom plate (Greiner) and 30 μl each of the provided Malachite Green reagents were added sequentially. Each sample was incubated for an additional 20 minutes at room temperature before absorbance was measured at 620 nm. Absorbance measurements collected from three independent experiments were analyzed for statistical significance by one-way ANOVA.

Protein electrophoresis and western blotting. As described previously (Kenney et al.,

2019), the concentration of protein in activated ES products was determined using a

Pierce BCA Protein Assay Kit (Thermo Scientific). As the activated products were the only preparation to produce a readable signal from the BCA assay, a 10 μl aliquot corresponding to 150 ng of activated products and an equivalent 10 μl volume of non- activated products were reduced in 50 mM DTT and loaded into a Novex WedgeWell 4-

20% Tris-Glycine Gel (Invitrogen). The composition of each well was adjusted to 26 μl of sample and water, 4 μl of DTT, and 10 μl of Laemmli buffer. Additionally, 5 μl of

PageRuler Plus Prestained Protein Ladder (Thermo Scientific) were loaded separately for size estimation. To label glycosyltransferases in the ES products, the gel was transferred to nitrocellulose with a Trans-Blot Turbo Transfer System (Bio Rad) and blocked overnight at 4°C with 5% powdered milk in Tris-NaCl-Tween (TNT, 25 mM Tris pH 7.4,

0.5 M NaCl, 0.1% Tween 20) (Sherman et al., 2015). The membrane was then incubated with a 1:2,000 dilution of GTDC1 rabbit polyclonal antibody (Proteintech) in 5% powdered milk for 2 hours at room temperature. Secondary antibody labeling was achieved with a 1-hour incubation with a 1:2,000 dilution of anti-rabbit IgG, HRP-linked antibody (Cell Signaling Technology) in 5% dry milk at room temperature. Signal for the

HRP substrate was generated by exposure to Supersignal West Femto Maximum

Sensitivity Substrate (Thermo Fisher) for 5 minutes.

Recombinant expression of H. bacteriophora candidate genes. Two candidate virulence factor genes were expressed in Sf9 cells using a pMIB/V5-His A expression vector. Initial amplicons were generated using primers specific for Hb-ugt-1 (F: 5′

CTTGGTACCTAAAATCCTAGTCTTTAGCC 3′; R: 5′

AGACTCGAGTTCGGATTTCATTTTTTTCTCCG 3′) and Hba_19909 (F: 5′

CTTGGTACCCAATTGCCTTCATTGTATTTG 3′; R: 5′

AGACTCGAGCGAACAGCCACAGCACTTTTTGA 3′), each modified to contain restriction sites for KpnI and XhoI at the 5′ and 3′ ends, respectively, of the amplicons.

Following cloning of the amplicons, One Shot TOP10 chemically competent E. coli were transformed with these constructs and selected on LB plates containing 100 μg/mL ampicillin. The same primers were used to confirm successful transformations via colony-PCR prior to growth in liquid culture, plasmid isolation, and sequencing.

Plasmids featuring correct sequences were transfected into Sf9 insect cells using

Cellfectin II reagent (Invitrogen) and selectively allowed to colonize wells in a 6-well plate by propagating in Sf-900 II SFM (Thermo Fisher) containing 10 μg/ml blasticidin

76 and 15 μg/ml gentamycin. Upon sufficient growth and differentiation from untransfected cells, cultures were suspended in 300 ml of liquid medium and allowed to grow at 27°C with shaking at 130 rpm until they reached a concentration of 6 x 106 cells/ml. Culture supernatants were queried for the presence of recombinant protein by western blot, targeting the V5 epitope (Anti-V5-HRP antibody, Invitrogen), and if positive, the total culture supernatants were prepared for purification, first through concentration driven by

8 kDa polyethylene glycol flakes, and then dialysis in 150 mM sodium phosphate at 4°C for approximately 16 to 20 hours. The resulting solution was centrifuged to remove debris, diluted 1:3 in low-stringency wash buffer (50 mM NaH2PO4, 500 mM NaCl, 40 mM Imidazole, 0.5% Tween 20), and co-incubated with 1 ml Ni-NTA agarose (Qiagen) for 1 hour rotating at 90 rpm at room temperature. The recombinant-bound matrices were loaded onto an affinity purification column and washed with 10 equivalents of low- stringency wash buffer. Following this washing step, elution proceeded with two individual washes of high-stringency buffer (50 mM NaH2PO4, 500 mM NaCl, 100 mM imidazole, 0.5% Tween 20) followed by 6 individual washes with elution buffer (50 mM

NaH2PO4, 300 mM NaCl, and 250 mM imidazole). Each aliquot was assessed again by western blot and those fractions containing recombinant protein were further concentrated against polyethylene glycol and dialyzed overnight in PBS. Before storage at -20°C, protein concentration was determined with a Pierce BCA Protein Assay Kit

(Thermo Fisher) and the solution containing the purified recombinant protein was supplemented with protease inhibitor cocktail (Sigma).

Injection of flies and larvae for the assessment of gene expression, survival, and pupation rate. All injections were performed with a Drummond Nanoject III

Programable Nanoliter Injector, where treatments were transmitted through an oil-filled pulled glass capillary that had been opened with forceps to a degree that would allow delivery of the treatments while causing minimal damage to the organism. Adult flies were injected between 7 and 10 days after eclosion, whereas larvae were selected once they had reached the wandering third instar phase. In both cases, D. melanogaster stocks were maintained on a yeast - supplemented cornmeal-soy-based diet (Meidi Laboratories) at 25°C on a 12-hour day-night cycle. Oregon-R flies were used for AMP and Br-C expression studies while survival rates were collected in reference to the RelE20 line and its associated background, w1118. All injections were preceded by a period of anesthetization with carbon dioxide, though generally the technique was adapted to optimize the recovery of each life stage. Adults were injected intramesothoracially with an approximately 69 nl aliquot containing 7 ng of recombinant protein or BSA in PBS- protease inhibitor solution before placement in vials containing instant Drosophila medium (Carolina Biological) incubated under the same conditions. Survival was assessed once every 12 hours, or flies were collected at the 6-hour time point for gene expression analysis. Alternatively, Oregon-R larvae were anesthetized with carbon dioxide for 2 to 3 minutes before being placed on slightly moist filter paper and injected with 5 ng of each treatment. Injections were delivered at a shallow angle between segments in the dorsal side of the abdomen, such that the probability of damaging the imaginal discs or organs would be low. Injected larvae were placed on fresh filter paper

78 moistened with Ringer’s buffer and incubated at 25°C for a period of 8 hours, at which point larvae were observed for characteristics indicative of pupation.

Gene expression analysis. As previously described (Kenney et al., 2019), RNA was extracted from five flies or larvae, or the entirety of the activated nematodes. Isolation was achieved via homogenization in TRIzol reagent (Ambion, Life Technologies), where

IJs were freeze-thawed at -80°C for four repetitions prior to pestle homogenization to enhance yield. Reverse transcription was performed on 1 μg of total RNA using a High-

Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR

(qPCR) reactions were conducted and monitored with a CFX96 Real-Time System,

C1000 Thermal Cycler (Bio-Rad) with the following cycling conditions: 95°C for 2 min,

40 repetitions of 95°C for 15 sec followed by 61°C for 30 sec, and then one round of

95°C for 15 sec, 65°C for 5 sec, and finally 95°C for 5 sec. Each reaction well contained

10 μl GreenLink No-ROX qPCR Mix (BioLink), 40 ng of cDNA template, forward and reverse primers at a final concentration of 200 nM and ultrapure water to 20 μl total.

Primers were as follows: Diptericin (F: 5' GCTGCGCAATCGCTTCTACT 3'; R: 5'

TGGTGGAGTTGGGCTTCATG 3'), Defensin (F: 5′

CGCATAGAAGCGAGCCACATG 3′; R: 5′ GCAGTAGCCGCCTTTGAACC 3′),

Drosomycin (F: 5' GACTTGTTCGCCCTCTTCG 3'; R: 5'

CTTGCACACACGACGACAG 3'), Metchnikowin (F: 5′

TCTTGGAGCGATTTTTCTGG 3′; R: 5′ AATAAATTGGACCCGGTCTTG 3′), Attacin

(F: 5′ CAATGGCAGACACAATCTGG 3′; R: 5′ ATTCCTGGGAAGTTGCTGTG 3′)

Hb-ugt-1 (F: 5′ TTCTTAACGACACGCGACTG 3′; R: 5′

CTCGTGCTGCAGATTCTTGA 3′), Broad-Complex (F: 5′

GAGCACACCCTGCAAACAC 3′; R: 5′ GCTGCGTGAGTCCAGAGAC 3′), rp49 (F: 5'

GATGACCATCCGCCCAGCA 3'; R: 5' CGGACCGACAGCTGCTTGGC 3'), and rpl32

(F: 5′ ATCGGATAGATACCACCGCC 3′; R: 5′ TTGTGGGCATAGCACG 3′).

Statistical analysis for gene expression was performed on values derived from qPCR

-ΔΔC measurements processed according to the 2 T method (Livak and Schmittgen, 2001;

Schmittgen and Livak, 2008) with all values being normalized to rp49 in the case of flies and rpl32 for H. bacteriophora. The expression of Hb-ugt-1 in H. bacteriophora was assessed using a one-way ANOVA comparing dCt values gathered from three independent experiments. A Bonferroni multiple comparisons test was used to assign significance to comparisons between specific treatments. For all other gene expression assays, ddCt values were collected from three independent trials at two replicates per trial. Antimicrobial peptide gene expression was assessed with a one-way ANOVA as above while Broad-Complex expression was analyzed with a student’s t-test.

FIGURE LEGENDS

Figure 1. Hb-ugt-1 is upregulated in response to host-associated factors, but not development-inducing symbiotic bacteria. The expression of Hb-ugt-1 in response to assorted host factors and Photorhabdus luminescens bacteria was assessed by qPCR at the indicated time points. Approximately 1,000 axenic infective juveniles (IJs) were exposed to 25% Drosophila melanogaster line Oregon-R (A) or Manduca sexta (C) hemolymph plasma while 5,000 nematodes were injected directly into the hemocoel of live Galleria mellonella larvae (B). One thousand IJs were plated on a lawn of P.

80 luminescens as a virulence-neutral control (D). Average fold change drawn from three

-ΔΔCT independent trials and calculated according to the 2 method is shown, where error bars represent standard error (*p<0.05, **p<0.01, ***p<0.001). Graphs were generated using GraphPad Prism version 5.03 (www.graphpad.com).

Figure 2. Hb-ugt-1 is a putative UDP glycosyltransferase (UGT). (A) The amino acid sequence for Hb-UGT-1 displays sequence similarity to ecdysone glycosyltransferases. A region containing the domain associated with sugar binding is shown, where color intensity represents percent identity. The full alignment was produced with sequences from three insects; Drosophila melanogaster (NP_001246082.2), Bombyx mori

(NP_001243972.1), and Manduca sexta (XP_030029659.1), three nematodes;

Ancylostoma ceylanicum (EYC08379.1), Brugia malayi (XP_001894161.1), and

Caenorhabditis elegans (NP_500913.1), and three insect-infective viruses; Spodoptera frugiperda multiple nucleopolyhedrovirus (AAP79109.1), Agrotis ipsiolon nucleopolyhedrovirus (YP_002268062.1), and Autographa californica nucelopolyhedrovirus (NP_054044.1). (B) A maximum-likelihood phylogenetic tree was generated for the aligned sequences with MEGA-X software. The consensus tree shown was developed from 200 bootstrap replicates and numbers next to branches indicate the percentage of replicates in which the associated taxa clustered together. The alignment image was produced with Jalview version 2.11.1.0 (www.jalview.org) and the image for the phylogenetic tree was exported from MEGA-X Version 10.1.5 (megasoftware.net).

Figure 3. Heterorhabditis bacteriophora activated ES products glycosylate 20- hydroxyecdysone and contain a GTDC1 domain-containing protein. (A) Activated

ES products (Act) were assayed for glycosyltransferase activity against Ringer’s Buffer

(R) and non-activated ES product (NA) controls using a colorimetric assay. UDP-glucose and 20-hydroxyecdysone were used as the donor sugar and sugar acceptor, respectively.

All values were normalized to a negative control containing only substrate and the manufacturer-provided reaction buffer. The experiment was performed in triplicate and results are presented as phosphate input liberated from the UDP molecule (***p<0.001).

(B) ES products were separated by SDS-PAGE and labeled with anti-GTDC1 antibody to identify glycosyltransferases secreted by the nematode. The size in kilodaltons (kDa) of ladder markers is indicated on the left side of the image. The phosphate output graph was produced with GraphPad Prism version 5.03 (www.graphpad.com).

Figure 4. Recombinant Hb-UGT-1 suppresses a subset of antimicrobial peptide genes in Drosophila melanogaster. (A-E) Adult flies of the Oregon-R line of D. melanogaster were injected with approximately 7 ng of recombinant protein or BSA prior to homogenization and RNA extraction at 6-hour post injection. Expression for the indicated antimicrobial peptide genes was normalized to rp49 and fold change was calculated relative to the 0-hour time point. Average expression for three trials is shown where each trial consisted of two replicates with five flies each, three males and two females. Error bars indicate standard error and significance was assessed using a one-way

ANOVA (**p<0.01). (F) Alternatively, survival for injected RelE20 (Rel) flies was assessed every 12 hours and compared to that of the wild type (wt) w1118 line that serves

82 as their genetic background. Curves consist of average values for three trials at two replicates of 10 flies each per trial. Bars represent standard error and significance was assessed with a Mantel-Cox test (***p<0.001). All graphs were generated with GraphPad

Prism version 5.03 (www.graphpad.com).

Figure 5. Hb-ugt-1 recombinant protein suppresses Broad-Complex expression in

Drosophila melanogaster adults and larvae. (A) Adult D. melanogaster Oregon-R were injected with approximately 7 ng of recombinant Hb-UGT -1 or BSA and assessed for

Broad-Complex expression normalized to rp49 at a 6-hour post injection. (B) Third instar larvae of the same line were co-injected with approximately 5 ng of recombinant protein and 1.5 ng of 20-hydroxyecdysone prior to collection at 0.5-hour for RNA extraction and qPCR. Fold change relative to the 0-hour time point is shown for three independent trials consisting of 10 larvae total across two replicates. Error bars indicate standard error and significance was assessed using a student’s t-test (**p<0.01). Graphs were exported from

GraphPad Prism version 5.03 (www.graphpad.com).

Figure 6. Hb-UGT-1 reduces the pupation rate of third instar Drosophila melanogaster larvae. (A) Third instar larvae of Oregon-R D. melanogaster injected with

5 ng of recombinant Hb-UGT-1 or BSA were surveyed at 8-hour post-injection for immobility and spiracle inversion, which were used to indicate a commitment to pupation. Significantly fewer larvae begin pupation when injected with rHb-UGT-1 as compared to BSA. (B and C) Representative images are shown for a pupated larva featuring the characteristic spiracle inversion and a larva that has not begun pupation,

83 respectively. Melanization is present at the wounding site for both larvae. Bars indicate the average rate collected from five independent trials and a total of 73 and 77 larvae, respectively, for BSA and rHb-UGT-1 injections. Error bars represent standard error and significance was assigned by Chi-Square analysis (*p<0.05). The graph was generated using GraphPad Prism version 5.03 (www.graphpad.com).

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

SUPPLEMENTARY MATERIAL

Figure S1. Hb-ugt-1 shows sequence similarity to other ecdysone glycosyltransferases. The full-length alignment associated with the excerpt in figure 2 is shown. Color intensity represents percent identity.

Figure S2. The GTDC1 antibody labels rHb-ugt-1. An aliquot of approximately 1.8 µg of the recombinant protein was separated on an SDS-PAGE gel and subsequently labeled with anti-GTDC1 antibody via western blot. The arrow indicates the migration distance for the recombinant protein, which correlates to its predicted size of 59.5-kDa. Ladder sizes are indicated in kDa on the left side of the image.

Chapter 3: A putative lysozyme and serine carboxypeptidase from Heterorhabditis bacteriophora show differential virulence capacities in Drosophila melanogaster*

ABSTRACT

Nematode virulence factors are of interest for a variety of applications including biocontrol against insect pests and the alleviation of autoimmune diseases with nematode-derived factors. In silico “omics” techniques have generated a wealth of candidate factors that may be important in the establishment of nematode infections, although the challenge of characterizing these individual factors in vivo remains. Here we provide a fundamental characterization of a putative lysozyme and serine carboxypeptidase from the host-induced transcriptome of Heterorhabditis bacteriophora.

Both factors accelerated the mortality rate following Drosophila melanogaster infections with Photorhabdus luminescens, and both factors suppressed phenoloxidase activity in D. melanogaster hemolymph. Furthermore, the serine carboxypeptidase was lethal to a subpopulation of flies and suppressed the upregulation of antimicrobial peptides as well as phagocytosis. Together, our findings suggest that this serine carboxypeptidase possess both toxic and immunomodulatory properties while the lysozyme is likely to confer immunomodulatory, but not toxic effects.

INTRODUCTION

The early stages of nematode infection by Heterorhabditis bacteriophora can be characterized by a number of fundamental actions. The nematode will enter through natural openings or the cuticle, migrate to the hemocoel, and in Drosophila

* This chapter is in press at Developmental and Comparative Immunology 93 melanogaster, tend to move toward the anterior of the host (Dziedziech et al., 2020a).

Arguably however, the most important event of the early infection is the release of the symbiotic bacterium Photorhabdus luminescens, as this provides a source of nourishment for nematode growth and development, directly contributes to the suppression of host immunity, and eventually induces host death by septicemia (Clarke, 2020). The relative contributions of P. luminescens and H. bacteriophora to immune suppression and mortality have not been described exhaustively, but axenic nematodes are known to be capable of overwhelming the host by themselves (Hallem et al., 2007). Some insects have also demonstrated an ability to fully encapsulate and neutralize H. bacteriophora however (Ebrahimi et al., 2011), indicating that when successful, the nematode must have addressed host immunity prior to or in collaboration with bacterial intervention. Because this interaction is likely mediated by molecular effectors produced by the nematode, a search for virulence factors produced by the nematode is warranted, though this field has developed relatively recently.

Since the initial description of the genus Heterorhabditis in 1975 (Poinar, 1975), the characterization of entomopathogenic nematodes (EPNs) has been primarily concerned with defining their host range, geographic distribution, and techniques for efficiently employing these nematodes as a method of biocontrol against insect pests

(Poinar and Grewal, 2012). Following the development of new molecular technologies and the emergence of “omics”, this work is now being supplemented with genomic and transcriptomic studies aimed at identifying specific genes or gene families that might participate in the infection process (Hao et al., 2012; Moshayov et al., 2013; Bai et al.,

2013; Vadnal et al., 2017; Rougon-Cardoso et al., 2016). While invaluable to the

94 foundational understanding of potential virulence mechanisms, the information gleaned from these studies is strictly in silico, and as such requires confirmation by in vitro and in vivo approaches. To a degree, entomopathogenic nematology has addressed this gap by examining the excretory-secretory (ES) products of EPNs and identifying their effects in vivo in an insect host (Lu et al., 2017; Chang et al., 2019; Kenney et al., 2019).

Furthermore, on a smaller scale, specific genes expressed during the infective stage have been produced in recombinant form and assessed for impacts on insect immunity (Jing et al., 2010; Toubarro et al., 2013a; Toubarro et al., 2013b). Functional characterization is the ultimate goal of virulence factor identification, but as demonstrated by the relative paucity of such studies, additional and more basic approaches may be useful when mining the available wealth of omics data.

Here we provide an initial characterization of a putative serine carboxypeptidase

(Hba_11636)(Hb-sc-1) and putative lysozyme (Hba_19909)(Hb-ilys-1), which were identified as candidate virulence factors from the transcriptome of hemolymph-activated

H. bacteriophora infective juveniles (IJs) (Vadnal et al., 2017). These gene ontology categories have been identified in a variety of parasitic nematode genomes, transcriptomes, or proteomes and are therefore likely to contribute to parasitism

(Hewitson et al., 2011; Dillman et al., 2015; IHG, 2011). We examined the expression of both genes by H. bacteriophora IJs in response to representative host exposure as well as their own symbiotic bacterium, P. luminescens. This confirmed activation in response to a host and described expression during a period of constitutive growth and development.

These genes were then expressed in recombinant form and each protein was assessed for its capacity to contribute to an infection. When co-injected with an infection-relevant

95 dose of P. luminescens, both proteins hastened the onset of mortality in adult D. melanogaster, as compared to BSA. This implicated Hb-sc-1 and Hb-ilys-1 as virulence factors, but each exhibited clear differences in how they might achieve this. Both limited phenoloxidase activity, but only Hb-sc-1 was found to reduce phagocytic activity and antimicrobial peptide (AMP) upregulation, and only Hb-ilys-1 supported a higher rate of

P. luminescens proliferation in vivo.

Together, these results demonstrate a method of quickly assessing individual genes as virulence factors in a way that is easily scalable and requires only a small amount of recombinant protein. The information garnered from these types of assays allows for prioritization and selection of candidates using additional in vivo knowledge as a supplement to the fundamental data gathered from ‘omics’ studies. This will be especially important as transgenesis in EPNs is developed, as it has been in other nematode parasites and as is standard in Caneorhabditis elegans (Lok, 2012; Lok et al.,

2017; Nance and Frøkjær-Jensen, 2019). H. bacteriophora has demonstrated strong potential as a means of biocontrol against insect pests (Modic et al., 2020; Akhurst et al.,

1992), and applied knowledge of specific virulence factors may serve to increase the efficiency or host range of the nematode.

MATERIALS AND METHODS

Exposure of H. bacteriophora to infection-related stimuli

All treatments were conducted with axenic Heterorhabditis bacteriophora IJs of the strain TT01. Production of axenic nematodes was described previously in detail

(Kenney et al., 2019). Briefly, fifth or sixth instar Galleria mellonella infected with the

RET16 strain of Photorhabdus temperata were used to propagate IJs, as this species of

Photorhabdus is incapable of colonizing H. bacteriophora. IJs were collected according to the White method (White, 1927).

D. melanogaster hemolymph for the in vitro activation of H. bacteriophora was isolated from third-instar larvae. Initially, a filter for separating larvae from hemolymph was constructed by placing a small incision at the bottom of a 0.5 ml centrifuge tube using a clean razor blade. This tube was then nested in a 1.5 ml centrifuge tube and a 5 μl aliquot of a 2.5 μg/ml solution of phenylthiourea (PTU) dissolved in PBS was dispensed into the smaller tube. Following a rinse with water, D. melanogaster larvae were pinched near the mouth hooks with enough force to break the cuticle and submerged in the PBS-

PTU solution before releasing the forceps. When 20 larvae had been added to the 0.5 ml tube of the filter apparatus, hemolymph was collected by centrifugation at 17,900 x g for

30 seconds at 4°C. Collection from 20 larvae typically results in the addition of 5 μl of hemolymph to the 5 μl of PBS-PTU solution. This half-diluted solution was then again diluted two-fold with PBS-PTU and filtered through a 10 μm polyethelene filter.

Materials and solutions were kept on ice whenever possible in order to inhibit melanization, and melanized hemolymph was not used for IJ treatments. This process was repeated in triplicate in order to comfortably ensure a sufficient amount of hemolymph solution for each trial. Approximately 1,000 IJs were then collected in a 1.5 ml centrifuge tube. IJs were washed twice with water by centrifugation at 2,600 x g for

30 seconds, and 40 μl of hemolymph solution were added to the pellet after the second wash. The IJ and hemolymph mixture was agitated gently by pipetting before incubation at 28°C for the indicated periods.

Activation in vivo was performed by injecting IJs directly into the hemocoel of fifth-instar Galleria mellonella larvae. Approximately 5,000 IJs were prepared for injection as described above, except that the nematodes were first subjected to a five- minute surface-sterilization step in a 3% hypochlorite solution derived from commercial bleach. Here, this solution was generated by adding 300 μl of bleach to 10 ml of PBS.

The surface sterilized nematodes were washed three times with PBS and resuspended in

100 µl of PBS. Galleria larvae were surface-sterilized with 70% ethanol and anesthetized on ice for 15 minutes. The IJs were then loaded into an 18.5G needle affixed to a 1 ml syringe and Galleria larvae were transferred to a petri dish lined with moist filter paper.

Under a stereo microscope, Galleria were injected at a shallow angle in a segment junction and then returned to the ice for five minutes before being moved a final time to a fresh petri dish lined with slightly moist filter paper. Recovery of IJs from Galleria after the specified incubation times was achieved by dissection in a small pool of PBS. In most instances, approximately 2,000 IJs were recovered from the PBS surrounding the dissected Galleria larvae.

Lawns of the TT01 strain of P. luminescens subspecies laumondii were generated on LB agar plates seeded with a 50 μl aliquot from an overnight culture grown in liquid

LB at 28°C with shaking at 220 rpm. Plated cultures of P. luminescens were allowed to grow for 48 hours at 28°C before the introduction of H. bacteriophora IJs.

Approximately 1000 nematodes were washed twice in water and resuspended in a 100 μl aliquot of water, which was then dispersed across the surface of the lawn by pipetting individual drops onto different regions of the plate. The plated IJs were incubated on the

P. luminescens lawns in the dark on moist paper towels for various times. IJs were

98 recovered from the bacterial lawns by pipetting 5 ml of M9 buffer directly onto the plate and swirling gently to dislodge the nematodes. The plate wash was repeated twice, and the washes transferred to a 15 ml Falcon tube and centrifuged to collect the IJs.

Gene expression analysis

To quantify candidate gene expression, all IJs exposed to each treatment were recovered for RNA extraction and cDNA synthesis prior to qPCR. To enhance yield, IJs were freeze-thawed four times at -80°C. After the final thawing, the IJ pellet was homogenized with a pestle in TRIzol reagent (Ambion, Life Technologies). Samples containing 1 μg of RNA were converted to cDNA using an Applied Biosystems High-

Capacity cDNA Reverse Transcription Kit according to the manufacturer’s instructions.

Flies were processed in an identical manner, though RNA was extracted from five flies, three male and two females, which were homogenized by pestle without freeze-thawing.

Real time PCR was performed in a CFX96 Real-Time System, C1000 Thermal Cycler

(Bio-Rad). The cycling conditions were as follows: an initial denaturation step of 2 minutes at 95°C, followed by a two-part step of 15 seconds at 95°C and 30 seconds at

61°C repeated 40 times. This stage was followed by a 15-second interval at 95°C, a five second interval at 65°C, and finally a period of 5 seconds at 95°C. Each reaction well contained 40 ng of cDNA template, forward and reverse primers at 200 nM, 10 μl of

GreenLink No-ROX qPCR Mix (BioLink), and ultrapure water to a final volume of 20

μl. Primer sets used for amplification are listed in Table S1.

Protein alignments and phylogenetic trees

BioEdit software (version 7.2.5) was used to generate protein alignments using the CLUSTALW algorithm. For both pairwise and multiple alignments, gap opening, and extension penalties were set to 3 and 0.2, respectively. Where applicable, minor manual adjustments were made to the alignments provided these changes improved alignment quality without overriding the impartiality of the algorithm. Sections of alignments were visualized with JalView software (version 2.11.0). MEGA software (version 10.1.5) was used to generate phylogenetic trees by the Maximum Likelihood method with 500 bootstrap replicates.

Production and purification of recombinant H. bacteriophora candidate proteins

Recombinant candidate virulence factor genes were expressed in an Sf9 insect expression system using a pMIB/V5-His A expression vector (Invitrogen). Primers bearing KpnI and XhoI sites at the 5’ and 3’ ends, respectively, were designed for both

Hb-sc-1 and Hb-ilys-1 (Table S1) in order to produce the initial amplicons. Gel-extracted amplicons were cloned into the pMIB V5 His vector and transformed into One Shot

TOP10 chemically competent E. coli. Transformants were selected on LB agar plates containing ampicillin (100 μg/ml) and screened by colony PCR. Plasmid DNA was isolated from positive cultures using Mini Prep kits (Qiagen?) and confirmed by Sanger sequencing. Protein expression constructs were transfected into Sf9 insect cells using

Cellfectin II reagent (Invitrogen), and grown on 6-well plates containing Sf-900 II SFM supplemented with blasticidin (10 μg/ml) and gentamycin (15 μg/ml). Culture supernatants were screened by western blots using antibody against the V5 epitopes on the recombinant proteins. Positive cultures were scaled up into 300 ml liquid cultures and

100 grown for 5 days at 27°C with shaking. Culture supernatants were collected, concentrated against 8 kDa polyethylene glycol flakes two to three-fold, and dialyzed against 150 mM sodium phosphate for 16 to 20 hours at 4°C with gentle stirring. To purify recombinant protein, dialyzed culture supernatants were centrifuged, diluted two-fold in low- stringency wash buffer (50 mM NaH2PO4, 500 mM NaCl, 40 mM Imidazole, 0.5%

Tween 20), and incubated for 1 hour with 1 ml Ni-NTA agarose (Qiagen) at room temperature while rotating at 90 rpm. An affinity purification column was used to wash the recombinant protein-bound matrices with 2 volumes of high-stringency buffer (50 mM NaH2PO4, 500 mM NaCl, 100 mM imidazole, 0.5% Tween 20) and 10 volumes of low-stringency wash buffer. Recombinant proteins were eluted in eight 1 ml fractions of elution buffer (50 mM NaH2PO4, 300 mM NaCl, and 250 mM imidazole). The eluted fractions were assayed again for the presence of recombinant protein by western blot against V5 epitope. Positive fractions were combined, concentrated further against polyethylene glycol (8 kDa), and dialyzed overnight in PBS. Protein concentration was determined with a Pierce BCA Protein Assay Kit (Thermo Fisher) and samples were stored at -20°C.

Injections of flies for assessment of survival, AMP gene expression, and bacterial load

For co-injections of symbiotic bacteria and candidate virulence factors, P. luminescens was first grown at 28°C for 48 hours on MacConkey Agar (Sigma). A single colony was transferred to 10 ml of Lysogeny Broth (LB) (VWR), which was then incubated overnight in a rotary shaker set to 28°C and 220 rpm. Before use for injection,

101 overnight cultures were washed twice with PBS and corrected to an OD600 of 0.4 by dilution in PBS. The resulting P. luminescens-PBS solution was diluted four-fold in each sample of recombinant protein by mixing 0.5 μl of suspended bacteria with 1.5 μl of recombinant protein on a piece of parafilm on ice. For control injections containing recombinant protein alone, this step was performed with 0.5 μl of PBS rather than the P. luminescens-PBS solution. Immediately after mixing by pipette, the resulting co-injection solution was loaded into an oil-filled pulled glass capillary affixed to a Drummond

Nanoject III Programmable Nanoliter injector. A 69 nl aliquot containing 10 ng of recombinant protein and 50 CFUs of P. luminescens was delivered via intramesothoracic injection to 7 to 10-day old adult flies (Oregon-R strain) anesthetizatized with carbon dioxide. Injections for AMP gene expression analysis consisted of 69 nl aliquots containing 13 ng of recombinant protein. Injected flies were placed in vials containing instant Drosophila medium (Carolina) for recovery and incubation.

Phenoloxidase activity

For each treatment, Oregon-R adult D. melanogaster flies were injected with 13 ng of protein. One hour after injection, 20 flies were collected in a Pierce Spin Column

(10 μM) (ThermoFisher) on ice. A 20 μl aliquot of 2.5x protease inhibitor cocktail

(Sigma) in 0.1M sodium phosphate buffer (pH 6.6) was added to the column followed by four glass beads, sized 4 mm. Each sample was centrifuged at 10,000 rpm for 20 minutes at 4°C and the resulting supernatant transferred to a new tube containing 10 μl of 2.5x protease inhibitor on ice. To normalize extracted hemolymph, protein concentration was measured with a Pierce BCA Protein Assay Kit (Thermo Fisher) and samples were

102 diluted to 15 μg in 40 μl aliquots. CaCl2 was added to each sample to a final concentration of 5 mM, and the entire 40 μl of extracted hemolymph was added to 160 μl of fresh L-DOPA solution (20 mM in 0.1M sodium phosphate buffer pH 6.6) in a 96 well plate. Absorbance was measured at 475 nm after a 20-minute incubation at 29°C in the dark. A control containing only phosphate buffer with CaCl2 and L-DOPA was used as a blank, and absorbance values were converted to μM of dopachrome based on the molar extinction coefficient, where ԑ = 3700 M-1 cm-1 (Vermeer et al., 2012).

Quantification of phagocytic activity

Injections were carried out as described for P. luminescens co-injections, except that the bacterial solution was substituted with a 4 mg/ml suspension of pHrodo Red E. coli BioParticles Conjugate for Phagocytosis (Molecular Probes). This solution was diluted 1:4 in PBS containing candidate proteins immediately prior to injection. After a 1- hour incubation at 25°C, the region associated with the pericardial nephrocytes on the dorsal side of the abdomen was imaged with a Zyla (ANDOR) 5.5 camera affixed to a

Nikon ECLIPSE Ni microscope at 10x magnification. Area-normalized corrected total fluorescence of isolated red channels was measured using ImageJ software.

Statistical analysis

-ΔΔC For gene expression analyses, values were processed according to the 2 T method (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008). Cycle threshold values were normalized to rpl32 and rp49 for experiments with H. bacteriophora and D. melanogaster, respectively. Significant differences were detected with a one-way

103

ANOVA test of ddCt values from three independent experiments. This test was supplemented with a Bonferroni multiple comparisons test to assign significance levels to differences between individual time points. Curves in survival assays were distinguished statistically based on a Log-rank (Mantel Cox) test. Because there were only two treatments in the antimicrobial peptide expression assay, differences were determined using a Student’s t-test while a one-way ANOVA was used for the phenoloxidase and phagocytosis assays. All tests were carried out using GraphPad Prism version 5.03 and error bars in each figure represent standard error.

RESULTS

Hb-sc-1 and Hb-ilys-1 are responsive to host factors and Photorhabdus

To confirm the roles of the H. bacteriophora putative lysozyme and serine carboxypeptidase during infections, we examined the expression of the genes encoding these factors by qPCR following the exposure of H. bacteriophora IJs to 25% D. melanogaster hemolymph plasma, the hemocoel of live fifth-instar Galleria mellonella, or a lawn of P. luminescens. The timing of measurements was based on the original nine- hour incubation that was used to identify these genes (Vadnal et al., 2017). In agreement with these previous results, both genes were significantly upregulated in response to D. melanogaster hemolymph (p<0.001 for Hb-sc-1) as well as the Galleria hemocoel

(p<0.05 for Hb-ilys-1 and p<0.001 for Hb-sc-1) within a period of nine hours (Fig. 1A,

1B, 1D, and 1E). Notable variations include the slightly earlier upregulation of Hb-ilys-1 in D. melanogaster hemolymph within five hours (p<0.01) (Fig. 1A) and the approximately ten-fold upregulation of Hb-sc-1 one hour after injection into Galleria

104

(Fig. 1E). Exposure to P. luminescens resulted in robust upregulation of Hb-ilys-1 between nine and 72 hours after placement onto bacterial lawns (Fig. 1C). Alternatively,

Hb-sc-1 expression peaked at nine hours and subsequently decreased, returning by 72 hours to a level equivalent to baseline expression. These results demonstrate that both candidate genes are upregulated rapidly in response to host factors as well as to P. luminescens. These genes are then clearly associated with the onset of an infection, though their role in virulence as opposed to growth and development cannot be discerned from this expression data alone. Instead, this distinction is necessarily deferred to the subsequent assays focused on immune activity. Briefly, it should be noted that upregulation in response to P. luminescens is not necessarily disqualifying for consideration as a virulence factor. The symbiotic bacterium is not a host factor, but it is also not likely that H. bacteriophora will encounter this concentration of P. luminescens outside of an infection.

Hb-ilys-1 and Hb-sc-1 encode conserved domains for an i-type lysozyme and a serine carboxypeptidase, respectively

Based on a BlastP search, Hb-ilys-1 aligned with invertebrate-type (i-type) lysozymes (InterPro family IPR008597). In support of this, Hb-ilys-1 was aligned with lysozymes, lysozyme-like proteins, and i-type lysozymes from C. elegans, and found to cluster with i-type lysozymes (Fig. 2A). Membership in this family implies that the protein is capable of muramidase and isopeptidase activity. Interestingly, while Hb-ilys-1 contains the necessary residues for muramidase activity (Fig. 2B), it does not contain a

Serine residue necessary for isopeptidase activity (Fig. 2C). Instead, this residue has been

105 substituted by Alanine, as is the case for the C. elegans i-type lysozymes with the exception of ilys-4 (Gravato-Nobre et al., 2016). The same method revealed that Hb-sc-1 belongs to the Peptidase S10, serine carboxypeptidase gene family (IPR001563) and aligned with other nematode members of this family (Fig. 2D). The analysis also revealed that Hb-sc-1 contains the conserved serine residue in the center of the serine carboxypeptidase motif (Fig. 2E) (Huang et al., 2017). Membership in these families does not suggest a specific mechanism of action that may promote infection, but the prediction that they are catalytically active generates a broad variety of possibilities that could make the deployment of these proteins advantageous to H. bacteriophora.

Both Hb-SC-1 and Hb-ILYS-1 increase the severity of Photorhabdus infections

Evidence suggests that when H. bacteriophora releases P. luminescens into the hemocoel of a host, a bacterial subpopulation resistant to host antimicrobial peptides seeds the population that eventually overwhelms the insect (Mouammine et al., 2017).

We therefore hypothesized that if candidate virulence proteins are immunosuppressive, they bolster this subpopulation and allow an infection to progress more quickly. Adult D. melanogaster flies succumbed to P. luminescens infection more quickly when bacteria were co-injected with recombinant Hb-sc-1 or Hb-ilys-1 (rHb-SC-1 and rHb-ILYS-1, respectively) (Fig. 3A) (p<0.0001). In addition, rHb-sc-1 was found to be lethal to approximately 20% of flies when injected on its own, as compared to BSA. Interestingly however, the initial 50 CFU inoculum of P. luminescens only proliferated more rapidly when co-injected with rHb-ilys-1, as determined by the abundance of P. luminescens

16srRNA and mcf1 transcript (Fig. 3B and 3C). Photorhabdus luminescens transcript

106 levels appeared elevated in flies co-injected with bacteria and rHb-SC-1, but not to a degree that was significantly different (p>0.05) from levels in those injected with BSA.

Because the recombinant proteins accelerated the P. luminescens proliferation, it is possible that these proteins suppress immunity or otherwise directly contribute to the increased mortality we observed. The differences in their capacity to support P. luminescens populations indicate that this is likely achieved through different mechanisms.

Adult rHb-SC-1-injected flies exhibit subdued antimicrobial peptide responses

A number of AMP genes are downregulated in response to H. bacteriophora infection, but upregulated in response to P. luminescens (Castillo et al., 2015), indicating that these nematodes might be able to counteract AMP upregulation. While we have found that rHb-ILYS-1 does not substantially limit AMP upregulation (Kenney et al.

2020), Hb-sc-1 may be at least partially responsible for this effect. To examine this possibility, the expression of a panel of AMP genes was measured six hours after injecting rHb-SC-1, as this interval correlates to relatively high expression for these genes (Lemaitre et al., 1997). The immune deficiency (Imd) pathway-associated genes

Diptericin and Attacin (Fig. 4A and 4B) were upregulated to a significantly lower degree when flies were injected with rHb-SC-1 than to BSA. Similarly, upregulation of the Toll pathway-associated gene Drosomycin was diminished by rHb-SC-1 injection (Fig. 4D), though the expression of Metchnikowin was not significantly affected (Fig. 4C). This indicates that the immune response is not adequately activated when the flies have been administered with rHb-SC-1, though these results alone do not indicate whether this

107 restriction is the result of specific suppression or indiscriminate damage caused by proteolytic activity of the putative serine carboxypeptidase.

Recombinant Hb-SC-1 and Hb-ILYS-1 suppress the phenoloxidase response in flies

Melanization mediated by phenoloxidase is a crucial part of the D. melanogaster immune response, being necessary for overcoming microbial infections (Binggeli et al.,

2014). The level of phenoloxidase activity in D. melanogaster hemolymph can be quantified by a co-incubation of hemolymph and L-DOPA, where phenoloxidase converts L-DOPA to dopachrome, which can be detected spectrophotometrically. When adult flies were injected with rHb-SC-1 and rHb-ILYS-1, extracted hemolymph exhibited significantly less (p<0.05) phenoloxidase activity, as compared to that from the control

BSA-infected flies (Fig. 5). While both recombinant proteins were associated with a roughly two-fold reduction in dopachrome conversion, the effects produced by rHb-SC-1 and rHb-ILYS-1 were not significantly different from each other. Although the mechanisms of action remain unknown, these observations suggest that both rHb-SC-1 and rHb-ILYS-1 possess immunosuppressive properties.

Recombinant rHb-SC-1 interferes with phagocytosis

Phagocytic activity in D. melanogaster can be visualized and quantified by injecting commercially available conjugates of E. coli and particles that fluoresce when exposed to the low-pH environment of the lysosome. After co-injecting these conjugates with the recombinant candidate virulence factors, we found that the resulting fluorescence from co-injection with rHb-sc-1 (Fig. 6A) was significantly lower than that

108 seen with either rHb-ILYS-1 or BSA (Fig. 6B) (p<0.05), suggesting decreased phagocytic activity. This finding further implicates Hb-sc-1 as a virulence factor gene and indicates that rHb-SC-1 might broadly interfe with the cellular response of the fly, as crystal cells are largely responsible for the release of phenoloxidase in the hemolymph

(Dziedziech et al., 2020b).

DISCUSSION

The principal function of lysozymes is the disruption of bacterial cell walls, which is achieved through muramidase activity involving the hydrolysis of β-1,4-glycosidic bonds between N-acetylmuramic acid and N-acetyl glucosamine in peptidoglycan chains

(Ko et al., 2016). This definition describes a general activity, but the effects of lysozymes can be more diverse, especially when considering other classes within the group.

Lysozyme-like proteins, which generally do not contain the residues required for muramidase activity, are bacteriostatic rather than bactericidal, an effect that apparently stems from peptidoglycan binding as opposed to hydrolysis (Gandhe et al., 2007). There are also invertebrate-type (i-type) lysozymes that are predicted to have isopeptidase activity in addition to muramidase activity, though the mechanism of isopeptidase cleavage has not been described (Manuvera et al., 2015).

Furthermore, describing the activity of lysozymes has proven to be far more complex than simply identifying catalytic residues. An i-type lysozyme from the ladybird beetle Harmonia axyridis has the putative residues required for isopeptidase activity, but lacks activity against known isopeptidase substrates (Beckert et al., 2016). An i-type lysozyme from the sea cucumber S. japonicus also limits the growth of an assortment of

109

Gram-positive and Gram-negative bacteria, but its antibacterial activity is increased by up to 25% following a heat-inactivation step that fully ablates muramidase activity (Cong et al., 2009). Interestingly, lysozyme M in mice is also bactericidal against both Gram- positive and Gram-negative bacteria following the substitution of a catalytic residue that ablates muramidase activity (Nash et al., 2006).

This apparently indiscrete nature of lysozyme activities introduces some difficulty in characterizing new lysozymes, including Hb-ILYS-1. We therefore opted to focus on the broader, potential immuno-modulatory effects of the recombinant form of this protein. One initial result that casts doubt on the idea that Hb-ILYS-1 functions as a virulence factor is the consistent upregulation in response to P. luminescens alone. This finding suggests a possible digestive role for Hb-ILYS-1, which is supported by the role of P. luminescens as the primary food source for the nematode during an infection, and by a digestive role of invertebrate lysozymes in C. elegans (Park et al., 2017; Gravato-

Nobre et al., 2017). However, if this were the sole effect of Hb-ILYS-1, co-injection of this enzyme with P. luminescens should be strongly protective for the insect, while in fact, the opposite was observed, as the bacterial population instead proliferated more rapidly. In this case at least, rHb-ILYS-1 is not likely to be active against P. luminescens.

Importantly, P. luminescens produces O-acetylated peptidoglycan, which conveys resistance to lysozymes (Sychantha et al., 2018; Weadge et al., 2005), and thus the bacteria possibly switch phases, altering the regulation of this modification as beneficial for symbiosis with the nematode or virulence against the host.

The ability of rHb-ILYS-1 to suppress phenoloxidase activity, as measured by an

L-DOPA conversion assay, supports a role for Hb-ilys-1 in virulence. There are a number

110 of mechanisms by which this could be achieved, though it should be noted that some lysozyme-like proteins are capable of scavenging free radicals (Narmadha and Yenugu,

2016), which are byproducts of DOPA oxidation by phenoloxidase (Komarov et al.,

2005). Interestingly, this implies that lysozymes not only target phenoloxidase activation, but also a portion of its downstream effects. Overall, these results demonstrate a potential role of Hb-ilys-1 in virulence, and especially immunomodulation, though more work would be required to determine the mechanism by which these effects are achieved.

The proteolytic activity of serine proteases allows for a large assortment of possible effects, both in self-modulatory process such as digestion, fertilization, or development, and virulence processes including anticoagulation, immune evasion, or tissue invasion (Yang et al., 2015). The participation of serine proteases in virulence is well documented, having been identified in the secreted products of Onchocerca L3 larvae (Lackey et al., 1989) and Trichuris muris (Hasnain et al., 2012), the transcriptome of the phytoparasitic nematode Radopholus similis (Huang et al., 2017), and the venom proteins of the D. melanogaster-infective parasitoid wasp Pachycrepoideus vindemmiae

(Yang et al., 2020). Moreover, a number of serine proteases from the entomopathogenic nematode Steinernema carpocapsae have been thoroughly characterized and found to participate in the suppression of prophenoloxidase, the induction of apoptosis, and the invasion of host tissues (Balasubramanian et al., 2009; Toubarro et al., 2009; Toubarro et al., 2010). Our present findings support a role for Hb-sc-1 in virulence, as it was found to promote an infection by P. luminescens, suppress phenoloxidase activity, limit AMP upregulation, and additionally suppress phagocytosis. Of note, a serine protease in the secreted products of Brugia malayi suppresses granulocyte chemotaxis by cleaving the

111 complement component C5a, and an interesting line of future research would be to determine whether Hb-sc-1 has a similar effect on the analogous TEP6 of D. melanogaster, which promotes phagocytosis in some instances (Rees-Roberts et al.,

2009; Shokal and Eleftherianos, 2017). The mechanism of action of Hb-sc-1 similarly cannot be specifically determined from our data, but based on its broad immunosuppressive capacity and mild lethality, this putative serine carboxypeptidase would likely be a strong candidate for enhancing the virulence of H. bacteriophora against an insect host.

Collectively, our present findings permit important distinctions to be made regarding candidate virulence genes. We show that both Hb-sc-1 and Hb-ilys-1 are likely to be involved in virulence, but also that the effects of rHb-SC-1 appear to be damaging enough to induce mortality while rHb-ILYS-1 appears to be more strictly immunomodulatory. Based on this information, Hb-sc-1 may be a better candidate for improving the ability of H. bacteriophora to control insect pests and Hb-ilys-1 may be of more interest to those combing nematode products for immunomodulators that could be useful in controlling autoimmune diseases like asthma or inflammatory bowel disease

(Zakeri et al., 2018). Furthermore, while these assays were conducted in Drosophila, the observed effects should be comparable in other hosts, as immune regulation is achieved through similar mechanisms in other insects likely to be parasitized by H. bacteriophora.

The Lepidopteran Bombyx mori, for instance, carries homologs to Imd pathway components, which also appear to regulate AMP expression (Tanaka et al., 2007). By accumulating basic virulence information for a wider variety of proteins, this type of

112 characterization may then help to bridge the gap between the growing expanse of

“omics” data and the downstream application of parasite virulence factors.

FIGURE LEGENDS

Figure 1. Heterorhabditis bacteriophora candidate virulence factors respond dynamically to infection-related stimuli. The expression of Hb-ilys-1 (A-C) and Hb-sc-

1 (D-F) was measured following exposure of infective juveniles (IJs) to 25% Drosophila melanogaster strain Oregon R hemolymph (A and D), the hemocoels of live fifth instar

Galleria mellonella larvae (B and E) or a lawn of the nematode’s symbiotic bacterium,

Photorhabdus luminescens (C and F). RNA was extracted from 5,000 IJs isolated from dissected G. mellonella or 1,000 IJs collected from D. melanogaster hemolymph or a P. luminescens lawn and processed for gene expression analysis by qPCR at the indicated times. Columns indicate average fold change determined with the 2-ΔΔCT method and error bars report standard error. Significance was assigned using a one-way ANOVA for values spanning three independent trials (*p<0.05, **p<0.01, ***p<0.001). Asterisks directly above error bars indicate significance as compared to baseline values.

Figure 2. Phylogenetic reconstruction and alignment of Heterorhabditis bacteriophora Hb-ILYS-1 with nematode invertebrate-type lysozymes and Hb-SC-1 with serine carboxypeptidases. Maximum-likelihood phylogenetic trees were generated for each candidate virulence factor and related nematode proteins based on 500 bootstrap replicates following a CLUSTALW alignment. The percentage of replicates in which taxa clustered together is indicated adjacent to branching points. (A) Hb-ilys-1 was

113 aligned with lysozymes (lys), lysozyme-like proteins (lys-like), and invertebrate-type lysozymes (ilys) from Caenorhabditis elegans (ilys-2 (NP_500207.1), ilys-3

(NP_500206.1), ilys-4 (NP_501313.2), ilys-6 (NP_500470.2), lys-4 (NP_502192.1), lys-6

(NP_502194.1), lys-8 (NP_495083.1), lys-10 (NP_501405.1), lys-1 (NP_505642.1), lys-2

(NP_505643.1), lys-5 (NP_502193.1), lys-7 (NP_503972.1)). The glutamic acid and aspartic acid residues required for muramidase activity in lysozymes are indicated by asterisks (B), as well as the serine and histidine residues necessary for isopeptidase activity (C). The intensity of the purple columns in alignments indicates the percent identity across sequences. (D) Hb-SC-1 was aligned with serine carboxypeptidases from free-living nematodes (Pristionchus pacificus (PDM84856.1), Diploscapter pachys

(PAV76124.1), C. elegans (NP_496507.1), and C. briggsae (XP_002631311.1)) and fellow parasites (Radopholus similis (AIC75882.1), Brugia malayi (XP_001900088.1),

Steinernema carpocapsae (ADZ30828.1), Haemonchus contortus (CDJ88056.1),

Ancylostoma caninum (RCN35633.1), and Necator americanus (ETN85040.1)). (E) A section of the alignment containing the catalytically active serine residue, labeled with an asterisk, is shown.

Figure 3. Heterorhabditis bacteriophora Hb-ILYS-1 and Hb-SC-1 both hasten mortality induced by Photorhabdus luminescens, but only Hb-ilys-1 is associated with a higher bacterial load. D. melanogaster flies were co-injected with 10 ng of recombinant candidate proteins (Hb-SC-1 or Hb-ILYS-1), or BSA and approximately 50

CFUs of P. luminescens (BSA-Pl, Hb-sc-1-Pl, Hb-ilys-1-Pl) (A). This mixture was produced by combining quadruple-concentrated bacteria with candidate proteins in a 1:4

114 suspension. Control injections of the individual candidate proteins or BSA were produced in the same manner, but with PBS alone rather than a PBS-P. luminescens solution.

Observations for survival were made at 12 hours post-injection (hpi) and then every hour after 24 until 33, as this is the period in which mortality events are most concentrated.

Two final observations were made at 48 and 72 hours. Points are present on the curve when mortality events were observed and at multiples of 24 hours. Curves were produced with observations taken over three independent trials consisting of 10 males and 10 females each per treatment. Significance was determined using a Log-rank (Mantel-Cox) test (***p<0.001). Following the same injection scheme, the Photorhabdus-specific bacterial load was also assessed at 14 hpi by qPCR with primers specific to the P. luminescens 16S rRNA (B) and mcf1 (C) genes normalized to rp49. Each column shows the average fold-change in P. luminescens gene abundance between 0 and 14 hpi while error bars depict standard error. Significance was determined using a one-way ANOVA comparing measurements collected from three independent trials consisting of two technical replicates at five flies per replicate (**p<0.01).

Figure 4. Drosophila antimicrobial peptide upregulation is diminished following exposure to rHb-SC-1. Oregon R Drosophila melanogaster flies were injected with 13 ng of recombinant Hb-SC-1 or a BSA control and processed at 6 hpi for measurements of

Diptericin (A), Attacin (B), Metchnikowin (C), and Drosomycin (D) expression via qPCR. Each column indicates average fold change over the 0-hour measurement for the same treatment. Error bars represent standard error as calculated from three independent

115 trials at two replicates per trial, where each replicate consists of five flies. Significance levels were assigned using a Student’s t-test (*p<0.05) (**p<0.01).

Figure 5. Heterorhabditis bacteriophora Hb-ILYS-1 and Hb-SC-1 inhibit phenoloxidase activity. D. melanogaster flies were injected with 13 ng of either of the recombinant candidate virulence factors, Hb-SC-1 or Hb-ILYS-1, or BSA. At 1 hpi, the combined hemolymph of 20 flies was collected and assessed for their capacity to convert

L-DOPA to dopachrome, as identified by absorbance measurements at 475 nm. Columns indicate average values for five independent trials, error bars show standard error, and significance was assigned via a one-way ANOVA test (*p<0.05).

Figure 6. Heterorhabditis bacteriophora Hb-SC-1 suppresses phagocytosis. D. melanogaster flies were injected with a 69 nl aliquot containing 10 ng of recombinant candidate protein and pHrodo E. coli conjugates at a concentration of 1 mg/mL. The region associated with the pericardial nephrocytes was imaged at 1 hpi with fluorescence microscopy at 10x magnification. Representative isolated red channel images are shown

(A). Corrected total fluorescence was then measured for each image using ImageJ software and accumulated values from four independent trials at four flies per treatment per trial were compared with a one-way ANOVA (*p<0.05) (B). Error bars represent standard error.

116

Figure 1

117

Figure 2

118

Figure 3

119

Figure 4

120

Figure 5

121

Figure 6

122

SUPPLEMENTARY MATERIAL

Table S1. List of primers used for expression analyses and cloning. Forward (F) and reverse (R) primers are shown for sets targeting Heterorhabditis bacteriophora, Photorhabdus luminescens, and Drosophila melanogaster. All sequences are printed in the 5′ to 3′ direction.

H. bacteriophora Target Primer Sequence (5′ to 3′) Hb-ilys-1 F TCTTGCGGATATTATCAAATAAAGC R GCGATTTATATAGGCTTTGACACA Hb-sc-1 F TGGAGATGACCAGACTGCTTT R CCGCCATATGATTCTCCAGT rpl32 F ATCGGATAGATACCACCGCC R TTGTGGGCATAGCACGC Hb-ilys-1 F CTTGGTACCCAATTGCCTTCATTGTATTTG (KpnI/XhoI) R AGACTCGAGCGAACAGCCACAGCACTTTTTGA Hb-sc-1 (KpnI/XhoI) F CTTGGTACCTCTTATTACCAATCTACCTGG R AGACTCGAGGAAAGACATAAGGGTATCTAC

P. luminescens Target Primer Sequence (5′ to 3′) mcf1 F AAGGAGGTCAATGCTCGCTAC R GACACAACTAATCTGCCGTTCTC 16S rRNA F ACAGAGTTGGATCTTGACGTTACCC R AATCTTGTTTGCTCCCCACGCTT

D. melanogaster Target Primer Sequence (5′ to 3′) Diptericin F GCTGCGCAATCGCTTCTACT R TGGTGGAGTTGGGCTTCATG Attacin F CAATGGCAGACACAATCTGG R ATTCCTGGGAAGTTGCTGTG Drosomycin F GACTTGTTCGCCCTCTTCG R CTTGCACACACGACGACAG Metchnikowin F TCTTGGAGCGATTTTTCTGG R AATAAATTGGACCCGGTCTTG rp49 F GATGACCATCCGCCCAGCA R CGGACCGACAGCTGCTTGGC

123

Discussion

Between Steinernema and Heterorhabditis species of EPNs, Steinernematids tend to attract slightly more research interest. A search of the PubMed database currently returns 30 percent more entries for “Steinernema” than for “Heterorhabditis”, and a likely explanation is that Steinernematids induce higher rates of mortality in insect species more commonly used in a laboratory setting. This rationale does of course justify the use and study of Steinernema species, but it also fails to capture the aspects of

Heterorhabditis species that make their study imperative. As members of Clade V of the phylum Nematoda, Heterorhabditids are more closely related to both C. elegans and the

Strongylids (Sommer and Streit, 2011), making the genetic tools of C. elegans and comparisons to important vertebrate parasites more applicable. Overall, this position makes Heterorhabditids useful as models for identifying genetic features that contribute to the emergence of a parasitic lifestyle, and accordingly, a number of transcriptomic studies have examined expression patterns in H. bacteriophora that relate to virulence

(Adhikari et al., 2009; Hao et al., 2012; Vadnal et al., 2017). Furthermore, the ES products of H. bacteriophora have been shown to suppress the Imd pathway in D. melanogaster (Kenney et al., 2019) as well as phenoloxidase activity in G. mellonella

(Eliáš et al., 2020), demonstrating that this species does produce immunomodulatory factors that would be advantageous for establishing an infection. Together, these “omics” studies and host-side investigations of ES product effects have opened a new space of inquiry. As a means of bridging these pools of information, candidates identified in silico can be assessed for their individual contributions to the effects of bulk ES products. A putative UDP-glycosyltransferase, invertebrate-type lysozyme, and serine

124 carboxypeptidase have now been characterized in this manner, and each has demonstrated a unique array of immunomodulatory capacities.

The upregulation of an ecdysteroid UGT by H. bacteriophora in response to host hemolymph illustrates the ambiguity that can arise from the predicted function of a candidate virulence gene. Ecdysteroids have a well-established role in the onset of molting in insects (Sonobe and Ito, 2009), and likewise the nematode Brugia malayi also appears to use ecdysone signaling as a regulator of molting and fertility (Tzertzinis et al.,

2010). A sensible hypothesis might be that H. bacteriophora similarly produces this UGT to moderate its development, and that this is a mechanism shared between the insect and nematode members of the Ecdysozoan clade. The complication to this idea is that numerous entomopathogenic baculoviruses encode an ecdysteroid UGT in their genome, and that in these viruses the UGT acts as a virulence factor by conjugating the host molting hormone, ecdysone, with UDP-glucose, thus inactivating the hormone and preventing the insect from molting (O’Reilly, 1995). Distinguishing between these functions based on sequence data alone will be impossible; in the case of baculovirus

UGTs, there is even evidence that this gene was acquired from lepidopteran insects through horizontal gene transfer (Hughes, 2013), so the same gene can have two different functions depending on the timing of expression. In order to resolve the question of how the H. bacteriophora UGT (Hb-ugt-1) might participate in an infection, the recombinant protein was injected into D. melanogaster flies and larvae, which resulted in reduced antimicrobial peptide upregulation, suppressed expression of the ecdysone-associated transcription factor Broad-Complex, and delayed pupation (Kenney et al., 2020). While seemingly disparate, these effects are closely related and could all follow from the

125 activity of a UGT. The suppression of Broad-Complex and the limited upregulation of

AMPs are both consistent with ecdysone inactivation. When ecdysone binds to its receptor, EcR, the receptor translocates to the nucleus and promotes the expression of several other transcription factors, including Broad-Complex, which can subsequently induce the expression of the Imd pathway receptor PGRP-LC, as well as a number of

AMP genes, independently of Imd pathway activity (Rus et al., 2013). Delayed pupation could likewise be explained by ecdysone inactivation in that if the larval ecdysone titer does not surpass the necessary threshold, the larva will not molt (Wismar et al., 2000).

Taken along with the observations that H. bacteriophora does not readily upregulate Hb- ugt-1 in response to its growth-inducing symbiont P. luminescens and that the ES products of the hemolymph-activated IJ contain a glycosyltransferase, these findings indicate that in this setting the UGT is functioning as a virulence factor. By inactivating ecdysone through the secretion of a UGT, H. bacteriophora appears to prevent the expression of AMPs that might otherwise contribute to resistance to Photorhabdus.

Further work could confirm this idea and determine whether this activity also reduces a portion of phenoloxidase activity attributable to Imd-based JNK activity. More work is also required to determine whether Hb-ugt-1 participates in the regulation of development in Heterorhabditis, but the fact that it can subvert immunity in an insect shows that molecular innovation is not required if existing factors can be opportunistically repurposed as virulence factors. Ecdysone signaling is a powerful regulatory system in insects, and through shared evolutionary history, nematodes already have the capacity to manipulate its activity. The nematode can then easily manipulate host-parasite interactions by simply secreting this factor into host hemolymph.

126

Lysozymes similarly require a characterization in vivo to determine whether the assortment of activities attributed to these proteins could contribute to the progress of an infection. Based on their ability to bind and degrade peptidoglycan, lysozymes can act as potent antimicrobial effectors (Ko et al., 2016). In C. elegans, this activity of lysozymes has been shown to contribute to both digestion and immunity (Boehnisch et al., 2011), and while a similar role in H. bacteriophora cannot be ruled out, it is also possible that

Hb-ilys-1 is secreted into the hemolymph of a host, which is supported by the presence of a secretion signal at the N-terminus of the protein sequence and the presence of proteins smaller than 25 kDa in the activated products of H. bacteriophora (Kenney et al., 2019)

(the predicted size of Hb-ILYS-1 is approximately 15 kDa). A secreted lysozyme could potentially have an immunomodulatory function, and one mechanism that might contribute to this is a reduction in peptidoglycan (PGN) concentration in the gut or hemolymph. A growing population of Gram-positive bacteria, like the Lactobacillales of the Drosophila gut microbiome (Bost et al., 2018), can shed as much as 50% of its PGN during cell division (Gravato-Nobre et al., 2016). By secreting a lysozyme, H. bacteriophora might promote the clearance of endogenous PGN and thereby reduce the activation of innate immune responses that normally control native gut flora (Ragland and Criss, 2017). A general decrease in innate immune activity would support the finding that Photorhabdus proliferated more rapidly in D. melanogaster when co-injected with rHb-ILYS-1. Alternatively, lysozymes have also been found to directly bind factors that generate reactive oxygen species (Liu et al., 2006). If H. bacteriophora were able to secrete a lysozyme with the same ability, this could contribute greatly to the survival of the nematode in a melanized capsule, where oxidative stress is a central challenge.

127

Importantly, injection of rHb-ILYS-1 was found to inhibit phenoloxidase activity, though more work is required to identify a specific mechanism for how this is achieved. An interesting technical possibility is that the reduction of phenoloxidase activity observed upon rHb-ILYS-1 injection stemmed from a reduction in PGN concentration rather than a direct interference with prophenoloxidase activation. The L-DOPA-based assay used here to determine phenoloxidase activity has also been developed into an assay used to quantify PGN levels in human plasma (Kobayashi et al., 2000). This method is based on mixing human plasma with Bombyx mori hemolymph plasma, where the association between insect phenoloxidase activity and PGN concentration is apparently close enough that one can be used as a strong predictor of the other. Generally, then, Hb-ilys-1 does appear to function as a virulence factor, though in a strictly immunomodulatory sense, as the recombinant protein was not found to be lethal. This gene is therefore a promising candidate for further characterization of its immunomodulatory properties and its participation in host-parasite interactions. Another interesting avenue of future research would be to examine the interactions between Hb-ILYS-1 and Photorhabdus. While O- acetylation is a feature of P. luminescens PGN, and this modification renders the bacteria resistant to lysozymes (Sychantha et al., 2018; Weadge et al., 2005), the relationship between this O-acetylation and the phase of Photorhabdus has not been explored. If the non-virulent phase of Photorhabdus is susceptible, H. bacteriophora could potentially use Hb-ILYS-1 to proactively “train” its symbiont into a population composed primarily of the virulent phase so that reproduction of the bacteria is more efficient when exposed to AMPs. This concept would agree with our observation of more rapid bacterial growth when co-injected with rHb-ILYS-1. Nematode-driven selection could also explain the

128 tendency of Photorhabdus to switch phases when grown under in vitro conditions (Han and Ehlers, 2001). However, accelerated growth in vivo may simply be the result of decreased competition from lysozyme-susceptible insect-commensal bacteria.

A number of protease families are expanded in clade V parasitic nematodes, including astacins and cathepsin proteases (IHG, 2019), which are believed to participate in the digestion of host blood and tissues. An astacin-like metalloprotease from A. caninum has been shown to digest connective tissue substrates like collagen (Williamson et al., 2006), and three different types of proteases from the same nematode are known to be capable of digesting hemoglobin (Williamson et al., 2004). A similar role for secreted proteases from H. bacteriophora is a distinct possibility, especially considering the finding that a serine protease from S. carpocapsae participates in tissue invasion

(Toubarro et al., 2010). Through an assortment of assays, rHb-SC-1 was demonstrated to be lethal to a subpopulation of susceptible flies, prevent the full upregulation of antimicrobial peptides, limit phenoloxidase activity, and suppress phagocytosis. There are studies that have identified mechanisms that could lead to the protease-induced suppression of specific branches of immunity, for example the degradation of complement factors by carboxypeptidases in B. malayi secreted products (Rees-Roberts et al., 2009), but the variety of immune response being affected by Hb-sc-1 indicate a more general mode of activity. This leaves a number of questions unanswered, for instance how each of these branches is being physically affected and whether the nematode can produce this amount of Hb-sc-1 during a natural infection. Based on the extent of damage caused by rHb-SC-1, however, it is clearly a suitable candidate for enhancing H. bacteriophora virulence in efforts toward the biocontrol of insect pests. As

129 methods of transformation improve, Hb-sc-1 could be examined for its ability to enhance the virulence of H. bacteriophora in vivo against a variety of hosts. Furthermore, based on its expression profile showing strong activation in response to host factors, this gene could be a useful case for understanding how parasite effectors are regulated and to which host factors they respond. This information will be crucial to designing transgenic systems that strongly upregulate inserted virulence genes in appropriate contexts.

The phylogenetic relationships of H. bacteriophora make it a useful node for identifying genetic changes that contribute to the emergence of parasitism, and indeed a number of genomic and transcriptomic studies have highlighted large groups of genes that may be relevant to the transition from free-living microbivore to obligate parasite

(Adhikari et al., 2009; Hao et al., 2012; Vadnal et al., 2017). Making predictions about whether an individual candidate gene participates in host-parasite interactions is not always possible, as most genes typically also have functions in regulating the parasite’s own physiology. The characterizations of these three H. bacteriophora virulence candidates represent a method of determining whether a gene can participate in an infection, and can make some distinctions about how this is achieved. Furthermore, these assays can be conducted with established Drosophila protocols and small amounts of recombinant protein. The characterization of larger groups of candidates in this manner could eventually allow for further categorization along lines of lethality, immunomodulatory capacity, and the specificity of effects. With this knowledge, the evaluation of proteins for downstream functions, like the biocontrol of insect pests or the alleviation of vertebrate infections, will be better informed and hopefully more efficient.

130

References

Adhikari, B.N., Lin, C.Y., Bai, X., Ciche, T.A., Grewal, P.S., Dillman, A.R., Chaston, J.M., Shapiro-Ilan, D.I., Bilgrami, A.L., Gaugler, R., Sternberg, P.W., Adams, B.J., 2009. Transcriptional profiling of trait deterioration in the insect pathogenic nematode Heterorhabditis bacteriophora. BMC Genomics 10, 1–18. Aguinaldo, A.M.A., Turbeville, J.M., Linford, L.S., Rivera, M.C., Garey, J.R., Raff, R.A., Lake, J.A., 1997. Evidence for a clade of nematodes, arthropods and other moulting animals. Nature 387, 489–493. Ahn, S.-J., Vogel, H., Heckel, D.G., 2012. Comparative analysis of the UDP- glycosyltransferase multigene family in insects. Insect Biochem. Mol. Biol. 42, 133–147. Akhurst, R., Bedding, R., Bull, R., Smith, D., 1992. An epizootic of Heterorhabditis spp. (Heterorhabditidae : Nematoda) in sugar cane scarabaeids (Coleoptera). Fundam. Appl. Nematol. 15, 71–73. Akhurst, R.J., Mourant, R.G., Baud, L., Boemare, N.E., 1996. Phenotypic and DNA relatedness between nematode symbionts and clinical strains of the genus Photorhabdus (Enterobacteriaceae). Int. J. Syst. Bacteriol. 46, 1034–1041. Aliota, M.T., Fuchs, J.F., Mayhew, G.F., Chen, C.C., Christensen, B.M., 2007. Mosquito transcriptome changes and filarial worm resistance in Armigeres subalbatus. BMC Genomics 8, 463. Alonso, V., Nasrolahi, S., Dillman, A.R., 2018. Host-Specific Activation of Entomopathogenic Nematode Infective Juveniles. Insects 9. An, R., Voss, M., Jagdale, G.B., Grewal, P.S., 2012. Differences in Immune Defense Evasion of Selected Inbred Lines of Heterorhabditis Bacteriophora in Two White Grub Species. Insects 3, 378–89. Arefin, B., Kucerova, L., Dobes, P., Markus, R., Strnad, H., Wang, Z., Hyrsl, P., Zurovec, M., Theopold, U., 2014. Genome-wide transcriptional analysis of Drosophila larvae infected by entomopathogenic nematodes shows involvement of complement, recognition and extracellular matrix proteins. J. Innate Immun. 6, 192–204. Armer, C.A., Rao, S., Berry, R.E., 2004. Insect cellular and chemical limitations to pathogen development: The Colorado potato beetle, the nematode Heterorhabditis marelatus, and its symbiotic bacteria. J. Invertebr. Pathol. 87, 114–122. Aymeric, J.-L., Givaudan, A., Duvic, B., 2010. Imd pathway is involved in the interaction of Drosophila melanogaster with the entomopathogenic bacteria, Xenorhabdus nematophila and Photorhabdus luminescens. Mol. Immunol. 47, 2342–2348. Bai, X., Adams, B.J., Ciche, T.A., Clifton, S., Gaugler, R., Kim, K., Spieth, J., Sternberg, P.W., Wilson, R.K., Grewal, P.S., 2013. A lover and a fighter: the genome sequence of an entomopathogenic nematode Heterorhabditis bacteriophora. PLoS One 8, e69618. Balasubramanian, N., Hao, Y.J., Toubarro, D., Nascimento, G., Simões, N., 2009. Purification, biochemical and molecular analysis of a chymotrypsin protease with prophenoloxidase suppression activity from the entomopathogenic nematode Steinernema carpocapsae. Int. J. Parasitol. 39, 975–984. 131

Baur, M.E., Kaya, H.K., Peng, Y.S., Jiang, J., 1995. Nonsusceptibility of the Honey Bee, Apis mellifera (Hymenoptera: Apidae), to Steinernematid and Heterorhabditid Nematodes. J. Nematol. 27, 378–81. Beckert, A., Wiesner, J., Schmidtberg, H., Lehmann, R., Baumann, A., Vogel, H., Vilcinskas, A., 2016. Expression and characterization of a recombinant i-type lysozyme from the harlequin ladybird beetle Harmonia axyridis. Insect Mol. Biol. 25, 202–215. Bedding, R.A., Molyneux, A.S., 1982. Penetration of insect cuticle by infective juveniles of Heterorhabditis SPP. (Heterorhabditidae: Nematoda). Nematologica 28, 354– 359. Benagiano, M., Bianchi, P., D’Elios, M.M., Brosens, I., Benagiano, G., 2019. Autoimmune diseases: Role of steroid hormones. Best Pract. Res. Clin. Obstet. Gynaecol. 60, 24–34. Berry, R.E., Liu, J., Reed, G., 1997. Comparison of Endemic and Exotic Entomopathogenic Nematode Species for Control of Colorado Potato Beetle (Coleoptera: Chrysomelidae). J. Econ. Entomol. 90, 1528–1533. Bidla, G., Dushay, M.S., Theopold, U., 2007. Crystal cell rupture after injury in Drosophila requires the JNK pathway, small GTPases and the TNF homolog eiger. J. Cell Sci. 120, 1209–1215. Binggeli, O., Neyen, C., Poidevin, M., Lemaitre, B., 2014. Prophenoloxidase Activation Is Required for Survival to Microbial Infections in Drosophila. PLoS Pathog. 10. https://doi.org/10.1371/journal.ppat.1004067 Blaxter, M., Koutsovoulos, G., 2015. The evolution of parasitism in Nematoda. Parasitology 142 Suppl 1, S26-39. Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren, J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K., 1998. A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71–75. Blaxter, M.L., Page, A.P., Rudin, W., Maizels, R.M., 1992. Nematode surface coats: Actively evading immunity. Parasitol. Today 8, 243–247. Bock, K.W., 2016. The UDP-glycosyltransferase (UGT) superfamily expressed in humans, insects and plants: Animal-plant arms-race and co-evolution. Biochem. Pharmacol. 99, 11–17. Boehnisch, C., Wong, D., Habig, M., Isermann, K., Michiels, N.K., Roeder, T., May, R.C., Schulenburg, H., 2011. Protist-type lysozymes of the nematode Caenorhabditis elegans contribute to resistance against pathogenic Bacillus thuringiensis. PLoS One 6. Bost, A., Martinson, V.G., Franzenburg, S., Adair, K.L., Albasi, A., Wells, M.T., Douglas, A.E., 2018. Functional variation in the gut microbiome of wild Drosophila populations. Mol. Ecol. 27, 2834–2845. https://doi.org/10.1111/mec.14728 Breton, C., Fournel-Gigleux, S., Palcic, M.M., 2012. Recent structures, evolution and mechanisms of glycosyltransferases. Curr. Opin. Struct. Biol. 22, 540–549. Brivio, M.F., Mastore, M., 2018. Nematobacterial complexes and insect hosts: Different weapons for the same war. Insects.

132

Brivio, M.F., Moro, M., Mastore, M., 2006. Down-regulation of antibacterial peptide synthesis in an insect model induced by the body-surface of an entomoparasite (Steinernema feltiae). Dev. Comp. Immunol. 30, 627–638. Brivio, M.F., Pagani, M., Restelli, S., 2002. Immune suppression of Galleria mellonella (Insecta, Lepidoptera) humoral defenses induced by Steinernema feltiae (Nematoda, Rhabditida): Involvement of the parasite cuticle. Exp. Parasitol. 101, 149–156. Brun, S., Vidal, S., Spellman, P., Takahashi, K., Tricoire, H., Lemaitre, B., 2006. The MAPKKK Mekk1 regulates the expression of Turandot stress genes in response to septic injury in Drosophila. Genes to Cells 11, 397–407. Caradoc-Davies, K.M., Graves, S., O’Reilly, D.R., Evans, O.P., Ward, V.K., 2001. Identification and in vivo characterization of the Epiphyas postvittana nucleopolyhedrovirus Ecdysteroid UDP-glucosyltransferase. Virus Genes 22, 255–64. Castillo, J.C., Shokal, U., Eleftherianos, I., 2013. Immune gene transcription in Drosophila adult flies infected by entomopathogenic nematodes and their mutualistic bacteria. J. Insect Physiol. 59, 179–185. Chalk, R., Townson, H., Ham, P.J., 1995. Brugia pahangi: The Effects of Cecropins on Microfilariae in Vitro and in Aedes aegypti. Exp. Parasitol. 80, 401–406. Chang, D.Z., Serra, L., Lu, D., Mortazavi, A., Dillman, A.R., 2019. A core set of venom proteins is released by entomopathogenic nematodes in the genus Steinernema. PLOS Pathog. 15, e1007626. Ciche, T.A., Ensign, J.C., 2003. For the insect pathogen Photorhabdus luminescens, which end of a nematode is out? Appl. Environ. Microbiol. 69, 1890–7. Cong, L., Yang, X., Wang, X., Tada, M., Lu, M., Liu, H., Zhu, B., 2009. Characterization of an i-type lysozyme gene from the sea cucumber Stichopus japonicus, and enzymatic and nonenzymatic antimicrobial activities of its recombinant protein. J. Biosci. Bioeng. 107, 583–588. Cooper, D., Wuebbolt, C., Heryanto, C., Eleftherianos, I., 2019. The prophenoloxidase system in Drosophila participates in the anti-nematode immune response. Mol. Immunol. 109, 88–98. Cordero, J.B., Stefanatos, R.K., Scopelliti, A., Vidal, M., Sansom, O.J., 2012. Inducible progenitor-derived Wingless regulates adult midgut regeneration in Drosophila. EMBO J. 31, 3901–3917. Crook, M., 2014. The dauer hypothesis and the evolution of parasitism: 20 years on and still going strong. Int. J. Parasitol. de Doucet, M.M., Bertolotti, M., Giayetto, A., Miranda, M., 1999. Host Range, Specificity, and Virulence of Steinernema feltiae, Steinernema rarum, and Heterorhabditis bacteriophora (Steinernematidae and Heterorhabditidae) from Argentina. J. Invertebr. Pathol. 73, 237–242. Dillman, A.R., Guillermin, M.L., Lee, J.H., Kim, B., Sternberg, P.W., Hallem, E.A., 2012. Olfaction shapes host-parasite interactions in parasitic nematodes. Proc. Natl. Acad. Sci. U. S. A. 109. Dillman, A.R., Macchietto, M., Porter, C.F., Rogers, A., Williams, B., Antoshechkin, I., Lee, M.M., Goodwin, Z., Lu, X., Lewis, E.E., Goodrich-Blair, H., Stock, S.P., Adams, B.J., Sternberg, P.W., Mortazavi, A., 2015. Comparative genomics of

133

Steinernema reveals deeply conserved gene regulatory networks. Genome Biol. 16, 9–11. Dudzic, J.P., Kondo, S., Ueda, R., Bergman, C.M., Lemaitre, B., 2015. Drosophila innate immunity: regional and functional specialization of prophenoloxidases. BMC Biol. 13, 81. Dziedziech, A., Shivankar, S., Theopold, U., 2020a. High-Resolution Infection Kinetics of Entomopathogenic Nematodes Entering Drosophila melanogaster. Insects 11, 60. Dziedziech, A., Shivankar, S., Theopold, U., 2020b. Drosophila melanogaster responses against entomopathogenic nematodes: Focus on hemolymph clots. Insects. Ebrahimi, L., Niknam, G., Dunphy, G.B., 2011. Hemocyte Responses of the Colorado Potato Beetle, Leptinotarsa decemlineata, and the Greater Wax Moth, Galleria mellonella, to the Entomopathogenic Nematodes, Steinernema feltiae and Heterorhabditis bacteriophora. J. Insect Sci. 11, 75. Eleftherianos, I., Boundy, S., Joyce, S.A., Aslam, S., Marshall, J.W., Cox, R.J., Simpson, T.J., Clarke, D.J., Ffrench-Constant, R.H., Reynolds, S.E., 2007. An antibiotic produced by an insect-pathogenic bacterium suppresses host defenses through phenoloxidase inhibition. Proc. Natl. Acad. Sci. U. S. A. 104, 2419–2424. Eleftherianos, I., Joyce, S., Ffrench-Constant, R.H., Clarke, D.J., Reynolds, S.E., 2010. Probing the tri-trophic interaction between insects, nematodes and Photorhabdus. Parasitology 137, 1695–1706. Eleftherianos, I., Xu, M., Yadi, H., Ffrench-Constant, R.H., Reynolds, S.E., 2009. Plasmatocyte-spreading peptide (PSP) plays a central role in insect cellular immune defenses against bacterial infection. J. Exp. Biol. 212, 1840–1848. Eliáš, S., Hurychová, J., Toubarro, D., Frias, J., Kunc, M., Dobeš, P., Simões, N., Hyršl, P., 2020. Bioactive excreted/secreted products of entomopathogenic nematode Heterorhabditis bacteriophora inhibit the phenoloxidase activity during the infection. Insects 11, 1–19. htt Evans, O.P., O’reilly, D.R., 1998. Purification and kinetic analysis of a baculovirus ecdysteroid UDP-glucosyltransferase. Biochem. J. 330 (Pt 3, 1265–70. Fleming, M.W., 1993. Ecdysteroids during development in the ovine parasitic nematode, Haemonchus contortus. Comp. Biochem. Physiol. Part B Comp. Biochem. 104, 653–655. Franssens, V., Smagghe, G., Simonet, G., Claeys, I., Breugelmans, B., De Loof, A., Vanden Broeck, J., 2006. 20-Hydroxyecdysone and juvenile hormone regulate the laminarin-induced nodulation reaction in larvae of the flesh fly, Neobellieria bullata. Dev. Comp. Immunol. 30, 735–740. Gandhe, A.S., Janardhan, G., Nagaraju, J., 2007. Immune upregulation of novel antibacterial proteins from silkmoths (Lepidoptera) that resemble lysozymes but lack muramidase activity. Insect Biochem. Mol. Biol. 37, 655–666. Gaugler, R., Wang, Y.I., Campbell, J.F., 1994. Aggressive and evasive behaviors in Popillia japonica (Coleoptera: Scarabaeidae) larvae: Defenses against entomopathogenic nematode attack. J. Invertebr. Pathol. 64, 193–199. Ghazal, S., Oshone, R., Simpson, S., Morris, K., Abebe-Akele, F., W.Kelley, T., Khalil, K.M., Tisa, L.S., 2016. Draft genome sequence of Photorhabdus luminescens

134

subsp. laumondii HP88, an entomopathogenic bacterium isolated from nematodes. Genome Announc. 4. Gravato-Nobre, M.J., Vaz, F., Filipe, S., Chalmers, R., Hodgkin, J., 2016. The Invertebrate Lysozyme Effector ILYS-3 Is Systemically Activated in Response to Danger Signals and Confers Antimicrobial Protection in C. elegans. PLOS Pathog. 12, e1005826. Hallem, E.A., Dillman, A.R., Hong, A. V., Zhang, Y., Yano, J.M., Demarco, S.F., Sternberg, P.W., 2011. A sensory code for host seeking in parasitic nematodes. Curr. Biol. 21, 377–383. Hallem, E.A., Rengarajan, M., Ciche, T.A., Sternberg, P.W., 2007. Nematodes, Bacteria, and Flies: A Tripartite Model for Nematode Parasitism. Curr. Biol. 17, 898–904. Han, R., Ehlers, R.-U., 2001. Effect of Photorhabdus luminescens phase variants on the in vivo and in vitro development and reproduction of the entomopathogenic nematodes Heterorhabditis bacteriophora and Steinernema carpocapsae. FEMS Microbiol. Ecol. 35, 239–247. Han, R., Ehlers, R.-U., 2000. Pathogenicity, Development, and Reproduction of Heterorhabditis bacteriophora and Steinernema carpocapsae under Axenic in Vivo Conditions. J. Invertebr. Pathol. 75, 55–58. Hao, Y.-J., Montiel, R., Lucena, M.A., Costa, M., Simoes, N., 2012. Genetic diversity and comparative analysis of gene expression between Heterorhabditis bacteriophora Az29 and Az36 isolates: Uncovering candidate genes involved in insect pathogenicity. Exp. Parasitol. 130, 116–125. Hashmi, S., Abu Hatab, M.A., Gaugler, R.R., 1997. GFP: Green fluorescent protein a versatile gene marker for entomopathogenic nematodes. Fundam. Appl. Nematol. 20, 323–327. Hashmi, S., Hashmi, G., Gaugler, R., 1995. Genetic Transformation of an Entomopathogenic Nematode by Microinjection. J. Invertebr. Pathol. 66, 293– 296. Hasnain, S.Z., McGuckin, M.A., Grencis, R.K., Thornton, D.J., 2012. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier. PLoS Negl. Trop. Dis. 6. Hawdon, J.M., Datu, B., 2003. The second messenger cyclic GMP mediates activation in Ancylostoma caninum infective larvae. Int. J. Parasitol. 33, 787–793. Hedengren, M., Bengt Åsling, Dushay, M.S., Ando, I., Ekengren, S., Wihlborg, M., Hultmark, D., 1999. Relish, a Central Factor in the Control of Humoral but Not Cellular Immunity in Drosophila. Mol. Cell 4, 827–837. Hewitson, J.P., Harcus, Y., Murray, J., van Agtmaal, M., Filbey, K.J., Grainger, J.R., Bridgett, S., Blaxter, M.L., Ashton, P.D., Ashford, D.A., Curwen, R.S., Wilson, R.A., Dowle, A.A., Maizels, R.M., 2011. Proteomic analysis of secretory products from the model gastrointestinal nematode Heligmosomoides polygyrus reveals dominance of Venom Allergen-Like (VAL) proteins. J. Proteomics 74, 1573– 1594. Hu, K., Webster, J.M., 2000. Antibiotic production in relation to bacterial growth and nematode development in Photorhabdus-Heterorhabditis infected Galleria mellonella larvae. FEMS Microbiol. Lett. 189, 219–223.

135

Huang, F.-F., Chai, C.-L., Zhang, Z., Liu, Z.-H., Dai, F.-Y., Lu, C., Xiang, Z.-H., 2008. The UDP-glucosyltransferase multigene family in Bombyx mori. BMC Genomics 9, 563. Huang, X., Xu, C.-L., Chen, W.-Z., Chen, C., Xie, H., 2017. Cloning and characterization of the first serine carboxypeptidase from a plant parasitic nematode, Radopholus similis. Sci. Rep. 7. Hughes, A.L., 2013. Origin of Ecdysosteroid UDP-glycosyltransferases of Baculoviruses through Horizontal Gene Transfer from Lepidoptera. Coevolution 1, 1–7. Hyrsl, P., Dobes, P., Wang, Z., Hauling, T., Wilhelmsson, C., Theopold, U., 2011. Clotting Factors and Eicosanoids Protect against Nematode Infections. J. Innate Immun. 3, 65–70. International Helminth Genomes Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat. Genet. 51, 163–174. Jarosz, J., 1998. Active resistance of entomophagous rhabditid Heterorhabditis bacteriophora to insect immunity. Parasitology 117, S0031182098003011. Jing, Y., Toubarro, D., Hao, Y., Simões, N., 2010. Cloning, characterisation and heterologous expression of an astacin metalloprotease, Sc-AST, from the entomoparasitic nematode Steinernema carpocapsae. Mol. Biochem. Parasitol. 174, 101–108. Johnigk, S.-A., Ehlers, R.-U., 1999. Juvenile development and life cycle of Heterorhabditis bacteriophora and H. indica (Nematoda: Heterorhabditidae). Nematology 1, 251–260. Kaieda, Y., Masuda, R., Nishida, R., Shimell, M., O’Connor, M.B., Ono, H., 2017. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster. Dev. Biol. 430, 166– 176. Kamali, S., Karimi, J., Koppenhöfer, A.M., 2018. New Insight into the Management of the Tomato Leaf Miner, Tuta absoluta (Lepidoptera: Gelechiidae) with Entomopathogenic Nematodes. J. Econ. Entomol. 111, 112–119. Kaplan, F., Perret-Gentil, A., Giurintano, J., Stevens, G., Erdogan, H., Schiller, K.C., Mirti, A., Sampson, E., Torres, C., Sun, J., Lewis, E.E., Shapiro-Ilan, D., 2020. Conspecific and heterospecific pheromones stimulate dispersal of entomopathogenic nematodes during quiescence. Sci. Rep. 10, 1–12. Kaplanis, J.N., Thompson, M.J., Dutky, S.R., Robbins, W.E., 1979. The ecdysteroids from the tobacco hornworm during pupal-adult development five days after peak titer of molting hormone activity. Steroids 34, 333–345. Kenmoku, H., Hori, A., Kuraishi, T., Kurata, S., 2017. A novel mode of induction of the humoral innate immune response in Drosophila larvae. DMM Dis. Model. Mech. 10, 271–281. https://doi.org/10.1242/dmm.027102 Kennedy, M.W., 2000. The polyprotein lipid binding proteins of nematodes. Biochim. Biophys. Acta - Protein Struct. Mol. Enzymol. 1476, 149–164. Kenney, E., Hawdon, J.M., O’Halloran, D., Eleftherianos, I., 2019. Heterorhabditis bacteriophora Excreted-Secreted Products Enable Infection by Photorhabdus luminescens Through Suppression of the Imd Pathway. Front. Immunol. 10, 2372. Kenney, E., Yaparla, A., Hawdon, J.M., O’Halloran, D.M., Grayfer, L., Eleftherianos, I., 2020. A putative UDP-glycosyltransferase from Heterorhabditis bacteriophora

136

suppresses antimicrobial peptide gene expression and factors related to ecdysone signaling. Sci. Rep. 10, 12312. Kim, Y., Ji, D., Cho, S., Park, Y., 2005. Two groups of entomopathogenic bacteria, Photorhabdus and Xenorhabdus, share an inhibitory action against phospholipase A2 to induce host immunodepression. J. Invertebr. Pathol. 89, 258–264. Ko, J., Wan, Q., Bathige, S.D.N.K., Lee, J., 2016. Molecular characterization, transcriptional profiling, and antibacterial potential of G-type lysozyme from seahorse (Hippocampus abdominalis). Fish Shellfish Immunol. 58, 622–630. Kobayashi, T., Tani, T., Yokota, T., Kodama, M., 2000. Detection of peptidoglycan in human plasma using the silkworm larvae plasma test. FEMS Immunol. Med. Microbiol. 35, 49–58. Komarov, D.A., Slepneva, I.A., Glupov, V. V., Khramtsov, V. V., 2005. Superoxide and hydrogen peroxide formation during enzymatic oxidation of DOPA by phenoloxidase. Free Radic. Res. 39, 853–858. Koppenhöfer, A.M., Grewal, P.S., Fuzy, E.M., 2007. Differences in penetration routes and establishment rates of four entomopathogenic nematode species into four white grub species. J. Invertebr. Pathol. 94, 184–195. Kunc, M., Arefin, B., Hyrsl, P., Theopold, U., 2017. Monitoring the effect of pathogenic nematodes on locomotion of Drosophila larvae. Fly (Austin). 11, 208–217. Labaude, S., Griffin, C.T., 2018. Transmission Success of Entomopathogenic Nematodes Used in Pest Control. Insects 9. Lackey, A., James, E.R., Sakanari, J.A., Resnick, S.D., Bianco, A.E., Mckerrow, A.H., 1989. Extracellular Proteases of Onchocerca. Experimental Parasitology 68, 176– 185. Lavine, M.D., Strand, M.R., 2008. Insect Hemocytes and Their Role in Immunity. Insect Immunol. 32, 25–47. Li, X.-Y., Cowles, R.S., Cowles, E.A., Gaugler, R., Cox-Foster, D.L., 2007. Relationship between the successful infection by entomopathogenic nematodes and the host immune response. Int. J. Parasitol. 37, 365–374. Ligoxygakis, P., Pelte, N., Ji, C., Leclerc, V., Duvic, B., Belvin, M., Jiang, H., Hoffmann, J.A., Reichhart, J.M., 2002. A serpin mutant links Toll activation to melanization in the host defence of Drosophila. EMBO J. 21, 6330–6337. Liu, C., Enright, T., Tzertzinis, G., Unnasch, T.R., 2012. Identification of genes containing ecdysone response elements in the genome of Brugia malayi. Mol. Biochem. Parasitol. 186, 38. Liu, H., Zheng, F., Cao, Q., Ren, B., Zhu, L., Striker, G., Vlassara, H., 2006. Amelioration of oxidant stress by the defensin lysozyme. Am. J. Physiol. Metab. 290, E824–E832. Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25, 402–408. Lok, J.B., 2012. Nucleic acid transfection and transgenesis in parasitic nematodes. Parasitology 139, 574–588. Lok, J.B., Shao, H., Massey, H.C., Li, X., 2017. Transgenesis in Strongyloides and related parasitic nematodes: Historical perspectives, current functional genomic applications and progress towards gene disruption and editing. Parasitology 144, 327–342.

137

Lu, D., Macchietto, M., Chang, D., Barros, M.M., Baldwin, J., Mortazavi, A., Dillman, A.R., 2017a. Activated entomopathogenic nematode infective juveniles release lethal venom proteins. PLoS Pathog. 13, e1006302. Lu, D., Sepulveda, C., Dillman, A.R., 2017b. Infective Juveniles of the Entomopathogenic Nematode Steinernema scapterisci Are Preferentially Activated by Cricket Tissue. PLoS One 12, e0169410. Ma, H., Abbas, M.N., Zhang, K., Hu, X., Xu, M., Liang, H., Kausar, S., Yang, L., Cui, H., 2019. 20-Hydroxyecdysone regulates the transcription of the lysozyme via Broad-Complex Z2 gene in silkworm, Bombyx mori. Dev. Comp. Immunol. 94, 66–72. Machado, R.A.R., Thönen, L., Arce, C.C.M., Theepan, V., Prada, F., Wüthrich, D., Robert, C.A.M., Vogiatzaki, E., Shi, Y.M., Schaeren, O.P., Notter, M., Bruggmann, R., Hapfelmeier, S., Bode, H.B., Erb, M., 2020. Engineering bacterial symbionts of nematodes improves biocontrol potential of the western corn rootworm. Nat. Biotechnol. Manuvera, V.A., Kurdyumov, A.S., Filonova, K.A., Lazarev, V.N., 2015. Generation of recombinant destabilase-lysozyme from medicinal leeches in three different expression systems. Protein Expr. Purif. 116, 50–58. Márkus, R., Kurucz, É., Rus, F., Andó, I., 2005. Sterile wounding is a minimal and sufficient trigger for a cellular immune response in Drosophila melanogaster. Immunol. Lett. 101, 108–111. Mastore, M., Brivio, M.F., 2008. Cuticular surface lipids are responsible for disguise properties of an entomoparasite against host cellular responses. Dev. Comp. Immunol. 32, 1050–1062. Matoušková, P., Lecová, L., Laing, R., Dimunová, D., Vogel, H., Raisová Stuchlíková, L., Nguyen, L.T., Kellerová, P., Vokřál, I., Lamka, J., Szotáková, B., Várady, M., Skálová, L., 2018. UDP-glycosyltransferase family in Haemonchus contortus: Phylogenetic analysis, constitutive expression, sex-differences and resistance- related differences. Int. J. Parasitol. Drugs drug Resist. 8, 420–429. McCormack, S., Yadav, S., Shokal, U., Kenney, E., Cooper, D., Eleftherianos, I., 2016. The insulin receptor substrate Chico regulates antibacterial immune function in Drosophila. Immun. Ageing 13, 15. McLean, F., Berger, D., Laetsch, D.R., Schwartz, H.T., Blaxter, M., 2018. Improving the annotation of the Heterorhabditis bacteriophora genome. Gigascience 7, 1–12. Memari, Z., Karimi, J., Kamali, S., Goldansaz, S.H., Hosseini, M., 2016. Are Entomopathogenic Nematodes Effective Biological Control Agents Against the Carob Moth, Ectomyelois ceratoniae? J. Nematol. 48, 261–267. Modic, Š., Žigon, P., Kolmanič, A., Trdan, S., Razinger, J., 2020. Evaluation of the Field Efficacy of Heterorhabditis Bacteriophora Poinar (Rhabditida: Heterorhabditidae) and Synthetic Insecticides for the Control of Western Corn Rootworm Larvae. Insects 11, 202. Moshayov, A., Koltai, H., Glazer, I., 2013. Molecular characterisation of the recovery process in the entomopathogenic nematode Heterorhabditis bacteriophora. Int. J. Parasitol. 43, 843–852. Mouammine, A., Pages, S., Lanois, A., Gaudriault, S., Jubelin, G., Bonabaud, M., Cruveiller, S., Dubois, E., Roche, D., Legrand, L., Brillard, J., Givaudan, A.,

138

2017. An antimicrobial peptide-resistant minor subpopulation of Photorhabdus luminescens is responsible for virulence. Sci. Rep. 7, 43670. Myllymäki, H., Valanne, S., Rämet, M., 2014. The Drosophila Imd Signaling Pathway. J. Immunol. 192, 3455–3462. Nance, J., Frøkjær-Jensen, C., 2019. The Caenorhabditis elegans transgenic toolbox, Genetics. Narmadha, G., Yenugu, S., 2016. In silico and biochemical characterization of lysozyme- like proteins in the rat. PLoS One 11. Nash, J.A., Ballard, T.N.S., Weaver, T.E., Akinbi, H.T., 2006. The Peptidoglycan- Degrading Property of Lysozyme Is Not Required for Bactericidal Activity In Vivo. J. Immunol. 177, 519–526. Noguez, J.H., Conner, E.S., Zhou, Y., Ciche, T.A., Ragains, J.R., Butcher, R.A., 2012. A novel ascaroside controls the parasitic life cycle of the entomopathogenic nematode Heterorhabditis bacteriophora. ACS Chem. Biol. 7, 961–6. O’Halloran, D.M., Burnell, A.M., 2003. An investigation of chemotaxis in the insect parasitic nematode Heterorhabditis bacteriophora. Parasitology 127, 375–385. O’Reilly, D.R., 1995. Baculovirus-encoded ecdysteroid UDP-glucosyltransferases. Insect Biochem. Mol. Biol. 25, 541–550. O’Reilly, D.R., Miller, L.K., 1989. A baculovirus blocks insect molting by producing ecdysteroid UDP-glucosyl transferase. Science 245, 1110–2. Ono, M., Yoshiga, T., 2019. Cellular immunity in the insect Galleria mellonella against insect non-parasitic nematodes. Parasitology 708–715. Palmer, W.H., Joosten, J., Overheul, G.J., Jansen, P.W., Vermeulen, M., Obbard, D.J., Van Rij, R.P., 2019. Induction and Suppression of NF-κB Signalling by a DNA Virus of Drosophila. J. Virol. 93, e01443-18. Pankewitz, F., Hilker, M., 2008. Polyketides in insects: Ecological role of these widespread chemicals and evolutionary aspects of their biogenesis. Biol. Rev. 83, 209–226. Parihar, M., Minton, R.L., Flowers, S., Holloway, A., Morehead, B.E., Paille, J., Gissendanner, C.R., 2010. The genome of the nematode Pristionchus pacificus encodes putative homologs of RXR/Usp and EcR. Gen. Comp. Endocrinol. 167, 11–17. Park, H.B., Sampathkumar, P., Perez, C.E., Lee, J.H., Tran, J., Bonanno, J.B., Hallem, E.A., Almo, S.C., Crawford, J.M., 2017. Stilbene epoxidation and detoxification in a Photorhabdus luminescens-nematode symbiosis. J. Biol. Chem. 292, 6680– 6694. Peña, J.M., Carrillo, M.A., Hallem, E.A., 2015. Variation in the susceptibility of Drosophila to different entomopathogenic nematodes. Infect. Immun. 83, 1130– 1138. Peters, Gouge, Ehlers, Hague, 1997. Avoidance of Encapsulation by Heterorhabditis spp. Infecting Larvae of Tipula oleracea. J. Invertebr. Pathol. 70, 161–4. Poinar, G.O.. J., Georgis, R., 1990. Characterization and field application of Heterorhabditis bacteriophora strain HP88 (Heteorhabditidae : Rhabditida). Rev. Nématologie 13, 387–393.

139

Poinar, G.O., 1975. Description and Biology of a New Insect Parasitic Rhabditoid, Heterorhabditis bacteriophora N. Gen., N. Sp. (Rhabditida; Heterorhabditidae N. Fam.). Nematologica 21, 463–470. Poinar, G.O., Grewal, P.S., 2012. History of entomopathogenic nematology, in: Journal of Nematology. pp. 153–161. Poinar, G.O., Paff, M., 1985. Laboratory infection of terrestrial isopods (Crustacea: Isopoda) with Neoaplectanid and Heterorhabditid nematodes (Rhabditida: Nematoda). J. Invertebr. Pathol. 45, 24–27. Poinar, G.O., Thomas, G.M., 1988. Infection of frog tadpoles (Amphibia) by insect parasitic nematodes (Rhabditida). Experientia 44, 528–531. Ragland, S.A., Criss, A.K., 2017. From bacterial killing to immune modulation: Recent insights into the functions of lysozyme. PLoS Pathog. Rasmann, S., Köllner, T.G., Degenhardt, J., Hiltpold, I., Toepfer, S., Kuhlmann, U., Gershenzon, J., Turlings, T.C.J., 2005. Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434, 732–737. Rees-Roberts, D., Mullen, L.M., Gounaris, K., Selkirk, M.E., 2010. Inactivation of the complement anaphylatoxin C5a by secreted products of parasitic nematodes. Int. J. Parasitol. 40, 527–532. Regaiolo, A., Dominelli, N., Andresen, K., Heermann, R., 2020. The biocontrol agent and insect pathogen Photorhabdus luminescens interacts with plant roots. Appl. Environ. Microbiol. Richardson, W.H., Schmidt, T.M., Nealson, K.H., 1988. Identification of an anthraquinone pigment and a hydroxystilbene antibiotic from Xenorhabdus luminescens. Appl. Environ. Microbiol. 54, 1602–1605. Rosa, J.S., Simões, N., 2004. Evaluation of twenty-eight strains of Heterorhabditis bacteriophora isolated in Azores for biocontrol of the armyworm, Pseudaletia unipuncta (Lepidoptera: Noctuidae). Biol. Control 29, 409–417. Rougon-Cardoso, A., Flores-Ponce, M., Ramos-Aboites, H.E., Martínez-Guerrero, C.E., Hao, Y.J., Cunha, L., Rodríguez-Martínez, J.A., Ovando-Vázquez, C., Bermúdez- Barrientos, J.R., Abreu-Goodger, C., Chavarría-Hernández, N., Simões, N., Montiel, R., 2016. The genome, transcriptome, and proteome of the nematode Steinernema carpocapsae: Evolutionary signatures of a pathogenic lifestyle. Sci. Rep. 6. Ruiz, F., Castelletto, M.L., Gang, S.S., Hallem, E.A., 2017. Experience-dependent olfactory behaviors of the parasitic nematode Heligmosomoides polygyrus. PLoS Pathog. 13. Rus, F., Flatt, T., Tong, M., Aggarwal, K., Okuda, K., Kleino, A., Yates, E., Tatar, M., Silverman, N., 2013. Ecdysone triggered PGRP-LC expression controls Drosophila innate immunity. EMBO J. 32, 1626–38. Schmid, M.R., Anderl, I., Vesala, L., Vanha-aho, L.M., Deng, X.J., Rämet, M., Hultmark, D., 2014. Control of Drosophila blood cell activation via toll signaling in the fat body. PLoS One 9. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Shapiro-Ilan, D., Raymond, B., 2016. Limiting opportunities for cheating stabilizes virulence in insect parasitic nematodes. Evol. Appl. 9, 462–470.

140

Shepherd, C., Navarro, S., Wangchuk, P., Wilson, D., Daly, N.L., Loukas, A., 2015. Identifying the immunomodulatory components of helminths. Parasite Immunol. 37, 293–303. Sherman, L.S., Schrankel, C.S., Brown, K.J., Smith, L.C., 2015. Extraordinary Diversity of Immune Response Proteins among Sea Urchins: Nickel-Isolated Sp185/333 Proteins Show Broad Variations in Size and Charge. PLoS One 10, e0138892. Shokal, U., Eleftherianos, I., 2017. Evolution and function of thioester-containing proteins and the complement system in the innate immune response. Front. Immunol. Sommer, R.J., Streit, A., 2011. Comparative Genetics and Genomics of Nematodes: Genome Structure, Development, and Lifestyle. Annu. Rev. Genet. 45, 1–20. Sonobe, H., Ito, Y., 2009. Phosphoconjugation and dephosphorylation reactions of steroid hormone in insects. Mol. Cell. Endocrinol. 307, 25–35. Sorrentino, R.P., Carton, Y., Govind, S., 2002. Cellular Immune Response to Parasite Infection in the Drosophila Lymph Gland Is Developmentally Regulated. Dev. Biol. 243, 65–80. Sorrentino, R.P., Melk, J.P., Govind, S., 2004. Genetic Analysis of Contributions of Dorsal Group and JAK-Stat92E Pathway Genes to Larval Hemocyte Concentration and the Egg Encapsulation Response in Drosophila. Genetics 166, 1343–1356. h Srikanth, K., Park, J., Stanley, D.W., Kim, Y., 2011. Plasmatocyte-spreading peptide influences hemocyte behavior via eicosanoids. Arch. Insect Biochem. Physiol. 78, 145–160. Stanley, D., Kim, Y., 2018. Prostaglandins and Other Eicosanoids in Insects: Biosynthesis and Biological Actions. Front. Physiol. 9, 1927. Steiner, W.A., 1996. Melanization of Steinernema feltiae Filipjev and S. kraussei Steiner in larvae of Otiorhynchus sulcatus (F.). Fundam. Appl. Nematol. 19, 67–70. Sychantha, D., Brott, A.S., Jones, C.S., Clarke, A.J., 2018. Mechanistic pathways for peptidoglycan O-acetylation and De-O-acetylation. Front. Microbiol. Tanaka, H., Matsuki, H., Furukawa, S., Sagisaka, A., Kotani, E., Mori, H., Yamakawa, M., 2007. Identification and functional analysis of Relish homologs in the silkworm, Bombyx mori. Biochim. Biophys. Acta - Gene Struct. Expr. 1769, 559– 568. Tanji, T., Hu, X., Weber, A.N.R., Ip, Y.T., 2007. Toll and IMD pathways synergistically activate an innate immune response in Drosophila melanogaster. Mol. Cell. Biol. 27, 4578–88. Thurston, G.S., Yule, W.N., Dunphy, G.B., 1994. Explanations for the Low Susceptibility of Leptinotarsa decemlineata to Steinernema carpocapsae. Biol. Control 4, 53–58. Tian, Z. ling, Wang, Z. hua, Maria, M., Qu, N., Zheng, J. wu, 2019. Meloidogyne graminicola protein disulfide isomerase may be a nematode effector and is involved in protection against oxidative damage. Sci. Rep. 9, 11949. Toepfer, S., Gueldenzoph, C., Ehlers, R.-U., Kuhlmann, U., 2005. Screening of entomopathogenic nematodes for virulence against the invasive western corn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae) in Europe. Bull. Entomol. Res. 95, 473–482.

141

Toubarro, D., Avila, M.M., Hao, Y., Balasubramanian, N., Jing, Y., Montiel, R., Faria, T.Q., Brito, R.M., Simões, N., 2013a. A serpin released by an entomopathogen impairs clot formation in insect defense system. PLoS One 8, e69161. Toubarro, D., Avila, M.M., Montiel, R., Simões, N., 2013b. A pathogenic nematode targets recognition proteins to avoid insect defenses. PLoS One 8, e75691. Toubarro, D., Lucena-Robles, M., Nascimento, G., Costa, G., Montiel, R., Coelho, A. V., Simões, N., 2009. An apoptosis-inducing serine protease secreted by the entomopathogenic nematode Steinernema carpocapsae. Int. J. Parasitol. 39, 1319–1330. Toubarro, D., Lucena-Robles, M., Nascimento, G., Santos, R., Montiel, R., Veríssimo, P., Pires, E., Faro, C., Coelho, A. V., Simões, N., 2010. Serine protease-mediated host invasion by the parasitic nematode Steinernema carpocapsae. J. Biol. Chem. 285, 30666–30675. Tsuzuki, S., Matsumoto, H., Furihata, S., Ryuda, M., Tanaka, H., Sung, E.J., Bird, G.S., Zhou, Y., Shears, S.B., Hayakawa, Y., 2014. Switching between humoral and cellular immune responses in Drosophila is guided by the cytokine GBP. Nat. Commun. 5. Tsuzuki, S., Ochiai, M., Matsumoto, H., Kurata, S., Ohnishi, A., Hayakawa, Y., 2012. Drosophila growth-blocking peptide-like factor mediates acute immune reactions during infectious and non-infectious stress. Sci. Rep. 2, 1–10. Tzertzinis, G., Egañ A, A.L., Palli, S.R., Robinson-Rechavi, M., Gissendanner, C.R., Liu, C., Unnasch, T.R., Maina, C. V., 2010. Molecular evidence for a functional ecdysone signaling system in Brugia malayi. PLoS Negl. Trop. Dis. 4. Tzou, P., Ohresser, S., Ferrandon, D., Capovilla, M., Reichhart, J.-M., Lemaitre, B., Hoffmann, J.A., Imler, J.-L., 2000. Tissue-Specific Inducible Expression of Antimicrobial Peptide Genes in Drosophila Surface Epithelia. Immunity 13, 737– 748. Vadnal, J., Granger, O.G., Ratnappan, R., Eleftherianos, I., O’Halloran, D.M., Hawdon, J.M., 2018. Refined ab initio gene predictions of Heterorhabditis bacteriophora using RNA-seq. Int. J. Parasitol. 48, 585–590. Vadnal, J., Ratnappan, R., Keaney, M., Kenney, E., Eleftherianos, I., O’Halloran, D., Hawdon, J.M., 2017. Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora. BMC Genomics 18, 8. Valanne, S., Wang, J.-H., Rämet, M., 2011. The Drosophila Toll Signaling Pathway. J. Immunol. 186, 649–656. Van Tol, R.W.H.M., Van Der Sommen, A.T.C., Boff, M.I.C., Van Bezooijen, J., Sabelis, M.W., Smits, P.H., 2001. Plants protect their roots by alerting the enemies of grubs. Ecol. Lett. 4, 292–294. Verma, P., Tapadia, M.G., 2015. Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster. Mol. Immunol. 66, 325–339. Vermeer, L.M., Higgins, C.A., Roman, D.L., Doorn, J.A., 2013. Real-time monitoring of tyrosine hydroxylase activity using a plate reader assay. Anal. Biochem. 432, 11– 15. Viney, M., 2018. The genomic basis of nematode parasitism. Brief. Funct. Genomics.

142

Walter, T.N., Dunphy, G.B., Mandato, C.A., 2008. Steinernema carpocapsae DD136: Metabolites limit the non-self adhesion responses of haemocytes of two lepidopteran larvae, Galleria mellonella (F. Pyralidae) and Malacosoma disstria (F. Lasiocampidae). Exp. Parasitol. 120, 161–174. Wang, X., Fuchs, J.F., Infanger, L.C., Rocheleau, T.A., Hillyer, J.F., Chen, C.C., Christensen, B.M., 2005. Mosquito innate immunity: Involvement of β 1,3-glucan recognition protein in melanotic encapsulation immune responses in Armigeres subalbatus. Mol. Biochem. Parasitol. 139, 65–73. Wang, Y., Campbell, J.F., Gaugler, R., 1995. Infection of entomopathogenic nematodes Steinernema glaseri and Heterorhabditis bacteriophora against Popillia japonica (Coleoptera: Scarabaeidae) larvae. J. Invertebr. Pathol. 66, 178–184. Wang, Y., Gaugler, R., 1999. Steinernema glaseri surface coat protein suppresses the immune response of Popillia japonica (Coleoptera: Scarabaeidae) larvae. Biol. Control 14, 45–50. Wang Yi, Gaugler, R., Cui Liwang, 1994. Variations in immune response of Popillia japonica and Acheta domesticus to Heterorhabditis bacteriophora and Steinernema species. J. Nematol. 26, 11–18. Wang, Z., Zhou, X.E., Motola, D.L., Gao, X., Suino-Powell, K., Conneely, A., Ogata, C., Sharma, K.K., Auchus, R.J., Lok, J.B., Hawdon, J.M., Kliewer, S.A., Xu, H.E., Mangelsdorf, D.J., 2009. Identification of the nuclear receptor DAF-12 as a therapeutic target in parasitic nematodes. Proc. Natl. Acad. Sci. U. S. A. 106, 9138–9143. Warnock, N.D., Cox, D., McCoy, C., Morris, R., Dalzell, J.J., 2019. Transcriptional variation and divergence of host-finding behaviour in Steinernema carpocapsae infective juveniles. BMC Genomics 20, 884. Weadge, J.T., Pfeffer, J.M., Clarke, A.J., 2005. Identification of a new family of enzymes with potential O-acetylpeptidoglycan esterase activity in both Gram-positive and Gram-negative bacteria. BMC Microbiol. 5, 1–15. White, G.F., 1927. A method for obtaining infective nematode larvae from cultures. Science 66, 302–3. Williamson, A.L., Lecchi, P., Turk, B.E., Choe, Y., Hotez, P.J., McKerrow, J.H., Cantley, L.C., Sajid, M., Craik, C.S., Loukas, A., 2004. A multi-enzyme cascade of hemoglobin proteolysis in the intestine of blood-feeding hookworms. J. Biol. Chem. 279, 35950–35957. Williamson, A.L., Lustigman, S., Oksov, Y., Deumic, V., Plieskatt, J., Mendez, S., Zhan, B., Bottazzi, M.E., Hotez, P.J., Loukas, A., 2006. Ancylostoma caninum MTP-1, an astacin-like metalloprotease secreted by infective hookworm larvae, is involved in tissue migration. Infect. Immun. 74, 961–967. Wismar, J., Habtemichael, N., Warren, J.T., Dai, J.-D., Gilbert, L.I., Gateff, E., 2000. The Mutation without childrenrgl Causes Ecdysteroid Deficiency in Third-Instar Larvae of Drosophila melanogaster. Dev. Biol. 226, 1–17. Xiong, X.-P., Kurthkoti, K., Chang, K.-Y., Li, J.-L., Ren, X., Ni, J.-Q., Rana, T.M., Zhou, R., 2016. miR-34 Modulates Innate Immunity and Ecdysone Signaling in Drosophila. PLoS Pathog. 12, e1006034.

143

Yadav, S., Daugherty, S., Shetty, A.C., Eleftherianos, I., 2017. RNAseq analysis of the Drosophila response to the entomopathogenic nematode Steinernema. G3 Genes, Genomes, Genet. 7, 1955–1967. Yajima, M., Takada, M., Takahashi, N., Kikuchi, H., Natori, S., Oshima, Y., Kurata, S., 2003. A newly established in vitro culture using transgenic Drosophila reveals functional coupling between the phospholipase A2-generated fatty acid cascade and lipopolysaccharide-dependent activation of the immune deficiency (imd) pathway in insect immunity. Biochem. J. 371, 205–210. Yamanaka, N., Rewitz, K.F., O’Connor, M.B., 2013. Ecdysone control of developmental transitions: lessons from Drosophila research. Annu. Rev. Entomol. 58, 497–516. Yang, H., Hultmark, D., 2016. Tissue communication in a systemic immune response of Drosophila. Fly (Austin). Yang, H., Kronhamn, J., Ekström, J., Korkut, G.G., Hultmark, D., 2015. JAK / STAT signaling in Drosophila muscles controls the cellular immune response against parasitoid infection. EMBO Rep. 16, 1664–1672. Yang, L., Yang, Y., Liu, M.-M., Yan, Z.-C., Qiu, L.-M., Fang, Q., Wang, F., Werren, J.H., Ye, G.-Y., 2020. Identification and Comparative Analysis of Venom Proteins in a Pupal Ectoparasitoid, Pachycrepoideus vindemmiae. Front. Physiol. 11, 9. Yang, Y., Wen, Y.J., Cai, Y.N., Vallée, I., Boireau, P., Liu, M.Y., Cheng, S.P., 2015. Serine proteases of parasitic helminths. Korean J. Parasitol. 53, 1–11. Zakeri, A., Hansen, E.P., Andersen, S.D., Williams, A.R., Nejsum, P., 2018. Immunomodulation by helminths: Intracellular pathways and extracellular vesicles. Front. Immunol. Zakovic, S., Levashina, E.A., 2018. Insects Go on a STING Operation to Tackle Intracellular Invaders. Immunity 49, 195–197. Zeng, H. jin, Sun, D. qin, Chu, S. hui, Zhang, J. jun, Hu, G. zhou, Yang, R., 2020. Inhibitory effects of four anthraquinones on tyrosinase activity: Insight from spectroscopic analysis and molecular docking. Int. J. Biol. Macromol. 160, 153– 163. Zettervall, C.J., Anderl, I., Williams, M.J., Palmer, R., Kurucz, E., Ando, I., Hultmark, D., 2004. A directed screen for genes involved in Drosophila blood cell activation. Proc. Natl. Acad. Sci. U. S. A. 101, 14192–14197. Zheng, W., Rus, F., Hernandez, A., Kang, P., Goldman, W., Silverman, N., Tatar, M., 2018. Dehydration triggers ecdysone-mediated recognition-protein priming and elevated anti-bacterial immune responses in Drosophila Malpighian tubule renal cells. BMC Biol. 16, 1–14. Zioni Cohen-Nissan, S., Glazer, I., Segal, D., 1992. Life Cycle and Reproductive Potential of the Nematode Heterorhabditis bacteriophora Strain HP88. J. Nematol. 24, 352–8.

144