DOCSLIB.ORG

AID and Apobecs As Multifaceted Intrinsic Virus- Restricting Factors: Emerging Concepts in the Light of COVID-19

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
AID and Apobecs As Multifaceted Intrinsic Virus- Restricting Factors: Emerging Concepts in the Light of COVID-19 PERSPECTIVE published: 01 July 2021 doi: 10.3389/fimmu.2021.690416 AID and APOBECs as Multifaceted Intrinsic Virus- Restricting Factors: Emerging Concepts in the Light of COVID-19 Anastasia Meshcheryakova 1*, Peter Pietschmann 1, Philip Zimmermann 2, Igor B. Rogozin 3 and Diana Mechtcheriakova 1* 1 Department of Pathophysiology and Allergy Research, Center of Pathophysiology, Infectiology and Immunology, Medical University of Vienna, Vienna, Austria, 2 Nebion AG, Zürich, Switzerland, 3 National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD, United States The AID (activation-induced cytidine deaminase)/APOBEC (apolipoprotein B mRNA Edited by: editing enzyme catalytic subunit) family with its multifaceted mode of action emerges as Zhiwei Wu, potent intrinsic host antiviral system that acts against a variety of DNA and RNA viruses Nanjing University, China including coronaviruses. All family members are cytosine-to-uracil deaminases that either Reviewed by: Sheikh Rahman, have a profound role in driving a strong and specific humoral immune response (AID) or Emory University, United States restricting the virus itself by a plethora of mechanisms (APOBECs). In this article, we Mireille Laforge, U1141 Neuroprotection du Cerveau highlight some of the key aspects apparently linking the AID/APOBECs and SARS-CoV-2. en De´ veloppement (INSERM), France Among those is our discovery that APOBEC4 shows high expression in cell types and *Correspondence: anatomical parts targeted by SARS-CoV-2. Additional focus is given by us to the lymphoid Diana Mechtcheriakova structures and AID as the master regulator of germinal center reactions, which result in diana.mechtcheriakova@ meduniwien.ac.at antibody production by plasma and memory B cells. We propose the dissection of the Anastasia Meshcheryakova AID/APOBECs gene signature towards decisive determinants of the patient-specific and/ anastasia.meshcheryakova@ fi fi meduniwien.ac.at or the patient group-speci c antiviral response. Finally, the patient-speci c mapping of the AID/APOBEC polymorphisms should be considered in the light of COVID-19. Specialty section: Keywords: AID, APOBECs, APOBEC4, AID/APOBECs gene expression signature, lymphoid structures, germinal This article was submitted to center, SARS-CoV-2, COVID-19 Viral Immunology, a section of the journal Frontiers in Immunology Received: 02 April 2021 INTRODUCTION Accepted: 07 June 2021 Published: 01 July 2021 Maintaining the integrity of our genetic material is a prerequisite for proper long-term hierarchical Citation: functioning of cells, cell-based tissues, and tissue-based organs. This guarantees the full-fledged Meshcheryakova A, Pietschmann P, transfer of genetic material to the next generation and the maintenance of physiological, disease-free Zimmermann P, Rogozin IB and conditions. Multimodular systems monitor unwanted editing of genetic material, flag its presence Mechtcheriakova D (2021) AID and and repair it (1–3). In parallel to preventing degeneration, circumstances exist in which DNA- and/ APOBECs as Multifaceted Intrinsic or RNA-modifications must be reinforced to ensure effective protection. This applies to the Virus-Restricting Factors: Emerging Concepts in the Light of COVID-19. mutagenic cellular factors of the AID (activation-induced cytidine deaminase)/APOBEC Front. Immunol. 12:690416. (apolipoprotein B mRNA editing enzyme catalytic subunit) family, composed in total of eleven doi: 10.3389/fimmu.2021.690416 members and evolutionally acting in both adaptive and innate immune responses (4–6). Frontiers in Immunology | www.frontiersin.org 1 July 2021 | Volume 12 | Article 690416 Meshcheryakova et al. AID/APOBECs and SARS-CoV-2 In this perspective, we bring up for discussion the strategic at the DNA level (17), our knowledge of mutable motifs and relevance of the AID/APOBECs for the understanding of the other context features associated with AID/APOBECs at the patient-specific nature of SARS-CoV-2 replication and viral RNA level is scarce (14, 16, 18). Addressing mutable motifs adaptation, mutational landscape and pathobiology, and of the represents a powerful approach to study molecular mechanisms antiviral immune response. Figure 1 reflects the major research of mutations linked to genetic diversity and adaptation of virus areas related to the APOBEC family and the emerging interest of populations in the course of natural infection (17, 19). the scientific community for the role of APOBECs in the context APOBECs, with the best studied APOBEC3 subfamily of SARS-CoV-2. comprising seven members (APOBEC3A, APOBEC3B, The current knowledge on other aspects of AID/APOBEC APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, biology including their origin, evolution, paralogs, structural APOBEC3H), act against a wide variety of viruses including features, cellular location, as well as the special role of AID/ HIV-1 (RNA type), hepatitis B virus (DNA type), herpesviruses APOBECs in cancer mutagenesis, as well as lessons and models (DNA type), and parvoviruses (DNA type) (20). Recent emerged from HIV-APOBECs counteractions can be found in discoveries demonstrated the APOBEC3-mediated restriction excellent review articles (7–12). of viruses from the Coronaviridae family (15), including very first indications for the APOBEC-driven editing of RNA in SARS-CoV-2, a single-stranded positive sense RNA virus (16). INTRINSIC ANTIVIRAL HOST DEFENSE Consistent with the potential involvement of APOBECs in the SYSTEM EDITING THE GENETIC process of coronavirus editing, several authors have identified an MATERIAL OF THE VIRUS overrepresentation of C-to-U transitions in the SARS-CoV-2 genome. Specifically, the preponderance of C-to-U transitions was The AID/APOBEC family represents the crucial part of the identified to occur within the sequence context targeted by intrinsic host defense system that provides rapid and robust APOBECs and could be attributed to structural configurations protection against endogenous retrotransposons and retroviruses preferred by these antiviral proteins (8, 16, 21–23). Moreover, the as well as exogenous viruses (10, 13). C-to-U substitutions were shown to be associated with non- From the mode of action, the AID/APOBEC proteins are synonymous mutations, thus changing the amino acid sequence cytosine-to-uracil (C-to-U) deaminases, enzymes that and, as potential consequence, resulting in a shift in the ratio of physiologically target nucleic acids (9). An important point here is hydrophilic to hydrophobic protein areas (23, 24). This is of that the members of the AID/APOBEC family might have different particular relevance for the masking or unmasking of the preferences for either DNA or RNA as substrates (14–16). The latter immunogenic epitopes of viral proteins, which in turn drive the underlines the potential relevance for restriction of viral RNA, specific immune responses ensuring the fight in the course of counteracting the virus type which triggers some of the most COVID-19. The arising question whether the APOBEC-driven persistent and complex challenges for public health and medicine. shaping of the SARS-CoV-2 genome creates antigenic epitopes, Although solid data regarding nucleotide context specificity which can be better seen by the cells of the adaptive immune system of AID/APOBEC enzymes, also known as mutable motifs, exist due to more stable presentation by antigen presenting cells in the A B "APOBEC" and ... "APOBEC" and ... 250 Retrotransposon SARS-CoV-2 200 Virus 150 100 50 Cancer HIV 0 1996 1999 2012 2003 2008 2014 1994 1995 1997 1998 2000 2001 2007 2010 2011 2013 2016 2017 2018 2019 2020 2021 2004 2006 2009 2015 2002 2005 Coronavirus Cancer Immunology Cardiovascular Coronavirus HIV Virus Retrotransposons SARS-CoV-2 Cardiovascular Immunology FIGURE 1 | APOBEC-related research in various disciplines. PubMed-based search was performed using the combination of keywords “APOBEC” AND each of the eight indicated terms such as “Cancer”, “Immunology”, “Cardiovascular”, “Coronavirus”, “HIV” for human immunodeficiency virus, “Virus”, “Retrotransposon” (assessed on February 23, 2021). The outcome, as measured by the number of corresponding scientific publications, reveals (A) the proportion of scientific publications coming from indicated research areas and (B) the corresponding publications, published in the years between 1994 and 2021. Frontiers in Immunology | www.frontiersin.org 2 July 2021 | Volume 12 | Article 690416 Meshcheryakova et al. AID/APOBECs and SARS-CoV-2 context of MHC molecules and/or can ensure stronger binding to responses (28). Of increasing interest is the location of action of the corresponding antigen receptors, or vice versa, needs to AID-expressing B cells – the above described events take place be elucidated. within highly organized and specialized structures known as Additional striking features of SARS-CoV-2 are encouraged Germinal Centers (GCs) of lymphoid structures. The strictly to be discussed in the light of APOBECs pressure. The genome of coordinated sequence of events, which includes active cellular SARS-CoV-2 seems to avoid cytosine, thus being depleted of this participants such as mature dendritic cells, T cells, follicular nucleotide (25). In the article by Danchin A and Marliere P (25), helper T cells, follicular dendritic cells, and, as central actors, the the emphasis is given to the unique role of cytosine-related B cells, ensures the desired outcome of a GC reaction – the metabolic processes in coordination with the antiviral response
Load more

Recommended publications
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • 1 the Immune System
    1 The immune system The immune response Innate immunity Adaptive immunity The immune system comprises two arms (rapid response) (slow response) functioning cooperatively to provide a Dendritic cell Mast cell comprehensive protective response: the B cell innate and the adaptive immune system. Macrophage γδ T cell T cell The innate immune system is primitive, does not require the presentation of an antigen, Natural and does not lead to immunological memory. killer cell Basophil Its effector cells are neutrophils, Complement protein macrophages, and mast cells, reacting Antibodies Natural Eosinophil killer T cell CD4+ CD8+ within minutes to hours with the help of T cell T cell complement activation and cytokines (CK). Granulocytes Neutrophil B-lymphocytes B-cell receptor The adaptive immune response is provided by the lymphocytes, which precisely recognise unique antigens (Ag) through cell-surface receptors. epitope Receptors are obtained in billions of variations through antigen cut and splicing of genes and subsequent negative T-lymphocytes selection: self-recognising lymphocytes are eradicated. T-cell receptor Immunological memory after an Ag encounter permits a faster and heightened state of response on a subsequent exposure. epitope MHC Lymphocytes develop in primary lymphoid tissue (bone marrow [BM], thymus) and circulate towards secondary Tonsils and adenoids Lymph lymphoid tissue (lymph nodes [LN], spleen, MALT). nodes Lymphatic vessels The Ag reach the LN carried by lymphocytes or by Thymus dendritic cells. Lymphocytes enter the LN from blood Lymph transiting through specialised endothelial cells. nodes The Ag is processed within the LN by lymphocytes, Spleen macrophages, and other immune cells in order to mount a specific immune response.
    [Show full text]
  • Somatic Hypermutation Targeting to Intrinsic Hotspots of Immunoglobulin
    Leukemia (2001) 15, 1772–1778 2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu Somatic hypermutation targeting to intrinsic hotspots of immunoglobulin genes in follicular lymphoma and multiple myeloma C Belessi1, K Stamatopoulos2, N Stavroyianni2, K Zoi2, T Papadaki3 and C Kosmas4 1Hematology Laboratory, General Hospital of Nikea, Piraeus; 2First Department of Medicine, Athens University School of Medicine, Laikon General Hospital, Athens; 3Hemopathology Unit, Evangelismos Hospital, Athens; and 4Department of Medicine, Helena Venizelou Hospital, Athens, Greece In this study, we analyzed the targeting of the somatic hyper- of the secondary lymphoid organs where contact with and mutation (SHM) mechanism at specific hotspot sequence 3 ␬ selection by antigen takes place. The molecular hallmark of motifs in the VH and V genes of 10 follicular lymphoma (FL) cases and the V␬ and V␭ genes of 11 ␬- and six ␭-light chain this phase is the introduction of mutations within rearranged expressing multiple myeloma (MM) cases. These sequences IgV genes, at a rate much higher than usual, a phenomenon were analyzed for targeting of specific motifs, ie certain highly described as somatic hypermutation.4 mutable trinucleotides (3-NTPs), the tetranucleotide (4-NTP) Antigen selection in B cell ontogeny is evidenced by non- RGYW and its complementary, WRCY (where R = purine, random distribution of somatic mutations in lg HC and LC V = = Y pyrimidine and W A or T). Comparisons were carried out genes, a feature providing useful information concerning the between mutation frequencies in RGYW vs WRCY and the inci- 5 dence of mutations in complementarity determining region ontogenetic assignment of B cell neoplastic disorders.
    [Show full text]
  • An RNA Editing Fingerprint of Cancer Stem Cell Reprogramming
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eScholarship - University of California UC San Diego UC San Diego Previously Published Works Title An RNA editing fingerprint of cancer stem cell reprogramming. Permalink https://escholarship.org/uc/item/4vm8q0f6 Journal Journal of translational medicine, 13(1) ISSN 1479-5876 Authors Crews, Leslie A Jiang, Qingfei Zipeto, Maria A et al. Publication Date 2015-02-12 DOI 10.1186/s12967-014-0370-3 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Crews et al. Journal of Translational Medicine (2015) 13:52 DOI 10.1186/s12967-014-0370-3 METHODOLOGY Open Access An RNA editing fingerprint of cancer stem cell reprogramming Leslie A Crews1,2, Qingfei Jiang1,2, Maria A Zipeto1,2, Elisa Lazzari1,2,3, Angela C Court1,2, Shawn Ali1,2, Christian L Barrett4, Kelly A Frazer4 and Catriona HM Jamieson1,2* Abstract Background: Deregulation of RNA editing by adenosine deaminases acting on dsRNA (ADARs) has been implicated in the progression of diverse human cancers including hematopoietic malignancies such as chronic myeloid leukemia (CML). Inflammation-associated activation of ADAR1 occurs in leukemia stem cells specifically in the advanced, often drug-resistant stage of CML known as blast crisis. However, detection of cancer stem cell-associated RNA editing by RNA sequencing in these rare cell populations can be technically challenging, costly and requires PCR validation. The objectives of this study were to validate RNA editing of a subset of cancer stem cell-associated transcripts, and to develop a quantitative RNA editing fingerprint assay for rapid detection of aberrant RNA editing in human malignancies.
    [Show full text]
  • Antibody List
    產品編號 產品名稱 PA569955 1110059E24Rik Polyclonal Antibody PA569956 1110059E24Rik Polyclonal Antibody PA570131 1190002N15Rik Polyclonal Antibody 01-1234-42 123count eBeads Counting Beads MA512242 14.3.3 Pan Monoclonal Antibody (CG15) LFMA0074 14-3-3 beta Monoclonal Antibody (60C10) LFPA0077 14-3-3 beta Polyclonal Antibody PA137002 14-3-3 beta Polyclonal Antibody PA14647 14-3-3 beta Polyclonal Antibody PA515477 14-3-3 beta Polyclonal Antibody PA517425 14-3-3 beta Polyclonal Antibody PA522264 14-3-3 beta Polyclonal Antibody PA529689 14-3-3 beta Polyclonal Antibody MA134561 14-3-3 beta/epsilon/zeta Monoclonal Antibody (3C8) MA125492 14-3-3 beta/zeta Monoclonal Antibody (22-IID8B) MA125665 14-3-3 beta/zeta Monoclonal Antibody (4E2) 702477 14-3-3 delta/zeta Antibody (1H9L19), ABfinity Rabbit Monoclonal 711507 14-3-3 delta/zeta Antibody (1HCLC), ABfinity Rabbit Oligoclonal 702241 14-3-3 epsilon Antibody (5H10L5), ABfinity Rabbit Monoclonal 711273 14-3-3 epsilon Antibody (5HCLC), ABfinity Rabbit Oligoclonal PA517104 14-3-3 epsilon Polyclonal Antibody PA528937 14-3-3 epsilon Polyclonal Antibody PA529773 14-3-3 epsilon Polyclonal Antibody PA575298 14-3-3 eta (Lys81) Polyclonal Antibody MA524792 14-3-3 eta Monoclonal Antibody PA528113 14-3-3 eta Polyclonal Antibody PA529774 14-3-3 eta Polyclonal Antibody PA546811 14-3-3 eta Polyclonal Antibody MA116588 14-3-3 gamma Monoclonal Antibody (HS23) MA116587 14-3-3 gamma Monoclonal Antibody (KC21) PA529690 14-3-3 gamma Polyclonal Antibody PA578233 14-3-3 gamma Polyclonal Antibody 510700 14-3-3 Pan Polyclonal
    [Show full text]
  • Download Download
    Robyn A Lindley. Medical Research Archives vol 8 issue 8. Medical Research Archives REVIEW ARTICLE Review of the mutational role of deaminases and the generation of a cognate molecular model to explain cancer mutation spectra Author Robyn A Lindley1,2 1Department of Clinical Pathology 2GMDx Genomics Ltd, The Victorian Comprehensive Cancer Centre Level 3 162 Collins Street, Faculty of Medicine, Dentistry & Health Sciences Melbourne VIC3000, AUSTRALIA University of Melbourne, Email: [email protected] 305 Gratton Street, Melbourne, VIC 3000, AUSTRALIA Email: [email protected] Correspondence: Robyn A Lindley, Department of Clinical Pathology, Faculty of Medicine, Dentistry & Health Sciences, University of Melbourne, 305 Gratton Street, Melbourne VIC 3000 AUSTRALIA Mobile: +61 (0) 414209132 Email: [email protected] Abstract Recent developments in somatic mutation analyses have led to the discovery of codon-context targeted somatic mutation (TSM) signatures in cancer genomes: it is now known that deaminase mutation target sites are far more specific than previously thought. As this research provides novel insights into the deaminase origin of most of the somatic point mutations arising in cancer, a clear understanding of the mechanisms and processes involved will be valuable for molecular scientists as well as oncologists and cancer specialists in the clinic. This review will describe the basic research into the mechanism of antigen-driven somatic hypermutation of immunoglobulin variable genes (Ig SHM) that lead to the discovery of TSM signatures, and it will show that an Ig SHM-like signature is ubiquitous in the cancer exome. Most importantly, the data discussed in this review show that Ig SHM-like cancer-associated signatures are highly targeted to cytosine (C) and adenosine (A) nucleotides in a characteristic codon-context fashion.
    [Show full text]
  • WO2019226953A1.Pdf
    ) ( 2 (51) International Patent Classification: Street, Brookline, MA 02446 (US). WILSON, Christo¬ C12N 9/22 (2006.01) pher, Gerard; 696 Main Street, Apartment 311, Waltham, MA 0245 1(US). DOMAN, Jordan, Leigh; 25 Avon Street, (21) International Application Number: Somverville, MA 02143 (US). PCT/US20 19/033 848 (74) Agent: HEBERT, Alan, M. et al. ;Wolf, Greenfield, Sacks, (22) International Filing Date: P.C., 600 Atlanitc Avenue, Boston, MA 02210-2206 (US). 23 May 2019 (23.05.2019) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection av ailable) . AE, AG, AL, AM, (26) Publication Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (30) Priority Data: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, 62/675,726 23 May 2018 (23.05.2018) US HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 62/677,658 29 May 2018 (29.05.2018) US KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 415 Main Street, Cambridge, MA 02142 (US). PRESI¬ OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, DENT AND FELLOWS OF HARVARD COLLEGE SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, [US/US]; 17 Quincy Street, Cambridge, MA 02138 (US).
    [Show full text]
  • Genesymbol Bindingsite Motifs Pvalue Description Ensembl Gene Id AASDH Chr4:57207615-57208306 1 9.55E-79
    GeneSymbol BindingSite Motifs pValue description ensembl_gene_id AASDH chr4:57207615-57208306 1 9.55E-79 aminoadipate-semialdehyde dehydrogenase ENSG00000157426 ABCA10 chr17:67259657-67260436 1 2.57E-85 ATP-binding cassette, sub-family A (ABC1), member 10 ENSG00000154263 ABCB9 chr12:123415801-123416656 1 5.89E-77 ATP-binding cassette, sub-family B (MDR/TAP), member 9 ENSG00000150967 ABCG5 chr2:44039916-44040709 1 1.66E-75 ATP-binding cassette, sub-family G (WHITE), member 5 ENSG00000138075 ABCG8 chr2:44136156-44136727 1 5.13E-87 ATP-binding cassette, sub-family G (WHITE), member 8 ENSG00000143921 ABHD5 chr3:43717538-43718405 1 9.77E-76 abhydrolase domain containing 5 ENSG00000011198 ABL2 chr1:179167916-179168697 1 3.16E-87 c-abl oncogene 2, non-receptor tyrosine kinase ENSG00000143322 ABRA chr8:107672555-107673551 1 1.48E-107 actin-binding Rho activating protein ENSG00000174429 ACADL chr2:211076683-211077481 1 2.40E-77 acyl-CoA dehydrogenase, long chain ENSG00000115361 ACADM chr1:76190984-76192200 1 2.40E-135 acyl-CoA dehydrogenase, C-4 to C-12 straight chain ENSG00000117054 ACAT1 chr11:107996439-107997181 1 2.09E-76 acetyl-CoA acetyltransferase 1 ENSG00000075239 ACP6 chr1:147102212-147103195 1 1.55E-80 acid phosphatase 6, lysophosphatidic ENSG00000162836 ACSL4 chrX:109046263-109047211 1 4.79E-84 acyl-CoA synthetase long-chain family member 4 ENSG00000068366 ACSM4 chr12:7419079-7419616 1 3.72E-72 acyl-CoA synthetase medium-chain family member 4 ENSG00000215009 ACTRT1 chrX:126916430-127482343 4 2.01E-78 actin-related protein T1 ENSG00000123165
    [Show full text]
  • Supplementary Information.Pdf
    Supplementary Information Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein‐Barr virus infection Huaqing Zhong1, Xinran Hu2, Andrew B. Janowski2, Gregory A. Storch2, Liyun Su1, Lingfeng Cao1, Jinsheng Yu3, and Jin Xu1 Department of Clinical Laboratory1, Children's Hospital of Fudan University, Minhang District, Shanghai 201102, China; Departments of Pediatrics2 and Genetics3, Washington University School of Medicine, Saint Louis, Missouri 63110, United States. Supplementary information includes the following: 1. Supplementary Figure S1: Fold‐change and correlation data for hyperactive and hypoactive genes. 2. Supplementary Table S1: Clinical data and EBV lab results for 110 study subjects. 3. Supplementary Table S2: Differentially expressed genes between AIM vs. Healthy controls. 4. Supplementary Table S3: Differentially expressed genes between CAEBV vs. Healthy controls. 5. Supplementary Table S4: Fold‐change data for 303 immune mediators. 6. Supplementary Table S5: Primers used in qPCR assays. Supplementary Figure S1. Fold‐change (a) and Pearson correlation data (b) for 10 cell markers and 61 hypoactive and hyperactive genes identified in subjects with acute EBV infection (AIM) in the primary cohort. Note: 23 up‐regulated hyperactive genes were highly correlated positively with cytotoxic T cell (Tc) marker CD8A and NK cell marker CD94 (KLRD1), and 38 down‐regulated hypoactive genes were highly correlated positively with B cell, conventional dendritic cell
    [Show full text]
  • Somatic Hypermutation of T Cell Receptor a Chain Contributes To
    RESEARCH ARTICLE Somatic hypermutation of T cell receptor a chain contributes to selection in nurse shark thymus Jeannine A Ott1, Caitlin D Castro2, Thaddeus C Deiss1, Yuko Ohta2, Martin F Flajnik2, Michael F Criscitiello1,3* 1Comparative Immunogenetics Laboratory, Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, Texas, United States; 2Department of Microbiology and Immunology, University of Maryland at Baltimore, Baltimore, United States; 3Department of Microbial Pathogenesis and Immunology, College of Medicine, Texas A&M Health Science Center, Texas A&M University, Texas, United States Abstract Since the discovery of the T cell receptor (TcR), immunologists have assigned somatic hypermutation (SHM) as a mechanism employed solely by B cells to diversify their antigen receptors. Remarkably, we found SHM acting in the thymus on a chain locus of shark TcR. SHM in developing shark T cells likely is catalyzed by activation-induced cytidine deaminase (AID) and results in both point and tandem mutations that accumulate non-conservative amino acid replacements within complementarity-determining regions (CDRs). Mutation frequency at TcRa was as high as that seen at B cell receptor loci (BcR) in sharks and mammals, and the mechanism of SHM shares unique characteristics first detected at shark BcR loci. Additionally, fluorescence in situ hybridization showed the strongest AID expression in thymic corticomedullary junction and medulla. We suggest that TcRa utilizes SHM to broaden diversification of the primary ab T cell repertoire in sharks, the first reported use in vertebrates. DOI: https://doi.org/10.7554/eLife.28477.001 *For correspondence: [email protected] Competing interests: The Introduction authors declare that no competing interests exist.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Allergic Rhinitis Patients of Switch Recombination in the Nasal Mucosa Local Somatic Hypermutation and Class
    Local Somatic Hypermutation and Class Switch Recombination in the Nasal Mucosa of Allergic Rhinitis Patients This information is current as Heather A. Coker, Stephen R. Durham and Hannah J. Gould of September 23, 2021. J Immunol 2003; 171:5602-5610; ; doi: 10.4049/jimmunol.171.10.5602 http://www.jimmunol.org/content/171/10/5602 Downloaded from References This article cites 33 articles, 7 of which you can access for free at: http://www.jimmunol.org/content/171/10/5602.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 23, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Local Somatic Hypermutation and Class Switch Recombination in the Nasal Mucosa of Allergic Rhinitis Patients Heather A. Coker,1* Stephen R. Durham,† and Hannah J. Gould2* Immunoglobulin E is produced by nasal B cells in response to allergen.
    [Show full text]