DOCSLIB.ORG

Precision Ophthalmologytm 2020, As

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Precision Ophthalmologytm 2020, As APPLI PREC ISION OPHT H A LMOLOG Y TM ED2020 GENE TICS A G APPLIED TCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAT GENETICS C T G The Department of Ophthalmology At the same time, we train ophthalmologists Aat Columbia University Irving Medical Center and researchers to be the future leaders is a leading international center for the in the field. We have successfully developed management of sight-threatening disorders new drugs, devices and procedures to and scientific exploration to elucidate enhance the lives of our patients and have CTATTTCGGTAGCATCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAACCTTAACCTAGC disease mechanisms and discover novel launched the Applied Genetics Initiative treatments. These aspirations are realized at Columbia Ophthalmology. That through seamless collaborations between our groundbreaking tradition continues today outstanding, compassionate physicians and with Precision Ophthalmologytm 2020, as our talented scientists. described in the following pages. C T FROM THE CHAIRMAN Over the last two decades, our ability critical information for the diagnosis, In our previous book, we to interrogate the human genome prognosis and treatment of disease. introduced the concept of Precision has radically transformed medicine. In addition to determining if an Ophthalmology™: using each Sequencing the genome went from individual is at risk for developing a individual’s own genetic profile a billion-dollar project that required certain disease, we will also be able to tailor a course of treatment A more than ten years of exhaustive to advise them about the risk that specifically designed for him or effort, to a routine task that is their children or other loved ones will her. Columbia’s Applied Genetics regularly completed overnight in our develop it as well. In the related and Initiative in Ophthalmology is a G labs for a few hundred dollars. emerging field of pharmacogenetics, global leader and is making Precision With that achievement has we no longer have to deliver drugs Ophthalmology™ a reality for our Department Milestones 06 come virtually limitless opportunities by trial and error. Instead, we are patients today. In these pages, we’ll to take what we know about the increasingly able to use genetic show you how. Genetics Primer 1 4 genetics of disease and risk, and information to predict a person’s the possibility of treating faulty response to available drug treatment genes, and deliver that knowledge to options and select the therapy that is Foundational Biology 1 6 patients in a way that makes a most likely to work for them. CTATTTCGGTAGCATCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAACCTTAACCT05AGC Vision Science Today 24 meaningful difference in their lives. There are also evolving This new field of ophthalmology, treatments that are directed and in fact all of medicine, is known specifically at particular genetically The Inheritance Question 32 as Applied Genetics. Precision determined diseases. Many of the Ophthalmology™ 2020 explores the most significant advances in gene Genetic Testing & Therapies 38 promise of this growing field, and the therapy for the treatment of disease work that is being done within the have occurred in ophthalmology, new Applied Genetics Initiative at the including the first FDA-approved Disease-Specific Applications 46 Columbia University Department of gene therapy for the treatment of any G.A. (Jack) Cioffi, MD Ophthalmology, to make the most of disease. Edward S. Harkness Professor Gene Discovery 58 those possibilities. So, while we can expect further Jean and Richard Deems Professor We do not need to wait for great leaps forward in gene therapy Chair, Department of Ophthalmology full-fledged gene-based “cures” for and gene surgery in the very near Clinical Trials 64 diseases to leverage our genetic future, we already have the ability, knowledge in ways that can transform today, to leverage the genome for The Future 70 people’s lives. Understanding an diagnosing, counseling and treating individual’s genotype, and how individuals with genetic eye disease. that genetic code interacts with Applied Genetics informs every step environmental factors to produce the of the process: determining who observable traits or characteristics should be tested, how testing can be that we call phenotype, already yields best utilized, and evaluation of the personal and family implications of TC being tested. DEPARTMENT MILESTONES 1935-36 Discovery of hyaluronic acid by Dr. Karl Meyer. 1933 The Department moves Phillips Thygeson, 1866 Cornelius into the Edward S. Harkness Eye MD, OphD, describes R. Agnew, MD, Institute on 165th Street. the microbiologic establishes an transmission of ophthalmology trachoma. clinic at the 1903 Arnold H. College of Knapp, MD, son of Physicians and Herman, appointed Surgeons. professor of 1938 Dr. Castroviejo ophthalmology at 1911 Edmund B. urges people to P&S and becomes Wilson, PhD, maps will their eyes to the third clinic color blindness onto science, leading to director. the X chromosome. the development of today’s eye banks. 1931 Edward S. Harkness pledges money to build a separate Eye Institute 1943 Raymond 1869 Herman at the new medical L. Pfeiffer, MD, J. Knapp, MD, center. is the first to establishes the New delineate the York Ophthalmic landmarks of the and Aural Institute, ocular orbit on which later becomes plain x-rays. the Herman Knapp Memorial Hospital. CTATTTCGGTAGC A TC ATTCTATTCGGTTTAC ACGGCGGTAACC TTAACAC TC AG CAGCATCATTC ATTTCGG TTTA CA CGA TCC AGAGTG CGG TAA CCTTAA CCT07AGC 1867 Dr. Agnew is appointed the first professor of ophthalmology at P&S, marking the 1888 Dr. official beginning Herman Knapp 1939 Dr. Thygeson of the program. is appointed 1933 Ramon becomes the fourth professor of 1911 Herman Knapp Castroviejo, MD, clinic director, ophthalmology at Memorial Eye Hospital, performs the first serving until 1945. founded by Arnold Knapp, P&S, and becomes 1928 Presbyterian Hospital corneal transplant on opens at 10th Avenue and the second clinic moves to 168th Street, and a human. 57th Street, two blocks 1940-41 New director. the Vanderbilt Clinic—the from P&S. The Eye staff at methods for clinical care unit of P&S, with P&S hold appointments at quantitative analysis its Ophthalmology service— the new hospital. of intracellular sugars moves uptown with it. John M. are developed by Wheeler, MD, DSc, becomes the Dr. Zacharias Dische. first chair of the Department of The Knapp Hospital Ophthalmology. closes, and the Knapp Memorial Library of Physiological Optics 1936 The Muscle Clinic becomes the opens. Eye Institute’s first subspecialty clinic. 1st Clinic Director 2nd Clinic Director 3rd Clinic Director 1st Department Chair CORNELIUS R. AGNEW, MD HERMAN J. KNAPP, MD ARNOLD H. KNAPP, MD JOHN M. WHEELER, MD, DSC 1867-1888 1888-1902 1903-1928 1928-1939 DEPARTMENT MILESTONES 1966 Saiichi Mishima, MD, 1962 First develops a system keratoprosthesis, for preserving developed by Hernando corneas until Cardona, MD, is transplantation. presented to the 19th 1947 First International Congress of retinoblastoma, Ophthalmology. pediatric, and adult ocular tumor clinics are established by Dr. Algernon B. Reese. 1958 World’s 1968 David Maurice, MD, and first retina clinic Dr. Donn are first to use confocal is established by microscopy to detect new Charles J. Campbell, 1956 George Merriam Jr., structural features of the eye. MD, PhD. MD, with Elizabeth Focht, American Optical Company MD, of NYU, establishes releases its monocular indirect a relationship between ophthalmoscope, developed in cataract formation and 1961 Frank part by Dr. Campbell. radiation. This leads to the Carroll, MD, a 1964 First development of standards leader in research basic and on diseases of of ocular radiation safety clinical corneal 1969 D. Jackson Willis the optic nerve, 1948 still in use today. research center Coleman, MD, Knighton, MD, establishes an established develops the first establishes a Optic Nerve Clinic. by Drs. Gerard commercially Glaucoma Clinic DeVoe and available hand- on the newly Anthony Donn. operated ultrasound remodeled fifth B-scan system floor of the Eye for ophthalmic Institute. evaluation. CTATTTC GGTA GC ATCATTCT ATTCGGTTTACACGG CGG TAACC TTAA CACTC AG CAGCATC A TTCATTTCGG TTTA CACG A TCCA GAGTG CGG TAACC TTAACCT 09AGC 1969 Dr. Phillip Knapp describes a 1961 Dr. Campbell muscle transposition 1948 The is first to use the procedure for pupillography ruby laser in humans, paralytic strabismus laboratory is 1955 American Optical working with Rittler that becomes established by releases the AO HRR color and Charles Koester, known as the Otto Lowenstein, vision test, developed MD. Fight for Sight “Knapp procedure” MD, PhD, a by LeGrand Hardy, MD, Children’s Eye Clinic and remains in pioneer in the director of the Knapp added to the Eye common use to this quantitative Memorial Physiological 1957 Irene Institute, headed by day. measurement of Optics Laboratories, and M. Loewenfeld, PhD, 1962 John W. 1966 Max Phillip Knapp, MD. pupil function. Catherine Rittler, working and Dr. Lowenstein Espy, MD, creates Forbes, MD, with Gertrude Rand, PhD, build an “electronic the Eye Institute’s describes of Johns Hopkins. pupillograph” that Contact Lens indentation incorporates infrared Clinic, which he gonioscopy in technology. It is directs for 25 closed-angle the first device to years. glaucoma. accurately measure and analyze the diameter of the pupils. 1968
Load more

Recommended publications
  • College News October 2018
    30 YEARS 1988 - 2018 QUARTERLY MAGAZINE OCTOBER EDITION 2018 Congratulations to this year’s Honorary Fellows, Professor Harminder Dua, Miss Marcia Zondervan and the diplomates receiving their award at the RCOphth Admissions Ceremony in September. PAGE 4 A SAS perspective Jugnoo Rahi Trainee Knowledge PAGE 6 New PAGE 15 New PAGE 18 How to to the NHS Chair, Academic mix research with subcommittee clinical training college news Dear fellow members, “Treating clinicians can lawfully choose Avastin for ophthalmic use on grounds of cost” Contents The 21st of September 2018 will live long in the memory of those who have campaigned 3 Awards galore! to be allowed to use Avastin (bevacizumab) 5 2018 Admissions as treatment for wet age-related macular Ceremony degeneration (ARMD). The landmark ruling by 6 New to the NHS - A Mrs Justice Whipple has brought clarity to the SAS Perspective interpretation of the national and European 7 Focus Managing legislation and should be read in full by all refractive surprise ophthalmologists. The College has issued a briefing note via Eye- 11 Museum Piece Mail to help answer some of the comments Births and Books in Whilst some may consider this a victory and concerns raised by members and I wish Ophthalmology 1818 over ‘Big Pharma’, we must not forget that members to continue to contribute to the 15 Jugnoo Rahi pharmaceutical companies are responsible discussions around Avastin. - New Academic for the development of the drugs we now use subcommittee chair to prevent blindness. It is essential that we Please do contact me at president@rcophth. 17 Ophthalmologists in recognise their vital role in eye health and ac.uk and I will do my best to answer your Training continue to work closely with them in future.
    [Show full text]
  • Emily Y. Chew, M.D
    CURRICULUM VITAE Name: Emily Y. Chew Place of Birth: Canton, China Citizenship: United States Marital Status: Married, three children Education 1971-1972 University of British Columbia, Vancouver, B.C., Canada (1st year sciences) 1972-1973 University of Toronto, Canada (2nd year of arts and sciences) 1974-1977 University of Toronto, School of Medicine (6-year program post-high school) 1977-1978 Internship in Internal Medicine, University of Toronto 1978-1981 Residency in Ophthalmology, University of Toronto 1982-1983 Fellowships in Medical Retina & Genetics Johns Hopkins University, Baltimore, (Irene Maumenee, MD, Arnall Patz, MD) University of Nijmegen, Nijmegen, the Netherlands (August Deutman, MD) Brief Chronology of Employment: 1983-1984 Lecturer, University of Toronto, Dept. of Ophthalmology 1985-1986 Assist. Professor, University of Toronto, Dept. of Ophthalmology 1987-1991 Visiting Scientist, Biometry & Epidemiology Program, NEI/NIH 1991-now Medical Officer, Division of Biometry & Epidemiology, NEI/NIH 2000-2017 Deputy Director, Division of Epidemiology and Clinical Applications, NEI. 2008-now Deputy Clinical Director, National Eye Institute 2009-now Chief of Clinical Trials Branch, National Eye Institute 2017-now Director, Division of Epidemiology and Clinical Applications, NEI/NIIH Honors and Other Scientific Recognition: 1981 Research Prize, Ophthalmology, U. of Toronto 1982 E.A. Baker Scholarship for Advanced Training in Ophthalmology 1986 Best Teacher’s Award, Ophthalmology, U. of Toronto 1996 American Academy of Ophthalmology Honors Award 2001 NEI Director’s Award (Achievements in the Age-Related Eye Disease Study) 2001 NEI Director’s Award (Compassion in patient care) 2003 NIH Director’s Award for Excellence in Mentoring 2004 Award of Merit in Retina Research, Schepens Lecture (Retina Society) shared with F.L.
    [Show full text]
  • Copyright and Use of This Thesis This Thesis Must Be Used in Accordance with the Provisions of the Copyright Act 1968
    COPYRIGHT AND USE OF THIS THESIS This thesis must be used in accordance with the provisions of the Copyright Act 1968. Reproduction of material protected by copyright may be an infringement of copyright and copyright owners may be entitled to take legal action against persons who infringe their copyright. Section 51 (2) of the Copyright Act permits an authorized officer of a university library or archives to provide a copy (by communication or otherwise) of an unpublished thesis kept in the library or archives, to a person who satisfies the authorized officer that he or she requires the reproduction for the purposes of research or study. The Copyright Act grants the creator of a work a number of moral rights, specifically the right of attribution, the right against false attribution and the right of integrity. You may infringe the author’s moral rights if you: - fail to acknowledge the author of this thesis if you quote sections from the work - attribute this thesis to another author - subject this thesis to derogatory treatment which may prejudice the author’s reputation For further information contact the University’s Copyright Service. sydney.edu.au/copyright Clinical Studies into the Causes of Idiopathic Macular Telangiectasia Type 2: Sleep Apnoea and Macular Telangiectasia: The SAMTel Project Martin Lee Submitted to the Faculty of Medicine in fulfillment of the requirements of the degree Masters of Philosophy (Medicine) Department of Clinical Ophthalmology & Eye Health University of Sydney January 2015 Acknowledgements: To my family, especially parents, Anne and Russell, and siblings Alison and Frances, thank you for your unbridled support and endless encouragement to enable me to continue to pursue my educational interests.
    [Show full text]
  • UK Eye Care Services Project Phase One: Systematic Review of the Organisation of UK Eye Care Services
    UK Eye Care Services Project Phase One: Systematic Review of the Organisation of UK Eye Care Services University of Warwick September 2010 (Revised February 2011) Dr Carol Hawley Helen Albrow Dr Jackie Sturt Lynda Mason UK Eye Care Services Project Contents Phase One: Systematic Review of the Organisation of UK Eye Care Services Study team i Acknowledgements i Glossary of abbreviations ii Executive Summary 1 1. Background to current organisation of UK eye care services 4 Devolution in Scotland and Wales 6 Global thinking surrounding eye care services and the UK response 8 Other ophthalmic roles 9 Generalisability of care pathways 11 Report Aim 11 2. Methods 12 2.1 Data searches 12 2.2 Data Extraction 14 3. Results 15 3.1 Report organisation 15 3.2 Summary of ‘black’ literature 17 Optometrists in primary care 18 Optometrists within the HES 19 Combined eye examination and referral initiatives for all eye conditions 22 Referral initiatives for all eye conditions 23 Referral quality and frequencies for all eye conditions 25 Glaucoma 28 Ocular Hypertension (OHT) 40 Cataract 41 Posterior Capsular Opacification 47 Diabetic Retinopathy (DR) 49 Blood Glucose screening 60 Optometric Prescribing 61 Low Vision Services 64 Paediatric eye care services 67 Melanoma 71 Flashes and floaters 72 Critique of the COSI concept (Community Optometrists with a Special Interest) 74 Optometric technological comparison studies 75 4. Conclusions from the literature 76 5. References 78 UK Eye Care Services Project Appendices Phase One: Systematic Review of the Organisation
    [Show full text]
  • Crafting Alliances
    05-Wei-45241.qxd 2/14/2007 5:16 PM Page 191 CHAPTER 5 Crafting Alliances egardless of how successful a social enterprise is at mobilizing funds, most R organizations will inevitably face resource and capacity constraints as a limiting factor to achieving their mission. The resources that any single organi- zation brings to bear on a social problem are often dwarfed by the magnitude and complexity of most social problems. Thus, social entrepreneurs often pursue alliance approaches as a means to mobilizing resources, financial and nonfinan- cial, from the larger context and beyond their own organizational boundaries, to achieve increased mission impact. Social enterprise alliances among nonprofits, nonprofits and business, nonprofits and government, and even across all sectors in the form of tripartite alliances between nonprofit, government, and business have become increasingly common in recent years. Because alliances capitalize on the resources and capacities of more than one organization and capture syn- ergies that would otherwise often go unrealized, they have the potential to gen- erate mission impact far beyond what the individual contributors could achieve independently. This chapter first describes some alliance trends in the social sec- tor and illustrates them with case examples. Next, we introduce a conceptual framework that can be helpful for developing an alliance strategy. Finally, we briefly introduce the chapter’s two case studies, which offer readers an opportu- nity for in-depth analysis of a range of alliance approaches. ALLIANCE TRENDS Increased Competition Increased competition due to a growing number of nonprofits coupled with recent overall declines in social sector funding have contributed to a dramatic 191 05-Wei-45241.qxd 2/14/2007 5:16 PM Page 192 192 Entrepreneurship in the Social Sector increase in the number and form of social enterprise alliances.
    [Show full text]
  • Macular Telangiectasia Type 2: Quantitative Analysis of a Novel
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UCL Discovery Macular telangiectasia type 2: quantitative analysis of a novel phenotype and implications for the pathobiology of the disease Mali Okada, MBBS, MMed*; Catherine A Egan, FRANZCO*†; Tjebo FC Heeren, MD*‡; Adnan Tufail, MD, FRCOphth*; Marcus Fruttiger, PhD‡; Peter M Maloca, MD*§ * Moorfields Eye Hospital NHS Foundation Trust, London, UK † Department of Ophthalmology, University of Bonn, Bonn, Germany ‡ UCL Institute of Ophthalmology, London, United Kingdom § Department of Ophthalmology, University of Basel, Basel, Switzerland Short Title: Retinal microcystoid spaces in MacTel 2 Funding: Supported by the Lowy Medical Research Institute, Sydney, Australia as part of The Macular Telangiectasia Project (MO, CE). AT receives a proportion of funding from the National Institute for Health Research (NIHR) and Biomedical Research Centre at Moorfields Eye Hospital and the University College London Institute of Ophthalmology. The views expressed in the publication are those of the authors and not necessarily those of the Department of Health. Financial Disclosures: AT is on the advisory board for Heidelberg engineering (Heidelberg, Germany) and Optovue (Optovue Inc, USA). PM receives fees for lectures from Heidelberg engineering (Heidelberg, Germany) 1 Address for correspondence: Peter M Maloca, MD Moorfields Eye Hospital 162 City Road, London EC1V 2PD London, United Kingdom Tel: +44 20 72533411 Fax: +44 20 72534696 [email protected] Key words Macular telangiectasia type 2; spectral domain optical coherence tomography; volume rendering; microcystoid spaces; cystoid macular oedema; microcystic macular oedema; inner nuclear layer cysts; microcysts; microcavitations Summary Statement Retinal microcystoid spaces are a novel phenotype of Macular Telangiectasia (MacTel) type 2 on optical coherence tomography.
    [Show full text]
  • Fight for Sight Is the UK's Largest Charity Funding Pioneering Eye
    Fight for Sight is the UK’s largest charity funding pioneering eye research since 1965. Our mission Fight for Sight funds pioneering research to prevent sight loss and treat eye disease. Our vision A future everyone can see. Fight£3.3m for Sight committed to research in 2017/18 Fight£8m for Sight commitment to active research projects Number of active research projects 166 Number of funded institutions 49 5 49 49 2 49 7 49 3 49 3 49 2 49 7 49 1 49 10 49 5 49 4 Numbers of patients in clinical studies funded by Fight for Sight Number16,230 of patients Number87 of studies recruited into NIHR on the NIHR CRN supported studies funded portfolio funded partly partly or wholly by or wholly by Fight for Sight Fight for Sight between between April 2008 April 2008 and and January 2018 January 2018 Number71 of sites Number23 of studies from which NIHR has open on the NIHR recruited participants for CRN portfolio studies funded partly or funded partly or wholly wholly by Fight for Sight by Fight for Sight between April 2008 as of January 2018 and January 2018 National Institute for Health Research (NIHR) Clinical Research Network (CRN) Charity partners Fight for Sight is very pleased to be collaborating with other charities in the sector. Fight for Sight is the UK’s largest charity funding pioneering eye research since 1965. Estimated prevalence of main eye diseases in the UK Age-related macular degeneration 600,000 people Glaucoma 500,000 people Cataract 500,000 people Diabetic retinopathy 144,000 people How many people fear losing their sight? of25% the adult population are not having an eye test of people78% stated every 2E years.
    [Show full text]
  • Eye Research Charity Looking for Pioneering Researchers in Scotland Fight for Sight Partners with Chief Scientist Office to Fund Research in Scotland
    Immediate release Eye research charity looking for pioneering researchers in Scotland Fight for Sight partners with Chief Scientist Office to fund research in Scotland Fight for Sight, the UK’s leading eye research charity, has partnered with the Scottish Government’s Chief Scientist Office (CSO) to help address age-related eye diseases. The charity is calling for research applications from Scottish based researchers for a grant of up to £200,000 for up to three years. The grant will support research to help address age- related eye diseases and conditions as well as projects focusing on the association of visual impairment with other long-term conditions, such as dementia, stroke or diabetes. The closing date for Fight for Sight/ CSO Project grant applications is 5pm on 1 November 2017. Supporting Quote: Dr Alan McNair, Senior Research Manager at the Scottish Government Chief Scientist Office “CSO is delighted to partner with Fight for Sight in this exciting research funding initiative. Age related eye diseases can severely impact patients and those close to them. Research is essential if we are to develop a better understanding of the impact of these conditions and develop effective new treatments”. Michele Acton, Chief Executive of Fight for Sight “It is only through funding eye research that we will be able to address age-related sight loss. Partnering with the CSO will bring us closer to our goals to the benefit of people in Scotland and worldwide.” Online Resources: W: http://www.fightforsight.org.uk/apply-for-funding/funding-opportunities/fight-for-sight-cso- project-grant/ T: @fightforsightUK F: https://www.facebook.com/fightforsightuk ENDS About Fight for Sight 1.
    [Show full text]
  • Genetic Disruption of Serine Biosynthesis Is a Key Driver Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934356; this version posted February 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Genetic Disruption of Serine Biosynthesis is a Key 2 Driver of Macular Telangiectasia Type 2 Etiology and 3 Progression 4 5 RoBerto Bonelli,1,2 Brendan R E Ansell,1,2 Luca Lotta,3 Thomas Scerri,1,2 Traci E Clemons,4 Irene Leung,5 The 6 MacTel Consortium,6 Tunde Peto,7 Alan C Bird,8 Ferenc Sallo,9 Claudia LangenBerg,3 and Melanie Bahlo*1,2. 7 8 9 1 Department of Medical Biology, The University of Melbourne, 3052, Parkville, Victoria, Australia. 10 2 Population Health and Immunity Division, Walter and Eliza Hall Institute of Medical Research, 3052, Parkville, Victoria, 11 Australia. 12 3 MRC Epidemiology Unit, University of Cambridge, CB2 0SL, Cambridge, UK. 13 4 The EMMES Corporation, Rockville, 20850, Maryland, United States. 14 5 Department of Research and Development, Moorfields Eye Hospital NHS Foundation Trust, EC1V 2PD, London, United 15 Kingdom. 16 6 A list of members and affiliations is provided in Table S8. 17 7 Department of Ophthalmology, Queen’s University, Belfast, BT7 1NN, United Kingdom. 18 8 Inherited Eye Disease, Moorfields Eye Hospital NHS Foundation Trust, EC1V 2PD, London, United Kingdom. 19 9 Department of Ophthalmology, University of Lausanne, Hôpital Ophtalmique Jules-Gonin, Fondation Asile des aveugles, 20 Switzerland.
    [Show full text]
  • Rotational Three-Dimensional OCTA
    www.nature.com/scientificreports OPEN Rotational Three-dimensional OCTA: a Notable New Imaging Tool to Characterize Type 3 Macular Neovascularization Enrico Borrelli 1, Riccardo Sacconi 1, Gerd Klose2, Luis de Sisternes3, Francesco Bandello1 & Giuseppe Querques 1* This study explored whether rotational three-dimensional (3D) visualization of optical coherence tomography angiography (OCTA) volume data may yield valuable information regarding type 3 macular neovascularization (MNV). In this retrospective, cross-sectional study, we collected data from 15 eyes (13 patients) with treatment-naïve type 3 MNV in their post-nascent stage and age-related macular degeneration (AMD). Subjects were imaged with the SS-OCT system (PLEX Elite 9000, Carl Zeiss Meditec Inc., Dublin, CA, USA). The OCTA volume data were processed with a prototype volume projection removal algorithm and then analyzed using volumetric visualization techniques in order to obtain a 3D visualization of the region occupied by type 3 MNV. The two-dimensional and three-dimensional OCTA images were investigated. Mean ± SD age was 75.1 ± 7.4 years. BCVA was 0.42 ± 0.21 LogMAR in the study eyes. Considering the cohort of analyzed eyes, on rotational 3D OCTA images, a total of 35 neovascular lesions (vs 22 lesions detected on 2D OCTA images) rising from the deep vascular complex and variably spanning the outer retinal layers and eventually reaching the RPE/sub-RPE space were detected. Nine of 35 lesions had a saccular shape, while the remaining cases had a fliform shape. On rotational 3D OCTA images, these lesions were inclined on the three planes, instead of perpendicular to the RPE/Bruch’s membrane.
    [Show full text]
  • Improving Anti-VEGF Drugs in the Vitreous by Eda Isil Altiok A
    Improving Anti-VEGF Drugs in the Vitreous By Eda Isil Altiok A dissertation submitted in partial satisfaction of the Requirement for the degree of Joint Doctor of Philosophy with UC San Francisco In Bioengineering In the graduate division Of the University of California, Berkeley Committee in charge: Professor Kevin E. Healy, Chair Professor David Schaffer Professor Tejal Desai Professor Anthony Adams Fall 2015 Improving Anti-VEGF Drugs in the Vitreous © 2015 by Eda Isil Altiok University of California, Berkeley Abstract Improving Anti-VEGF Drugs in the Vitreous By Eda Isil Altiok Doctor of Philosophy in Bioengineering University of California, Berkeley Professor Kevin Healy, Chair The work described in this dissertation present a novel technique utilizing multivalent hyaluronic acid bioconjugates with an anti-VEGF protein for improving the action of drugs in the vitreous. This technology, which has shown efficacy both in vitro and in vivo has the potential to enhance the bioactivity of drugs used for treating patients with diseases including diabetic retinopathy, wet AMD and other neovascular diseases of the retina. Chapter 2 described our initial efforts in creating multivalent conjugates of the anti-VEGF protein, sFlt. Before beginning in vivo studies, we wanted to determine what parameters would maximize the bioactivity of mvsFlt. We investigated the use of several HyA molecular weights and valencies of sFlt molecules to HyA chains. The characterization and in vitro experiments were carried out with 6 mvsFlt conjugates of 300 kDa, 650 kDa and 1 MDa molecular weights with feed ratios of 10 sFlt per 1 HyA chain (termed low conjugation ratio (LCR)) and 30 sFlt per 1 HyA chain (termed high conjugation ratio (HCR)).
    [Show full text]
  • Featured Article How Exercise May Protect Against Alzheimer’S
    Winter/Spring COLUMBIA PATHOLOGY 2019 AND CELL BIOLOGY REPORT Featured Article How Exercise May Protect Against Alzheimer’s The Body Scientific You Can Observe A Lot Just By Looking Featured Article Confessions of a Pathologist in this issue 3 From the Chair 4 Honors and Awards 6 In Memoriam 7 Event Spotlight: 1st International Symposium - Rh Disease 8 New Graduate Students 9 Confessions of a Pathologist 11 New Staff 12 Grants Awarded 14 New Faculty 15 Lab News: DCPL 7 16 The Body Scientific 17 Research: Biopsies in Donor Kidneys 18 Feature Article: How Excersice May Protect Against Alzheimer’s 20 Theses Defended 21 Newsroom: CUIMC and Fulgent Genetics Partnership Announced Columbia Pathology and Cell Biology Report Chairman Kevin A. Roth, MD, PhD Donald W. King, M.D. and Mary Elizabeth King, M.D. Professor of Pathology and Cell Biology Chair, Department of Pathology and Cell Biology Pathologist-in-Chief, CUIMC Department Administrator Joann Li Editor and Layout Designer 9 Milan Fredricks Copy Editor Ping Feng Contributing Writers Richard Kessin, PhD Heidrun Rotterdam, MD Address correspondence to: PCB Reports, Editor c/o Milan Fredricks Columbia University Department of Pathology and Cell Biology 630 W. 168th St., Box 23 New York, NY 10032 on the cover: Abstract background 16 (Source: rawpixel on freepik.com) FROM THE CHAIR Precision medicine and the future ignificant progress is being made last five years. This past year, PGM received at CUIMC in enhancing an excellent NYS DOH approval for Darwin OncoTarget/ Sprecision oncology program that will OncoTreat analysis of transcriptomes, significantly impact cancer patient care a powerful and novel systems biology and oncology research.
    [Show full text]