DOCSLIB.ORG

Download File

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download File EVOLUTIONARY NEUROGENOMIC APPROACHES PROVIDE INSIGHT INTO THE MOLECULAR BASIS OF VOCAL LEARNING By Morgan Wirthlin A DISSERTATION Presented to the Department of Behavioral Neuroscience and the Oregon Health & Science University School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy September 2016 School of Medicine Oregon Health & Science University CERTIFICATE OF APPROVAL ___________________________________ This is to certify that the PhD dissertation of Morgan Wirthlin has been approved ______________________________________ Claudio Mello, Mentor/Advisor ______________________________________ Lucia Carbone, Oral Exam Committee Chair ______________________________________ Stephen David, Member ______________________________________ Jacob Raber, Member ______________________________________ John Brigande, Member TABLE OF CONTENTS List of Tables ................................................................................................................................................. ii List of Figures ............................................................................................................................................... iii Acknowledgments ........................................................................................................................................ iv Abstract ......................................................................................................................................................... v 1 Introduction .......................................................................................................................................... 1 1.1 Models for the study of vocal learning ......................................................................................... 1 1.2 The neural basis for vocal learning ............................................................................................... 4 1.3 The molecular and genetic basis for vocal learning ...................................................................... 8 2 The role of novel genes in the evolution of vocal learning ................................................................. 10 2.1 Background ................................................................................................................................. 10 2.2 Results & Discussion ................................................................................................................... 11 2.3 Methods ...................................................................................................................................... 41 3 ‘Core sets’ of genes expressed in vocal learning circuits .................................................................... 48 3.1 Background ................................................................................................................................. 48 3.2 Results & Discussion ................................................................................................................... 51 3.3 Methods ...................................................................................................................................... 68 4 The role of genomic regulatory elements in the evolution of vocal learning .................................... 70 4.1 Background ................................................................................................................................. 70 4.2 Results & Discussion ................................................................................................................... 71 2.1 Methods ...................................................................................................................................... 96 5 New models for understanding the evolution of a complex behavior: a general discussion........... 101 5.1 Current models of the evolution of learned vocal behavior ..................................................... 101 5.2 The ‘Stepwise Hypothesis,’ a new model for the evolution of vocal learning .......................... 104 6 Conclusions ....................................................................................................................................... 111 6.1 Conclusions ............................................................................................................................... 111 6.2 Future Directions ...................................................................................................................... 113 Bibliography .............................................................................................................................................. 117 i List of Tables Table 1: Novel genes in songbirds .............................................................................................................. 16 Table 2. Comparative ISH analysis of HVC-like nuclei ................................................................................. 56 Table 3. Comparative ISH analysis of RA-like nuclei ................................................................................... 57 Table 4. Comparative ISH of song system markers in suboscines .............................................................. 65 Table 5. Promoters of song system marker genes with high quality ISH data ........................................... 74 Table 6. GC content and repetitive sequence in zebra finch brain-expressed gene promoters ................ 80 Table 7. TF motifs associated with song system gene sets ......................................................................... 82 Table 8. Brain-expression TFs associated with HVC projection neuron and RA expressed gene sets ........ 84 Table 9. TFs enriched in promoters of song system marker gene sets in zebra finch and chicken ............ 94 ii List of Figures Figure 1. Phylogeny of major extant avian lineages ..................................................................................... 3 Figure 2. Simplified schematic of the zebra finch song system .................................................................... 5 Figure 3. Chromosomal rearrangement leading to songbird gene duplication ......................................... 18 Figure 4. Syntenic and protein functional domain analysis of YTHDC2L1 and YTHDC2L5 .......................... 22 Figure 5. Schematic model depicting the predicted structure of songbird novel gene TMRA ................... 24 Figure 6. Expression of URB1 in the zebra finch brain ................................................................................ 26 Figure 7. Expression of CASC1 gene duplicatios in the zebra finch brain ................................................... 28 Figure 8. Expression of YTHDC2L1 gene duplications in the zebra finch brain ........................................... 30 Figure 9. Expression of TMRA in the zebra finch brain ............................................................................... 31 Figure 10. Schematic of analogous song-activated brain nuclei in avian vocal learners ............................ 49 Figure 11. Conserved gene markers of zebra finch HVC and Anna’s hummingbird VLN............................ 53 Figure 12. Comparative ISH of PVALB in HVC-like nuclei ............................................................................ 59 Figure 13. Phylogeny of songbirds, parrots, and suboscine families .......................................................... 61 Figure 14. Comparative neuroanatomy of songbird RA and a suboscine arcopallial domain .................... 66 Figure 15. Expression of song system markers in Amazonian antshrike .................................................... 67 Figure 16. FISH demonstrating select expression of gene markers in HVC projection neurons ................ 77 Figure 17. ISH of markers of HVC projection neurons ................................................................................ 77 Figure 18. Position of TBP and EGR1 motifs in brain-expressed zebra finch promoters ............................ 80 iii Acknowledgments I wish to thank the three most important mentors of my life, Manfred Ruddat, Daniel Margoliash, and Claudio Mello. It is through your inspiration, training, and belief in me that I have made it to this point. I am deeply indebted to the members of the Mello lab who have shared their time and expertise over the years, especially Peter Lovell, Chris Olson, and Julia Carleton. Without their help, especially in contributing microarray data and assisting with many of the hybridization experiments, this work would not have been possible. I would also like to thank my wife, Andria, for her love, encouragement, and support. This past year has been one of many milestones, and I can’t imagine having anyone else by my side for the journey. This dissertation is dedicated to the memory of the birds whose lives were ended in the course of these studies. It is my sincere hope that through passionate public outreach, we can inspire future generations to prioritize conservation, that we might continue to share the planet with these fascinating fellow lifeforms for many generations to come. iv Abstract How are complex, learned behaviors - such as the ability to speak and sing - encoded in our genes, and how did they evolve? Human speech is dependent on our ability to learn and control our vocalizations, a process that is poorly understood at the molecular level. Further, this trait is exceedingly rare in the animal kingdom, and notably
Load more

Recommended publications
  • For Whom the Bird Sings: Context-Dependent Gene Expression
    Neuron, Vol. 21, 775±788, October, 1998, Copyright 1998 by Cell Press For Whom The Bird Sings: Context-Dependent Gene Expression Erich D. Jarvis,* Constance Scharff, more motifs per bout, and that each motif is delivered Matthew R. Grossman, Joana A. Ramos, slightly faster (by 10±40 ms) than undirected song (Fig- and Fernando Nottebohm ure 1A; Sossinka and BoÈ hner, 1980; Bischof et al., 1981; Laboratory of Animal Behavior Caryl, 1981). The two behaviors also differ in hormone The Rockefeller University sensitivity: the amount of directed song increases with New York, New York 10021 estrogen treatment, undirected with testosterone (ProÈ ve 1974; Arnold, 1975b; Harding et al., 1983; Walters et al., 1991). Summary Though no separate neural circuits for directed and undirected song have been described, a great deal is Male zebra finches display two song behaviors: di- known about the brain circuits that mediate song acqui- rected and undirected singing. The two differ little in sition and production. Referred to collectively as ªthe the vocalizations produced but greatly in how song is song system,º these circuits consist in male zebra delivered. ªDirectedº song is usually accompanied by finches of a posterior motor pathway necessary for song a courtship dance and is addressed almost exclusively production and an anterior pathway necessary for song to females. ªUndirectedº song is not accompanied by acquisition. Both pathways originate in the high vocal the dance and is produced when the male is in the center (HVC) of the neostriatum. In the posterior pathway presence of other males, alone, or outside a nest occu- (Figure 1B, black arrows), neurons of one cell type in pied by its mate.
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing
    Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing Aristidou, Constantia; Koufaris, Costas; Theodosiou, Athina; Bak, Mads; Mehrjouy, Mana M; Behjati, Farkhondeh; Tanteles, George; Christophidou-Anastasiadou, Violetta; Tommerup, Niels; Sismani, Carolina Published in: PLOS ONE DOI: 10.1371/journal.pone.0169935 Publication date: 2017 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Aristidou, C., Koufaris, C., Theodosiou, A., Bak, M., Mehrjouy, M. M., Behjati, F., Tanteles, G., Christophidou- Anastasiadou, V., Tommerup, N., & Sismani, C. (2017). Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing. PLOS ONE, 12(1), [e0169935]. https://doi.org/10.1371/journal.pone.0169935 Download date: 29. sep.. 2021 RESEARCH ARTICLE Accurate Breakpoint Mapping in Apparently Balanced Translocation Families with Discordant Phenotypes Using Whole Genome Mate-Pair Sequencing Constantia Aristidou1,2, Costas Koufaris1, Athina Theodosiou1, Mads Bak3, Mana M. Mehrjouy3, Farkhondeh Behjati4, George Tanteles5, Violetta Christophidou- Anastasiadou6, Niels Tommerup3, Carolina Sismani1,2* a1111111111 a1111111111 1 Department of Cytogenetics and Genomics, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 2 The Cyprus School of Molecular Medicine, The Cyprus Institute of Neurology and Genetics, a1111111111
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • REVIEW ARTICLE the Genetics of Autism
    REVIEW ARTICLE The Genetics of Autism Rebecca Muhle, BA*; Stephanie V. Trentacoste, BA*; and Isabelle Rapin, MD‡ ABSTRACT. Autism is a complex, behaviorally de- tribution of a few well characterized X-linked disorders, fined, static disorder of the immature brain that is of male-to-male transmission in a number of families rules great concern to the practicing pediatrician because of an out X-linkage as the prevailing mode of inheritance. The astonishing 556% reported increase in pediatric preva- recurrence rate in siblings of affected children is ϳ2% to lence between 1991 and 1997, to a prevalence higher than 8%, much higher than the prevalence rate in the general that of spina bifida, cancer, or Down syndrome. This population but much lower than in single-gene diseases. jump is probably attributable to heightened awareness Twin studies reported 60% concordance for classic au- and changing diagnostic criteria rather than to new en- tism in monozygotic (MZ) twins versus 0 in dizygotic vironmental influences. Autism is not a disease but a (DZ) twins, the higher MZ concordance attesting to ge- syndrome with multiple nongenetic and genetic causes. netic inheritance as the predominant causative agent. By autism (the autistic spectrum disorders [ASDs]), we Reevaluation for a broader autistic phenotype that in- mean the wide spectrum of developmental disorders cluded communication and social disorders increased characterized by impairments in 3 behavioral domains: 1) concordance remarkably from 60% to 92% in MZ twins social interaction; 2) language, communication, and and from 0% to 10% in DZ pairs. This suggests that imaginative play; and 3) range of interests and activities.
    [Show full text]
  • COVER PAGE and CAMPUS MAP to Be Inserted (Campus Map on Last Page)
    COVER PAGE and CAMPUS MAP to be inserted (campus map on last page) 1 Welcome and Conference Overview Welcome to the 2012 New Zealand Ecological Society Conference. The organising committee is excited by the wide range of symposia and papers submitted. When we volunteered Lincoln University to host this conference we wanted to show that science is still alive and well in Canterbury and the great response we have had from all of you indicates that our somewhat shaken heart is still beating! Given the high numbers of papers submitted we have had to organise four concurrent sessions for the first two days of the conference. What this means is that we are hosting over 130 oral presentations. This high level of demand was somewhat unexpected but we are pleased to report that we accepted nearly all of the oral papers that were submitted to the conference organisers. No mean feat! I would especially like to thank the organising committee and all our student helpers. We have a small team of organisers and they have all worked extremely hard to bring this event together. Our postgraduate students have done an excellent job creating the “student-only day” and it was a delight to support this endeavour. We also thank the Lincoln University Conference & Event Management group for their professional management of this event. Well done team! This conference would not have been possible without the generous support of all our sponsors. Given the current economic climate I did wonder if we may end up with the “2012 Austerity Conference”; however, I was pleasantly surprised with the level of support we have received and I particularly want to thank our main sponsors: the Faculty of Agriculture and Life Sciences here at Lincoln and the Department of Conservation.
    [Show full text]
  • CADPS2 (NM 001009571) Human Tagged ORF Clone – RC220606
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC220606 CADPS2 (NM_001009571) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CADPS2 (NM_001009571) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CADPS2 Synonyms: CAPS2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC220606 representing NM_001009571 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGGACCCGTCTTCCAGCGAAGAGGAGTCGGACGAGGGGCTGGAAGAGGAAAGCCGCGATGTGCTGG TGGCAGCCGGCAGCTCGCAGCGAGCTCCTCCAGCCCCGACTCGGGAAGGGCGGCGGGACGCGCCGGGGCG CGCGGGCGGCGGCGGCGCGGCCAGATCTGTGAGCCCGAGCCCCTCTGTGCTCAGCGAGGGGCGAGACGAG CCCCAGCGGCAGCTGGACGATGAGCAGGAGCGGAGGATCCGCCTGCAGCTCTACGTCTTCGTCGTGAGGT GCATCGCGTACCCCTTCAACGCCAAGCAGCCCACCGACATGGCCCGGAGGCAGCAGAAGCTTAACAAACA ACAGTTGCAGTTACTGAAAGAACGGTTCCAGGCCTTCCTCAATGGGGAAACCCAAATTGTAGCTGACGAA GCATTTTGCAACGCAGTTCGGAGTTATTATGAGGTTTTTCTAAAGAGTGACCGAGTGGCCAGAATGGTAC AGAGTGGAGGGTGTTCTGCTAATGACTTCAGAGAAGTATTTAAGAAAAACATAGAAAAACGTGTGCGGAG TTTGCCAGAAATAGATGGCTTGAGCAAAGAGACAGTGTTGAGCTCATGGATAGCCAAATATGATGCCATT TACAGAGGTGAAGAGGACTTGTGCAAACAGCCAAATAGAATGGCCCTAAGTGCAGTGTCTGAACTTATTC TGAGCAAGGAACAACTCTATGAAATGTTTCAGCAGATTCTGGGTATTAAAAAACTGGAACACCAGCTCCT TTATAATGCATGTCAGCTGGATAACGCAGATGAACAAGCAGCCCAGATCAGAAGGGAACTTGATGGCCGG CTGCAATTGGCAGATAAAATGGCAAAGGAAAGAAAATTCCCCAAATTTATAGCAAAAGATATGGAGAATA
    [Show full text]
  • Recent Literature
    564 tVol.[ Auk73 RECENT LITERATURE EDITED BY FRANK McKINNEY ANATOMY AND EMBRYOLOGY ALDriCH, E.C. 1956. Pterylography and molt of the Allen Hummingbird. Con- dor, 58: 121-133.--Feather tracts of Selasphorussasin are diagrammed in detail and discussed,and comparisonsare made with certain other species. Specialized rectrices,which are sexually dimorphic, assistin production of flight sounds. Molt and degrees of plumage wear are suggestedas criteria of age and sex.--D. W. J. BAILEY, R.E. 1955. The incubation patch of tinamous. Condor, 57: 301-303.- Twenty-sevenindividuals of Nothoproctafrom Peru have been examinedin this study. All males had incubation patches during the breeding season(Feb.-Apr.), but males collected at other times of the year and all females lacked such patches. Gross anatomical descriptions are given for ventral apteria, molt, and the patches, and microscopicsections are depicted for nonbreedingand breeding males. These are the first details available for the incubation patches of ratitc birds.--D. W. J. BAs, C. 1954-1955. On the relation between the masticatory muscles and the surface of the skull in Ardea cinerea (L.) Parts I-III (to be continued). Kon. Nederlandse Akad. Wetensch. Ser. C. Biol. Med. Sci., 57: 678-685, figs. 1-6. 58: 101-120, figs. 7-40. BE•GE•, A.J. 1955. On the anatomy and relationships of Glossy Cuckoos of the genera Chrysococcyx,Lampromorpha, and Chalcites. Proc. U.S. Nat. Mus., 10S: no. 3335: 585-597, 3 pls. BE•cER, A.J. 1956. The appendicularmyology of the Pygmy Falcon (Polihierax semitorquatus). Amer. Midi. Nat., 55: 326-333, 3 figs. BU•GG•AAF, P.
    [Show full text]
  • Impaired Secretion of Brain-Derived Neurotrophic Factor and Neuropsy- Chiatric Diseases Naoki Adachi and Hiroshi Kunugi*
    The Open Neuroscience Journal, 2008, 2, 59-64 59 Open Access Impaired Secretion of Brain-Derived Neurotrophic Factor and Neuropsy- chiatric Diseases Naoki Adachi and Hiroshi Kunugi* Department of Mental Disorder Research, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo 187-8502, 4-1-1, Ogawahigashi, Tokyo, 187-8502, Japan Abstract: Recent studies have elucidated mechanisms of brain-derived neurotrophic factor (BDNF) secretion, and im- paired secretion of BDNF may be involved in the pathogenesis of several neuropsychiatric diseases. The huntingtin gene, for example, has been shown to regulate vesicular transport of BDNF, which may play a role in the neurodegeneration present in Huntington's disease. In animal studies, mice lacking calcium-dependent activator protein for secretion 2 (CADPS2), which is involved in the activity-dependent release of BDNF, showed several phenotypes including autistic behavior. A single nucleotide polymorphism that results in an amino-acid change (Val66Met) in the BDNF gene has been shown to cause a decline in the function of BDNF vesicular sorting and has been reported to be associated with behavioral and intermediate phenotypes (e.g., episodic memory) in humans. In this review, we introduce recent progress in the mo- lecular mechanisms of BDNF secretion and discuss its possible role in the pathophysiology and treatment of neuropsy- chiatric diseases. INTRODUCTION of transmembrane receptor proteins: the tyrosine kinase Trk (tropomyosin-related kinase) receptors and the low affinity Brain-derived neurotrophic factor (BDNF), a member of common neurotrophin receptor (p75NTR). Neurotrophins the neurotrophin family, has been implicated in a broad are expressed in a precursor form (pro-neurotrophins) and range of processes that are important for neuronal survival are proteolytically processed to a mature form.
    [Show full text]
  • An Initial Estimate of Avian Ark Kinds
    Answers Research Journal 6 (2013):409–466. www.answersingenesis.org/arj/v6/avian-ark-kinds.pdf An Initial Estimate of Avian Ark Kinds Jean K. Lightner, Liberty University, 1971 University Blvd, Lynchburg, Virginia, 24515. Abstract Creationists recognize that animals were created according to their kinds, but there has been no comprehensive list of what those kinds are. As part of the Answers in Genesis Ark Encounter project, research was initiated in an attempt to more clearly identify and enumerate vertebrate kinds that were SUHVHQWRQWKH$UN,QWKLVSDSHUXVLQJPHWKRGVSUHYLRXVO\GHVFULEHGSXWDWLYHELUGNLQGVDUHLGHQWLÀHG 'XHWRWKHOLPLWHGLQIRUPDWLRQDYDLODEOHDQGWKHIDFWWKDWDYLDQWD[RQRPLFFODVVLÀFDWLRQVVKLIWWKLVVKRXOG be considered only a rough estimate. Keywords: Ark, kinds, created kinds, baraminology, birds Introduction As in mammals and amphibians, the state of avian $VSDUWRIWKH$UN(QFRXQWHUSURMHFW$QVZHUVLQ WD[RQRP\LVLQÁX['HVSLWHWKHLGHDORIQHDWO\QHVWHG Genesis initiated and funded research in an attempt hierarchies in taxonomy, it seems groups of birds to more clearly identify and enumerate the vertebrate are repeatedly “changing nests.” This is partially NLQGVWKDWZHUHSUHVHQWRQWKH$UN,QDQLQLWLDOSDSHU because where an animal is placed depends on which WKH FRQFHSW RI ELEOLFDO NLQGV ZDV GLVFXVVHG DQG D characteristics one chooses to consider. While many strategy to identify them was outlined (Lightner et al. had thought that molecular data would resolve these 6RPHRIWKHNH\SRLQWVDUHQRWHGEHORZ issues, in some cases it has exacerbated them. For this There is tremendous variety seen today in animal HVWLPDWHRIWKHDYLDQ$UNNLQGVWKHWD[RQRPLFVFKHPH OLIHDVFUHDWXUHVKDYHPXOWLSOLHGDQGÀOOHGWKHHDUWK presented online by the International Ornithologists’ since the Flood (Genesis 8:17). In order to identify 8QLRQ ,28 ZDVXVHG *LOODQG'RQVNHUD which modern species are related, being descendants 2012b and 2013). This list includes information on RI D VLQJOH NLQG LQWHUVSHFLÀF K\EULG GDWD LV XWLOL]HG extant and some recently extinct species.
    [Show full text]
  • Advances in Autism Genetics: on the Threshold of a New Neurobiology
    REVIEWS Advances in autism genetics: on the threshold of a new neurobiology Brett S. Abrahams and Daniel H. Geschwind Abstract | Autism is a heterogeneous syndrome defined by impairments in three core domains: social interaction, language and range of interests. Recent work has led to the identification of several autism susceptibility genes and an increased appreciation of the contribution of de novo and inherited copy number variation. Promising strategies are also being applied to identify common genetic risk variants. Systems biology approaches, including array-based expression profiling, are poised to provide additional insights into this group of disorders, in which heterogeneity, both genetic and phenotypic, is emerging as a dominant theme. Gene association studies Autistic disorder is the most severe end of a group of into the ASDs. This work, in concert with important A set of methods that is used neurodevelopmental disorders referred to as autism technical advances, made it possible to carry out the to determine the correlation spectrum disorders (ASDs), all of which share the com- first candidate gene association studies and resequenc- (positive or negative) between mon feature of dysfunctional reciprocal social interac- ing efforts in the late 1990s. Whole-genome linkage a defined genetic variant and a studies phenotype of interest. tion. A meta-analysis of ASD prevalence rates suggests followed, and were used to identify additional that approximately 37 in 10,000 individuals are affected1. loci of potential interest. Although
    [Show full text]
  • He Kotuku Rerenga Tahi
    Kotuku at Tomahawk Lagoon Craig McKenzie “He kotuku rerenga tahi” – “a white heron’s flight is seen but once” This is a whakatauki or proverb, which is used to indicate a very special and rare event and is also applied to visitors of importance; to compare a visitor to a kotuku is meant as a high compliment. The Otago Branch extends a hearty southern welcome to you all to this OSNZ conference, the first to be held under the banner of the New Zealand Bird Conference, and the first to be held in the south for over two decades. As a sign of good things to come, we in Otago have been favoured this May by the presence of six white herons, kotuku, which turned up together at nearby Tomahawk Lagoon, and also several others at estuaries around the area. This number has not been seen for decades. We trust that this exciting occurrence bodes well for an enjoyable and informative conference, where you will renew old friendships, make new ones, share birding experiences, hear the results of current research on our NZ birds and learn new things at the workshops. Dunedin is an important site for birds and we trust that many of you will have the chance to encounter some of them while you are here. Regional Representative, Otago Branch, Mary Thompson Our evolving view of the kakapo and its allies. GEOFFREY K CHAMBERS1 and Trevor H. Worthy2 1School of Biological Sciences , Victoria University of Wellington PO Box 600, Wellington 6140, NEW ZEALAND. 2School of Earth and Environmental Sciences, University of Adelaide Adelaide 5005, South Australia, AUSTRALIA.
    [Show full text]