DOCSLIB.ORG

Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection This information is current as Brenna E. Kiniry, Peter W. Hunt, Frederick M. Hecht, Ma of October 3, 2021. Somsouk, Steven G. Deeks and Barbara L. Shacklett J Immunol published online 19 January 2018 http://www.jimmunol.org/content/early/2018/01/19/jimmun ol.1701532 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/01/19/jimmunol.170153 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 3, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 19, 2018, doi:10.4049/jimmunol.1701532 The Journal of Immunology Differential Expression of CD8+ T Cell Cytotoxic Effector Molecules in Blood and Gastrointestinal Mucosa in HIV-1 Infection Brenna E. Kiniry,* Peter W. Hunt,† Frederick M. Hecht,‡ Ma Somsouk,x Steven G. Deeks,‡ and Barbara L. Shacklett*,{ We previously reported that CD8+ T cells in human gastrointestinal mucosa exhibit reduced perforin expression and weak or impaired cytotoxic capacity compared with their counterparts in blood. Nevertheless, these cells degranulate and express cyto- kines and chemokines in response to cognate Ag. In addition to weak expression of perforin, earlier studies suggested differential regulation of perforin and granzymes (Gzms), with GzmA and B expressed by significantly higher percentages of mucosal CD8+ T cells than perforin. However, this topic has not been fully explored. The goal of this study was to elucidate the expression and coexpression patterns of GzmA, B, and K in conjunction with perforin in rectosigmoid CD8+ T cells during HIV-1 infection. We Downloaded from found that expression of both perforin and GzmB, but not GzmA or GzmK, was reduced in mucosa compared with blood. A large fraction of rectosigmoid CD8+ T cells either did not express Gzms or were single-positive for GzmA. Rectosigmoid CD8+ T cells appeared skewed toward cytokine production rather than cytotoxic responses, with cells expressing multiple cytokines and chemokines generally lacking in perforin and Gzm expression. These data support the interpretation that perforin and Gzms are differentially regulated, and display distinct expression patterns in blood and rectosigmoid T cells. These studies may help inform the development of strategies to combat HIV-1 and other mucosal pathogens. The Journal of Immunology, 2018, 200: http://www.jimmunol.org/ 000–000. ucosal tissues are primary targets for HIV (HIV-1) CD8+ T cells exhibit strikingly low perforin expression and re- infection, and the gastrointestinal mucosa is a major duced cytotoxicity compared with blood T cells, suggesting CD8+ M site of virus transmission and pathogenesis. Accord- T cells housed in the gut are primed for cytokine release rather ingly, understanding mucosal immune responses to HIV-1 is im- than cytotoxicity (11). portant for the development of strategies to fight infection. CD8+ Despite significantly lower perforin levels in the gut compared with + T cells are thought to play a crucial role in containing HIV-1 in- blood, HIV-1 individuals not on antiretroviral therapy (ART) display by guest on October 3, 2021 fection, as depletion of these cells results in viral rebound (1, 2). greater proportions of perforin and granzyme (Gzm) B–positive However, the specific effector functions by which CD8+ T cells CD8+ T cells in gastrointestinal mucosa compared with those on mediate viral containment remain unclear. In blood, both perforin- ART and HIV-1–negative adults (10–12). Whether this indicates mediated cytotoxicity and polyfunctionality, defined as the si- expression of cytotoxic effector proteins by polyfunctional HIV-1– multaneous production of multiple cytokines and chemokines, specific CD8+ T cells, the emergence of a cytotoxic HIV-1–specific have been identified as possible correlates of immune-mediated effector T (TEFF) cell subset, and/or bystander activation-induced protection from disease progression (3–9). CD8+ T cell poly- perforin and GzmB expression in non–HIV-1–specific CD8+ functionality, including robust production of macrophage inflam- T cells in the mucosa during chronic HIV-1 infection is unknown. matory protein (MIP)-1b, has also been identified as a potential Interestingly, despite low perforin expression, gastrointestinal correlate of protection in mucosa (10). However, gastrointestinal CD8+ T cells express GzmB, albeit at lower levels compared with *Department of Medical Microbiology and Immunology, School of Medicine, Uni- the University of California San Francisco–Gladstone Center for AIDS Research versity of California Davis, Davis, CA 95616; †Division of Experimental Medicine, (P30 AI027763). Additional support was provided by the Delaney AIDS Research Department of Medicine, Zuckerberg San Francisco General Hospital and Trauma Enterprise (AI096109 and AI126611) and the American Foundation for AIDS Center, University of California San Francisco, San Francisco, CA 94110; Research Institute for HIV Cure Research (109301). ‡Positive Health Program, Department of Medicine, Zuckerberg San Francisco Gen- B.L.S. conceived and directed the project; M.S., P.W.H., F.M.H., and S.G.D. char- eral Hospital and Trauma Center, University of California San Francisco, San Fran- x acterized the participant cohort and procured clinical samples; B.E.K. conducted cisco, CA 94110; Division of Gastroenterology, Department of Medicine, laboratory assays and data analysis; B.E.K. and B.L.S. prepared, wrote, and edited Zuckerberg San Francisco General Hospital and Trauma Center, University { the manuscript; all authors read and approved the manuscript. of California San Francisco, San Francisco, CA 94110; and Division of In- fectious Diseases, Department of Medicine, School of Medicine, University of Address correspondence and reprint requests to Dr. Barbara L. Shacklett, Depart- California Davis, Davis, CA 95616 ment of Medical Microbiology and Immunology, University of California Davis, School of Medicine, 3146 Tupper Hall, Davis, CA 95616. E-mail address: ORCIDs: 0000-0001-6371-747X (S.G.D.); 0000-0002-7067-732X (B.L.S.). [email protected] Received for publication November 6, 2017. Accepted for publication December 15, The online version of this article contains supplemental material. 2017. Abbreviations used in this article: ART, antiretroviral therapy; C, controller; FSC, This work was supported by National Institutes of Health/National Institute of Al- forward scatter; Gzm, granzyme; MIP, macrophage inflammatory protein; SEB, lergy and Infectious Diseases Grant R01 AI057020. The University of California Staphylococcal enterotoxin B; SN, seronegative; S1PR1, sphingosine-1-phosphate Davis Flow Cytometry Shared Resource Laboratory was supported by grants from receptor; T , effector T; T , effector memory; T , transitional memory; Tx, the National Institutes of Health National Cancer Institute (P30 CA0933730), EFF EM TM treated; V, viremic untreated; VL, viral load. the National Institutes of Health National Center for Research Resources (C06- RR12088, S10-RR12964, S10-RR026825, and S10-OD018223-01A1), and Ó the James B. Pendleton Charitable Trust. The SCOPE cohort was supported by Copyright 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1701532 2 GASTROINTESTINAL CD8+ T CELLS IN HIV-1 blood, and display ample degranulation, measured by expression Pharmingen (San Diego, CA). Perforin (B-D48: PE) was from Cell Sci- of CD107, suggesting that these mucosal CD8+ T cells may pro- ences (Canton, MA). This perforin Ab detects de novo as well as pre- duce and release cytotoxic granules containing little or no perforin formed perforin and is suitable for monitoring perforin expression following TCR stimulation (21). The HIV-1 Gag peptide pool (Consensus (11, 13). Numerous in vitro and mouse in vivo studies have Clade B) consisted of 123 15-mers overlapping by 11 residues (JPT In- demonstrated noncytolytic, extracellular functions of GzmA, B, novative Peptide Solutions, Berlin, Germany). Staphylococcal enterotoxin and K, including extracellular matrix degradation and the direct B (SEB) was from Sigma-Aldrich. and indirect processing and release of proinflammatory cytokines Ag stimulation and intracellular cytokine staining (14–17). The concept of Gzms functioning in a noncytolytic manner to elicit a proinflammatory state appears consistent with Staining was performed as previously described with slight modifications (12) + on ex vivo blood and mucosal mononuclear cells rested overnight at 37˚C, the strong propensity of gut CD8 T cells to produce chemokines 6 5% CO2. For stimulation assays, cells were incubated at 2 3
Load more

Recommended publications
  • SARS-Cov-2 Entry Protein TMPRSS2 and Its Homologue, TMPRSS4
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441280; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 SARS-CoV-2 Entry Protein TMPRSS2 and Its 2 Homologue, TMPRSS4 Adopts Structural Fold Similar 3 to Blood Coagulation and Complement Pathway 4 Related Proteins ∗,a ∗∗,b b 5 Vijaykumar Yogesh Muley , Amit Singh , Karl Gruber , Alfredo ∗,a 6 Varela-Echavarría a 7 Instituto de Neurobiología, Universidad Nacional Autónoma de México, Querétaro, México b 8 Institute of Molecular Biosciences, University of Graz, Graz, Austria 9 Abstract The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) utilizes TMPRSS2 receptor to enter target human cells and subsequently causes coron- avirus disease 19 (COVID-19). TMPRSS2 belongs to the type II serine proteases of subfamily TMPRSS, which is characterized by the presence of the serine- protease domain. TMPRSS4 is another TMPRSS member, which has a domain architecture similar to TMPRSS2. TMPRSS2 and TMPRSS4 have been shown to be involved in SARS-CoV-2 infection. However, their normal physiological roles have not been explored in detail. In this study, we analyzed the amino acid sequences and predicted 3D structures of TMPRSS2 and TMPRSS4 to under- stand their functional aspects at the protein domain level. Our results suggest that these proteins are likely to have common functions based on their conserved domain organization.
    [Show full text]
  • A Novel CD4+ CTL Subtype Characterized by Chemotaxis and Inflammation Is Involved in the Pathogenesis of Graves’ Orbitopa
    Cellular & Molecular Immunology www.nature.com/cmi ARTICLE OPEN A novel CD4+ CTL subtype characterized by chemotaxis and inflammation is involved in the pathogenesis of Graves’ orbitopathy Yue Wang1,2,3,4, Ziyi Chen 1, Tingjie Wang1,2, Hui Guo1, Yufeng Liu2,3,5, Ningxin Dang3, Shiqian Hu1, Liping Wu1, Chengsheng Zhang4,6,KaiYe2,3,7 and Bingyin Shi1 Graves’ orbitopathy (GO), the most severe manifestation of Graves’ hyperthyroidism (GH), is an autoimmune-mediated inflammatory disorder, and treatments often exhibit a low efficacy. CD4+ T cells have been reported to play vital roles in GO progression. To explore the pathogenic CD4+ T cell types that drive GO progression, we applied single-cell RNA sequencing (scRNA-Seq), T cell receptor sequencing (TCR-Seq), flow cytometry, immunofluorescence and mixed lymphocyte reaction (MLR) assays to evaluate CD4+ T cells from GO and GH patients. scRNA-Seq revealed the novel GO-specific cell type CD4+ cytotoxic T lymphocytes (CTLs), which are characterized by chemotactic and inflammatory features. The clonal expansion of this CD4+ CTL population, as demonstrated by TCR-Seq, along with their strong cytotoxic response to autoantigens, localization in orbital sites, and potential relationship with disease relapse provide strong evidence for the pathogenic roles of GZMB and IFN-γ-secreting CD4+ CTLs in GO. Therefore, cytotoxic pathways may become potential therapeutic targets for GO. 1234567890();,: Keywords: Graves’ orbitopathy; single-cell RNA sequencing; CD4+ cytotoxic T lymphocytes Cellular & Molecular Immunology
    [Show full text]
  • A Triple-Mutated Allele of Granzyme B Incapable of Inducing Apoptosis
    A triple-mutated allele of granzyme B incapable of inducing apoptosis Dorian McIlroy*†, Pierre-Franc¸ois Cartron‡, Pierre Tuffery§, Yasmine Dudoit*, Assia Samri*, Brigitte Autran*, Franc¸ois M. Vallette‡, Patrice Debre´ *, and Ioannis Theodorou*¶ *Laboratoire d’Immunologie Cellulaire et Tissulaire, Institut National de la Sante´et de la Recherche Me´dicale U543, Faculte´deMe´ decine Pitie´-Salpeˆtrie`re, 75013 Paris, France; ‡Institut National de la Sante´et de la Recherche Me´dicale U419, Institut de Biologie, 44000 Nantes, France; and §Institut National de la Sante´et de la Recherche Me´dicale U436, Equipe de Bioinformatique Ge´nomique et Mole´culaire, Universite´de Paris 7, 75013 Paris, France Communicated by Jean Dausset, Fondation Jean Dausset–Centre d’E´ tude du Polymorphisme Humain, Paris, France, December 27, 2002 (received for review June 6, 2002) Granzyme B (GzmB) is a serine protease involved in many pathol- resistant cell lines (20, 21). However, no congenital human ogies, including viral infections, autoimmunity, transplant rejec- diseases have been linked to the disruption of the GzmB gene, tion, and antitumor immunity. To measure the extent of genetic and GzmB knockout mice have no developmental or hemato- variation in GzmB, we screened the GzmB gene for polymorphisms logical abnormalities (22). Therefore, we hypothesized that, in and defined a frequently represented triple-mutated GzmB allele. contrast to mutations in the perforin gene (23), coding poly- 48 88 245 In this variant, three amino acids of the mature protein Q P Y morphisms in the GzmB gene might be relatively well tolerated ؉ 245 88 48 are mutated to R A H .InCD8 cytotoxic T lymphocytes, GzmB in humans and, if present, could influence the killing of tumor ͞ was expressed at similar levels in QPY homozygous, QPY RAH cells.
    [Show full text]
  • Microarray Analysis of Novel Genes Involved in HSV- 2 Infection
    Microarray analysis of novel genes involved in HSV- 2 infection Hao Zhang Nanjing University of Chinese Medicine Tao Liu ( [email protected] ) Nanjing University of Chinese Medicine https://orcid.org/0000-0002-7654-2995 Research Article Keywords: HSV-2 infection,Microarray analysis,Histospecic gene expression Posted Date: May 12th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-517057/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background: Herpes simplex virus type 2 infects the body and becomes an incurable and recurring disease. The pathogenesis of HSV-2 infection is not completely clear. Methods: We analyze the GSE18527 dataset in the GEO database in this paper to obtain distinctively displayed genes(DDGs)in the total sequential RNA of the biopsies of normal and lesioned skin groups, healed skin and lesioned skin groups of genital herpes patients, respectively.The related data of 3 cases of normal skin group, 4 cases of lesioned group and 6 cases of healed group were analyzed.The histospecic gene analysis , functional enrichment and protein interaction network analysis of the differential genes were also performed, and the critical components were selected. Results: 40 up-regulated genes and 43 down-regulated genes were isolated by differential performance assay. Histospecic gene analysis of DDGs suggested that the most abundant system for gene expression was the skin, immune system and the nervous system.Through the construction of core gene combinations, protein interaction network analysis and selection of histospecic distribution genes, 17 associated genes were selected CXCL10,MX1,ISG15,IFIT1,IFIT3,IFIT2,OASL,ISG20,RSAD2,GBP1,IFI44L,DDX58,USP18,CXCL11,GBP5,GBP4 and CXCL9.The above genes are mainly located in the skin, immune system, nervous system and reproductive system.
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells with an Increased Cytotoxic Potential
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Granzyme B (GZMB) (NM 004131) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC321693 Granzyme B (GZMB) (NM_004131) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Granzyme B (GZMB) (NM_004131) Human Untagged Clone Tag: Tag Free Symbol: GZMB Synonyms: C11; CCPI; CGL-1; CGL1; CSP-B; CSPB; CTLA1; CTSGL1; HLP; SECT Vector: pCMV6-AC (PS100020) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene sequence for NM_004131.3 CCAGGGCAGCCTTCCTGAGAAGATGCAACCAATCCTGCTTCTGCTGGCCTTCCTCCTGCT GCCCAGGGCAGATGCAGGGGAGATCATCGGGGGACATGAGGCCAAGCCCCACTCCCGCCC CTACATGGCTTATCTTATGATCTGGGATCAGAAGTCTCTGAAGAGGTGCGGTGGCTTCCT GATACAAGACGACTTCGTGCTGACAGCTGCTCACTGTTGGGGAAGCTCCATAAATGTCAC CTTGGGGGCCCACAATATCAAAGAACAGGAGCCGACCCAGCAGTTTATCCCTGTGAAAAG ACCCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCA GCTGGAGAGAAAGGCCAAGCGGACCAGAGCTGTGCAGCCCCTCAGGCTACCTAGCAACAA GGCCCAGGTGAAGCCAGGGCAGACATGCAGTGTGGCCGGCTGGGGGCAGACGGCCCCCCT GGGAAAACACTCACACACACTACAAGAGGTGAAGATGACAGTGCAGGAAGATCGAAAGTG CGAATCTGACTTACGCCATTATTACGACAGTACCATTGAGTTGTGCGTGGGGGACCCAGA GATTAAAAAGACTTCCTTTAAGGGGGACTCTGGAGGCCCTCTTGTGTGTAACAAGGTGGC CCAGGGCATTGTCTCCTATGGACGAAACAATGGCATGCCTCCACGAGCCTGCACCAAAGT CTCAAGCTTTGTACACTGGATAAAGAAAACCATGAAACGCCACTAACTACAGGAAGCAAA CTAAGCCCCCGCTGTGATGAAACACCTTCTCTGGAGCCAAGTCCAGATTTACACTGGGAG AGGTGCCAGCAACTGAATAAATACCTCTTAGCTGAGTGGAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA Restriction
    [Show full text]
  • The Proteomic Landscape of Resting and Activated CD4+ T Cells Reveal Insights Into Cell Differentiation and Function
    International Journal of Molecular Sciences Article The Proteomic Landscape of Resting and Activated CD4+ T Cells Reveal Insights into Cell Differentiation and Function Yashwanth Subbannayya 1 , Markus Haug 1, Sneha M. Pinto 1, Varshasnata Mohanty 2, Hany Zakaria Meås 1, Trude Helen Flo 1, T.S. Keshava Prasad 2 and Richard K. Kandasamy 1,* 1 Centre of Molecular Inflammation Research (CEMIR), Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology, 7491 Trondheim, Norway; [email protected] (Y.S.); [email protected] (M.H.); [email protected] (S.M.P.); [email protected] (H.Z.M.); trude.fl[email protected] (T.H.F.) 2 Center for Systems Biology and Molecular Medicine, Yenepoya (Deemed to be University), Mangalore 575018, India; [email protected] (V.M.); [email protected] (T.S.K.P.) * Correspondence: [email protected] Abstract: CD4+ T cells (T helper cells) are cytokine-producing adaptive immune cells that activate or regulate the responses of various immune cells. The activation and functional status of CD4+ T cells is important for adequate responses to pathogen infections but has also been associated with auto-immune disorders and survival in several cancers. In the current study, we carried out a label-free high-resolution FTMS-based proteomic profiling of resting and T cell receptor-activated (72 h) primary human CD4+ T cells from peripheral blood of healthy donors as well as SUP-T1 cells. We identified 5237 proteins, of which significant alterations in the levels of 1119 proteins were observed between resting and activated CD4+ T cells.
    [Show full text]
  • A 40-Cm Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology An
    A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis Shunya Nakane, Laurie Zoecklein, Jeffrey Gamez, Louisa Papke, Kevin Pavelko, Jean- François Bureau, Michel Brahic, Larry Pease, Moses Rodriguez To cite this version: Shunya Nakane, Laurie Zoecklein, Jeffrey Gamez, Louisa Papke, Kevin Pavelko, et al.. A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis. Brain Pathology, Wiley, 2003, 13 (4), pp.519-533. 10.1111/j.1750-3639.2003.tb00482.x. hal-03223233 HAL Id: hal-03223233 https://hal.archives-ouvertes.fr/hal-03223233 Submitted on 10 May 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. RESEARCH ARTICLE A 40-cM Region on Chromosome 14 Plays a Critical Role in the Development of Virus Persistence, Demyelination, Brain Pathology and Neurologic Deficits in a Murine Viral Model of Multiple Sclerosis Shunya Nakane1; Laurie J. Zoecklein1; Jeffrey D. Introduction Gamez1; Louisa M. Papke1; Kevin D.
    [Show full text]
  • Gene Expression Profiling in Acute Allograft Rejection
    Spivey et al. Journal of Translational Medicine 2011, 9:174 http://www.translational-medicine.com/content/9/1/174 REVIEW Open Access Gene expression profiling in acute allograft rejection: challenging the immunologic constant of rejection hypothesis Tara L Spivey1,2,3, Lorenzo Uccellini1,4, Maria Libera Ascierto1,5,6, Gabriele Zoppoli5,7, Valeria De Giorgi1, Lucia Gemma Delogu8, Alyson M Engle1, Jaime M Thomas1, Ena Wang1, Francesco M Marincola1* and Davide Bedognetti1,5,9* Abstract In humans, the role and relationship between molecular pathways that lead to tissue destruction during acute allograft rejection are not fully understood. Based on studies conducted in humans, we recently hypothesized that different immune-mediated tissue destruction processes (i.e. cancer, infection, autoimmunity) share common convergent final mechanisms. We called this phenomenon the “Immunologic Constant of Rejection (ICR).” The elements of the ICR include molecular pathways that are consistently described through different immune- mediated tissue destruction processes and demonstrate the activation of interferon-stimulated genes (ISGs), the recruitment of cytotoxic immune cells (primarily through CXCR3/CCR5 ligand pathways), and the activation of immune effector function genes (IEF genes; granzymes A/B, perforin, etc.). Here, we challenge the ICR hypothesis by using a meta-analytical approach and systematically reviewing microarray studies evaluating gene expression on tissue biopsies during acute allograft rejection. We found the pillars of the ICR consistently present among the studies reviewed, despite implicit heterogeneity. Additionally, we provide a descriptive mechanistic overview of acute allograft rejection by describing those molecular pathways most frequently encountered and thereby thought to be most significant. The biological role of the following molecular pathways is described: IFN-g, CXCR3/CCR5 ligand, IEF genes, TNF-a, IL-10, IRF-1/STAT-1, and complement pathways.
    [Show full text]
  • Single-Cell Transcriptome Analysis Reveals Gene Signatures Associated with T-Cell Persistence
    Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0299 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Single-cell transcriptome analysis reveals gene signatures associated with T-cell persistence following adoptive cell therapy Yong-Chen Lu1, Li Jia1, Zhili Zheng1, Eric Tran1,2, Paul F. Robbins1, Steven A. Rosenberg1 1Surgery Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 2Current address: Earle A. Chiles Research Institute, Providence Cancer Institute, Portland, OR 97213, USA Corresponding author: Yong-Chen Lu, Surgery Branch, National Cancer Institute, National Institutes of Health, Building 10-CRC, Rm 3-5930, 10 Center Dr, Bethesda, MD, 20892. Phone: 240-858-3818, E-mail: [email protected] Corresponding author: Steven A. Rosenberg, Surgery Branch, National Cancer Institute, National Institutes of Health, Building 10-CRC, Rm 3-3940, 10 Center Dr, Bethesda, MD, 20892. Phone: 240-858-3080, E-mail: [email protected] Running title: Gene signatures associated with T-cell persistence Financial Support: This work was supported by the Intramural Research Program of National Cancer Institute. Disclosure of Potential Conflicts of Interest: No potential conflicts of interest were disclosed. Keywords: single-cell, adoptive cell therapy, persistence, tumor-infiltrating lymphocytes, cancer immunotherapy 1 Downloaded from cancerimmunolres.aacrjournals.org on September 27, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0299 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Cleavage of the APE1 N-Terminal Domain in Acute Myeloid Leukemia Cells Is Associated with Proteasomal Activity
    biomolecules Article Cleavage of the APE1 N-Terminal Domain in Acute Myeloid Leukemia Cells Is Associated with Proteasomal Activity 1, , ,§ 1, 2 Lisa Lirussi y z , Giulia Antoniali y , Pasqualina Liana Scognamiglio , Daniela Marasco 2 , Emiliano Dalla 1 , Chiara D’Ambrosio 3 , Simona Arena 3 , Andrea Scaloni 3 and Gianluca Tell 1,* 1 Department of Medicine, University of Udine, 33100 Udine, Italy; [email protected] (L.L.); [email protected] (G.A.); [email protected] (E.D.) 2 Department of Pharmacy, University of Naples “Federico II”, 80134 Naples, Italy; [email protected] (P.L.S.); [email protected] (D.M.) 3 Proteomics & Mass Spectrometry Laboratory, ISPAAM, National Research Council, 80147 Naples, Italy; [email protected] (C.D.); [email protected] (S.A.); [email protected] (A.S.) * Correspondence: [email protected]; Tel.: +39-0432-494311 These authors contributed equally to this work. y Present address: Department of Clinical Molecular Biology, University of Oslo, 0318 Oslo, Norway. z § Present address: Department of Clinical Molecular Biology, Akershus University Hospital, 1478 Lørenskog, Norway. Received: 1 March 2020; Accepted: 30 March 2020; Published: 31 March 2020 Abstract: Apurinic/apyrimidinic endonuclease 1 (APE1), the main mammalian AP-endonuclease for the resolution of DNA damages through the base excision repair (BER) pathway, acts as a multifunctional protein in different key cellular processes. The signals to ensure temporo-spatial regulation of APE1 towards a specific function are still a matter of debate. Several studies have suggested that post-translational modifications (PTMs) act as dynamic molecular mechanisms for controlling APE1 functionality.
    [Show full text]
  • Granulysin: Killer Lymphocyte Safeguard Against Microbes
    Available online at www.sciencedirect.com ScienceDirect Granulysin: killer lymphocyte safeguard against microbes 1 2 Farokh Dotiwala and Judy Lieberman Primary T cell immunodeficiency and HIV-infected patients are of infected target cells, such as perturbations of major plagued by non-viral infections caused by bacteria, fungi, and histocompatibility protein expression or molecular signs parasites, suggesting an important and underappreciated role of cellular stress, as part of innate immunity. Most killer for T lymphocytes in controlling microbes. Here, we review T cells, as part of the adaptive immune response, only recent studies showing that killer lymphocytes use the expand and become cytotoxic about a week after they first antimicrobial cytotoxic granule pore-forming peptide encounter target cells. However, innate-like killer T cells granulysin, induced by microbial exposure, to permeabilize (gd T cells, NK T cells, mucosal associated invariant cholesterol-poor microbial membranes and deliver death- T (MAIT) cells) that have restricted T cell receptors that inducing granzymes into these pathogens. Granulysin and recognize common features of infected cells, including granzymes cause microptosis, programmed cell death in pathogenic lipids and microbial metabolites, are often microbes, by inducing reactive oxygen species and destroying localized at barrier surfaces where infection enters the microbial antioxidant defenses and disrupting biosynthetic and body. These killer cells may have been activated by other central metabolism pathways
    [Show full text]