Featured Article How Exercise May Protect Against Alzheimer’S

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Winter/Spring COLUMBIA PATHOLOGY 2019 AND CELL BIOLOGY REPORT Featured Article How Exercise May Protect Against Alzheimer’s The Body Scientific You Can Observe A Lot Just By Looking Featured Article Confessions of a Pathologist in this issue 3 From the Chair 4 Honors and Awards 6 In Memoriam 7 Event Spotlight: 1st International Symposium - Rh Disease 8 New Graduate Students 9 Confessions of a Pathologist 11 New Staff 12 Grants Awarded 14 New Faculty 15 Lab News: DCPL 7 16 The Body Scientific 17 Research: Biopsies in Donor Kidneys 18 Feature Article: How Excersice May Protect Against Alzheimer’s 20 Theses Defended 21 Newsroom: CUIMC and Fulgent Genetics Partnership Announced Columbia Pathology and Cell Biology Report Chairman Kevin A. Roth, MD, PhD Donald W. King, M.D. and Mary Elizabeth King, M.D. Professor of Pathology and Cell Biology Chair, Department of Pathology and Cell Biology Pathologist-in-Chief, CUIMC Department Administrator Joann Li Editor and Layout Designer 9 Milan Fredricks Copy Editor Ping Feng Contributing Writers Richard Kessin, PhD Heidrun Rotterdam, MD Address correspondence to: PCB Reports, Editor c/o Milan Fredricks Columbia University Department of Pathology and Cell Biology 630 W. 168th St., Box 23 New York, NY 10032 on the cover: Abstract background 16 (Source: rawpixel on freepik.com) FROM THE CHAIR Precision medicine and the future ignificant progress is being made last five years. This past year, PGM received at CUIMC in enhancing an excellent NYS DOH approval for Darwin OncoTarget/ Sprecision oncology program that will OncoTreat analysis of transcriptomes, significantly impact cancer patient care a powerful and novel systems biology and oncology research. The Department of approach that assesses activity of potentially Pathology and Cell Biology and in particular, targetable master regulators (developed by our Personalized Genomic Medicine (PGM) Dr. Andrea Califano’s laboratory, Department Laboratory, have played a key role in this of Systems Biology), which will further effort. Under the leadership of its Medical advance precision oncology efforts at Director, Mahesh M. Mansukhani, M.D., and CUIMC. PGM is also the only academic Kevin A. Roth, M.D., Ph.D., Chair with the efforts of outstanding physician, laboratory currently providing tumor whole [email protected] laboratory, and administrative personnel, transcriptome sequencing for both fresh/ the PGM Laboratory has been a pioneer and frozen and paraffin embedded tissue. In innovator in the oncology-related clinical addition, PGM is actively engaged in new genomics space. PGM has over five years’ cancer-related test development, including experience in advanced, high-quality cancer more sensitive and specific cancer panels related somatic and constitutional genomics and the detection of circulating tumor DNA.. testing, all performed in a CLIA-certified, CAP- accredited, and New York State Department The PGM Laboratory has partnered with the of Health (NYS DOH)-approved laboratory. Herbert Irving Comprehensive Cancer Center (HICCC) in pursuing several significant Since the PGM launch of clinical precision oncology initiatives. Most notably, constitutional whole exome sequencing PGM faculty and staff members participate (WES) in 2013 and clinical cancer WES and at CUIMC in pediatric and adult molecular transcriptome sequencing in 2014, more than tumor boards and nationally in the American 3000 samples have undergone constitutional Society of Clinical Oncology’s Targeted WES analysis, over 500 cancer specimens Agent and Profiling Utilization Registry have been analyzed by WES, and whole (TAPUR) study molecular tumor board. The transcriptome (RNA) sequencing. Recently, PGM bioinformatics team has led CUIMC with support from the Sohn Foundation, involvement in Project GENIE, an American clinical cancer WES with transcriptome Association for Cancer Research program for analysis has been routinely offered to high- aggregation of cancer genomics and clinical risk pediatric cancer patients treated at outcome data in a HIPAA compliant registry participating institutions in the tri-state area. with the goal of catalyzing novel clinical and translational cancer research. PGM also In addition to this, PGM offers several supports the HICCC with a variety of industry- next generation sequencing (NGS) cancer and grant- funded clinical research studies gene panels, including the Illumina TruSeq designed to accelerate the development of Amplicon Cancer Panel and the 467 gene cancer therapeutics and to improve patient Columbia Combined Cancer Panel (CCCP) access to cost- effective and potentially life- that provides sequence, copy number, extending personalized therapies. In total, the and gene fusion information. The CCCP is Department of Pathology and Cell Biology is approved for determining patient participation committed to enhancing the PGM Laboratory’s in the National Cancer Institute MATCH capabilities as a critical component of the clinical trial. In total, these panels have CUIMC precision oncology community.◆ tested over 4000 cancer specimens in the 4 PCB REPORTS Honors and Awards Steve Spitalnik, MD, PhD Matthias Szabolcs, MD Dr. Steven Spitalnik and Dr. Matthias Szabolcs Receive ColumbiaDoctors’ Patient Safety Recognition Awards Two Pathology faculty have earned special Pathology and Cell Biology, is a co-winner of the recognition as part of ColumbiaDoctors’ Patient Team Building Award. This quarterly prize honors Safety Recognition Award Program. individuals who are selected by their peers for consistently demonstrating teamwork in action Dr. Steven Spitalnik, MD, PhD, Professor of and encouraging others to do the same. Dr. Pathology and Cell Biology, is the winner of the Szabolcs received this award at a recognition annual Leadership/Stewardship award for 2019. luncheon on March 6. This annual award honors any ColumbiaDoctors leader who fosters a just culture and supports “This is excellent news. It’s wonderful that great a culture of safety. The award was presented faculty in both AP and CP are being recognized!”, during an annual recognition luncheon at the said Dr. Kevin Roth, the department chair. Faculty Club on March 13. Congratulations to Dr. Spitalnik and Dr. Szabolcs Dr. Matthias Szabolcs, MD, Professor of for receiving these remarkable awards. Updates on Construction Projects • Fenoglio Library - The construction, which started in November 2018, is expected to be completed in early April 2019. • Labs renovation on VP&S 14 and 11 - VP&S 14 will be completed by April 1st and VP&S 11 is expected to be done by June. • Office space construction on VP&S 11 and 16 - Construction is expected to be done by June. WINTER/SPRING 2019 5 Honors and Awards The Shelanski Research Innovation Award The Shelanski Research Innovation Award in Pathology, We are proud to announce Chun-Chieh established in honor of Herman Alder Shelanski, the (Paul) Lin, MD as the winner of the brilliant developer of povidone-iodine, is a competitive 2018 Shelanski Research Innovation award program designed to support the development Award in Pathology for his proposal tiled: of innovative research ideas and concepts contributed Deciphering Multifactorial Genetic by fellows and residents within the Department of Contributions for Motor Neuron Pathology and Cell Biology. Development. The Herman Shelanski Memorial Fund and Ralph Dr. Lin will work under the mentorship of Richard Mann, Ph.D., Abrams Fund will provide up to $5,000 to defray cost for Higgins Professor of Biochemistry and Molecular Biophysics supplies and services for research projects that further and Professor of Neuroscience (in Systems Biology). our understanding of mechanisms of biology and pathophysiology of the disease. OTHER HONORS AND AWARDS (SINCE AUGUST 2018) Cory Abate-Shen, PhD was elected a fellow of the American Association for the Advancement of Science and named Chair of Pharmacology, effective April 1, 2019. Alex Chavez, MD, PhD Swarnali Acharyya, PhD was selected as a 2018-2021 Irving Scholar for “Diagnosing and Appointed as a Gerstner Targeting Cachexia to Prolong Patient Survival”. Scholar Richard Axel, MD Dr. Alejandro Chavez has been was elected a fellow of the American Association for the appointed to a three-year term as a Advancement of Science. Louis V. Gerstner Jr. Scholar effective July 1, 2019 through June 30, 2022. As a Gerstner Scholar, Dr. Chavez will receive Ibrahim Batal, MD $70,000 per year, for a total of $225,000, was a winner of the Renal Pathology Society’s mid-career to support and enhance his research. achievement award, referred to as the Gloria Gallo Award. Designed to support junior physician- Joseph Schwartz, MD scientist in their goal of bringing new received the 2019 Hemphill-Jordan Leadership Award from the treatments to patients, the Gerstner American Association of Blood Banks. Award program began in 2008. Every year, the winners have the potential to touch a significant portion of our Vivette D’Agati, MD patient population with their varied received the prestigious “Distinguished Alumni Award” at the 2018 fields of focus. The selection committee NewYork Presbyterian/Columbia Society of the Alumni Dinner. recognizes the potential impact of the work highlighted in this proposal Clarissa Waites, PhD and gave this candidate its most received RISE award for “Entropic Forces and SNARE Protein enthusiastic support. Ubiquitination in Synaptic Transmission and Plasticity” 6 PCB REPORTS In Memoriam Dept. Mourns the Loss of VP&S Professor Emeritus Donald West King, MD,
Recommended publications
  • Generation of Three-Dimensional Retinal Tissue with Functional Photoreceptors from Human Ipscs

    Generation of Three-Dimensional Retinal Tissue with Functional Photoreceptors from Human Ipscs

    ARTICLE Received 31 Oct 2013 | Accepted 5 May 2014 | Published 10 Jun 2014 DOI: 10.1038/ncomms5047 Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCs Xiufeng Zhong1, Christian Gutierrez1, Tian Xue2,3, Christopher Hampton1, M. Natalia Vergara1, Li-Hui Cao3,w, Ann Peters4, Tea Soon Park4, Elias T. Zambidis4, Jason S. Meyer5, David M. Gamm6, King-Wai Yau1,3 & M. Valeria Canto-Soler1 Many forms of blindness result from the dysfunction or loss of retinal photoreceptors. Induced pluripotent stem cells (iPSCs) hold great potential for the modelling of these diseases or as potential therapeutic agents. However, to fulfill this promise, a remaining challenge is to induce human iPSC to recreate in vitro key structural and functional features of the native retina, in particular the presence of photoreceptors with outer-segment discs and light sensitivity. Here we report that hiPSC can, in a highly autonomous manner, recapitulate spatiotemporally each of the main steps of retinal development observed in vivo and form three-dimensional retinal cups that contain all major retinal cell types arranged in their proper layers. Moreover, the photoreceptors in our hiPSC-derived retinal tissue achieve advanced maturation, showing the beginning of outer-segment disc formation and photosensitivity. This success brings us one step closer to the anticipated use of hiPSC for disease modelling and open possibilities for future therapies. 1 Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore, Maryland 21287, USA. 2 School of Life Sciences and Hefei National Laboratory for Physical Sciences at Microscale, University of Science and Technology of China, Hefei 230026, China.
  • 2020 Annual Report Table of Contents

    2020 Annual Report Table of Contents

    Saving Sight is our Vision 2020 Annual Report Table of Contents A Letter From Our President 02 A Letter From Our Executive Director 03 A Report From Our Research Committee Chair 04 2019-2020 Research Funding 06 Clinical Trial Updates 09 International Advocacy Efforts 10 Programs 12 Fundraising 14 Testimonials 15 Board of Directors 19 Officers at Large 19 Directors 20 Scientific Advisory Boards 21 Staff 23 Financial Summary 24 Donors 25 01 A Letter From Our President The families, friends, and communities within the Choroideremia Research Foundation have continued our progress towards treatments to stop the loss of vision due to CHM, and to restore lost vision. Our membership resides in over 30 countries, and we are currently funding research in 5 countries. The CRF reaches out to find fellow CHM patients as we think and communicate on a global basis, and continue to Neal Bench collaborate with medical institutions, clinical trial partners and President other inherited retinal disease organizations. Due to the pandemic, the CRF family missed a great opportunity to gather in Rochester, NY last June, allowing for personal camaraderie, informative presentations, and recognizing 20 years of progress driven by the Foundation. Some of those plans have been moved to our virtual platform with additional programs to add in 2021. With the hopes of a global return to some level of normalcy, our thoughts are to plan for an in-person conference in 2022. Our staff and volunteers have been working to enhance our communications and open additional avenues into the research and support communities. I would like to thank our board and committee members for their time and input over the past year.
  • Precision Ophthalmologytm 2020, As

    Precision Ophthalmologytm 2020, As

    APPLI PREC ISION OPHT H A LMOLOG Y TM ED2020 GENE TICS A G APPLIED TCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAT GENETICS C T G The Department of Ophthalmology At the same time, we train ophthalmologists Aat Columbia University Irving Medical Center and researchers to be the future leaders is a leading international center for the in the field. We have successfully developed management of sight-threatening disorders new drugs, devices and procedures to and scientific exploration to elucidate enhance the lives of our patients and have CTATTTCGGTAGCATCATTCTATTCGGTTTACACGGCGGTAACCTTAACACTCAG CAGCATCATTCATTTCGGTTTACACGATCCAGAGTGCGGTAACCTTAACCTAGC disease mechanisms and discover novel launched the Applied Genetics Initiative treatments. These aspirations are realized at Columbia Ophthalmology. That through seamless collaborations between our groundbreaking tradition continues today outstanding, compassionate physicians and with Precision Ophthalmologytm 2020, as our talented scientists. described in the following pages. C T FROM THE CHAIRMAN Over the last two decades, our ability critical information for the diagnosis, In our previous book, we to interrogate the human genome prognosis and treatment of disease. introduced the concept of Precision has radically transformed medicine. In addition to determining if an Ophthalmology™: using each Sequencing the genome went from individual is at risk for developing a individual’s own genetic profile a billion-dollar project that required certain disease, we will also be able to tailor a course of treatment A more than ten years of exhaustive to advise them about the risk that specifically designed for him or effort, to a routine task that is their children or other loved ones will her. Columbia’s Applied Genetics regularly completed overnight in our develop it as well.
  • Download This Issue As A

    Download This Issue As A

    246 Years Strong PS& Columbia Spring 2013 Medicine Columbia University University College ofCollege Physicians of & PhysiciansSurgeons & Surgeons One Resea RcheR, prostate Cancer TwO caReeRs More questions than answers in diagnosis and treatment of w hen his sister came down with a the second leading rare disease, Tom Maniatis had no idea cause of death in American men how it would change his life’s work Another nobel The Class of 1966 scored its second Nobel Prize when Robert Lefkowitz received 2012’s Nobel Prize in Chemistry • FROM THE DEAN Dear Readers, Articles in this issue of Columbia Medicine illustrate just some of the many ways we proudly carry out our education, research, patient departments care, and community outreach missions. Education is highlighted by the scholarly projects completed 2 l etters by four members of the Class of 2013, the first class to fulfill requirements of the new P&S curriculum. 4 P&S News These scholarly projects—a global health study in Madagascar, a study of hospital 13 Clinical advances readmissions after pancreatic resection, • For Concussion Patients, the Care They Need laboratory research into ways to improve • For Kids with Autism, Learning to Talk Starts with Reading mitochondrial function in lung failure, and TELSON • For Forgotten Adults with Cerebral Palsy, a Center of Their Own I development of digital resources to teach F KE I cultural competency—show how graduates in / M the Class of 2013 used this new requirement 32 graduate School life MES I T to expand their horizons beyond traditional A graduate student and her supercomputer colleague lectures, books, and clinical rotations.
  • Stem Cell Research in New York State: a Snapshot

    Stem Cell Research in New York State: a Snapshot

    Stem Cell Research in New York State: A Snapshot NYSTEM NEW YORK STATE STEM CELL SCIENCE New York State Department of Health Wadsworth Center TABLE OF CONTENTS PART I EXECUTIVE SUMMARY STEM CELL RESEARCH IN NEW YORK STATE: A SNAPSHOT PART II DIRECTORY OF PRINCIPAL INVESTIGATORS ENGAGED IN STEM CELL RESEARCH IN NEW YORK STATE PART I EXECUTIVE SUMMARY STEM CELL RESEARCH IN NEW YORK STATE: A SNAPSHOT Executive Summary This report summarizes data obtained from responses to written surveys and structured personal interviews with stem cell scientists in New York State between June and October, 2007. The findings are accompanied by a directory of the scientists interviewed. The objectives of this initial inquiry were threefold: (i) identify institutions and scientists in New York State with ongoing stem cell research programs; (ii) develop an overview of the scope and directions of these researchers’ activities and (iii) solicit the views of the stem cell science community in New York regarding the potential scope and mechanisms of funding by NYSTEM. Letters were sent to 42 institutions that were identified through publicly available funding and publication records as having relevant research efforts. Overall, from 28 responding institutions we received feedback from 162 principal investigators (PI) at 23 institutions in time for inclusion in this report. The first interviews took place July 20 and the most recent visit was October 4; in this span of 10 weeks we interviewed investigators from 21 institutions representing all geographic areas of the state. Importantly, this inquiry identified a strong community of stem cell scientists across the state, as judged by publications and external funding, with diverse interests and expertise, who are well positioned to take immediate advantage of the opportunities that will be provided by NYSTEM.
  • Rd2021program.Pdf

    Rd2021program.Pdf

    XIX INTERNATIONAL SYMPOSIUM ON RETINAL DEGENERATION RD2021 Sept. 27 - Oct. 2, 2021 Online and in person at the Sonesta Nashville Airport Hotel, Nashville, TN International Organizing Committee John D. Ash Eric Pierce RoBert E. Anderson Catherine Bowes Rickman Joe G. Hollyfield Christian Grimm A scientific conference planned and managed By: Travel Awardees (Note: Presenting authors are underlined. Travel Awardees are in bold.) The organizers of RD2021 wish to congratulate the 101 recipients of RD2021 Young Investigator Travel Awards listed below and funded by the National Eye Institute, NIH, USA; the Foundation Fighting Blindness, USA; Pro Retina, Germany; and the Fritz Tobler Foundation, Switzerland. Eligibility was restricted to graduate students, postdoctoral fellows, instructors and assistant professors actively involved in retinal degeneration research. These awards were based on the quality of the abstract submitted by each applicant. The Travel Awards Committee consisted of 13 senior retinal degeneration investigators and was chaired by Catherine Bowes Rickman. BrightFocus Foundation Awardees Angela Armento Daniel Hass Marika Zuanon Postdoctoral Fellow Postdoctoral Fellow Graduate Student University of Tübingen University of Washington Cardiff University [email protected] [email protected] [email protected] Manas Biswal Ankita Kotnala Bruna Costa Assistant Professor Postdoctoral Fellow Graduate Student University of South Florida Vanderbilt University Columbia University [email protected] [email protected]
  • Main Congress

    Main Congress

    Main Congress Programme Tuesday 17 October 2017 1: ESGCT 2017 opening Chairs Robin Ali, Zoltan Ivics ESGCT 25th Anniversary retrospective Robin Ali [UNIVERSITY COLLEGE LONDON] INV29 Genotoxicity – 15 years after, and the future? Christopher Baum [HANNOVER MEDICAL SCHOOL] Room INV30 Clinical gene therapy for neurodegenerative diseases: C01 Past, present, and future 17:00 - 19:00 17:00 Nathalie Cartier [INSERM/ CEA UMR1169, MIRCEN CEA AND UNIVERSITY PARIS-SUD, UNIVERSITY PARIS SACLAY] INV31 Haemophilia: From Talmud to CRISPR/Cas Thierry vandenDriessche [FREE UNIVERSITY OF BRUSSELS] 19:00 - 21:00 : Welcome reception Molecular Therapy meet the editor Programme Wednesday 18 October 2017 1a: Disease modelling Chairs Robin Ali, Andras Nagy INV32 Astrocyte - neuronal cross talk in neurodegeneration Siddharthan Chandran [UNIVERSITY OF EDINBURGH] INV33 Human glial progenitor cell-based treatment and modelling of neurological disease Steve Goldman [UNIVERSITY OF ROCHESTER MEDICAL CENTRE, NY] OR01 Generation of three-dimensional human artificial skeletal muscle tissue from iPS cells enables complex disease modelling for muscular dystrophy Francesco Saverio Tedesco [UNIVERSITY COLLEGE LONDON] Room B05 OR02 Reprogramming triggers mobilisation of endogenous retrotransposons - in human induced pluripotent stem cells with genotoxic effects on B07 08:30 - 10:40 host gene expression Gerald Schumann [PAUL EHRLICH INSTITUTE, LANGEN] OR03 Dynamic remodelling of neural cellular and extracellular signatures depicted in 3D in vitro differentiation of human iPSC-derived