Circrna-006258 Sponge-Adsorbs Mir-574-5P to Regulate Cell Growth and Milk Synthesis Via EVI5L in Goat Mammary Epithelial Cells

G C A T T A C G G C A T genes

Article CircRNA-006258 Sponge-Adsorbs miR-574-5p to Regulate Cell Growth and Milk Synthesis via EVI5L in Goat Mammary Epithelial Cells

Meng Zhang † , Li Ma †, Yuhan Liu, Yonglong He, Guang Li, Xiaopeng An and Binyun Cao * College of Animal Science and Technology, Northwest A&F University, Yangling 712100, Shanxi, China; [email protected] (M.Z.); [email protected] (L.M.); [email protected] (Y.L.); [email protected] (Y.H.); [email protected] (G.L.); [email protected] (X.A.) * Correspondence: [email protected]; Tel.: +86-29-87092102 These authors contributed equally to this work. † Received: 28 May 2020; Accepted: 25 June 2020; Published: 28 June 2020

Abstract: The development of the udder and the milk yield are closely related to the number and vitality of mammary epithelial cells. Many previous studies have proved that non-coding RNAs (ncRNAs) are widely involved in mammary gland development and the physiological activities of lactation. Our laboratory previous sequencing data revealed that miR-574-5p was differentially expressed during the colostrum and peak lactation stages, while the molecular mechanism of the regulatory effect of miR-574-5p on goat mammary epithelial cells (GMECs) is unclear. In this study, the targeting relationship was detected between miR-574-5p or ecotropic viral integration site 5-like (EVI5L) and circRNA-006258. The results declared that miR-574-5p induced the down-regulation of EVI5L expression at both the mRNA and protein levels, while circRNA-006258 relieved the inhibitory effect through adsorbing miR-574-5p. EVI5L blocked the G1 phase and promoted the S phase by activating the Rab23/ITGB1/TIAM1/Rac1-TGF-β/Smad pathway in GMECs. By increasing the protein expression of Bcl2 and reducing the protein expression of Bax, EVI5L promoted cell growth and inhibited apoptosis. The activation of the PI3K/AKT–mTOR signaling pathway promoted the production of triacylglycerol (TAG) and β-casein in GMECs. The circRNA–006258/miR-574-5p/EVI5L axis could regulate the cell growth and milk synthesis of GMECs by sponge-adsorbed miR-574-5p. These results would provide scientific evidence for precision animal breeding in the industry of dairy goats.

Keywords: EVI5L; miR-574-5p; circRNA-006258; milk synthesis; dairy goats

1. Introduction MicroRNAs (miRNAs) are a series of small non-coding RNA gene products containing 18–22 nucleotides. Recently, researchers found that miRNAs can bind to 3’ untranslated region (3’ UTR) of target messenger RNAs (mRNAs) and negatively regulate gene expression by transcriptional or translational inhibition [1–3]. MiR-574-5p are implicated in the pathophysiology of many tumors, including breast cancer, colorectal cancer and other oncoma [4–6]. In addition, miR-574-5p is a very important regulator for cell migration and proliferation [7–9]. Based on our laboratory sequencing data, miR-574-5p is diﬀerentially expressed in the colostrum and peak lactation periods [10]. MiR-574-5p targets MAP3K9 and reduces the secretion of β-casein and triglycerides through PI3K/AKT–mTOR pathways in goat mammary epithelial cells (GMECs) [11]. Circular RNAs (circRNAs), a kind of endogenous non-coding RNA (ncRNA) with a closed-loop structure, were discovered 40 years ago and are synthesized by a back-splicing event of protein-coding

Genes 2020, 11, 718; doi:10.3390/genes11070718 www.mdpi.com/journal/genes Genes 2020, 11, 718 2 of 16 mRNAs that occurs during post-transcriptional processes [12]. At present, many experiments have proved that circRNAs are modulators in numerous malignancies, and the process of cell growth and invasion [13–15]. At the present stage, considerable studies have found that circRNAs act as ‘miRNA sponges’ and bind proteins to affect a variety of biological processes [16]. Nevertheless, whether circRNAs participate in the GMEC growth and progression remains to be clarified, and the underlying mechanisms of circRNAs are not expounded syllabify in GMECs. The Ecotropic viral integration site 5-like (EVI5L) is a member of the EVI5 family. The EVI5 family belongs to a small subfamily of the Tre-2/Bub2/Cdc16 (TBC) domain-containing proteins [17,18]. Comparing mouse with human, the EVI5 family has two prominent domains: a Tre-2/Bub2/Cdc16 (TBC) domain which is related to the proteins that act as GTPase activating proteins (GAPs) for the Rab family GTPases at the N-terminal half, and a coiled-coil region bearing homology to the structural maintenance of chromosomes (SMC) family of ATPases at the C-terminal half [19,20]. Some reports showed that EVI5 might target Rab11 in cytokinesis [19,21], while EVI5L acts on Rab10 and Rab23 in cytosolic [22]. EVI5L takes part in primary cilium formation through binding Rab23 and the high expression of EVI5L significantly reduces primary cilium formation by more than half. Lim’s tests revealed that EVI5L, a putative Rab23 GAP, regulated the signal way-sonic hedgehog (Shh) signaling during mouse growing [23]. For mouse embryos, EVI5L expression was increased in Tgif1, Tgif2-null embryos and in double-null mouse embryo fibroblasts (MEFs) [20]. At present, all of the study of EVI5L is about the primary cilium formation, and reports about other functions of EVI5L are few. EVI5L was chosen for two reasons: (1) the 3’-UTR of EVI5L has the special nucleotide sequence which attached to the seed sequence of miR-574-5p; (2) EVI5L enigmatically plays roles in cell cycle progression, cytokinesis, and cellular membrane traffic [18]. In our previous work, the ncRNA library was obtained by bioinformatics prediction method. On account of the circRNA-006258 was a significant difference, and we selected it for the future studies. The regulation of circRNA-006258/miR-574-5p/EVI5L was detected by establishing an in vitro culture system of GMECs. Our purpose was to explore a circRNA–miRNA–mRNA network involved in the regulation of mammary epithelial cell growth and milk synthesis, and to reveal its molecular mechanism for the regulation of the lactation performance of dairy goats.

2. Materials and Methods

2.1. Mammary Gland Sample Collection All the experimental animals in this study were raised in accordance with the announcement NO.5 of the Ministry of Agriculture, and the program of the animal experiment was approved by the animal experiment program application review committee of Northwest A&F University. In this study, three Guanzhong dairy goats (3 year old, female) at 90 days postpartum during peak lactation were chosen from a local experiment station in Northwest A&F University of China. The research animals were anesthetized by the intramuscular injection of 150 mg phenobarbital sodium. After 30 min, using a scalpel, incision of 1 cm was cut in the middle of mammary gland, removing about 1 cm3 of mammary gland tissue, before suturing and sterilizing the wound. After 1 week, the surgical line was removed, and all the animals recovered. The mammary tissue samples were placed in phosphate buﬀer saline (PBS) and transferred immediately to the laboratory. There were 100 µg/mL streptomycin and 100 µg/mL penicillin in the PBS [22,24].

2.2. Cell Culture Firstly, fresh udder tissues were washed several times until the solution was pellucid and without milk. Secondly, the tissues were cut about 1 mm3 and were washed again with PBS. The smaller tissues were cultured in DME/F-12 medium (Gibco, Waltham, MA, USA) with 10% fetal calf serum (Gibco, Waltham, MA, USA), 5 µg/mL insulin, 100 U/mL penicillin and streptomycin (Gibco, Waltham, MA, Genes 2020, 11, 718 3 of 16

USA), 10 ng/mL epidermal growth factor 1 (EGF-1, Gibco, Waltham, MA, USA) at 37 ◦C in a humidiﬁed atmosphere with 5% CO2. After about 1 week, the puriﬁed GMECs were received.

2.3. Vector Construction Some genes were predicted can bind miR-574-5p by using Target Scan (http://www.targetscan.org/). The EVI5L CDS sequence (XM_018050954.1) of the goat were predicted by the NCBI genome website. Firstly, the 30 UTR fragment of EVI5L was cloned and building the plasmids of EVI5L with psiCHECK2 vector was to obtain WT-EVI5L-psiCHECK2. The fragment was cloned by PCR with the total RNA that was isolated from the GMECs. The specialized pMD™19-T vector (TaKaRa, Beijing, China) was used to get a high-eﬃciency PCR product and obtained the complete sequence. EVI5L was inserted into the pcDNA3.1 vector (Thermo Fisher, Shanghai, China) so that the restriction enzyme cutting site was Kpn I and Not I. EVI5L (pcDNA3.1) primer information for the vector construction: Forward: CACTAGAGATGGCGAGCCCCACTCTG. Reverse: CTGGGTACCTCAGTTGTCCAGGCCCTGGCT.

2.4. Luciferase Assay Before the luciferase assay, the psiCHECK-2 vectors (Addgene, Watertown, USA) of the EVI5L and circRNA-006258 were built. The miRNA-574-5p target sites were found from the former studies [11]. Primers of wild psiCHECK-2 vectors were designed and synthesized in the 3’ UTR of EVI5L and circRNA-006258 with special restriction enzyme sites: Xho I and Not I. The primers were used for psiCHECK-2 vectors in Table S1. Then, when the GMECs had a density of 50,000 cells/well in 48-well plates, 0.33 mg psiCHECK-2-EVI5L and psiCHECK-2-circRNA-006258 were cotransfected, respectively, with 10 pmol miRNA-574-5p mimics or inhibitors into cells. After 24 h, renilla and firefly luciferase activities were measured using thermo scientific varioskan flash (Thermo scientific, Waltham, MA, USA) by the Dual-Glo luciferase assay system (Promega, Madison, WI, USA).

2.5. Transfection and RNA Extraction The cells were cultured in 6-well plates and the density of every well was 80–90%. Using Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) transfected into GMECs with NC, inhNC, miR-574-5p mimics/inhibitors, si-EVI5L (small interfering RNA of EVI5L) (GenePharma, Shanghai, China), si-circ-006258 (GenePharma, Shanghai, China), pcDNA3.1, pcDNA3.1-EVI5L plasmids, after 24 h or 48 h, the cell samples were collected for further experiment. Total RNA was isolated using Trizol reagent (Invitrogen, CA, USA) [25]. RNA concentration and purity were evaluated with Agilent 2100 Bioanalyzer (Agilent Technologies, PaloAlto, CA, USA) and the RNA was stored at 80 C. Table S2 provides the sequences of EVI5L, circRNA-006258 and miR-574-5p. − ◦ 2.6. Reverse Transcription and Real-Time PCR Reverse transcription was conducted according to the introduction of PrimeScript RT reagent Kit with gDNA Eraser (TAKARA, Beijing, China) [26]. SYBR Premix Ex Taq II (TAKARA, Beijing, China) was used to quantify the mRNA standards of disparate genes and the statistics were analyzed with the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The validated primers used for RT-qPCR are listed in Table1. The RT-PCR conditions were: 95 ◦C for 10 min and then 40 cycles at 94 ◦C for 15 s, 60 ◦C for 30 s, followed by 72 ◦C for 30 s. U6 and β-actin were applied to the internal controls for EVI5L and miR-574-5p mRNA [27]. Each experiment was independently repeated ∆∆Ct at least three times. The relative expression level was calculated by the N = 2− method [28]. The analyses were performed in triplicate. Genes 2020, 11, 718 4 of 16

Table 1. Primer information for RT-qPCR.

Gene GenBank Accession No. Primer Sequences (5’ 3’) → FORWARD: CGGTATGAGTGTGTGTGTGTGAG miR-574-5p REVERSE: ATCCAGTGCAGGGTCCGAGG RT PRIMER: GTCGTATCCAGTGCAGGGTCCGA GGTATTCGCACTGGATACGACCACACA FORWARD: CTCGCTTCGGCAGCACA U6 REVERSE: AACGCTTCACGAATTTGCGT FORWARD:TGTGTTCGTGCGGCTGATGC EVI5L XM_018050954.1 REVERSE:AGGTGGTGAGGAAGAGTGTGAGG FORWARD:AGCGGCATCTCCACCATCTG circRNA-006258 / REVERSE:GAAACACTTGGCTGGGCTGG FORWARD: GATCTGGCACCACACCTTCT β-actin XM_018039831.1 REVERSE: GGGTCATCTTCTCACGGTTG

2.7. Western Blot Cells transfected for 48 h were collected, then the cells were lysed by RIPA (Radio Immunoprecipitation Assay) lysis buffer (Bioteke, Beijing, China) and centrifuged at 4 ◦C for about 15 min (12,000 g). The total protein would go through a series of experiments: 12% SDS-polyacrylamide × gel electrophoresis (SDS-PAGE) separated the different protein, and the gels were moved to PVDF (Polyvinylidene fluoride) membranes (Merck Millipore, MA, USA). The PVDF membranes were sealed with 10% skimmed milk powder for 2 h at room temperature. After the membranes were washed three times with Tris-buffered saline plus Tween 20 (TBST), and they were then incubated with the primary antibodies for 4 h, and the mouse or rabbit antibodies for 2 h. All of the main antibodies are shown in Table2. Subsequently, all the proteins were tested by Quantity One program (Bio-Rad, CA, USA).

Table 2. All of the main antibodies of Western blot (WB).

Name Manufacturer Product Number β-actin Beyotime, Shanghai, China AA128 EVI5L abcam, Cambridge, U.K. ab243722 Rab 23 ABclonal, Wuhan, China A7979 ITGB 1 Sangon Biotech, Shanghai, China D120869 TIAM 1 ABclonal, Wuhan, China A10252 Rac 1 ABclonal, Wuhan, China A7720 Smad 3 ABclonal, Wuhan, China A11388 p-Smad 3 ABclonal, Wuhan, China Ao0554 CDK 4 Sangon Biotech, Shanghai, China D120396 p-CDK 4 ABclonal, Wuhan, China Ap0593 Cyclin D1 ABclonal, Wuhan, China A11310 CDK 2 Sangon Biotech, Shanghai, China D120395 p-CDK 2 Sangon Biotech, Shanghai, China D155352 Cyclin E1 ABclonal, Wuhan, China A14225 AKT Cell Signaling, America #9272 p-AKT Cell Signaling, America #9271 mTOR Abway, Beijing, China CY5306 p-mTOR Boster, Wnhan, China BM4840 Bcl 2 Abway, Beijing, China CY6717 BAX Abway, Beijing, China CY5059 S6K1 BBI, Shanghai, China D199437 p-S6K1 BBI, Shanghai, China D151520

2.8. Cell Cycle, Proliferation and Apoptosis Assay Cell viability and proliferation were tested as previously described with CCK-8 (ZETA™ life, San Francisco, CA, USA) and Edu (Ribobio, Guangzhou, China) [24,29]. The GMECs were cultivated in Genes 2020, 11, 718 5 of 16

96-well plates. After 24, 48, and 72 h transfection, 20 µL CCK8 solution from each well was added to 20 µL CCK8 solution. About 2 h later, using the Epoch microplate reader (Biotek, Winooski, VT, USA), the absorbance at 450 nm was measured. After 24 h transfection, the GMECs were treated with 50 Mm for about 2 h and then DAPI (4’,6-diamidino-2-phenylindole) was added to the mix solution for about 15 min at 37 ◦C. Then, the cells were washed in PBS three times. A fluorescence microscope was calculated for taking the cell images. The ratio of EdU positive cells (EdUstaining cells/the total of cells) was calculated and each experiment had three independent replicates. Cell cycle staining Kit (SeaBiotech, Shanghai, China) and the flow cytometer was performed to detect the cell cycle. The cells were harvested and were washed three times with PBS. Then, 75% ethanol in PBS fixed the cell overnight at 20 C. The apoptosis of the GMECs was tested with the − ◦ flow cytometry method (FCM) and an Annexin V-FITC PI staining apoptosis assay kit (SeaBiotech, Shanghai, China). There were three replicates per condition for every group.

2.9. Determination of β-Casein and Triglyceride Analysis After 24 h transfection, the cell-free supernatants and lysates were obtained and were used to test β-casein and the triglyceride analysis. β-casein and the triglyceride analysis of GMECs were carried out with an Enzyme-linked immunosorbent assay (ELISA) kit (Tongwei, Shanghai, China) and a triglycerides quantitative assay kit (Applygen, Beijing, China), respectively [11].

2.10. Statistical Analysis SPSS 19.0 (Beijing, China) were used to processes all the data present in the experiment. The data could not just be the same and were revealed as the means SE (standard error) of the three independent ± experiments The diﬀerences of each group were analyzed using one-way and two-way analysis of variance (ANOVA), then a Bonferroni post-hoc correction for all group comparisons was performed, considered statistically signiﬁcant at * p < 0.05 and ** p < 0.01.

3. Results

3.1. EVI5L Is One of Target Genes of miR-574-5p in GMECs The 3’ UTR of EVI5L has the special nucleotide sequence which could be specifically attached to miR-574-5p (Figure1A,B). From Figure1C, the groups co-transfected with WT- EVI5L-psiCHECK2 and miR-574-5p mimic significantly attenuated luciferase activities compared with the experiment groups that were co-transfected with WT-EVI5L-psiCHECK2 and negative control (NC). There was no significant change in the co-transcriptional group of miR-574-5p and MUT-EVI5L-psiCHECK2. The results of mRNA detection (Figure1D) indicated that miR-574-5p mimics apparently down-regulated EVI5L compared to NC; inversely, the EVI5L expression with miR-574-5p inhibitors transparently reduced in contrast with the inhibitor negative control (inhNC). Western blot (Figure1E) analysis also demonstrated that the miR-574-5p mimics reduced the protein of EVI5L, while the inhibitor-treated group had an opposite performance compared with the inhNC. To sum up, miR-574-5p played a demotivated role for the expression of EVI5L on mRNA and protein levels. GenesGenes 20202020, ,1111, ,718 718 66 of of 16 16

FigureFigure 1. 1. MMiR-574-5p-targetediR-574-5p-targeted and and down down-regulated-regulated EVI5L.EVI5L. (A(A) )EVI5LEVI5L presentspresents a a complementary complementary sequencesequence (GCS), (GCS), 3′ 3 0 untranslateduntranslated region region (3′ (3 0 UTR),UTR), binding binding the the seed seed sequence sequence of of miR miR-574-5p.-574-5p. (B (B,C,C) ) ContributionContribution vector vector to to test test the the luciferase luciferase expression expression and and the the result result of of the the luciferase luciferase assay. assay. ( (DD)) The The analysis result about the mRNA expression of EVI5L by RT-qPCR. (E) Western blot analysis of EVI5L analysis result about the mRNA expression of EVI5L by RT-qPCR. (E) Western blot analysis of EVI5L expression after 48 h transfection with miR-574-5p mimics, inhibitors, NC and inhNC in goat mammary expression after 48 h transfection with miR-574-5p mimics, inhibitors, NC and inhNC in goat epithelial cells (GMECs). WT-EVI5L-WT, WT-EVI5L-psiCHECK2; EVI5L-mut, MUT-EVI5L-psiCHECK2; mammary epithelial cells (GMECs). WT-EVI5L-WT, WT-EVI5L-psiCHECK2; EVI5L-mut, MUT- NC: negative control; inhNC: inhibitor negative control. ** means significant difference (p < 0.01), * EVI5L-psiCHECK2; NC: negative control; inhNC: inhibitor negative control. ** means significant means significant difference (p < 0.05). difference (p < 0.01), * means significant difference (p < 0.05). 3.2. EVI5L Arrested G0/G1 Phase and Promoted S Phase in GMECs 3.2. EVI5L Arrested G0/G1 Phase and Promoted S Phase in GMECs As shown in Figure2A,B and Figure S1A,B, for S phase, the number of GMECs in the control group (pcDNA3.1)As shown was in moreFigure than 2A,B in and the overexpressionFigure S1A,B, forEVI5L S phase,plasmid the number (pc-EVI5L of ).GMECs However, in the the control groups grouptransfected (pcDNA3.1) with miR-574-5p, was more si-thanEVI5L in theand overexpression the negative control EVI5L (NC) plasmid indicated (pc-EVI5L that the). However, percentage the of groupscells in thetransfected G0/G1 phase with of miR miR-574-5p-574-5p, si was-EVI5L less and than the the negativeNC; as miR-574-5p control (NC) and indicated si-EVI5L had that more the percentagecells in S phase of cells than in the the NC, G0/G1 observably. phase of Therefore, miR-574-5p it turnedwas less out than that theEVI5L NC;caused as miR the-574 G0-5p/G1 and phase si- EVI5Larrest had and more promoted cells thein S Sphase phase than in GMECs. the NC, observably. Therefore, it turned out that EVI5L caused the G0/G1The WB phase experiment arrest and was promoted performed the S to phase assess in the GMECs. molecular mechanism of EVI5L on cell cycle regulationThe WB in experiment GMECs. Pc- wasEVI5L performedincreased to the assess protein the expressionmolecular ofmechanism ITGB1, TIAM1, of EVI5L Rac1 on comparing cell cycle regulationwith pcDNA3.1, in GMECs. and comparedPc-EVI5L increased miR-574-5p the or protein si-EVI5L expressionwith the of negative ITGB1, controlTIAM1,(NC), Rac1 comparing but the WB withresult pcDNA3.1, was opposite and forcompared ITGB1, TIAM1miR-574 and-5p or Rac1 si-EVI5L (Figure with2C,D). the EVI5Lnegativealso control influenced (NC), thebut pathwaythe WB resultof TGF- wasβ/ Smadopposite (Figure for ITGB1,2E,F). ComparedTIAM1 and with Rac1 pcDNA3.1, (Figure 2C,D). pc- EVI5LEVI5L improvedalso influenced the total the pathway protein and of TGFphosphorylation-β/Smad (Figure of Smad3, 2E,F). CDK2, Compared CDK4 with and pcDNA3.1,promoted the pc cyclinE-EVI5L protein,improved but the decreased total protein the protein and phosphorylationof cyclinD. Quite theof Smad3 contrary,, CDK2 miR-574-5p, CDK4 and and si- EVI5L promotedhad di thefferent cyclinE works. protein, In short, butEVI5L decreasedregulated the proteinthe cell of cycle cyclinD. via the Quite Rab23 the/ITGB1 contrary,/TIAM1 miR/Rac1-TGF--574-5p andβ /siSmad-EVI5L pathway had different in GMECs. works. In short, EVI5L regulated the cell cycle via the Rab23/ITGB1/TIAM1/Rac1-TGF-β/Smad pathway in GMECs. Genes 2020, 11, 718 7 of 16 Genes 2020, 11, 718 7 of 16

FigureFigure 2. 2. EVI5LEVI5L causedcaused the the G0/G1 G0/G1 phase phase arrest arrest and and promoted promoted the the S S phase phase in in the the GMECs. GMECs. ( (AA)) Pc Pc--EVI5LEVI5L andand pcDNA3.1 pcDNA3.1 were were transfected transfected in GMECs in GMECs and the and cells the were cells cultured were cultured for about for 24 h about before 24 collection, h before thencollection, the cell then cycle the was cell examined cycle was by examined FCM. (B) by FCM FCM. analyzed (B) FCM the analyzed cell cycle the of cellthe GMECs cycle of thetransfected GMECs withtransfected miR-574 with-5p, miR-574-5p, si-EVI5L, si- andEVI5L NC., and (C, NC.D) EVI5L (C,D) EVI5Laffectedaff ected the the protein protein expression expression of of the the Rab23/ITGB1/TIAM1/Rac1Rab23/ITGB1/TIAM1/Rac1 pathway pathway in in the the WB WB assay. assay. ( (EE,F,F)) Western Western blot blot analysis analysis used used to to assess assess the the effecteffect of of EVI5LEVI5L onon the TGF TGF--β/Smadβ/Smad pathway pathway in in GMECs. FCM: FCM: flow flow cytometry cytometry analysis; analysis; pc pc--EVI5LEVI5L, , overexpressionoverexpression EVI5LEVI5L plasmid;plasmid; pcDNA3.1: pcDNA3.1: control control group; group; NC: NC: negative negative control; control; si si--EVI5LEVI5L: : small small interferinginterfering RNA RNA of of EVI5L; EVI5LEVI5L ++miRmiR-574-5p:-574-5p: pcDNA3.1 pcDNA3.1--EVI5L+miR+miR-574-5p.-574-5p. ** ** means means significant significant differencedifference ( (pp << 0.01),0.01), * * means means significant significant difference difference ( (pp << 0.05).0.05). 3.3. EVI5L Promoted the Growth of GMECs 3.3. EVI5L Promoted the Growth of GMECs As shown in Figure3A and Figure S1C, the overexpression of EVI5L made the quantity of cells As shown in Figure 3A and Figure S1C, the overexpression of EVI5L made the quantity of cells better than with pcDNA3.1; comparing with the miR-574-5p+pcDNA3.1-EVI5L group, the number of better than with pcDNA3.1; comparing with the miR-574-5p+pcDNA3.1-EVI5L group, the number of cells in the pcDNA3.1-EVI5L-treated group was upgraded; while the cells in the group of miR-574-5p cells in the pcDNA3.1-EVI5L-treated group was upgraded; while the cells in the group of miR-574- mimics decreased. We speculated that EVI5L could promote GMEC proliferation. The trials of NC 5p mimics decreased. We speculated that EVI5L could promote GMEC proliferation. The trials of NC and si-EVI5L validated this speculation (Figure3B and Figure S1D). The result of CCK-8 illustrated in and si-EVI5L validated this speculation (Figure 3B and Figure S1D). The result of CCK-8 illustrated Figure3C,D indicated that EVI5L activated the GMECs and weakened the function of miR-574-5p in in Figure 3C,D indicated that EVI5L activated the GMECs and weakened the function of miR-574-5p the viability of GMECs. Besides, flow cytometry was performed to analyze cell apoptosis (Figure3E,F in the viability of GMECs. Besides, flow cytometry was performed to analyze cell apoptosis (Figure and Figure S1E,F). EVI5L had a demotivated effect on GMECs. The effect of si-EVI5L was similar to 3E,F and Figure S1E,F). EVI5L had a demotivated effect on GMECs. The effect of si-EVI5L was similar miR-574-5p, and it also played a negative role in regulating the viability of GMECs. In brief, EVI5L to miR-574-5p, and it also played a negative role in regulating the viability of GMECs. In brief, EVI5L promoted the growth of GMECs and downregulated their apoptosis. promoted the growth of GMECs and downregulated their apoptosis. Herein, WB was performed to investigate the effect of EVI5L on Bcl2 and Bax in GMECs. The results Herein, WB was performed to investigate the effect of EVI5L on Bcl2 and Bax in GMECs. The showed that the overexpression of EVI5L (pc3.1-EVI5L) increased the expression of Bcl2 but decreased results showed that the overexpression of EVI5L (pc3.1-EVI5L) increased the expression of Bcl2 but Bax expression, while si-EVI5L had an antipodal impact (Figure3G,H, Figure S1I,J). decreased Bax expression, while si-EVI5L had an antipodal impact (Figure 3G,H, Figure S1I,J). GenesGenes 20202020,, 1111,, 718 718 88 of of 16 16

FigureFigure 3. 3. EVI5LEVI5L promotedpromoted the the growth growth of of GMECs. GMECs. ( (AA,B,B)) EdU EdU was was used used to to analyze analyze cell cell proliferation proliferation whenwhen the GMECs were cultured forfor aboutabout 2424 h h after after transfection.( transfection.(CC,D,D)) Using Using CCK-8 CCK-8 to to test test the the activity activity of ofGMECs GMECs which which were were cultured cultured for 24, for 48 24, and 48 72 and h after 72 transfection. h after transfection. (E,F) Flow (E cytometry,F) Flow cytometry was performed was performedto analyze cellto analyze apoptosis cell after apoptosis transfecting after transfecting for about 24 for h. (aboutG,H) WB24 h. assay (G,H was) WB conducted assay was to conducted investigate tothe investigate protein expression the protein of expression Bcl2 and Baxof Bcl2 in theand GMECs.Bax in the Pc- GMECs.EVI5L :Pc overexpression-EVI5L: overexpressionEVI5L plasmid; EVI5L plasmid;pcDNA3.1: pcDNA3.1: control group; control NC: group; negative NC: control;negative si- control;EVI5L: si small-EVI5L interfering: small interfering RNA; miR-574-5p RNA; miR+EVI5L-574-: 5pmiR-574-5p+EVI5L: miR+pcDNA3.1--574-5p+pcDNA3.1EVI5L. ** means-EVI5L. significant ** means significant difference difference (p < 0.01), *(p means < 0.01), significant * means significant difference difference(p < 0.05). (p < 0.05). 3.4. EVI5L Increased the Milk Synthesis via PI3K/AKT–mTOR Signaling Pathway 3.4. EVI5L Increased the Milk Synthesis via PI3K/AKT–mTOR Signaling Pathway After the 24 h transfection of the plasmids in GMECs, EVI5L up-regulated the TAG expression and After the 24 h transfection of the plasmids in GMECs, EVI5L up-regulated the TAG expression inhibited the function of miR-574-5p (Figure4A,B). Figure4C,D showed that the EVI5L overexpression and inhibited the function of miR-574-5p (Figure 4A,B). Figure 4C and 4D showed that the EVI5L plasmids (pcDNA3.1-EVI5L) augmented the expression of β-casein in contrast with pcDNA3.1. overexpression plasmids (pcDNA3.1-EVI5L) augmented the expression of β-casein in contrast with Si-EVI5L and miR-574-5p. which decreased the expression of β-casein. pcDNA3.1. Si-EVI5L and miR-574-5p. which decreased the expression of β-casein. The results of the WB assay are shown in Figure4E,F; EVI5L activated AKT, S6K1, and mTOR. The results of the WB assay are shown in Figure 4E,F; EVI5L activated AKT, S6K1, and mTOR. Compared with the pcDNA3.1 group, the AKT, mTOR and S6K1 phosphorylation ratios increased Compared with the pcDNA3.1 group, the AKT, mTOR and S6K1 phosphorylation ratios increased significantly in the EVI5L overexpression vector (pc-EVI5L)-treated group. For miR-574-5p +EVI5L, significantly in the EVI5L overexpression vector (pc-EVI5L)-treated group. For miR-574-5p +EVI5L, the AKT and S6K1 phosphorylation ratios were significantly higher than that of miR-574-5p. On the the AKT and S6K1 phosphorylation ratios were significantly higher than that of miR-574-5p. On the contrary, the si-EVI5L groups decreased AKT, S6K1, and mTOR phosphorylation. MiR-574-5p exerted contrary, the si-EVI5L groups decreased AKT, S6K1, and mTOR phosphorylation. MiR-574-5p the same effect as si-EVI5L. exerted the same effect as si-EVI5L. Genes 2020, 11, 718 9 of 16 Genes 2020, 11, 718 9 of 16

FigureFigure 4. 4. EVI5LEVI5L increasedincreased the the milk milk synthesis synthesis in in GMECs GMECs via via the the PI3K/AKT PI3K/AKT–mTOR–mTOR pathway. pathway. ( (AA,,BB)) The The secretionsecretion of triglyceridestriglycerides in in GMECs GMECs was was measured measured with with a detection a detection kit. (kit.C,D ()C The,D) expressionThe expression of β-casein of β- caseinin the cell-freein the cell supernatants-free supernatants by enzyme-linked by enzyme immunosorbent-linked immunosorbent assay kit. assay (E,F) WBkit. assay(E,F) WB was assay performed was performedto detect the to protein detect expressionthe protein of expression the PI3K/AKT–mTOR of the PI3K/AKT pathway–mT inOR GMECs. pathway Pc- inEVI5L GMECs.: overexpression Pc-EVI5L: overexpressionEVI5L plasmid; EVI5L pcDNA3.1: plasmid; control pcDNA3.1: group; NC: control negative group; control; NC: negative si-EVI5L control;: small interfering si-EVI5L: small RNA; interferingmiR-574-5p RNA;+EVI5L miR: miR-574-5p-574-5p+EVI5L+pcDNA3.1-: miR-574EVI5L-5p+pcDNA3.1. ** means- significantEVI5L. ** means difference significant(p < 0.01) difference, * means (significantp < 0.01), * dimeansfference significant (p < 0.05). difference (p < 0.05). 3.5. CircRNA-006258 Promoted EVI5L Expression in GMECs 3.5. CircRNA-006258 Promoted EVI5L Expression in GMECs On the basis of prior work, the target circRNA of miR-574-5p was predicted based on the circRNA On the basis of prior work, the target circRNA of miR-574-5p was predicted based on the library constructed previously. Through referring to this circRNA library and predicting by biological circRNA library constructed previously. Through referring to this circRNA library and predicting by software, we found that there might be a sponge relationship between circRNA-006258 and miR-574-5p biological software, we found that there might be a sponge relationship between circRNA-006258 (Figure5A). and miR-574-5p (Figure 5A). To verify this conjecture, we built two types of dual-luciferase reporter vector of To verify this conjecture, we built two types of dual-luciferase reporter vector of circRNA- circRNA-006258: wild type: WT-circRNA-006258-psiCHECK2 (Figure5B); and mutant type: 006258: wild type: WT-circRNA-006258-psiCHECK2 (Figure 5B); and mutant type: MUT-circRNA- MUT-circRNA-006258-psiCHECK2. By measuring the luciferase activity after transfection, we found 006258-psiCHECK2. By measuring the luciferase activity after transfection, we found that the double that the double luciferase activity of the WT-circRNA-006258-psiCHECK2 and miR-574-5p group was luciferase activity of the WT-circRNA-006258-psiCHECK2 and miR-574-5p group was significantly significantly lower than that of the WT-circRNA-006258-psiCHECK2 and the negative control (NC) lower than that of the WT-circRNA-006258-psiCHECK2 and the negative control (NC) (Figure 5C). (Figure5C). There was no significant change for the MUT-circRNA-006258-psiCHECK2 group. It There was no significant change for the MUT-circRNA-006258-psiCHECK2 group. It is speculated is speculated that circRNA-006258 is capable of adsorbing miR-574-5p as a “sponge”. As shown in that circRNA-006258 is capable of adsorbing miR-574-5p as a "sponge". As shown in Figure 5D, the Figure5D, the mRNA expression of EVI5L in the si-circRNA-006258 group is notably lower than that of mRNA expression of EVI5L in the si-circRNA-006258 group is notably lower than that of the NC the NC group. The WB assay showed the same results (Figure5E). It turned out that circRNA-006258 group. The WB assay showed the same results (Figure 5E). It turned out that circRNA-006258 adsorbed miR-574-5p and promoted the expression of EVI5L in GMECs. adsorbed miR-574-5p and promoted the expression of EVI5L in GMECs. GenesGenes 20202020, 11, 11, 718, 718 10 10of of16 16

Figure 5. CircRNA-006258 promoted the EVI5L expression in GMECs. (A) circRNA-006258 existed Figure 5. CircRNA-006258 promoted the EVI5L expression in GMECs. (A) circRNA-006258 existed complementary sequence (GCS) binding the seed sequence of miR-574-5p. (B,C) Contribution vector complementary sequence (GCS) binding the seed sequence of miR-574-5p. (B,C) Contribution vector used to test the luciferase expression and the result of luciferase assay. (D) The analysis result concerning used to test the luciferase expression and the result of luciferase assay. (D) The analysis result the mRNA expression of EVI5L by RT-qPCR. (E) Western blot analysis of EVI5L expression after 48 h concerning the mRNA expression of EVI5L by RT-qPCR. (E) Western blot analysis of EVI5L expression transfection with circRNA-006258 and NC in GMECs. Dual-luciferase reporter vector of circRNA-006258: after 48 h transfection with circRNA-006258 and NC in GMECs. Dual-luciferase reporter vector of wild type: WT-circRNA-006258-psiCHECK2; mutant type: MUT-circRNA-006258-psiCHECK2; NC: circRNA-006258: wild type: WT-circRNA-006258-psiCHECK2; mutant type: MUT-circRNA-006258- negative control; si-circRNA-006258: small interfering RNA. ** means significant difference (p < 0.01), * psiCHECK2; NC: negative control; si-circRNA-006258: small interfering RNA. ** means significant means significant difference (p < 0.05). difference (p < 0.01), * means significant difference (p < 0.05). 3.6. CircRNA-006258 Promoted GMEC Proliferation in GMECs 3.6. CircRNA-006258 Promoted GMEC Proliferation in GMECs The cell proliferation was detected by the EdU kit. Figure6A and Figure S1G indicate that the cellThe number cell proliferation of the si-circRNA-006258 was detected groupby the was EdU less kit. than Figure that 6A of theand NC Figure group. S1G Cells indicate were that collected the ceatll number specific of times the (24,si-circRNA 48, and-006258 72 h) and group tested was by less CCK-8 than tothat examine of the NC the group. viability Cells of the were GMECs. collected Cell atviability specific decreasedtimes (24, 48, significantly and 72 h) forand all tested the time by CCK periods-8 to (Figure examine6B). the The viability cells apoptosis of the GMECs. percentage Cell of viabilitysi-circRNA-006258 decreased significantly increased significantly for all the time compared periods with(Figure the 6B). NC The (Figure cells6C apoptosis and Figure percentage S1H). These of si-resultscircRNA demonstrated-006258 increased that the significantly circRNA-006258 compared promoted with the the NC proliferation (Figure 6C ofand GMECs, Figure enhancedS1H). These cell resultsviability, demonstrated and inhibited that their the apoptosis.circRNA-006258 promoted the proliferation of GMECs, enhanced cell viability, and inhibited their apoptosis.

3.7. CircRNA-006258 Promoted Milk Synthesis of GMECs Figure 6D showed that the triglyceride secretion of GMECs in the si-circRNA-006258 and miR- 574-5p group was significantly blocked in contrast with the NC group. Moreover, the β-casein in GMECs after si-circRNA-006258 transfection was significantly reduced compared with the NC group (Figure 6E). Data indicate that circRNA-006258 promoted the synthesis of triglycerides and β-casein in GMECs. Genes 2020, 11, 718 11 of 16 Genes 2020, 11, 718 11 of 16

Figure 6. CircRNA-006258 promoted GMEC growth. (A) EdU was used to analyze the cell proliferation Figure 6. CircRNA-006258 promoted GMEC growth. (A) EdU was used to analyze the cell when the GMECs were cultured for about 24 h after transfection. (B) Cell viability of the GMECs proliferation when the GMECs were cultured for about 24 h after transfection. (B) Cell viability of the was determined by CCK-8 when the cells were cultured for 24, 48, and 72 h after transfection. (C) GMECs was determined by CCK-8 when the cells were cultured for 24, 48, and 72 h after transfection. Flow cytometry was performed to analyze cell apoptosis after transfecting for about 24 h. (D) The (C) Flow cytometry was performed to analyze cell apoptosis after transfecting for about 24 h. (D) The secretion of triglycerides in the GMECs was measured with a detection kit. (E) The expression of secretion of triglycerides in the GMECs was measured with a detection kit. (E) The expression of β- β-casein in the cell-free supernatants by enzyme-linked immunosorbent assay kit. NC: negative control; casein in the cell-free supernatants by enzyme-linked immunosorbent assay kit. NC: negative control; si-circRNA-006258: small interfering RNA. ** means significant difference (p < 0.01), * means significant si-circRNA-006258: small interfering RNA. ** means significant difference (p < 0.01), * means difference (p < 0.05). significant difference (p < 0.05). 3.7. CircRNA-006258 Promoted Milk Synthesis of GMECs 3.8. CircRNA-006258 Regulated Cell Growth and Milk Synthesis Figure6D showed that the triglyceride secretion of GMECs in the si-circRNA-006258 and miR-574-5pFrom group Figures was 7A,B significantly, for the blockedcell cycle in of contrast GMECs, with we the found NC group. that si Moreover,-circRNA-006258 the β-casein inhibited in GMECsRab23/ITGB1/TIAM1/Rac1 after si-circRNA-006258 protein transfection expression, was significantly restrained the reduced percentage compared of total with protein the NC group and the (Figurephosphorylation6E). Data indicate of Smad3 that and circRNA-006258 CDK2 in the promotedTGF-β/Smad the pathway synthesis and of triglycerides depressed the and expressionβ-casein of incyclinE. GMECs. As for regulating the cell growth of GMECs, si-circRNA-006258 inhibited the protein expression of Bcl2 and promoted the expression of the Bax protein (Figures 7C, Figure S1K). Thereby, 3.8.for CircRNA-006258 milk synthesis Regulatedin GMECs, Cell si- GrowthcircRNA and-006258 Milk Synthesis barred the phosphorylation of AKT, mTOR, and S6K1,From and Figure inhibited7A,B, the for PI3K/AKT the cell cycle–mTOR of pathway GMECs, (Figure we found 7D). that si-circRNA-006258 inhibited Rab23/ITGB1/TIAM1/Rac1 protein expression, restrained the percentage of total protein and the phosphorylation of Smad3 and CDK2 in the TGF-β/Smad pathway and depressed the expression of cyclinE. As for regulating the cell growth of GMECs, si-circRNA-006258 inhibited the protein expression of Bcl2 and promoted the expression of the Bax protein (Figure7C, Figure S1K). Thereby, for milk synthesis in GMECs, si-circRNA-006258 barred the phosphorylation of AKT, mTOR, and S6K1, and inhibited the PI3K/AKT–mTOR pathway (Figure7D). GenesGenes 20202020, ,1111, ,718 718 1212 of of 16 16

Figure 7. CircRNA-006258 promoted the milk synthesis of GMECs. (A) CircRNA-006258 influenced Figurethe protein 7. CircRNA expression-006258 of thepromoted Rab23 /theITGB1 milk/TIAM1 synthesis/Rac1 ofpathway GMECs. by(A) WB. CircRNA (B) Western-006258 blot influenced analysis theassessed protein the expression activation of of the circRNA-006258 Rab23/ITGB1/TIAM1/Rac1 on the TGF-β/ Smadpathway pathway by WB. in GMECs.(B) Western (C) WBblot assayanalysis was assessedconducted the toactivation investigate of circRNA the protein-006258 expression on the TGF of Bcl2-β/Smad and Bax pathway in the GMECs.in GMECs. (D ()C Investigating) WB assay was the conductedeffect of circRNA-006258 to investigate the on protein the protein expression expression of Bcl2 of the and PI3K Bax/ AKT–mTORin the GMECs. pathway (D) Investigating by WB assay the in effectthe GMECs. of circRNA NC:-006258 negative on the control; protein si-circRNA-006258: expression of the PI3K/AKT small interfering–mTOR RNA. pathway ** means by WB significant assay in thediff GMECs.erence (p NC:< 0.01), negative * means control; significant si-circRNA difference-006258: (p < small0.05). interfering RNA. ** means significant difference (p < 0.01), * means significant difference (p < 0.05). 4. Discussion 4. Discussion Researchers found that the TGF-β/SMAD pathway could influence cell growth and regulate the cell cycleResearchers to transform found G1 that into the S TGF phase-β/SMAD [30]. Complexes pathway of could cyclin-dependent influence cell kinases growth (CDKs) and regulate and cyclins the cellthe cycle regulated to transform cell cycle. G1 CDK4 into/CDK6-cyclin S phase [30] D. and Complexes CDK2-cyclin of cyclin E separately-dependent altered kinases the G1 (CDKs) and S phase and cyclinsof cells the [31 regulated]. In our experiment, cell cycle. CDK4/CDK6 flow cytometry-cyclin confirmed D and CDK2 that EVI5L-cyclinpromoted E separately S phase altered in GMECs,the G1 andand S thephase results of cells of the[31] WB. In our assay experiment, for the protein flow cytometry of the cell confirmed cycle showed that thatEVI5LEVI5L promotedpromoted S phase the inexpression GMECs, ofand CDK4, the results CDK2, of cyclinD1 the WB but assay inhibited for the cyclinE protein protein of the in GMECs. cell cycle This showed is consistent that EVI5L with promotedthe report the of Clurmanexpression B.E. of [ 32CDK4]. Cells, CDK2 stopped, cyclinD1 at the G1but phase inhibited will gocyclinE into G0 protein phase, in which GMECs. is known This is as consistentthe static condition:with the report no growth, of Clurman no fission B.E. and[32]. no Cells migration. stopped The at the cells G1 in ph G0ase phase will willgo into exaggerate G0 phase, the whichlimit pointis known and quicklyas the static return condition: to the cell no cycle growth, and no proliferation fission and when no migration. they are stimulatedThe cells in by G0 external phase willsignals exaggerate such as the serum limit and point growth and quickly factors [return33]. The to hypophosphorylatedthe cell cycle and proliferation and dephosphorylated when they are of stimulatedpRb appear by in external the G0 phase,signals while such as the serum Phosphorylation and growth preventsfactors [33] cells. The from hypophosphorylated re-entering the cell cycleand dephosphorylatedand phosphorylated of pRb pRb appear mediates in the G0/ G1G0 transformationphase, while the [ 34Phosphorylation]. Beyond that, theprevents Myc pathwaycells from takes re- enteringthe main the role cell for cycle cell and cycle. phosphorylated Therefore, the pRb effect mediates of EVI5L G0/G1on the transformation Myc pathway in[34] GEMCs. Beyon isd supposedthat, the Mycto be pathway explored takes and the illuminated main role in for the cell next cycle. stage. Therefore, the effect of EVI5L on the Myc pathway in GEMCsRab23 is supposed promotes to hepatocellular be explored and carcinoma illuminated cell migration in the next via stage. the Rac1 /TGF-β signaling pathway and promotesRab23 squamous promotes cellhepatocellular carcinoma cell carcinoma migration cell and migration invasion byvia regulatingthe Rac1/TGF the integrin-β signalingβ1/Tiam1 pathway/Rac1 andpathway promotes [35]. squamous Curcumin couldcell carcinoma inhibit SDF-1 cell α migration-induced invasion and invasion through by Rac1 regulating/PI3K/ Akt the signaling integrin β1/Tiam1/Rac1complexes in human pathway esophageal [35]. carcinoma Curcumin cells could [35 –38 inhibit]. Hence, SDF we-1α speculated-induced that invasion these pathways through Rac1/PI3K/Aktmight regulate signaling the biological complexes processes in human in GMECs. esophageal Therefore, carcinoma we measured cells [35 the–38] related. Hence, protein we speculatedexpression that by WB.these The pathways function might of EVI5L regulatewas broughtthe biological into e ffprocessesect by Rab23 in GMECs./ITGB1/ TIAM1Therefore,/Rac1 we in measuredGMECs. Additionally,the related proteinEVI5L expressionaffected the by growth WB. The of the function GMECs of via EVI5L Rac1-TGF- was broughtβ/Smad into and effect Bax, Bcl2.by Rab23/ITGB1/TIAM1/Rac1The activation of the PI3K/AKT–mTOR in GMECs. pathwayAdditionally, by EVI5L EVI5Laccelerated affected the milkgrowth synthesis of the of GMECs the GMECs. via Rac1-TGFMore-β/Smad and more and studies Bax, have Bcl2. proved The that activation non-coding of theRNA PI3K/AKT (ncRNAs)– moleculesmTOR pathway are widely by involved EVI5L acceleratedin udder development the milk synthesis and the of the physiological GMECs. activities of lactation. The competitive endogenous More and more studies have proved that non-coding RNA (ncRNAs) molecules are widely involved in udder development and the physiological activities of lactation. The competitive Genes 2020, 11, 718 13 of 16 Genes 2020, 11, 718 13 of 16 endogenousRNA (ceRNA) RNA hypothesis (ceRNA) is a hypothesis new model is for a newpost transcriptional model for post gene transcriptional regulation. Accordinggene regulation. to the Accordinghypothesis, to the the expressions hypothesis, of the designated expressions miRNAs of designated are reduced miRNAs by ceRNA are reduced [39]. Nowadays, by ceRNA a lot[39] of. Nowadays,evidence has a attested lot of evidence that the form has attested circRNA–miRNA–mRNA that the form circRNA is important–miRNA to– exploremRNA the is important pathogenesis to exploreof tumors the and pathogenesis other diseases. of tumors On and the other strength diseases. of this On research, the strength their of targeted this research, drugs their are expectedtargeted drugsto be found.are expected Building to be the found. circRNA–miRNA–mRNA Building the circRNA– template,miRNA–mRNA various template, biological various processes biological were processesbetter elucidated. were better Xiaotong elucidated. Su et al. Xiaotong reported that Su et circ-0070269 al. reported/miR-182 that circ/NPTX1-0070269/miR played a- significance182/NPTX1 playedrole in hepatocellulara significance role carcinoma in hepatocellular (HCC), and carcinoma that this axis(HCC), could and serve that asthis a axis potential could therapeutic serve as a potentargettial [40 ].therapeutic Another research target [40] revealed. Another that circ-016910research revealed bound that miR-574-5p circ-016910 to regulate bound cellmiR physiology-574-5p to regulateand milk cell synthesis physiology via MAPK and milk and synthesis PI3K/AKT–mTOR via MAPK pathways and PI3K/AKT in GMECs–mTOR [11]. pathways The reporters in GMECs of the [11]circRNA–miRNA–mRNA. The reporters of the circRNA net are fewer–miRNA in goat–mRNA lactation net performance.are fewer in goat We foundlactation that performance. circRNA-006258 We founddirectly that bound circRNA miR-574-5p-006258 by directly the dual-luciferase bound miR-574 reporter-5p by system. the dual CircRNA-006258-luciferase reporter relieved system. the CircRNAinhibitory-006258 effect of relieved miR-574-5p the inhibitory on EVI5L through effect of sponging miR-574 miR-574-5p.-5p on EVI5L We through established sponging the network miR-574 of- 5p.circRNA-006258-miR-574-5p- We established the networkEVI5L of circRNAto fill the-006258 gap. -miR-574-5p-EVI5L to fill the gap. In conclusion, conclusion, based on on the the result result of of preliminary preliminary laboratory laboratory research: research: miR miR-574-5p-574-5p is is differentially differentially expressed in the colostrum and the peak lactation periods the target gene of miR miR-574-5p-574-5p an andd ncRNA database were were established established by by the the laboratory, laboratory, and and miR miR-574-5p-574-5p was was selected selected as the as research the research object. object. The Thetargeting targeting relationship relationship between between miR miR-574-5p-574-5p and and EVI5L EVI5L was was studied studied as as well well as as circRNA circRNA-006258,-006258, to elucidate the molecular regulation mechanism of mammarymammary epithelial cells in lactatinglactating goats.goats. This study may may contribute contribute to determine to determine the better the regulation better regulation molecular molecular mechanism mechanism of lactation performance of lactation performancein dairy goats. in dairy goats.

5. Conclusions Conclusions In brief, brief, our our data data indicated indicated that that circ circ-006258-006258 was wasa sponge a sponge for miR for-574 miR-574-5p-5p to regulate to regulate the growth the andgrowth milk and synthesis milk synthesis through throughEVI5L inEVI5L the lactationin the lactation period of period GMECs. of GMECs.We founded We the founded circRNA the- EVI5L 006258/miRcircRNA-006258-574-/5p/miR-574-5pEVI5L axis/ and elucidatedaxis and elucidated the function the and function the regulatory and the regulatory mechanism mechanism of this axis of inthis the axis lactation in the lactationperiod of period GMECs of (Figure GMECs 8). (Figure 8).

FiFiguregure 8. circcirc-006258-006258/miR/miR-574-5p-574-5p//EVI5L regulatesregulates cell growth and the milk synthesis in GMECs.

Supplementary Materials: The following are available online at www.mdpi.com/xxx/s1, Figure S1: EVI5L and circSupplementary-006258 promoted Materials: GMECThe proliferation following arein G availableMECs, Table online S1: at Thehttp: validated//www.mdpi.com primers /used2073-4425 for psiCHECK/11/7/718/s1-2, vectors,Figure S1: TableEVI5L S2:and EVI5L, circ-006258 circRNA promoted-006258 and GMEC miR proliferation-574-5p sequences. in GMECs, Table S1: The validated primers used for psiCHECK-2 vectors, Table S2: EVI5L, circRNA-006258 and miR-574-5p sequences. Author Contributions: Conceptualization, M.Z. and L.M.; methodology, Y.H.; software, Y.L.; validation, Y.L., B.C. and X.A.; formal analysis, G.L.; investigation, Y.L., M.Z. and L.M.; resources, B.C.; writing—original draft preparation, M. Z. and L.M.; writing—review and editing, B.C. and G.L.; visualization, G.L.; supervision, X.A.; Genes 2020, 11, 718 14 of 16

Author Contributions: Conceptualization, M.Z. and L.M.; methodology, Y.H.; software, Y.L.; validation, Y.L., B.C. and X.A.; formal analysis, G.L.; investigation, Y.L., M.Z. and L.M.; resources, B.C.; writing—original draft preparation, M.Z. and L.M.; writing—review and editing, B.C. and G.L.; visualization, G.L.; supervision, X.A.; project administration, X.A.; funding acquisition, B.C., M.Z. and L.M. contributed equally to this work. All authors have read and agreed to the published version of the manuscript. Funding: This study was supported by the Shaanxi Science, Technology Innovation Project Plan (2017ZDXM-NY-081 and 2018ZDCXL-NY-01-04) and Shaanxi key research and development program (2020ZDLNY02-01 and 2020ZDLNY02-02). Acknowledgments: This research is supported by Natural Science Foundation of Shaanxi Province (2020JQ-868). Conﬂicts of Interest: For this article, there is no conﬂict of interest regarding for all authors to publish.

References

1. Ambros, V.; Bartel, B.; Bartel, D.P.; Burge, C.B.; Carrington, J.C.; Chen, X.; Dreyfuss, G.; Eddy, S.R.; Griﬃths-Jones, S.; Marshall, M.; et al. A uniform system for microRNA annotation. RNA 2003, 9, 277–279. [CrossRef][PubMed] 2. E Pasquinelli, A.; Hunter, S.; Bracht, J. MicroRNAs: A developing story. Curr. Opin. Genet. Dev. 2005, 15, 200–205. [CrossRef][PubMed] 3. Chandra, S.; Vimal, D.; Sharma, D.; Rai, V.; Gupta, S.C.; Chowdhuri, D.K. Role of miRNAs in development and disease: Lessons learnt from small organisms. Life Sci. 2017, 185, 8–14. [CrossRef] 4. Chen, P.; Zhong, J.; Ye, J.; He, Y.; Liang, Z.; Cheng, Y.; Zheng, J.; Chen, H.; Chen, C. miR-324-5p protects against oxidative stress-induced endothelial progenitor cell injury by targeting Mtfr1. J. Cell. Physiol. 2019, 234, 22082–22092. [CrossRef][PubMed] 5. Han, Z.; Zhu, Y.; Cui, Z.; Guo, P.; Wei, A.; Meng, Q. MicroRNA Let-7f-1-3p attenuates smoke-induced apoptosis in bronchial and alveolar epithelial cells in vitro by targeting FOXO1. Eur. J. Pharmacol. 2019, 862, 172531. [CrossRef] 6. Xiaopeng, A.; Yue, Z.; Jidan, L.; Xingna, M.; Zhaoyu, G.; Cao, B. NTS Targeted By miR-182 Modulates the Apoptosis of Goat Endometrial Epithelial Cells; Acta Veterinaria: Belgrade, Serbia, 2019; Volume 69, pp. 340–347. [CrossRef] 7. Li, C.; Tan, F.; Pei, Q.; Zhou, Z.; Zhou, Y.; Zhang, L.; Wang, D.; Pei, H. Non-coding RNA MFI2-AS1 promotes colorectal cancer cell proliferation, migration and invasion through miR-574-5p/MYCBP axis. Cell Prolif. 2019, 52, e12632. [CrossRef] 8. Zhang, Z.; Li, X.; Xiao, Q.; Wang, Z. MiR-574-5p mediates the cell cycle and apoptosis in thyroid cancer cells via Wnt/beta-catenin signaling by repressing the expression of Quaking proteins. Oncol. Lett. 2018, 15, 5841–5848. 9. Wang, X.; Lu, X.; Geng, Z.; Yang, G.; Shi, Y. LncRNA PTCSC3/miR-574-5p Governs Cell Proliferation and Migration of Papillary Thyroid Carcinoma via Wnt/-Catenin Signaling. J. Cell. Biochem. 2017, 118, 4745–4752. [CrossRef] 10. Hou, J.; An, X.; Song, Y.; Cao, B.; Yang, H.; Zhang, Z.; Shen, W.; Li, Y. Detection and comparison of microRNAs in the caprine mammary gland tissues of colostrum and common milk stages. BMC Genet. 2017, 18, 38. [CrossRef] 11. Liu, Y.; Hou, J.; Zhang, M.; Seleh-Zo, E.; Wang, J.; Cao, B.; An, X. circ-016910 sponges miR-574-5p to regulate cell physiology and milk synthesis via MAPK and PI3K/AKT–mTOR pathways in GMECs. J. Cell. Physiol. 2019, 235, 4198–4216. [CrossRef] 12. Wang, Y.; Wang, L.; Wang, W.; Guo, X. Overexpression of circular RNA hsa_circ_0001038 promotes cervical cancer cell progression by acting as a ceRNA for miR-337-3p to regulate cyclin-M3 and metastasis-associated in colon cancer 1 expression. Gene 2020, 733, 144273. [CrossRef][PubMed] 13. Xiang, S.; Li, Z.; Weng, X. Changed cellular functions and aberrantly expressed miRNAs and circRNAs in bone marrow stem cells in osteonecrosis of the femoral head. Int. J. Mol. Med. 2020, 45, 805–815. [CrossRef] [PubMed] 14. Sheng, R.; Li, X.; Wang, Z.; Wang, X. Circular RNAs and their emerging roles as diagnostic and prognostic biomarkers in ovarian cancer. Cancer Lett. 2020, 473, 139–147. [CrossRef][PubMed] Genes 2020, 11, 718 15 of 16

15. Ma, H.-B.; Yao, Y.-N.; Yu, J.-J.; Chen, X.-X.; Li, H. Extensive profiling of circular RNAs and the potential regulatory role of circRNA-000284 in cell proliferation and invasion of cervical cancer via sponging miR-506. Am. J. Transl. Res. 2018, 10, 592–604. 16. Curry-Hyde, A.; Ueberham, U.; Arendt, T.; Janitz, M. Neural circular transcriptomes across mammalian species. Genomics 2020, 112, 1162–1166. [CrossRef] 17. Frasa, M.A.; Koessmeier, K.T.; Ahmadian, M.R.; Braga, V.M. Illuminating the functional and structural repertoire of human TBC/RABGAPs. Nat. Rev. Mol. Cell Biol. 2012, 13, 67. [CrossRef] 18. Lim, Y.S.; Tang, B.L. The Evi5 family in cellular physiology and pathology. FEBS Lett. 2013, 587, 1703–1710. [CrossRef] 19. Dabbeekeh, J.T.S.; Faitar, S.L.; Dufresne, C.P.; Cowell, J.K. The EVI5 TBC domain provides the GTPase-activating protein motif for RAB11. Oncogene 2006, 26, 2804–2808. [CrossRef] 20. Anderson, A.E.; Taniguchi, K.; Hao, Y.; Melhuish, T.A.; Shah, A.; Turner, S.D.; Sutherland, A.E.; Wotton, D. Tgif1 and Tgif2 Repress Expression of the RabGAP Evi5l. Mol. Cell. Boil. 2016, 37, e00527-16. [CrossRef] 21. Westlake, C.J.; Junutula, J.R.; Simon, G.C.; Pilli, M.; Prekeris, R.; Scheller, R.H.; Jackson, P.K.; Eldridge, A.G. Identification of Rab11 as a small GTPase binding protein for the Evi5 oncogene. Proc. Natl. Acad. Sci. USA 2007, 104, 1236–1241. [CrossRef] 22. Shi, H.; Luo, J.; Zhu, J.; Li, J.; Sun, Y.; Lin, X.; Zhang, L.; Yao, D.; Shi, H. PPAR gamma Regulates Genes Involved in Triacylglycerol Synthesis and Secretion in Mammary Gland Epithelial Cells of Dairy Goats. PPAR Res. 2013, 2013, 1–10. [CrossRef][PubMed] 23. Lim, Y.S.; Tang, B.L. A role for Rab23 in the trafficking of Kif17 to the primary cilium. J. Cell Sci. 2015, 128, 2996–3008. [CrossRef] 24. Ma, L.; Qiu, H.; Chen, Z.; Li, L.; Zeng, Y.; Luo, J.; Gou, D. miR-25 modulates triacylglycerol and lipid accumulation in goat mammary epithelial cells by repressing PGC-1beta. J. Anim. Sci. Biotechnol. 2018, 9, 48. [CrossRef][PubMed] 25. Chen, Z.; Shi, H.; Sun, S.; Luo, J.; Zhang, W.; Hou, Y.; Loor, J. MiR-183 regulates milk fat metabolism via MST1 in goat mammary epithelial cells. Gene 2018, 646, 12–19. [CrossRef][PubMed] 26. Liu, X.; Zhang, L.; Liu, Y.; Cui, J.; Che, S.; An, X.; Song, Y.; Cao, B. Circ-8073 regulates CEP55 by sponging miR-449a to promote caprine endometrial epithelial cells proliferation via the PI3K/AKT/mTOR pathway. Biochim. Biophys. Acta (BBA) Bioenerg. 2018, 1865, 1130–1147. [CrossRef] 27. Lin, X.; Luo, J.; Zhang, L.; Wang, W.; Shi, H.; Zhu, J. MiR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. Gene 2013, 521, 15–23. [CrossRef] 28. Han, P.; Guerrero-Netro, H.; Estienne, A.; Cao, B.; Price, C.A. Regulation and action of early growth response 1 in bovine granulosa cells. Reproduction 2017, 154, 547–557. [CrossRef] 29. Li, H.; Yang, J.; Wei, X.; Song, C.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. CircFUT10 reduces proliferation and facilitates differentiation of myoblasts by sponging miR-133a. J. Cell. Physiol. 2018, 233, 4643–4651. [CrossRef] 30. Jahangirimoez, M.; Medlej, A.; Tavallaie, M.; Soltani, B. Hsa-miR-587 Regulates TGFβ/SMAD Signaling and Promotes Cell Cycle Progression. Pathways 2019, 22, 158–164. 31. Moiseeva, T.N.; Qian, C.; Sugitani, N.; Osmanbeyoglu, H.U.; Bakkenist, C.J. WEE1 kinase inhibitor AZD1775 induces CDK1 kinase-dependent origin firing in unperturbed G1- and S-phase cells. Proc. Natl. Acad. Sci. USA 2019, 116, 23891–23893. [CrossRef] 32. E Clurman, B.; Sheaff, R.J.; Thress, K.; Groudine, M.; Roberts, J.M. Turnover of cyclin E by the ubiquitin-proteasome pathway is regulated by cdk2 binding and cyclin phosphorylation. Genome Res. 1996, 10, 1979–1990. [CrossRef][PubMed] 33. Canhoto, A.J.; Chestukhin, A.; Litovchick, L.; DeCaprio, J.A. Phosphorylation of the retinoblastoma-related protein p130 in growth-arrested cells. Oncogene 2000, 19, 5116–5122. [CrossRef] 34. Sage, J.; Miller, A.L.; Perez-Mancera, P.A.; Wysocki, J.M.; Jacks, T. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 2003, 424, 223–228. [CrossRef][PubMed] 35. Jian, Q.; Miao, Y.; Tang, L.; Huang, M.; Yang, Y.; Ba, W.; Liu, Y.; Chi, S.; Li, C. Rab23 promotes squamous cell carcinoma cell migration and invasion via integrin β1/Rac1 pathway. Oncotarget 2016, 7, 5342–5352. [CrossRef][PubMed] Genes 2020, 11, 718 16 of 16

36. Shen, T.; Huang, S. The role of Cdc25A in the regulation of cell proliferation and apoptosis. Anti-Cancer Agents Med. Chem. 2012, 12, 631–639. [CrossRef] 37. Lin, M.L.; Lu, Y.C.; Chen, H.Y.; Lee, C.C.; Chung, J.G.; Chen, S.S. Suppressing the formation of lipid raft-associated Rac1/PI3K/Akt signaling complexes by curcumin inhibits SDF-1α-induced invasion of human esophageal carcinoma cells. Mol. Carcinog. 2014, 53, 360–379. [CrossRef][PubMed] 38. Zhang, L.; Zhang, B.; You, W.; Li, P.; Kuang, Y. Rab23 Promotes Hepatocellular Carcinoma Cell Migration Via Rac1/TGF-β Signaling. Pathol. Oncol. Res. 2018, 26, 301–306. [CrossRef][PubMed] 39. Wang, G.; Guo, X.; Cheng, L.; Chu, P.; Chen, M.; Chen, Y.; Chang, C. An integrated analysis of the circRNA–miRNA–mRNA network reveals novel insights into potential mechanisms of cell proliferation during liver regeneration. Artif. Cells Nanomed. Biotechnol. 2019, 47, 3873–3884. [CrossRef][PubMed] 40. Su, X.; Su, J.; He, H.; Zhan, Y.; Liu, H. Hsa_circ_0070269 inhibits hepatocellular carcinoma progression through modulating miR-182/NPTX1 axis. Biomed. Pharmacother. 2019, 120, 109497. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).