DOCSLIB.ORG

Supplemental Materials and Methods Hydroxyl Radical Footprinting The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Materials and Methods Hydroxyl Radical Footprinting The 1 Supplemental Materials and Methods Hydroxyl Radical Footprinting The 28-nt zipcode flanked by 5′ and 3′ nucleotide extensions that were added for optimal resolution of RNA cleavage products by denaturing polyacrylamide gel electrophoresis was prepared by T7 transcription using synthetic DNA oligonucleotide templates (Invitrogen). The sequence of the sense template was 5′- GGGAATGGATCCACATCTACGAACCGGACTGTTACCAACACCCACACCCCTTCACTGCAGACTTG ACGAAGCTT-3′ and the sequence of the antisense template was 5′- AAGCTTCGTCAAGTCTGCAGTGAAGGGGTGTGGGTGTTGGTAACAGTCCGGTTCGTAGATGTGGA TCCATTCCC-3′. Italicized nucleotides indicate the zipcode[1-28] sequence. Templates were amplified by PCR using the T7 promoter sequence containing 41.30 primer (5′- GATAATACGACTCACTATAGGGAATGGATCCACATCTACGA-3′) and the 24.30 primer (5′- AAGCTTCGTCAAGTCTGCAGTGAA-3′). The transcribed RNA (5′- GGGAATGGATCCACATCTACGAACCGGACTGTTACCAACACCCACACCCCTTCACTGCAGACTTG ACGAAGCTT-3′) was gel-purified by denaturing polyacrylamide gel electrophoresis (8% [w/v] 29:1 acrylamide/Bis-acrylamide, 7M urea, 1X TBE), eluted, precipitated, and resuspended in CE buffer (10 mM sodium cacodylate pH 7.3, 0.1mM EDTA). RNA was dephosphorylated using Antarctic phosphatase (New England Biolabs) and then 5′-end labeled with 32P using T4 polynucleotide kinase (New England Biolabs). Labeled RNA was gel purified, eluted, precipitated, and resuspended in CE buffer as described above. Labeled 32P-RNA (0.01 uM) was equilibrated with recombinant MBP-ZBP1 KH34 (1µM, 0.1µM, 0.02µM, 0µM) in a buffer containing 10 mM sodium cacodylate (pH 7.3), 0.1 mM EDTA, 100 mM NaCl, and 0.01 mg mL-1 tRNA for approximately 3 h in order to ensure the binding reaction reached equilibrium. Cleavage reactions were initiated by mixing samples with freshly prepared Fe(II)-EDTA- Ascorbate solution (5mM, 10mM, and 25mM in reaction, respectively) for 30 minutes at room 2 temperature. After phenol/chloroform extraction, RNA cleavage products were gel-separated using denaturing polyacrylamide gel electrophoresis (10% [w/v] 29:1 acrylamide/Bis-acrylamide, 7M urea, 1X TBE) and imaged on storage phosphor screens using Storm 860 scanner (GE Healthcare). The hydroxyl radical reactivity of the nucleotides contacting ZBP1 KH34 were quantitated by SAFA individual peak fitting analysis(Das et al. 2005). The data for each protection were individually scaled to the integrated density of all bands in the respective lane(Shcherbakova et al. 2004). EMSA The sequences of the RNAs used in the ZBP1 KH34 EMSA experiments were: Zipcode[1–28], 5′-Fl-ACCGGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C3G, 5′-Fl-ACGGGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C3A, 5′-Fl-ACAGGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C3U, 5′-Fl-ACUGGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G4A, 5′-Fl-ACCAGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G4C, 5′-Fl-ACCCGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G4U, 5′-Fl-ACCUGACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G5A, 5′-Fl-ACCGAACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G5C, 5′-Fl-ACCGCACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]G5U, 5′-Fl-ACCGUACUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]A6G, 5′-Fl-ACCGGGCUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]A6C, 5′-Fl-ACCGGCCUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]A6U, 5′-Fl-ACCGGUCUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C7G, 5′-Fl-ACCGGAGUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C7A, 5′-Fl-ACCGGAAUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]C7U, 5′-Fl-ACCGGAUUGUUACCAACACCCACACCCC-3′; Zipcode[1–28]A22C;A24C, 5′-Fl-ACCGGACUGUUACCAACACCCCCCCCCC-3′; 3 Zipcode[1–28]5RE-3RE Swap, 5′-Fl-ACACACCCGUUACCAACACCCCGGACUC-3′; 25RE spacing, 5′-Fl-AGCGGACUGUUACUGAAUUAUUAAAGCGUUUUACACCCUU-3′; 30RE spacing, 5′-Fl-AGCGGACUGUUACUGAUUCGAAUUAUUAAAGCGUUUUACACCCUU-3′. Circular dichroism (CD) spectroscopy All CD spectra were recorded on a Jasco J-815 spectrometer (Japan Spectroscopic Co., Tokyo, Japan) equipped with a PTC-423 Peltier temperature-control system. Thermal unfolding was monitored in 1 cm path-length quartz cells (Hellma) by recording mean residue ellipticity at 222nm between 25°C and 85°C, at approximately 2°C intervals. Reversibility of unfolding was assessed by cooling to 25°C at the same rate. ZBP1 KH34 and ZBP1 KH34 F478A-F479A samples were prepared at 6uM concentration in 25 mM Tris pH 7.2, 500 mM NaCl. Data were fit to a modified version of the Gibbs- Helmholtz equation for a two-state (folded-unfolded) transition model using SigmaPlot v11.0 (SyStat, Chicago, IL, USA) as previously described(Greenfield 2006). Wavelength scans from 240nm-190nm were performed in 0.1 cm path-length quartz cells (Hellma) at 25°C. Protein samples were prepared at 35 uM concentration in 20 mM sodium phosphate buffer pH 7.2, 100 mM NaCl. To calculate approximate secondary structure, spectra were analyzed with the CDsstr algorithm(Johnson 1999; Sreerama and Woody 2000) using the DichroWeb server(Whitmore and Wallace 2004). ZBP1 Immunoprecipitation The gene symbols, accession numbers, and corresponding primer sequences used for PCR amplification of ZBP1 co-immunoprecipitated RNAs were: B2M, NM_009735, 5′- ACAGTTCCACCCGCCTCACATT-3′, 5′-TAGAAAGACCAGTCCTTGCTGAAG-3′; RPL13A, NM_009438, 5′-CTGCTCTCAAGGTTGTTCGGCT-3′, 5′-CCTTCCGTTTCTCCTCCAGAGT-3′; GAPDH, NM_008084, 5′- GGTGAAGGTCGGTGTGAACG-3′, 5′-CTCGCTCCTGGAAGATGGTG-3′; ACTB, NM_007393, 5′-GTCCCTCACCCTCCCAAAAG-3′, 5′- GCTGCCTCAACACCTCAACCC-3′; CSNK1D, 4 NM_027874, 5′-ATGCCATTTGGGTTTGTCAT-3′, 5′-CACCACACCTTTCTGGAGGT-3′; DTNA, NM_207650, 5′-CGTTTGCACAAAGTTCGAGA-3′, 5′-AGCTCCACCGTGAATGTACC-3′; EFNB2, NM_010111, 5′-CTAACCTCTCCTGCGCATTC-3′, 5′-GACGCACAGGACACTTCTCA-3′; EN1, NM_010133, 5′-ACACAACCCTGCGATCCTAC-3′, 5′-GATATAGCGGTTTGCCTGGA-3′; GNAO1, NM_010308, 5′-AGCAAGGCGATTGAGAAAAA-3′, 5′-ACGTCACACACCATCTTGGA-3′; PPP1R9B, BC029672, 5′-GCAACAGCCCTCAACTTCTC-3′, 5′-CTCTGCAGGCACACCATCTA-3′; IRX5, NM_018826, 5′-TCTATCCGGGCTACACGAAC-3′, 5′-GGGATACCGCACCAGAGTTA-3′; NTNG1, NM_030699, 5′-AGCATTCTTCGCTGTCAGGT-3′, 5′-ACAGGGGTATGACTGGCTTG-3′; BARHL2, NM_001005477, 5′-CAACCTCACTGACACCCAAGTC-3′, 5′-AAGGCGACGGAAACATCCTCTG-3′; HES1, NM_008235, 5′-GGAAATGACTGTGAAGCACCTCC-3′, 5′-GAAGCGGGTCACCTCGTTCATG- 3′; KCNAB2, AK143166, 5′-CGGCATCGTCTCAGGGAAGTAT-3′, 5′-CTCCTCACTCAGGATCTTGTCC- 3′; NLGN2, BC056478, 5′-CGATGTCATGCTCAGCGCAGTA-3′, 5′-CCACACTACCTCTTCAAAGCGG- 3′; OPRL1, AF043277, 5′-GCTCAGCACAAGTGGAGGATGA-3′, 5′- GGCTGTAGCAGACAGAGATGATC-3′; RAVER1, NM_027911, 5′-CTGGCTTCAGTGATGTGGATGC- 3′, 5′-CATCTCTGCTGTCTCGTACTCC-3′; SEMA6A, BC062979, 5′-AATGGCAGCCTTTTCCTGGAGG- 3′, 5′-GCAACATAGAGTGAGCCACTCG-3′; SYT3, NM_016663, 5′-TCCCAGCAAAGGACTCCAATGG- 3′, 5′-GGCACCGAGAACTGAAACGTCT-3′; SEPT8, BC049819, 5′-GTTTGCCTCTACTTCATCACGCC- 3′, 5′-GAGATGGTGTCAGCCTTGGCAA-3′. Fluorescence in situ hybridization The sequences for anti-sense probes (amino-modified T are underlined) used to detect the spinophilin mRNA were: 5′-ACATCCTCATTGCGTCGGTCATAGTCCTCGTTGGAGTAGGTGCTGAATAC-3′, 5′-AGCTCCACAGGAAACAGCTCCAACCTCTCCACTCGCTTCTCTAGCTCATA-3′, 5′-GTCTCCTCATCATCCTCTCCATACTGGGCGTATCTCTGCTCCATCATCTC-3′, 5′-CCTTTCTCCTGCTCCAGACTCTGCAACTTCCGTTTCAGCTGCTGGATTTC-3′, 5 5′-GGAACTCGATCTCCTTTTGCTGGTAGTCCTTGATGAGACGCTTGGCCTTG-3′, 5′-TTGGAGTTCCTCAGTGTCTGCAGGTTTCCTTCCAGTTCTGAGATCTTGTC-3′, 5′-TTAGGGCAAGGGTGGTAATGTGGAAGTGGCAAGAGATGGATTCTGAAAGG-3′, 5′-ACTGATCTCACAAGGAATCCACCTCCCAGCAAAAGGGCTTCCTAGTTCTA-3′, 5′-GTTTGTCCATTTCCTCCTTCCTGGCTAGCTCCGACTCTTCCAGTACCCGA-3′, 5′-AAGTGGGGAAACTGAGTCAATTTCACTTAGAAAGCAGGCTGACAGCAAGC-3′. The sequences for anti-sense probes (amino-modified T are underlined) used to detect the GFP mRNA were: 5′-GGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCG-3′, 5′-GGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTT-3′, 5′-TCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGT-3′. 6 Supplemental References Das R, Laederach A, Pearlman SM, Herschlag D, Altman RB. 2005. SAFA: semi-automated footprinting analysis software for high-throughput quantification of nucleic acid footprinting experiments. RNA (New York, NY 11: 344-354. Greenfield NJ. 2006. Using circular dichroism collected as a function of temperature to determine the thermodynamics of protein unfolding and binding interactions. Nat Protoc 1: 2527-2535. Johnson WC. 1999. Analyzing protein circular dichroism spectra for accurate secondary structures. Proteins 35: 307-312. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nature protocols 3: 1101-1108. Shcherbakova I, Gupta S, Chance MR, Brenowitz M. 2004. Monovalent ion-mediated folding of the Tetrahymena thermophila ribozyme. J Mol Biol 342: 1431-1442. Sreerama N, Woody RW. 2000. Estimation of protein secondary structure from circular dichroism spectra: comparison of CONTIN, SELCON, and CDSSTR methods with an expanded reference set. Anal Biochem 287: 252-260. Whitmore L, Wallace BA. 2004. DICHROWEB, an online server for protein secondary structure analyses from circular dichroism spectroscopic data. Nucleic acids research 32: W668-673. 7 Supplemental Figure Legends Figure S1. The ZBP1 KH34 didomain recognizes a bipartite RNA element within the zipcode RNA. (A) Hydroxyl radical footprint of ZBP1 KH34 bound to the 28 nucleotide zipcode RNA. Lane designations (from left): 28 nucleotide zipcode RNA in the absence of ZBP1 KH34, and in the presence of 1, 0.1, and 0.02 µM of ZBP1 KH34, respectively. (B) Quantification of cleavage intensity difference versus nucleotide position for the 0.1 µM ZBP1-KH34 bound RNA. Figure S2. ZBP1 KH34 recognizes alternate sequences at the 3′ zipcode binding site. (A) Representative EMSA result for ZBP1 KH34 binding to 3′ site mutant zipcode RNA; positions 22 and 24 of the zipcode are both mutated from A to C. The filled triangle
Load more

Recommended publications
  • Experimental Validation of the Regulated Expression of Large Numbers of Non-Coding Rnas from the Mouse Genome
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Article Experimental validation of the regulated expression of large numbers of non-coding RNAs from the mouse genome Timothy Ravasi,1,4,5 Harukazu Suzuki,2,4 Ken C. Pang,1,3,4 Shintaro Katayama,2,4 Masaaki Furuno,2,4,6 Rie Okunishi,2 Shiro Fukuda,2 Kelin Ru,1 Martin C. Frith,1,2 M. Milena Gongora,1 Sean M. Grimmond,1 David A. Hume,1 Yoshihide Hayashizaki,2 and John S. Mattick1,7 1ARC Special Research Centre for Functional and Applied Genomics, Institute for Molecular Bioscience, University of Queensland, Brisbane QLD 4072, Australia; 2Laboratory for Genome Exploration Research Group, RIKEN Genomic Science Center, RIKEN Yokohama Institute, Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa, 230-0045, Japan; 3T Cell Laboratory, Ludwig Institute for Cancer Research, Austin & Repatriation Medical Centre, Heidelberg VIC 3084, Australia Recent large-scale analyses of mainly full-length cDNA libraries generated from a variety of mouse tissues indicated that almost half of all representative cloned sequences did not contain an apparent protein-coding sequence, and were putatively derived from non-protein-coding RNA (ncRNA) genes. However, many of these clones were singletons and the majority were unspliced, raising the possibility that they may be derived from genomic DNA or unprocessed pre-mRNA contamination during library construction, or alternatively represent nonspecific “transcriptional noise.” Here we show, using reverse transcriptase-dependent PCR, microarray, and Northern blot analyses, that many of these clones were derived from genuine transcripts of unknown function whose expression appears to be regulated.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Transcriptomic Profile of the Subiculum-Projecting VIP Gabaergic Neurons in the Mouse CA1 Hippocampus
    Brain Structure and Function (2019) 224:2269–2280 https://doi.org/10.1007/s00429-019-01883-z SHORT COMMUNICATION Transcriptomic profle of the subiculum‑projecting VIP GABAergic neurons in the mouse CA1 hippocampus Xiao Luo1,2 · Einer Muñoz‑Pino1,2 · Ruggiero Francavilla1,2 · Maxime Vallée3,4 · Arnaud Droit3 · Lisa Topolnik1,2 Received: 16 March 2018 / Accepted: 2 May 2019 / Published online: 16 May 2019 © Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract In cortical circuits, the vasoactive intestinal peptide (VIP+)-expressing GABAergic cells represent a heterogeneous but unique group of interneurons that is mainly specialized in network disinhibition. While the physiological properties and connectivity patterns have been elucidated in several types of VIP+ interneurons, little is known about the cell type-specifc molecular repertoires important for selective targeting of VIP+ cell types and understanding their functions. Using patch- sequencing approach, we analyzed the transcriptomic profle of anatomically identifed subiculum-projecting VIP+ GABAe- rgic neurons that reside in the mouse hippocampal CA1 area, express muscarinic receptor 2 and coordinate the hippocampo- subicular interactions via selective innervation of interneurons in the CA1 area and of interneurons and pyramidal cells in subiculum. We explored the VIP+ cell gene expression within major gene families including ion channels, neurotransmitter receptors, neuromodulators, cell adhesion and myelination molecules. Among others, a large variety of genes involved in neuromodulatory signaling, including acetylcholine (Chrna4), norepinephrin (Adrb1), dopamine (Drd1), serotonin (Htr1d), cannabinoid (Cnr1), opioid (Oprd1, Oprl1) and neuropeptide Y (Npy1r) receptors was detected in these cells. Many genes that were enriched in other local VIP+ cell types, including the interneuron-selective interneurons and the cholecystokinin- coexpressing basket cells, were detected in VIP+ subiculum-projecting cells.
    [Show full text]
  • Characterization of Glomerular Extracellular Matrix in Iga Nephropathy by Proteomic Analysis of Laser-Captured Microdissected Gl
    Paunas et al. BMC Nephrology (2019) 20:410 https://doi.org/10.1186/s12882-019-1598-1 RESEARCH ARTICLE Open Access Characterization of glomerular extracellular matrix in IgA nephropathy by proteomic analysis of laser-captured microdissected glomeruli Flavia Teodora Ioana Paunas1,2* , Kenneth Finne2, Sabine Leh2,3, Tarig Al-Hadi Osman2, Hans-Peter Marti2,4, Frode Berven5 and Bjørn Egil Vikse1,2 Abstract Background: IgA nephropathy (IgAN) involves mesangial matrix expansion, but the proteomic composition of this matrix is unknown. The present study aimed to characterize changes in extracellular matrix in IgAN. Methods: In the present study we used mass spectrometry-based proteomics in order to quantitatively compare protein abundance between glomeruli of patients with IgAN (n = 25) and controls with normal biopsy findings (n = 15). Results: Using a previously published paper by Lennon et al. and cross-referencing with the Matrisome database we identified 179 extracellular matrix proteins. In the comparison between IgAN and controls, IgAN glomeruli showed significantly higher abundance of extracellular matrix structural proteins (e.g periostin, vitronectin, and extracellular matrix protein 1) and extracellular matrix associated proteins (e.g. azurocidin, myeloperoxidase, neutrophil elastase, matrix metalloproteinase-9 and matrix metalloproteinase 2). Periostin (fold change 3.3) and azurocidin (3.0) had the strongest fold change between IgAN and controls; periostin was also higher in IgAN patients who progressed to ESRD as compared to patients who did not. Conclusion: IgAN is associated with widespread changes of the glomerular extracellular matrix proteome. Proteins important in glomerular sclerosis or inflammation seem to be most strongly increased and periostin might be an important marker of glomerular damage in IgAN.
    [Show full text]
  • Genetic Loci on Chromosome 5 Are Associated with Circulating Levels Of
    Cytokine 81 (2016) 1–9 Contents lists available at ScienceDirect Cytokine journal homepage: www.journals.elsevier.com/cytokine Genetic loci on chromosome 5 are associated with circulating levels of interleukin-5 and eosinophil count in a European population with high risk for cardiovascular disease Olga McLeod a, Angela Silveira a, Elsa Valdes-Marquez b, Harry Björkbacka c, Peter Almgren d, Karl Gertow a, Jesper R. Gådin a, Alexandra Bäcklund a, Bengt Sennblad e, Damiano Baldassarre f,g, Fabrizio Veglia g, Steve E. Humphries h, Elena Tremoli f,g, Ulf de Faire i, Jan Nilsson c, Olle Melander d, Jemma C. Hopewell b, Robert Clarke b, Hanna M. Björck a, Anders Hamsten a, John Öhrvik a,j, ⇑ Rona J. Strawbridge a, , On behalf of the IMPROVE study group a Cardiovascular Medicine Unit, Department of Medicine Solna, Karolinska Institutet, Stockholm, Sweden b CTSU – Nuffield Department of Population Health, University of Oxford, Oxford, UK c Experimental Cardiovascular Research Unit, Department of Clinical Sciences Malmö, Lund University, Malmö, Sweden d Department of Clinical Sciences Malmö, Lund University, Malmö, Sweden e Cardiovascular Medicine Unit, Department of Medicine, Science for Life Laboratory, Karolinska Institutet, Stockholm, Sweden f Dipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano, Italy g Centro Cardiologico Monzino, IRCCS, Milan, Italy h Centre for Cardiovascular Genetics, University College London, UK i Division of Cardiovascular Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, Stockholm, Sweden j Centre for Clinical Research Västerås, Uppsala University, SE-72189 Västerås, Sweden article info abstract Article history: IL-5 is a Th2 cytokine which activates eosinophils and is suggested to have an atheroprotective role.
    [Show full text]
  • Curcumin Is a Potent Modulator of Microglial Gene Expression And
    Karlstetter et al. Journal of Neuroinflammation 2011, 8:125 JOURNAL OF http://www.jneuroinflammation.com/content/8/1/125 NEUROINFLAMMATION RESEARCH Open Access Curcumin is a potent modulator of microglial gene expression and migration Marcus Karlstetter1†, Elena Lippe1†, Yana Walczak1†, Christoph Moehle2, Alexander Aslanidis1, Myriam Mirza1 and Thomas Langmann1* Abstract Background: Microglial cells are important effectors of the neuronal innate immune system with a major role in chronic neurodegenerative diseases. Curcumin, a major component of tumeric, alleviates pro-inflammatory activities of these cells by inhibiting nuclear factor kappa B (NFkB) signaling. To study the immuno-modulatory effects of curcumin on a transcriptomic level, DNA-microarray analyses were performed with resting and LPS-challenged microglial cells after short-term treatment with curcumin. Methods: Resting and LPS-activated BV-2 cells were stimulated with curcumin and genome-wide mRNA expression patterns were determined using DNA-microarrays. Selected qRT-PCR analyses were performed to confirm newly identified curcumin-regulated genes. The migration potential of microglial cells was determined with wound healing assays and transwell migration assays. Microglial neurotoxicity was estimated by morphological analyses and quantification of caspase 3/7 levels in 661W photoreceptors cultured in the presence of microglia-conditioned medium. Results: Curcumin treatment markedly changed the microglial transcriptome with 49 differentially expressed transcripts in a combined analysis of resting and activated microglial cells. Curcumin effectively triggered anti-inflammatory signals as shown by induced expression of Interleukin 4 and Peroxisome proliferator activated receptor a. Several novel curcumin- induced genes including Netrin G1, Delta-like 1, Platelet endothelial cell adhesion molecule 1,andPlasma cell endoplasmic reticulum protein 1, have been previously associated with adhesion and cell migration.
    [Show full text]
  • Cell Type-Specific CLIP Reveals That NOVA Regulates 2 Cytoskeleton Interactions in Motoneurons
    bioRxiv preprint doi: https://doi.org/10.1101/237347; this version posted January 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Cell type-specific CLIP reveals that NOVA regulates 2 cytoskeleton interactions in motoneurons. 3 4 Yuan Yuan1, Shirley Xie1, Jennifer C. Darnell1, Andrew J. Darnell1, Yuhki Saito1,2, 5 Hemali Phatnani3,5, Elisabeth Murphy1, Chaolin Zhang4,5,6, Tom Maniatis5,6, and Robert 6 B. Darnell1,2,3* 7 8 1Laboratory of Molecular Neuro-Oncology, 2Howard Hughes Medical Institute, The 9 Rockefeller University, 1230 York Ave. NY, NY 10065 USA* 10 3New York Genome Center, 101 Avenue of the Americas, NY, NY 10013 USA* 11 4Department of Systems Biology, 5Department of Biochemistry and Molecular Biophysics, 12 6Center for Motor Neuron Biology and Disease, Columbia University, New York NY 13 10032, USA 14 *Correspondence author: Robert B. Darnell, M.D., Ph.D. 15 Laboratory of Molecular Neuro-Oncology 16 The Rockefeller University 17 Howard Hughes Medical Institute 18 Box 226 19 1230 York Avenue 20 New York, NY 10021 21 Phone: (212) 327-7460 22 Fax: (212) 327-7109 23 e-mail: [email protected] 24 25 26 27 28 MOTONEURON-SPECIFIC CLIP 29 Key words: cell-type specific, CLIP, motoneuron, NOVA, RNA, alternative splicing, 30 alternative last exon usage, septin 31 32 1 bioRxiv preprint doi: https://doi.org/10.1101/237347; this version posted January 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • Genome-Scale Single-Cell Mechanical Phenotyping Reveals Disease-Related Genes Involved in Mitotic Rounding
    ARTICLE DOI: 10.1038/s41467-017-01147-6 OPEN Genome-scale single-cell mechanical phenotyping reveals disease-related genes involved in mitotic rounding Yusuke Toyoda 1,2, Cedric J. Cattin3, Martin P. Stewart 3,4,5, Ina Poser1, Mirko Theis6, Teymuras V. Kurzchalia1, Frank Buchholz1,6, Anthony A. Hyman1 & Daniel J. Müller 3 To divide, most animal cells drastically change shape and round up against extracellular confinement. Mitotic cells facilitate this process by generating intracellular pressure, which the contractile actomyosin cortex directs into shape. Here, we introduce a genome-scale microcantilever- and RNAi-based approach to phenotype the contribution of > 1000 genes to the rounding of single mitotic cells against confinement. Our screen analyzes the rounding force, pressure and volume of mitotic cells and localizes selected proteins. We identify 49 genes relevant for mitotic rounding, a large portion of which have not previously been linked to mitosis or cell mechanics. Among these, depleting the endoplasmic reticulum-localized protein FAM134A impairs mitotic progression by affecting metaphase plate alignment and pressure generation by delocalizing cortical myosin II. Furthermore, silencing the DJ-1 gene uncovers a link between mitochondria-associated Parkinson’s disease and mitotic pressure. We conclude that mechanical phenotyping is a powerful approach to study the mechanisms governing cell shape. 1 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany. 2 Division of Cell Biology, Life Science Institute, Kurume University, Hyakunen-Kohen 1-1, Kurume, Fukuoka 839-0864, Japan. 3 Department of Biosystems Science and Engineering (D-BSSE), Eidgenössische Technische Hochschule (ETH) Zurich, Mattenstrasse 26, 4058 Basel, Switzerland.
    [Show full text]
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . netrin G1 (H-4): sc-393665 BACKGROUND PRODUCT Netrin G1 and netrin G2, also referred to as laminet-1 and laminet-2, are Each vial contains 200 µg IgG 1 kappa light chain in 1.0 ml of PBS with membrane bound axon guidance molecules involved in synaptic formation and < 0.1% sodium azide and 0.1% gelatin. maintenance. They comprise a subgroup within the UNC-6/netrin family. Both genes have been associated with schizophrenia involving single nucleotide APPLICATIONS polymorphisms. They are both expressed in the brain but G1 is most predom - netrin G1 (H-4) is recommended for detection of netrin G1 of human origin inantly expressed in the thalamus and G2 is most predominantly expressed in by Western Blotting (starting dilution 1:100, dilution range 1:100-1:1000), the cortex. These two proteins differ from classical netrins by their failure to immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml of cell bind netrin receptors, the presence of a glycosyl phosphatidylinositol mem - lysate)], immunofluorescence (starting dilution 1:50, dilution range 1:50- brane anchor, and the generation of multiple isoforms. Netrin G1 has at least 1:500) and solid phase ELISA (starting dilution 1:30, dilution range 1:30- nine isoforms, all of which are expressed in adult brain. Isoforms G1a, c, d, 1:3000). and e are also expressed in fetal brain. G1c and G1d are the most highly ex- pressed netrin G1 isoforms. Netrin G1 is involved in NMDA receptor function Suitable for use as control antibody for netrin G1 siRNA (h): sc-72290, and may play a role in Rett syndrome (RTT), atypical autism, epilepsy and netrin G1 shRNA Plasmid (h): sc-72290-SH and netrin G1 shRNA (h) mental retardation.
    [Show full text]
  • Septin 8 (SEPT8) (NM 001098813) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP316253 Septin 8 (SEPT8) (NM_001098813) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human septin 8 (SEPT8), transcript variant 4 Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 43.3 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_001092283 Locus ID: 23176 UniProt ID: Q92599 RefSeq Size: 4270 Cytogenetics: 5q31.1 RefSeq ORF: 1107 Synonyms: SEP2; SEPT8 Summary: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Septin 8 (SEPT8) (NM_001098813) Human Recombinant Protein – TP316253 Product images: Coomassie blue staining of purified SEPTIN8 protein (Cat# TP316253).
    [Show full text]
  • 35Th International Society for Animal Genetics Conference 7
    35th INTERNATIONAL SOCIETY FOR ANIMAL GENETICS CONFERENCE 7. 23.16 – 7.27. 2016 Salt Lake City, Utah ABSTRACT BOOK https://www.asas.org/meetings/isag2016 INVITED SPEAKERS S0100 – S0124 https://www.asas.org/meetings/isag2016 epigenetic modifications, such as DNA methylation, and measuring different proteins and cellular metab- INVITED SPEAKERS: FUNCTIONAL olites. These advancements provide unprecedented ANNOTATION OF ANIMAL opportunities to uncover the genetic architecture GENOMES (FAANG) ASAS-ISAG underlying phenotypic variation. In this context, the JOINT SYMPOSIUM main challenge is to decipher the flow of biological information that lies between the genotypes and phe- notypes under study. In other words, the new challenge S0100 Important lessons from complex genomes. is to integrate multiple sources of molecular infor- T. R. Gingeras* (Cold Spring Harbor Laboratory, mation (i.e., multiple layers of omics data to reveal Functional Genomics, Cold Spring Harbor, NY) the causal biological networks that underlie complex traits). It is important to note that knowledge regarding The ~3 billion base pairs of the human DNA rep- causal relationships among genes and phenotypes can resent a storage devise encoding information for be used to predict the behavior of complex systems, as hundreds of thousands of processes that can go on well as optimize management practices and selection within and outside a human cell. This information is strategies. Here, we describe a multi-step procedure revealed in the RNAs that are composed of 12 billion for inferring causal gene-phenotype networks underly- nucleotides, considering the strandedness and allelic ing complex phenotypes integrating multi-omics data. content of each of the diploid copies of the genome.
    [Show full text]