DOCSLIB.ORG

Dysregulation of Human Phase I Enzymes in APAP Overdose Subjects with Low ALT Levels

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dysregulation of Human Phase I Enzymes in APAP Overdose Subjects with Low ALT Levels Ouachita Baptist University Scholarly Commons @ Ouachita Honors Theses Carl Goodson Honors Program 2018 Dysregulation of Human Phase I Enzymes in APAP Overdose Subjects with Low ALT Levels Aaron Woodall Ouachita Baptist University Follow this and additional works at: https://scholarlycommons.obu.edu/honors_theses Part of the Pharmacy and Pharmaceutical Sciences Commons Recommended Citation Woodall, Aaron, "Dysregulation of Human Phase I Enzymes in APAP Overdose Subjects with Low ALT Levels" (2018). Honors Theses. 655. https://scholarlycommons.obu.edu/honors_theses/655 This Thesis is brought to you for free and open access by the Carl Goodson Honors Program at Scholarly Commons @ Ouachita. It has been accepted for inclusion in Honors Theses by an authorized administrator of Scholarly Commons @ Ouachita. For more information, please contact [email protected]. SENIOR THESIS APPROVAL This Honors Thesis entitled "Dysregulation of Human Phase I Enzymes in APAP Overdose Subjects with Low AL T Levels" written by Aaron Woodall and submitted in partial fulfillment of the requirements for completion of the Carl Goodson Honors Program meets the criteria for acceptance and has been approved by the undersigned readers. Dr. Jim Taylor, thesis director Dr. Angela Douglass, second reader Dr. Myra Houser, third reader Dr. Barbara Pemberton, Honors Program director April 20, 2018 Dysregulation of Human Phase I Enzymes in AP AP Overdose Subjects with Low AL T Levels Aaron Woodall Background: Acetaminophen (APAP) is a common analgesic that can cause liver injury and death in high doses. Changes in gene expression following APAP overdose may be more sensitive indicators of liver injtrry than the current clinical indicator, alanine aminotransferase (ALT). The aim of this study was to examine gene expression of Phase I enzymes in pediatric AP AP overdose patients with low ALT levels (<75 lUlL), in order to understand the mechanism of APAP toxicity. Methods: Blood samples were collected from control patients (no AP AP exposure; N=5) and APAP overdose patients {N=S). Using the P AXgene system, RNA was extracted from the blood samples and eDNA was synthesized. Quantitative polymerase chain reaction (qPCR) was performed and samples were profiled with an array containing 84 Phase I Enzyme drug metabolism genes. Results: The low ALT pediatric APAP overdose patients had higher (median [range]) ALT levels (35 [25,48] lUlL) compared to controls (16 [7, 20] IUIL). Three genes had significant downregulation that was later confirmed: GZMB (-2.86 fold, p<O.O I), ALDH6A 1 (-2.13 fold, p<O.Ol), and CYP4F12 (-4.04 fold, p<O.OS). Pathway analysis for the three genes pointed to signaling pathways connected to apoptosis, metabolism of valine and leucine (involved in the immune response), and hydroxylation of leukotriene B4 (involved in inflammation). Conclusion: Dysregulation of Phase I Enzyme drug metabolism pathways has relevance for understanding mechanisms of cell injury in APAP toxicity. Pathway analysis points to the potential for a weakened immune response associated with AP AP overdose. INTRODUCTION APAP toxicity does not have a clearly defined limit. Tylenol, the largest and most Acetaminophen (APAP) is a mild analgesic well-known distributer of APAP, recommends a found in many over-the-counter drugs. Taken in maximum daily dosage of 3,000 mg for adults. normal doses, it is generally regarded as safe For children, this amount greatly varies by and non-toxic, though liver injwy is common. weigh l and age [ I 0]. Nonetheless, the AP AP overdose is the leading cause of acute acetaminophen toxicity limit varies from person liver failure in the United States [6]. to person. Acetaminophen overdose is a common The clinical biomarker for APAP overdose is problem in the United States. A 2015 study alanine aminotransferase (ALT). Raised ALT (conducted from 2006-20 I 0) showed that in the levels indicate liver injwy, but this is not United States alone, 82,362 people visited the specific to acetaminophen (6]. APAP adducts emergency room every year for APAP arc fonncd in the metabolism of acetaminophen. overdose. Every year, there were roughly 494 AP AP is metabolized by Phase I enzymes in the deaths caused by acetaminophen toxicity [1]. cytochrome P450 family (namely CYP2El) into N-acetyl-p-benzoquinone imine (NAPQI), a toxic reactive intermediate metabolite. When 2 NAPQI binds to the cysteine group on a protein, selected with no AP AP influence in the last two APAP adducts are formed [7]. In a therapeutic weeks). dose of AP AP, this material is detoxified by RNA Isolation and eDNA Synthesis glutathione and is excreted. Thus, these adducts are only present in patients who have exceeded The PA.Xgcnc Blood miRNA system was the normal dosage of APAP and present liver used for the purification of total RNA from il\iury [6, 7]. peripheral blood collected in P A.Xgene Blood RNA Tubes. PAXgene-extracted RNA was The lab previously studied APAP overdose quantified using spectrophotometer in patients with severe liver injury, defined as (NanoDrop™ 1000, Thenno Fisher Scientific, having ALT levels >75 TU/L. The five high Wilmington, DE). eDNA synthesis was ALT blood samples were run in qPCR against performed using the RT2 First Strand kit five control samples, and three genes were (Qiagen). identified as being dowmegulated (using a 2- fold and p<0.05 cut-oft): ALDHlAl, Phase I PCR Array CYP27Al, and GZMB. The downregulation of all three genes was confirmed by individual For target gene expression analysis, Phase I analysis. Enzymes RP Profiler™ PCR Array (PAHS~ 068Z), which contains 84 genes involved in This study functioned as a follow-up to the Phase I drug metabolism, were used with the high ALT experiment and a conclusion to the SYBR®Green system (Qiagen). The ABI lab's PA.Xgene APAP overdose project. In this QuantStudio 6 Flex Real Time PCR cycler study, we investigated gene dysregulation of (Applied Biosystems) was used to perfonn APAP overdose patients who exhibited mild quantitative real-time PCR (qPCR). All liver injury, or low ALT levels, to better experiments were performed in DNase/RNase understand acetaminophen's pathway to cell free conditions and n01malized to GAPDH. The injury. analysis was performed by Threshold Cycle Method and the fold change obtained by the delta CT method. Qiagen's qPCR analysis tool, METHODS available on Sample Collection http://pcrdataanalysis.sabiosciences.com/pcr/arr ayanalysis.php, was used for analysis. The The study focused on pediatric AP AP Volcano plot considered genes that had 2:2 fold overdose patients with low AL T levels from change and a p-value <0.05 in the t-test. Arkansas Children's Hospital. Patients who were in the hospital due to AP AP overdose and eDNA Expression Analysis presented a mild liver injury, defined as ALT Quantitative real time PCR (qPCR) was levels <75 IU/L, were identified and selected for performed for all samples in triplicate on the study. Blood samples were collected by QuantStudioTM 6 Flex Real-Time PCR System nurses who were aware of the study and (TbermoFisher Scientific, Carlsbad, CA). qRT­ delivered to the lab for research. ALT levels and PCR quantification of eDNA expression was AP AP adduct levels were measured for each performed using assays and accompanying sample. Blood samples were stored in PAXgene reagents from Qiagen eDNA analyses were Blood RNA tubes (PreAnalytiX, GmbH, performed using Primer Assays for aldehyde Switzerland). This study included five AP AP dehydrogenase 6 family, member Al overdose samples (low ALT levels) and five (ALDH6A l; PPH16308B), Cytochrome P450 control samples (randomly identified and family 4, subfamily F, polypeptide 12 3 (CYP4Fl2, PPH01237F), Granzyme B (GZMB; The qpCR array, analyzed with the Qiagen PPH02594A), and Beta Actin ( ACTB; web portal qPCR analysis tool, identified three PPH00073G). For each primer assay, negative genes as dysregulated, defined as having a fold controls were run with water and eDNA change =:::2 and a p-value <0.05. They were samples. For no template controls (NTC) a identified on a volcano plot that plots -log( fold master mix with no eDNA was used. Data change) against -log(p-value) for each of the 84 normalization was performed with ACTB. genes profiled in the qPCR array (Figure Relative quantitation was calculated using the 2).ALDH6Al , GZMB, and CYP4F 12 were all delta CT method. Pathway analysis was identified as downrcgulated in the low ALT performed for each of the identified genes using APAP overdose samples. The individual qPCR The Human Gene Database available at validation assays confirmed the downrcgulation http://www.genecards.org/. of all three genes (Figure 3). GeneCards' reported pathway analysis shows that ALDH6Al is involved in metabolic RESULTS pathways in the degradation of valine, leucine, The ALT levels and AP AP adduct levels in and isoleucine [2]~ GZMB is involved in the the APA overdose low ALT group were Granzyme-B pathway of the immune response, significantly higher than those in the control specifically in apoptosis [4]; and CYP4Fl2 group, both with p-values <0.01 (Figure 1). catalyzes leukotriene B4 omega-hydroxylation [3]. Control 24 7 0.0001 30 10 0.0009 32 16 0.0038 36 18 0.008 38 14 Mean 13 0.0032 Low ALT 59 48 0.4403 60 25 0.6983 61 35 0.6663 69 33 0.7767 74 35 Mean 35.2 0.6454 Figure 1: Sample data for control and APAP overdose (low ALT) groups. The test group had higher ALT levels (p=0.0017) and significantly higher APAP adduct levels (p=0.0030). 4 ,, Nutmaliud to GAPDI {. 2-(nhl .lntl <IU)S p-value cutuf(s, ~ j : • ' l I ALIJIIt•AI ~. I 1 I ! ~ I ·l t I ·<~IFI2 I • i I • • • : I . • • I • ' • • ! ! #I• I • • • i ! • •.,. • I • i • I I .. , - I !' ·•, ; !' • ! .
Load more

Recommended publications
  • A Novel CD4+ CTL Subtype Characterized by Chemotaxis and Inflammation Is Involved in the Pathogenesis of Graves’ Orbitopa
    Cellular & Molecular Immunology www.nature.com/cmi ARTICLE OPEN A novel CD4+ CTL subtype characterized by chemotaxis and inflammation is involved in the pathogenesis of Graves’ orbitopathy Yue Wang1,2,3,4, Ziyi Chen 1, Tingjie Wang1,2, Hui Guo1, Yufeng Liu2,3,5, Ningxin Dang3, Shiqian Hu1, Liping Wu1, Chengsheng Zhang4,6,KaiYe2,3,7 and Bingyin Shi1 Graves’ orbitopathy (GO), the most severe manifestation of Graves’ hyperthyroidism (GH), is an autoimmune-mediated inflammatory disorder, and treatments often exhibit a low efficacy. CD4+ T cells have been reported to play vital roles in GO progression. To explore the pathogenic CD4+ T cell types that drive GO progression, we applied single-cell RNA sequencing (scRNA-Seq), T cell receptor sequencing (TCR-Seq), flow cytometry, immunofluorescence and mixed lymphocyte reaction (MLR) assays to evaluate CD4+ T cells from GO and GH patients. scRNA-Seq revealed the novel GO-specific cell type CD4+ cytotoxic T lymphocytes (CTLs), which are characterized by chemotactic and inflammatory features. The clonal expansion of this CD4+ CTL population, as demonstrated by TCR-Seq, along with their strong cytotoxic response to autoantigens, localization in orbital sites, and potential relationship with disease relapse provide strong evidence for the pathogenic roles of GZMB and IFN-γ-secreting CD4+ CTLs in GO. Therefore, cytotoxic pathways may become potential therapeutic targets for GO. 1234567890();,: Keywords: Graves’ orbitopathy; single-cell RNA sequencing; CD4+ cytotoxic T lymphocytes Cellular & Molecular Immunology
    [Show full text]
  • A Triple-Mutated Allele of Granzyme B Incapable of Inducing Apoptosis
    A triple-mutated allele of granzyme B incapable of inducing apoptosis Dorian McIlroy*†, Pierre-Franc¸ois Cartron‡, Pierre Tuffery§, Yasmine Dudoit*, Assia Samri*, Brigitte Autran*, Franc¸ois M. Vallette‡, Patrice Debre´ *, and Ioannis Theodorou*¶ *Laboratoire d’Immunologie Cellulaire et Tissulaire, Institut National de la Sante´et de la Recherche Me´dicale U543, Faculte´deMe´ decine Pitie´-Salpeˆtrie`re, 75013 Paris, France; ‡Institut National de la Sante´et de la Recherche Me´dicale U419, Institut de Biologie, 44000 Nantes, France; and §Institut National de la Sante´et de la Recherche Me´dicale U436, Equipe de Bioinformatique Ge´nomique et Mole´culaire, Universite´de Paris 7, 75013 Paris, France Communicated by Jean Dausset, Fondation Jean Dausset–Centre d’E´ tude du Polymorphisme Humain, Paris, France, December 27, 2002 (received for review June 6, 2002) Granzyme B (GzmB) is a serine protease involved in many pathol- resistant cell lines (20, 21). However, no congenital human ogies, including viral infections, autoimmunity, transplant rejec- diseases have been linked to the disruption of the GzmB gene, tion, and antitumor immunity. To measure the extent of genetic and GzmB knockout mice have no developmental or hemato- variation in GzmB, we screened the GzmB gene for polymorphisms logical abnormalities (22). Therefore, we hypothesized that, in and defined a frequently represented triple-mutated GzmB allele. contrast to mutations in the perforin gene (23), coding poly- 48 88 245 In this variant, three amino acids of the mature protein Q P Y morphisms in the GzmB gene might be relatively well tolerated ؉ 245 88 48 are mutated to R A H .InCD8 cytotoxic T lymphocytes, GzmB in humans and, if present, could influence the killing of tumor ͞ was expressed at similar levels in QPY homozygous, QPY RAH cells.
    [Show full text]
  • Microarray Analysis of Novel Genes Involved in HSV- 2 Infection
    Microarray analysis of novel genes involved in HSV- 2 infection Hao Zhang Nanjing University of Chinese Medicine Tao Liu ( [email protected] ) Nanjing University of Chinese Medicine https://orcid.org/0000-0002-7654-2995 Research Article Keywords: HSV-2 infection,Microarray analysis,Histospecic gene expression Posted Date: May 12th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-517057/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background: Herpes simplex virus type 2 infects the body and becomes an incurable and recurring disease. The pathogenesis of HSV-2 infection is not completely clear. Methods: We analyze the GSE18527 dataset in the GEO database in this paper to obtain distinctively displayed genes(DDGs)in the total sequential RNA of the biopsies of normal and lesioned skin groups, healed skin and lesioned skin groups of genital herpes patients, respectively.The related data of 3 cases of normal skin group, 4 cases of lesioned group and 6 cases of healed group were analyzed.The histospecic gene analysis , functional enrichment and protein interaction network analysis of the differential genes were also performed, and the critical components were selected. Results: 40 up-regulated genes and 43 down-regulated genes were isolated by differential performance assay. Histospecic gene analysis of DDGs suggested that the most abundant system for gene expression was the skin, immune system and the nervous system.Through the construction of core gene combinations, protein interaction network analysis and selection of histospecic distribution genes, 17 associated genes were selected CXCL10,MX1,ISG15,IFIT1,IFIT3,IFIT2,OASL,ISG20,RSAD2,GBP1,IFI44L,DDX58,USP18,CXCL11,GBP5,GBP4 and CXCL9.The above genes are mainly located in the skin, immune system, nervous system and reproductive system.
    [Show full text]
  • Granzyme B (GZMB) (NM 004131) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC321693 Granzyme B (GZMB) (NM_004131) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Granzyme B (GZMB) (NM_004131) Human Untagged Clone Tag: Tag Free Symbol: GZMB Synonyms: C11; CCPI; CGL-1; CGL1; CSP-B; CSPB; CTLA1; CTSGL1; HLP; SECT Vector: pCMV6-AC (PS100020) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene sequence for NM_004131.3 CCAGGGCAGCCTTCCTGAGAAGATGCAACCAATCCTGCTTCTGCTGGCCTTCCTCCTGCT GCCCAGGGCAGATGCAGGGGAGATCATCGGGGGACATGAGGCCAAGCCCCACTCCCGCCC CTACATGGCTTATCTTATGATCTGGGATCAGAAGTCTCTGAAGAGGTGCGGTGGCTTCCT GATACAAGACGACTTCGTGCTGACAGCTGCTCACTGTTGGGGAAGCTCCATAAATGTCAC CTTGGGGGCCCACAATATCAAAGAACAGGAGCCGACCCAGCAGTTTATCCCTGTGAAAAG ACCCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCA GCTGGAGAGAAAGGCCAAGCGGACCAGAGCTGTGCAGCCCCTCAGGCTACCTAGCAACAA GGCCCAGGTGAAGCCAGGGCAGACATGCAGTGTGGCCGGCTGGGGGCAGACGGCCCCCCT GGGAAAACACTCACACACACTACAAGAGGTGAAGATGACAGTGCAGGAAGATCGAAAGTG CGAATCTGACTTACGCCATTATTACGACAGTACCATTGAGTTGTGCGTGGGGGACCCAGA GATTAAAAAGACTTCCTTTAAGGGGGACTCTGGAGGCCCTCTTGTGTGTAACAAGGTGGC CCAGGGCATTGTCTCCTATGGACGAAACAATGGCATGCCTCCACGAGCCTGCACCAAAGT CTCAAGCTTTGTACACTGGATAAAGAAAACCATGAAACGCCACTAACTACAGGAAGCAAA CTAAGCCCCCGCTGTGATGAAACACCTTCTCTGGAGCCAAGTCCAGATTTACACTGGGAG AGGTGCCAGCAACTGAATAAATACCTCTTAGCTGAGTGGAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA Restriction
    [Show full text]
  • A 40-Cm Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology An
    A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis Shunya Nakane, Laurie Zoecklein, Jeffrey Gamez, Louisa Papke, Kevin Pavelko, Jean- François Bureau, Michel Brahic, Larry Pease, Moses Rodriguez To cite this version: Shunya Nakane, Laurie Zoecklein, Jeffrey Gamez, Louisa Papke, Kevin Pavelko, et al.. A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis. Brain Pathology, Wiley, 2003, 13 (4), pp.519-533. 10.1111/j.1750-3639.2003.tb00482.x. hal-03223233 HAL Id: hal-03223233 https://hal.archives-ouvertes.fr/hal-03223233 Submitted on 10 May 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. RESEARCH ARTICLE A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis Shunya Nakane1; Laurie J. Zoecklein1; Jeffrey D. Introduction Gamez1; Louisa M. Papke1; Kevin D.
    [Show full text]
  • Cleavage of the APE1 N-Terminal Domain in Acute Myeloid Leukemia Cells Is Associated with Proteasomal Activity
    biomolecules Article Cleavage of the APE1 N-Terminal Domain in Acute Myeloid Leukemia Cells Is Associated with Proteasomal Activity 1, , ,§ 1, 2 Lisa Lirussi y z , Giulia Antoniali y , Pasqualina Liana Scognamiglio , Daniela Marasco 2 , Emiliano Dalla 1 , Chiara D’Ambrosio 3 , Simona Arena 3 , Andrea Scaloni 3 and Gianluca Tell 1,* 1 Department of Medicine, University of Udine, 33100 Udine, Italy; [email protected] (L.L.); [email protected] (G.A.); [email protected] (E.D.) 2 Department of Pharmacy, University of Naples “Federico II”, 80134 Naples, Italy; [email protected] (P.L.S.); [email protected] (D.M.) 3 Proteomics & Mass Spectrometry Laboratory, ISPAAM, National Research Council, 80147 Naples, Italy; [email protected] (C.D.); [email protected] (S.A.); [email protected] (A.S.) * Correspondence: [email protected]; Tel.: +39-0432-494311 These authors contributed equally to this work. y Present address: Department of Clinical Molecular Biology, University of Oslo, 0318 Oslo, Norway. z § Present address: Department of Clinical Molecular Biology, Akershus University Hospital, 1478 Lørenskog, Norway. Received: 1 March 2020; Accepted: 30 March 2020; Published: 31 March 2020 Abstract: Apurinic/apyrimidinic endonuclease 1 (APE1), the main mammalian AP-endonuclease for the resolution of DNA damages through the base excision repair (BER) pathway, acts as a multifunctional protein in different key cellular processes. The signals to ensure temporo-spatial regulation of APE1 towards a specific function are still a matter of debate. Several studies have suggested that post-translational modifications (PTMs) act as dynamic molecular mechanisms for controlling APE1 functionality.
    [Show full text]
  • Granulysin: Killer Lymphocyte Safeguard Against Microbes
    Available online at www.sciencedirect.com ScienceDirect Granulysin: killer lymphocyte safeguard against microbes 1 2 Farokh Dotiwala and Judy Lieberman Primary T cell immunodeficiency and HIV-infected patients are of infected target cells, such as perturbations of major plagued by non-viral infections caused by bacteria, fungi, and histocompatibility protein expression or molecular signs parasites, suggesting an important and underappreciated role of cellular stress, as part of innate immunity. Most killer for T lymphocytes in controlling microbes. Here, we review T cells, as part of the adaptive immune response, only recent studies showing that killer lymphocytes use the expand and become cytotoxic about a week after they first antimicrobial cytotoxic granule pore-forming peptide encounter target cells. However, innate-like killer T cells granulysin, induced by microbial exposure, to permeabilize (gd T cells, NK T cells, mucosal associated invariant cholesterol-poor microbial membranes and deliver death- T (MAIT) cells) that have restricted T cell receptors that inducing granzymes into these pathogens. Granulysin and recognize common features of infected cells, including granzymes cause microptosis, programmed cell death in pathogenic lipids and microbial metabolites, are often microbes, by inducing reactive oxygen species and destroying localized at barrier surfaces where infection enters the microbial antioxidant defenses and disrupting biosynthetic and body. These killer cells may have been activated by other central metabolism pathways
    [Show full text]
  • Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection
    Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection This information is current as Brenna E. Kiniry, Peter W. Hunt, Frederick M. Hecht, Ma of October 3, 2021. Somsouk, Steven G. Deeks and Barbara L. Shacklett J Immunol published online 19 January 2018 http://www.jimmunol.org/content/early/2018/01/19/jimmun ol.1701532 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/01/19/jimmunol.170153 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 3, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 19, 2018, doi:10.4049/jimmunol.1701532 The Journal of Immunology Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection Brenna E. Kiniry,* Peter W. Hunt,† Frederick M. Hecht,‡ Ma Somsouk,x Steven G.
    [Show full text]
  • Monoclonal Antibody(Clone: GZMB/3056)
    9853 Pacific Heights Blvd. Suite D. San Diego, CA 92121, USA Tel: 858-263-4982 Email: [email protected] 36-2452: Anti-Granzyme B (NK/T-Cell Lymphoma Marker) Monoclonal Antibody(Clone: GZMB/3056) Clonality : Monoclonal Clone Name : GZMB/3056 Application : IHC Reactivity : Human Gene : GZMB Gene ID : 3002 Uniprot ID : P10144 Cathepsin G-like 1; CCPI; CGL1; CSPB; CTLA-1; CTSGL1; Cytotoxic serine protease B; Cytotoxic Alternative Name : T lymphocyte associated serine esterase 1; Cytotoxic T-lymphocyte proteinase 2; Fragmentin-2; GRB; Human lymphocyte protein (Hlp); Lymphocyte protease; SECT; T-cell serine protease 1-3E Isotype : Mouse IgG, kappa Recombinant fragment of human GZMB protein (around aa 73-187) (exact sequence is Immunogen Information : proprietary) Description Granzyme B is a member of the granule serine protease family stored specifically in NK cells or cytotoxic T cells. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the ability to recognize, bind, and lyse specific target cells. They are thoµght to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. Granzyme B is crucial for the rapid induction of target cell apoptosis by CTLs in the cell- mediated immune response. Granzyme B is useful as a marker in the identification of NK/T-cell lymphomas. High percentages of cytotoxic T-cells have been shown to be an unfavorable prognostic indicator in Hodgkin's Disease. Product Info Amount : 20 µg / 100 µg 200 µg/ml of Ab Purified from Bioreactor Concentrate by Protein A/G. Prepared in 10mM PBS with Content : 0.05% BSA & 0.05% azide.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Single-Cell Profiling Reveals the Trajectories of Natural Killer Cell
    www.nature.com/cmi Cellular & Molecular Immunology ARTICLE OPEN Single-cell profiling reveals the trajectories of natural killer cell differentiation in bone marrow and a stress signature induced by acute myeloid leukemia Adeline Crinier1, Pierre-Yves Dumas2,3,4, Bertrand Escalière1, Christelle Piperoglou5, Laurine Gil1, Arnaud Villacreces3,4, Frédéric Vély1,5, Zoran Ivanovic4,6, Pierre Milpied1, Émilie Narni-Mancinelli 1 and Éric Vivier 1,5,7 Natural killer (NK) cells are innate cytotoxic lymphoid cells (ILCs) involved in the killing of infected and tumor cells. Among human and mouse NK cells from the spleen and blood, we previously identified by single-cell RNA sequencing (scRNAseq) two similar major subsets, NK1 and NK2. Using the same technology, we report here the identification, by single-cell RNA sequencing (scRNAseq), of three NK cell subpopulations in human bone marrow. Pseudotime analysis identified a subset of resident CD56bright NK cells, NK0 cells, as the precursor of both circulating CD56dim NK1-like NK cells and CD56bright NK2-like NK cells in human bone marrow and spleen under physiological conditions. Transcriptomic profiles of bone marrow NK cells from patients with acute myeloid leukemia (AML) exhibited stress-induced repression of NK cell effector functions, highlighting the profound impact of this disease on NK cell heterogeneity. Bone marrow NK cells from AML patients exhibited reduced levels of CD160, but the CD160high group had a significantly higher survival rate. 1234567890();,: Keywords: NK cells; scRNASeq; AML Cellular & Molecular Immunology (2021) 18:1290–1304; https://doi.org/10.1038/s41423-020-00574-8 INTRODUCTION T lymphocytes and a subset of ILC3 cells (NCR+ ILC3 cells) in Natural killer (NK) cells are large granular lymphocytes in the ILC mucosa.5–7 family.
    [Show full text]
  • Gene Repertoire of Cytotoxic Effector Proteins in the Camelidae
    G C A T T A C G G C A T genes Article A Deadly Cargo: Gene Repertoire of Cytotoxic Effector Proteins in the Camelidae Ján Futas 1,2, Jan Oppelt 1,3 , Pamela Anna Burger 4 and Petr Horin 1,2,* 1 CEITEC VFU, University of Veterinary Sciences Brno, 612 42 Brno, Czech Republic; [email protected] (J.F.); [email protected] (J.O.) 2 Department of Animal Genetics, Veterinary and Pharmaceutical University, 612 42 Brno, Czech Republic 3 Department of Pathology and Laboratory Medicine, Division of Neuropathology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104-6100, USA 4 Research Institute of Wildlife Ecology, Department of Interdisciplinary Life Sciences, University of Veterinary Medicine Vienna, 1160 Vienna, Austria; [email protected] * Correspondence: [email protected] Abstract: Cytotoxic T cells and natural killer cells can kill target cells based on their expression and release of perforin, granulysin, and granzymes. Genes encoding these molecules have been only poorly annotated in camelids. Based on bioinformatic analyses of genomic resources, sequences corre- sponding to perforin, granulysin, and granzymes were identified in genomes of camelids and related ungulate species, and annotation of the corresponding genes was performed. A phylogenetic tree was constructed to study evolutionary relationships between the species analyzed. Re-sequencing of all genes in a panel of 10 dromedaries and 10 domestic Bactrian camels allowed analyzing their individual genetic polymorphisms. The data showed that all extant Old World camelids possess functional genes for two pore-forming proteins (PRF1, GNLY) and six granzymes (GZMA, GZMB, Citation: Futas, J.; Oppelt, J.; Burger, GZMH, GZMK, GZMM, and GZMO).
    [Show full text]