APPLI PREC ISION OPHT H A LMOLOG Y TM ED2020 GENE TICS A G APPLIED TCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAT GENETICS C T G The Department of Ophthalmology At the same time, we train ophthalmologists Aat Columbia University Irving Medical Center and researchers to be the future leaders is a leading international center for the in the field. We have successfully developed management of sight-threatening disorders new drugs, devices and procedures to and scientific exploration to elucidate enhance the lives of our patients and have CTATTTCGGTAGCATCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAACCTTAACCTAGC disease mechanisms and discover novel launched the Applied Genetics Initiative treatments. These aspirations are realized at Columbia Ophthalmology. That through seamless collaborations between our groundbreaking tradition continues today outstanding, compassionate physicians and with Precision Ophthalmologytm 2020, as our talented scientists. described in the following pages. C T FROM THE CHAIRMAN Over the last two decades, our ability critical information for the diagnosis, In our previous book, we to interrogate the human genome prognosis and treatment of disease. introduced the concept of Precision has radically transformed medicine. In addition to determining if an Ophthalmology™: using each Sequencing the genome went from individual is at risk for developing a individual’s own genetic profile a billion-dollar project that required certain disease, we will also be able to tailor a course of treatment A more than ten years of exhaustive to advise them about the risk that specifically designed for him or effort, to a routine task that is their children or other loved ones will her. Columbia’s Applied Genetics regularly completed overnight in our develop it as well. In the related and Initiative in Ophthalmology is a G labs for a few hundred dollars. emerging field of pharmacogenetics, global leader and is making Precision With that achievement has we no longer have to deliver drugs Ophthalmology™ a reality for our Department Milestones 06 come virtually limitless opportunities by trial and error. Instead, we are patients today. In these pages, we’ll to take what we know about the increasingly able to use genetic show you how. Genetics Primer 1 4 genetics of disease and risk, and information to predict a person’s the possibility of treating faulty response to available drug treatment genes, and deliver that knowledge to options and select the therapy that is Foundational Biology 1 6 patients in a way that makes a most likely to work for them. CTATTTCGGTAGCATCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAACCTTAACCT05AGC Vision Science Today 24 meaningful difference in their lives. There are also evolving This new field of ophthalmology, treatments that are directed and in fact all of medicine, is known specifically at particular genetically The Inheritance Question 32 as Applied Genetics. Precision determined diseases. Many of the Ophthalmology™ 2020 explores the most significant advances in gene Genetic Testing & Therapies 38 promise of this growing field, and the therapy for the treatment of disease work that is being done within the have occurred in ophthalmology, new Applied Genetics Initiative at the including the first FDA-approved Disease-Specific Applications 46 Columbia University Department of gene therapy for the treatment of any G.A. (Jack) Cioffi, MD Ophthalmology, to make the most of disease. Edward S. Harkness Professor Gene Discovery 58 those possibilities. So, while we can expect further Jean and Richard Deems Professor We do not need to wait for great leaps forward in gene therapy Chair, Department of Ophthalmology full-fledged gene-based “cures” for and gene surgery in the very near Clinical Trials 64 diseases to leverage our genetic future, we already have the ability, knowledge in ways that can transform today, to leverage the genome for The Future 70 people’s lives. Understanding an diagnosing, counseling and treating individual’s genotype, and how individuals with genetic eye disease. that genetic code interacts with Applied Genetics informs every step environmental factors to produce the of the process: determining who observable traits or characteristics should be tested, how testing can be that we call phenotype, already yields best utilized, and evaluation of the personal and family implications of TC being tested. DEPARTMENT MILESTONES 1935-36 Discovery of hyaluronic acid by Dr. Karl Meyer. 1933 The Department moves Phillips Thygeson, 1866 Cornelius into the Edward S. Harkness Eye MD, OphD, describes R. Agnew, MD, Institute on 165th Street. the microbiologic establishes an transmission of ophthalmology trachoma. clinic at the 1903 Arnold H. College of Knapp, MD, son of Physicians and Herman, appointed Surgeons. professor of 1938 Dr. Castroviejo ophthalmology at 1911 Edmund B. urges people to P&S and becomes Wilson, PhD, maps will their eyes to the third clinic color blindness onto science, leading to director. the X chromosome. the development of today’s eye banks. 1931 Edward S. Harkness pledges money to build a separate Eye Institute 1943 Raymond 1869 Herman at the new medical L. Pfeiffer, MD, J. Knapp, MD, center. is the first to establishes the New delineate the York Ophthalmic landmarks of the and Aural Institute, ocular orbit on which later becomes plain x-rays. the Herman Knapp Memorial Hospital. CTATTTCGGTAGC A TC ATTCTATTCGGTTTAC ACGGCGGTAACC TTAACAC TC AG CAGCATCATTC ATTTCGG TTTA CA CGA TCC AGAGTG CGG TAA CCTTAA CCT07AGC 1867 Dr. Agnew is appointed the first professor of ophthalmology at P&S, marking the 1888 Dr. official beginning Herman Knapp 1939 Dr. Thygeson of the program. is appointed 1933 Ramon becomes the fourth professor of 1911 Herman Knapp Castroviejo, MD, clinic director, ophthalmology at Memorial Eye Hospital, performs the first serving until 1945. founded by Arnold Knapp, P&S, and becomes 1928 Presbyterian Hospital corneal transplant on opens at 10th Avenue and the second clinic moves to 168th Street, and a human. 57th Street, two blocks 1940-41 New director. the Vanderbilt Clinic—the from P&S. The Eye staff at methods for clinical care unit of P&S, with P&S hold appointments at quantitative analysis its Ophthalmology service— the new hospital. of intracellular sugars moves uptown with it. John M. are developed by Wheeler, MD, DSc, becomes the Dr. Zacharias Dische. first chair of the Department of The Knapp Hospital Ophthalmology. closes, and the Knapp Memorial Library of Physiological Optics 1936 The Muscle Clinic becomes the opens. Eye Institute’s first subspecialty clinic. 1st Clinic Director 2nd Clinic Director 3rd Clinic Director 1st Department Chair CORNELIUS R. AGNEW, MD HERMAN J. KNAPP, MD ARNOLD H. KNAPP, MD JOHN M. WHEELER, MD, DSC 1867-1888 1888-1902 1903-1928 1928-1939 DEPARTMENT MILESTONES 1966 Saiichi Mishima, MD, 1962 First develops a system keratoprosthesis, for preserving developed by Hernando corneas until Cardona, MD, is transplantation. presented to the 19th 1947 First International Congress of retinoblastoma, Ophthalmology. pediatric, and adult ocular tumor clinics are established by Dr. Algernon B. Reese. 1958 World’s 1968 David Maurice, MD, and first retina clinic Dr. Donn are first to use confocal is established by microscopy to detect new Charles J. Campbell, 1956 George Merriam Jr., structural features of the eye. MD, PhD. MD, with Elizabeth Focht, American Optical Company MD, of NYU, establishes releases its monocular indirect a relationship between ophthalmoscope, developed in cataract formation and 1961 Frank part by Dr. Campbell. radiation. This leads to the Carroll, MD, a 1964 First development of standards leader in research basic and on diseases of of ocular radiation safety clinical corneal 1969 D. Jackson Willis the optic nerve, 1948 still in use today. research center Coleman, MD, Knighton, MD, establishes an established develops the first establishes a Optic Nerve Clinic. by Drs. Gerard commercially Glaucoma Clinic DeVoe and available hand- on the newly Anthony Donn. operated ultrasound remodeled fifth B-scan system floor of the Eye for ophthalmic Institute. evaluation. CTATTTC GGTA GC ATCATTCT ATTCGGTTTACACGG CGG TAACC TTAA CACTC AG CAGCATC A TTCATTTCGG TTTA CACG A TCCA GAGTG CGG TAACC TTAACCT 09AGC 1969 Dr. Phillip Knapp describes a 1961 Dr. Campbell muscle transposition 1948 The is first to use the procedure for pupillography ruby laser in humans, paralytic strabismus laboratory is 1955 American Optical working with Rittler that becomes established by releases the AO HRR color and Charles Koester, known as the Otto Lowenstein, vision test, developed MD. Fight for Sight “Knapp procedure” MD, PhD, a by LeGrand Hardy, MD, Children’s Eye Clinic and remains in pioneer in the director of the Knapp added to the Eye common use to this quantitative Memorial Physiological 1957 Irene Institute, headed by day. measurement of Optics Laboratories, and M. Loewenfeld, PhD, 1962 John W. 1966 Max Phillip Knapp, MD. pupil function. Catherine Rittler, working and Dr. Lowenstein Espy, MD, creates Forbes, MD, with Gertrude Rand, PhD, build an “electronic the Eye Institute’s describes of Johns Hopkins. pupillograph” that Contact Lens indentation incorporates infrared Clinic, which he gonioscopy in technology. It is directs for 25 closed-angle the first device to years. glaucoma. accurately measure and analyze the diameter of the pupils. 1968