CD36 or αvβ3 and αvβ5 Are Not Essential for MHC Class I Cross-Presentation of Cell-Associated Antigen by CD8 α+ Murine Dendritic Cells This information is current as of September 25, 2021. Oliver Schulz, Daniel J. Pennington, Kairbaan Hodivala-Dilke, Maria Febbraio and Caetano Reis e Sousa J Immunol 2002; 168:6057-6065; ; doi: 10.4049/jimmunol.168.12.6057

http://www.jimmunol.org/content/168/12/6057 Downloaded from

References This article cites 61 articles, 30 of which you can access for free at: http://www.jimmunol.org/content/168/12/6057.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

␣ ␤ ␣ ␤ CD36 or v 3 and v 5 Integrins Are Not Essential for MHC Class I Cross-Presentation of Cell-Associated Antigen by CD8␣؉ Murine Dendritic Cells1

Oliver Schulz,* Daniel J. Pennington,† Kairbaan Hodivala-Dilke,‡ Maria Febbraio,§ and Caetano Reis e Sousa2*

Cross-presentation of cell-associated Ag is thought to involve receptor-mediated uptake of apoptotic cells by dendritic cells (DC), ␣ ␤ ␣ ␤ and studies with human DC strongly implicate the endocytic receptor CD36 and the integrins v 3 and/or v 5 in this process. In the mouse, cross-presentation was recently shown to be a function of CD8␣؉ DC. Here we report that CD36 is expressed on CD8␣؉, but not on CD8␣؊, DC. To address the role of CD36 in cross-presentation we compared CD36؊/؊ and CD36؉/؉ H-2b DC for their ability to stimulate naive OT-1 T cells specific for OVA plus H-2Kb in the presence of OVA-loaded MHC-mismatched Downloaded from splenocytes as a source of cell-associated Ag for cross-presentation. Surprisingly, no difference was seen between CD36؊/؊ and CD36؉/؉ CD8␣؉ DC in their ability to cross-present cell-associated OVA or to capture OVA-bearing cells. Furthermore, the proliferation of CFSE-labeled OT-1 cells in response to OVA cross-presentation in vivo was normal in CD36؊/؊ bone marrow ␤ chimeras, also arguing against a necessary role for CD36 in cross-presentation by DC or other APC. DC doubly deficient for 3 ␤ and 5 integrins were similarly unimpaired in their ability to cross-present OVA-bearing cells in vitro. These data demonstrate

␤ ␤ http://www.jimmunol.org/ that in the mouse, receptors other than CD36 or 3 and 5 integrins can support the specialized cross-presenting function of .CD8␣؉ DC. The Journal of Immunology, 2002, 168: 6057–6065

n most cells, MHC class I molecules present peptides derived tutively in vivo and is thought to be an important component in the from cytosolic Ags and have only limited ability to present maintenance of peripheral CD8ϩ T cell tolerance (5, 6). To reflect I exogenous Ags acquired from the external milieu by endo- its dual role in immunity and tolerance, MHC presentation of ex- cytosis (1). The bias of the MHC class I presentation pathway for ogenous cell-associated Ag has been termed cross-presentation (5). endogenous Ags has presumably evolved to ensure that the cyto- The existence of a specialized cross-presenting APC was pos- toxic activity of CD8ϩ T cells remains focused on infected targets tulated in 1987 (7), but its identity remained elusive until recently by guest on September 25, 2021 and spares uninfected cells that may have passively acquired despite many attempts to reconstitute cross-presentation in vitro. pathogen Ags from the environment. However, if absolute, the Several reports suggested that both (M␾)3 and B inability to present exogenous Ags on MHC class I would prevent cells could present soluble exogenous Ags on MHC class I, but this CTL responses against viruses that do not enter APC or against was only seen in situations in which very large amounts of Ag parasites that are confined to the endocytic compartment. In fact, a were delivered to the cells or taken up via specific Ig, implying that large body of evidence suggests that MHC class I presentation of they were unlikely to constitute an efficient cross-presenting APC exogenous Ags can occur in vivo. Twenty-five years ago, Bevan in vivo (8Ð13). In contrast to M␾ and B cells, dendritic cells (DC) (2, 3) showed the existence of a cross-priming pathway in mice were shown to be able to efficiently present soluble exogenous Ags allowing the induction of CTL responses against minor histocom- on MHC class I, particularly upon macropinocytic uptake or after patibility Ags carried in a cell-based inoculum. Since then, the targeting to Fc receptors (14Ð16), and efficient MHC class I cross- general importance of cross-priming has become apparent with the presentation of cell-associated Ags was reconstituted in vitro using realization that it is an integral part of the immune response to human DC that had been fed influenza-infected monocytes (17). many tumors, viruses, allografts, and intracellular pathogens (4). DC can also cross-present cellular Ags on MHC class II (18) and In addition, MHC class I presentation of cell-associated Ags by are sufficient for the induction of CD8ϩ T cell cross-tolerance in bone marrow-derived APC has been shown to take place consti- vivo (19). Recently, Den Haan and Bevan (20) identified CD8␣ϩ DC as the major APC type in mouse spleen able to cross-present to CD8ϩ T cells OVA derived from a cell-based inoculum. The *Immunobiology Laboratory, †Lymphocyte Molecular Biology Laboratory, and ‡Cell same DC subset also excels in presenting soluble OVA protein on Adhesion and Disease Laboratory, Cancer Research UK, London Research Institute, MHC class I (21). Together, these observations suggest that DC London, United Kingdom; and ¤Division of Hematology and Medical Oncology, Department of Medicine, Weill Medical College of Cornell University, New York, might constitute the primary cross-presenting APC in vivo. NY 10021 Nevertheless, the mechanisms underlying cross-presentation by Received for publication January 22, 2002. Accepted for publication March 21, 2002. DC remain poorly understood. Since most instances of cross-pre- The costs of publication of this article were defrayed in part by the payment of page sentation involve cell-based inocula, one hypothesis is that DC charges. This article must therefore be hereby marked advertisement in accordance phagocytose apoptotic cells in the inoculum and re-present the with 18 U.S.C. Section 1734 solely to indicate this fact. acquired cellular Ags on MHC class I and MHC class II. Support 1 This work was supported by Cancer Research UK. 2 Address correspondence and reprint requests to Dr. Caetano Reis e Sousa, Immu- nobiology Laboratory, Cancer Research UK, London Research Institute, Lincoln’s Inn Fields Laboratories, 44 Lincoln’s Inn Fields, London, U.K. WC2A 3PX. E-mail 3 Abbreviations used in this paper: M␾, ; DC, dendritic cell; DN, double address: [email protected] negative; PS, phosphatidylserine; RAG, recombinase-activating gene.

Copyright © 2002 by The American Association of Immunologists, Inc. 0022-1767/02/$02.00 ␣ ␤ ␣ ␤ 6058 DC CROSS-PRESENTATION IN THE ABSENCE OF CD36 OR v 3 AND v 5 for this idea comes from work showing that immature human DC hierarchical gates: a scatter gate around live cells, a histogram gate on capable of phagocytosing apoptotic cells are better at cross-pre- CD11cbright cells, followed by gates on three distinct DC subsets defined senting cell-associated Ags than mature cells that have lost phago- using a CD4 vs CD8 dot plot. CD4, CD8, and double-negative (DN) DC populations from CD45.2/CD45.1 mixed bone marrow chimeras were fur- cytic ability (22). Much interest has therefore focused on which ther split into recipient-derived (CD36ϩ) and donor-derived (CD36Ϫ) sub- receptors mediate the uptake of apoptotic cells by DC. Albert et al. sets by gating on CD45.1ϩ and CD45.1Ϫ populations on a CD45.1 (22) used blocking Abs to show that two of these receptors in histogram. Ϫ/Ϫ human DC are CD36 and ␣ ␤ . An alternative , ␣ ␤ , has OT-1 T cells were isolated from lymph nodes of OT-1 ϫ RAG-1 v 5 v 3 mice and depleted of APC by negative selection using magnetic beads. also been implicated in apoptotic cell uptake by human DC (23). Briefly, cells were stained with a mixture of biotinylated mAbs including ␾ ␣ ␤ In contrast, M do not appear to use v 5, leading to the sugges- anti-Fc␥R, anti-CD4, anti-CD11c, anti-Gr-1, and anti-B220, washed, and tion that the receptors used by different phagocytes for uptake of incubated with streptavidin beads (Miltenyi Biotec, Bisley, U.K.). Labeled apoptotic cells are somehow responsible for the difference in the cells were removed on a MACS depletion column, and the flow-through fate of the internalized Ag: cross-presentation in DC vs degrada- fraction was collected, representing unlabeled, APC-depleted OT-1 T cells. ␾ ␣ ␤ tion in M (22). However, the direct involvement of CD36, v 3, Ab staining and flow cytometry ␣ ␤ and v 5 in cross-presentation has never been tested. Here we show that CD36 is selectively expressed in murine CD8␣ϩ DC. For flow cytometry, cell suspensions were washed in PBS/5 mM EDTA and stained in PBS/EDTA containing 1% FCS and 0.02% sodium azide However, using cells from genetically deficient mice, we demon- (FACS buffer). CD36 expression was determined on CD11c-enriched ␣ ␤ ␣ ␤ strate that neither CD36 nor the v 3 and v 5 integrins are re- splenocytes using a four-color staining protocol. Briefly, cells were stained sponsible for the superior cross-presenting ability of CD8␣ϩ DC. with anti-murine CD36 (mouse IgA) (30) in the presence of anti-Fc␥R, Our results suggest that the receptors critical for cross-presentation followed by biotinylated anti-mouse IgA, followed by an mAb cocktail, Downloaded from ␣ in the mouse remain to be identified. including FITC-conjugated anti-CD8 , PE-conjugated anti-CD11c, Tri- Color-conjugated streptavidin (Caltag Laboratories), and allophycocyanin- conjugated anti-CD4. Parallel samples were stained with an irrelevant iso- Materials and Methods type-matched control Ab to validate the specificity of the CD36 staining. Animals Events were collected on a FACSCalibur cytometer (BD Bioscience, Mountain View, CA) and analyzed using FlowJo software (Treestar, San Female C57BL/6 and BALB/c mice were purchased from Charles River Carlos, CA). (Margate, U.K.). OT-1 mice (24) on a recombinase-activating gene 1 http://www.jimmunol.org/ (RAG-1)Ϫ/Ϫ background (gift from Dr. D. Kioussis, National Institute for ϩ In vitro cross-presentation assay Medical Research, Mill Hill, U.K.), CD45.1 B6.SJL mice (gift from F. ␤ ␤ Powrie, , Oxford, U.K.) and 3/ 5 doubly deficient BALB/c splenocytes were loaded with OVA protein using osmotic shock mice (25) were bred at the animal facility of the London Research Institute treatment as previously described (20, 31, 32) and were subsequently ir- Ϫ Ϫ (South Mimms, U.K.) under specific pathogen-free conditions. CD36 / radiated using an x-ray source (1350 rad). Control cells were treated iden- mice (26) backcrossed at least six times onto a C57BL/6 background were tically, except for the omission of OVA. OVA-loaded or control spleno- housed at Weill Medical College of Cornell University in a fully accredited cytes (5 ϫ 105 cells) were then cocultured with sorted DC subsets (1Ð2 ϫ Association of Laboratory Animal Care facility. All mice were used at 105 cells) and APC-depleted OT-1 T cells (105 cells) in 96-well flat-bottom 6Ð10 wk of age. To analyze DC genetically deficient for CD36, bone culture plates. As a positive control, the same DC subsets were cultured at marrow chimeras were made by reconstituting irradiated CD45.1 B6.SJL ϫ 4 5

2Ð4 10 with OT-I T cells (10 cells) in the presence of subsaturating by guest on September 25, 2021 ϩ mice with 2 ϫ 106 congenic bone marrow cells from either CD45.2 amounts of OVA peptide, chosen so as to reveal any putative differences in Ϫ Ϫ ϩ ϩ ϩ CD36 / mice or CD45.2 CD36 / littermate controls. The dose of x- the stimulatory capacity of DC subsets. Cultures were incubated in RPMI ray radiation given to recipient mice was chosen according to the aim of the 1640 medium supplemented with 10% FCS, penicillin (100 U/ml), strep- experiment: sublethal irradiation (400 rad, twice) was used to make mixed tomycin (100 ␮g/ml), glutamine (2 mM), and 2-ME (5 ϫ 10Ϫ5 M). Two bone marrow chimeras to compare donor and recipient DC ex vivo; lethal days after culture initiation 25 ␮l supernatant was harvested and tested for irradiation (600 rad, twice) was used to analyze cross-presentation in wild- IL-2 production by sandwich ELISA using JES6-1A12 as the capture and Ϫ Ϫ type (WT) vs CD36 / full bone marrow chimeras in vivo. All chimeras JES6-5H4-B (biotinylated) as the detection Ab. The cultures were then were left for at least 5 wk before use to allow turnover of the splenic DC pulsed overnight with [3H]thymidine (1 ␮Ci/well; Amersham, Little Chal- compartment (27). font, U.K.), and [3H]thymidine incorporation was measured in a beta plate Reagents counter (Wallac, Newbury, U.K.). The OVA peptide 257Ð264 (OVA peptide; SIINFEKL) was made by the In vivo cross-presentation assay CRUC peptide synthesis service. OVA protein and polyethylene glycol ϫ Ϫ/Ϫ 1000 were obtained from Calbiochem-Novabiochem (Nottingham, U.K.). Lymph node and spleen cells from OT-1 RAG-1 mice were pooled, b labeled with CFSE (2 ␮M, 15 min, 37¡C; Molecular Probes, Eugene, OR), PE-conjugated H-2K /SIINFEKL tetramer (28) was a gift from the MHC ϫ 6 tetramer core facility of the National Institute of Allergy and Infectious and injected via the tail vein (5 10 /mouse) into chimeric CD45.1 B6.SJL mice that had been lethally irradiated and reconstituted with bone Diseases (Atlanta, GA). Ϫ/Ϫ The mAbs used were HL3, a hamster IgG mAb against CD11c; 53-6.7, marrow from either WT or CD36 mice. Next day mice were immunized ␣ by i.v. injection of PBS (vehicle control), OVA peptide (2.5 ␮g/mouse), or RM4-5, and RA3-6B2, rat IgG2a mAbs against CD8 , CD4, and B220, ϫ 6 respectively; A20, a mouse IgG2a mAb against CD45.1; and 2.4G2 and OVA- or mock-loaded BALB/c splenocytes (20Ð30 10 /mouse). Three RB6-8C5, rat IgG2b mAbs against Fc␥R III/II and Gr-1, respectively. All days later spleens were collected, and cell suspensions were stained with PE-conjugated H-2Kb/SIINFEKL tetramer and TriColor-conjugated anti- mAbs were obtained from BD Pharmingen (BD Bioscience, Oxford, U.K.), ␣ unless otherwise indicated. CD8 (Caltag Laboratories) and analyzed by flow cytometry. Cells Cell uptake assay Spleen cell suspensions were prepared as previously described (29) using CD11c-enriched cells (C57BL/6; 106/well) were prestained with FITC- Liberase CI (Roche Diagnostics, Lewes, U.K.). Splenic DC subsets were conjugated anti-CD11c and subsequently cocultured with BALB/c-derived isolated in two steps. First, DC-enriched splenocytes were prepared by splenocytes (5 ϫ 106 cells/well), which had been labeled with the li- magnetic selection using anti-CD11c MACS beads (Miltenyi Biotec, Bis- pophilic, fluorescent dye PKH26 (4 ␮M, 10 min, room temperature; Sigma, ley, U.K.) and positive selection columns as recommended by the manu- Dorset, U.K.) as recommended by the manufacturer, followed by further facturer. CD11c-enriched cells were then stained with PE-labeled anti- treatment as described for in vitro cross-presentation (see above). Cells CD11c, FITC-labeled anti-CD8␣, and CyChrome-labeled anti-CD4 and were harvested 4 h later in FACS buffer and analyzed by FACS. To com- sorted into subsets on a MoFlo cytometer (Cytomation, Fort Collins, CO). pare WT vs CD36Ϫ/Ϫ DC, CD11c-enriched cells from CD45.1/CD45.2 CD11c-enriched cells from CD45.2/CD45.1 mixed bone marrow chimeras mixed bone marrow chimeras were prestained with FITC-conjugated anti- were stained with FITC-labeled anti-CD45.1, PE-labeled anti-CD11c, Tri- CD45.1 and TC-conjugated anti-CD8␣ before adding them to PKH26- Color-labeled anti-CD8␣ (Caltag Laboratories, San Francisco, CA), and labeled splenocytes. To exclude dead cells from the analysis, the DNA allophycocyanin-labeled anti-CD4. Events were sorted based on a set of binding dye TOPRO-3 was added before sample acquisition. The Journal of Immunology 6059

Semiquantitative RT-PCR able to cross-present them to CD8ϩ T cells ex vivo. To establish ␣ϩ Total RNA was isolated from sorted DC subset samples using the RNeasy whether selective cross-presentation by CD8 DC is also seen in mini kit (Qiagen, Crawley, U.K.) combined with a DNA digestion step vitro, we used a protocol based on the one used by those authors. (DNase set, Qiagen). Single-stranded cDNA was synthesized using the Sorted DC subsets from C57BL/6 (H-2b) mice were incubated with SuperScript preamplification system (Life Technologies, Paisley, U.K.), irradiated allogeneic splenocytes osmotically loaded with OVA pro- and PCR was conducted according to standard protocols on a PTC-100 tein (OVA cells) (20, 31, 32), and the response of OT-I T cells was thermal cycler (MJ Research, Watertown, MA). PCR products were elec- b trophoresed on 1.5% agarose gels and visualized by ethidium bromide used to measure the display of processed OVA257Ð264/K complexes staining. The following primer pairs were used: ␤-actin (forward, GTTT by DC. As shown in Fig. 2, OT-I did not mount an allogeneic GAGACCTTCAACACCCC; reverse, GTGGCCATCTCCTGCTCGAAGTC; response to the inoculum, as they did not proliferate or produce product size, 320 bp), CD36 (forward, CCATTCCTCAGTTTGGTTCC; IL-2 in the absence of added syngeneic DC. Using proliferation of reverse, TGCATTTGCCAATGTCTAGC; product size, 450 bp). ϩ OT-I cells as a readout, CD8␣ DC were markedly more potent Results than other DC subsets at presenting OVA cells (Fig. 2A). This was ϩ OVA specific, as no proliferation was seen when DC were pulsed CD36 is preferentially expressed in CD8a DC with control allogeneic cells loaded in the absence of OVA (mock In an effort to molecularly characterize murine DC subsets, we con- cells; Fig. 2A). DN DC also cross-presented OVA cells to OT-I T ducted representational difference analysis (33) between freshly iso- cells, but were near 50-fold less potent than CD8␣ϩ DC, raising ϩ Ϫ lated CD8␣ and CD8␣ splenic DC (D. J. Pennington, O. Schulz, the possibility that their activity might be due to residual CD8␣ϩ and C. Reis e Sousa, unpublished observations). Cloning and se- DC contamination (Fig. 2A). In contrast, there was practically no ϩ quencing of one of the bands from the sample containing CD8␣ proliferation in response to CD4ϩ DC pulsed with OVA-cells (Fig. Downloaded from DC-specific cDNA revealed that it corresponded to nt 127Ð294 of 2A). Similar results were obtained when IL-2 secretion was mea- murine CD36 (data not shown). RT-PCR analysis conducted on fresh sured as an indicator of OT-I activation instead of proliferation samples of RNA purified from splenic DC subsets confirmed that (Fig. 2B). IL-2 was not made by T cells in the splenocyte inoculum ϩ ϩ CD36 was primarily expressed in CD8␣ DC (Fig. 1A). CD4 DC responding to allogeneic DC, as there was no accumula- Ϫ Ϫ were negative for CD36 expression, while CD8␣ CD4 (DN) DC tion in the cultures in the absence of OT-I (Fig. 2B). The differ- ϩ expressed CD36 mRNA at lower levels than CD8␣ DC (Fig. 1A). ential behavior of DC subsets in the assay was not due to intrinsic http://www.jimmunol.org/ Staining with an Ab specific for murine CD36 demonstrated that differences in their ability to stimulate T cells, because all subsets ϩ ϩ CD8␣ DC, but not CD4 DC, express CD36 at the cell surface (Fig. stimulated OT-I proliferation equally well when offered prepro- ϩ 1B). Staining was unimodal revealing that essentially all CD8␣ DC cessed OVA peptide (data not shown; see Figs. 3 and 6) as pre- express CD36 (Fig. 1B). Consistent with the RT-PCR data, expression viously reported (21, 34). We conclude that, as reported in vivo of CD36 was also seen in a small fraction of DN DC (Fig. 1B). (20), CD8␣ϩ DC are the major DC subtype involved in cross- However, this appeared to be due to contamination of the DN fraction presentation of cell-associated Ags in vitro. with CD8␣ϩ DC that were not completely excluded by electronic gating because backgating on CD36ϩ DN DC revealed that they ex- Ϫ/Ϫ ϩ

␣ by guest on September 25, 2021 pressed higher levels of CD8␣ than the bulk of DN DC (not shown). CD36 CD8 DC show no impairment in cross-presentation We conclude that CD36 expression in murine spleen DC is primarily in vitro ϩ restricted to the CD8␣ DC subset. CD36 can act as a receptor for cellular uptake by phagocytes (35)

ϩ and has been postulated to be involved in cross-presentation by CD8␣ DC selectively cross-present cell associated Ag in vitro ␣ϩ ϩ human DC (22). The selective expression of CD36 in CD8 DC to CD8 T cells raised the question of whether this receptor was responsible for Den Haan and Bevan (20) have shown that all DC subsets can their selective ability to cross-present cell-associated OVA. To ad- capture cell-associated Ags in vivo, but that only CD8␣ϩ DC are dress this question, we compared the cross-presenting ability of

FIGURE 1. CD36 is selectively expressed on CD8␣ϩ DC. A, Amplification of CD36 message in cDNA from sorted DC subsets by RT-PCR using primers specific for murine CD36 (upper panel). The amount of cDNA per sample was adjusted with respect to the ␤-actin control signal (lower panel). B, Flow cytometric analysis of CD36 surface expres- sion on DC subsets. CD11c enriched DC were stained for DC markers (CD11c, CD4, and CD8␣), and CD36. CD4ϩ, CD8␣ϩ, and DN subsets were identified on the basis of a CD4 vs CD8 contour plot (upper diagram) after gating on CD11cbright cells. Numbers represent the percentage of DC within each subset. Histogram plots in the lower panel show CD36 mAb (bold line) and isotype control mAb (thin line) profiles for each of the gated subsets. Data are repre- sentative of four experiments. ␣ ␤ ␣ ␤ 6060 DC CROSS-PRESENTATION IN THE ABSENCE OF CD36 OR v 3 AND v 5

FIGURE 2. CD8␣ϩ DC cross-present cell-associ- ated OVA Ag in vitro. Sorted DC subsets (C57BL/6) were cocultured either with irradiated, OVA-loaded al- logeneic (BALB/c) splenocytes (OVA-cells) or with mock-treated control splenocytes (mock-cells) in the presence or the absence of OT-1 T cells, as indicated. A, Cell proliferation was assessed by measuring [3H]thymidine uptake. B, IL-2 in culture supernatants was determined by ELISA. Data are the mean of trip- licate cultures from one of three experiments with sim- ilar results. All error bars are shown and represent 1 SD from the mean.

CD36Ϫ/Ϫ and WT CD8␣ϩ DC (Fig. 3A). To ensure that any pu- cells, as before (Fig. 3C). Interestingly, this was not altered by the ϩ/ϩ Ϫ/Ϫ Ϫ/Ϫ ϩ/ϩ tative differences between CD36 and CD36 DC were in- absence of CD36, as CD36 cells were comparable to CD36 Downloaded from trinsic to the cells rather than the environment in which they de- control CD8␣ϩ DC in their ability to cross-present OVA-cells veloped, bone marrow chimeric mice were constructed so as to (Fig. 3C). Titration experiments using wild-type DC demonstrated contain both cell types (see Materials and Methods). CD36Ϫ/Ϫ and that the in vitro cross-presentation assay was not saturated by the CD36ϩ/ϩ DC in the spleens of chimeric mice were identified by number of APC added to the wells; even a 5-fold decrease in the expression of the CD45.1 allelic marker in the latter, but not CD8␣ϩ DC was sufficient to completely abrogate OT-I prolifera- Ϫ ␣ϩ ␣Ϫ the former, cell type (Fig. 3B). CD45.1 CD8 and CD8 DC tion in response to OVA cells, but not to OVA peptide (data not http://www.jimmunol.org/ were present in the expected ratio, demonstrating that CD36 defi- shown). Thus, the stimulation of OT-I cells by CD36Ϫ/Ϫ CD45.2ϩ ciency does not affect CD8␣ϩ DC development (Fig. 3B). The two DC could not be accounted for by the small fraction (Ͻ1%) of types of CD8␣ϩ DC as well as control CD36ϩ/ϩ CD8␣Ϫ DC were CD36ϩ/ϩ CD45.1ϩ contaminants in the sorted fraction. We con- then purified by cell sorting, verified for the expected CD36 ex- clude that CD36 is not essential for cross-presentation by CD8␣ϩ pression pattern (Fig. 3B), and used as APC for OT-I in vitro. The DC in vitro. ability of CD36Ϫ/Ϫ CD8␣ϩ DC to stimulate OT-I T cells was comparable to that of all other CD36-sufficient DC subsets, as all CD36 expression by APC is not necessary for cross-presentation APC populations induced similar levels of OT-I proliferation in in vivo response to a subsaturating dose of preprocessed OVA peptide Primary DC isolated from lymphoid tissues undergo a process of by guest on September 25, 2021 (Fig. 3C). When assessed for the ability to cross-present cell-as- spontaneous maturation in vitro that results in a marked alteration sociated OVA, CD8␣ϩ DC were markedly superior to CD8␣Ϫ in phenotype and functional properties (36). To confirm that the

FIGURE 3. CD36 is not required for cross-presentation by CD8␣ϩ DC in vitro. A, CD36 expression on CD8␣ϩ DC from WT vs CD36Ϫ/Ϫ mice. Thick lines represent staining with an anti-CD36 Ab, whereas thin lines represent staining with an isotype- matched control. B, Flow cytometric analy- sis of CD36ϩ/ϩ and CD36Ϫ/Ϫ DC before and after cell sorting. MACS-enriched DC were stained with anti-CD45.1, anti-CD11c, anti-CD36, and anti-CD8␣. The dot plot, left, shows the preparations before sorting gated on CD11cbright cells. CD8␣ϩ and CD8␣Ϫ DC subsets of recipient (CD45.1ϩ) and donor (CD45.1Ϫ) origin are apparent. CD45.1ϩ and CD45.1Ϫ CD8␣ϩ sorted DC subsets are shown in the middle panel, and their relative CD36 expression is indicated on the right. C, Sorted DC were tested for cross-presentation of OVA cells in vitro. The indicated DC types were cocultured with OT-I T cells and OVA cells (left)or25 pM OVA peptide (right). Results represent the mean [3H]thymidine uptake of triplicate wells. All error bars are shown and represent 1 SD from the mean. No OT-I proliferation to peptide was seen in the absence of added DC (not shown). Data are from one of three experiments with similar results. The Journal of Immunology 6061 lack of CD36 dependence was not an artifact of the in vitro assay, trols reconstituted with WT bone marrow (Fig. 4B). We conclude we set up a test for cross-presentation in vivo. OT-I cells labeled that CD36 is not required for cross-presentation in vivo. with the cell division marker CFSE were transferred adoptively ␣ϩ into unirradiated C57BL/6 mice, which were then immunized with CD36 is not required for cellular uptake by CD8 DC OVA cells. OT-I cells were identified in the spleens of the recip- The failure to identify a role for CD36 in cross-presentation sug- ients 3 days after immunization by double staining with OVA/Kb gested that it might not be required for cell uptake by murine tetramers and anti-CD8 (Fig. 4A, arrows). These cells were ana- CD8␣ϩ DC. Therefore, we prepared mock-loaded irradiated allo- lyzed for CFSE content. As shown in Fig. 4B, control mice im- geneic splenocytes as described for the cross-presentation experi- munized with PBS or with mock cells contained only CFSEbright ments, labeled them with a fluorescent membrane dye (PKH26), OT-I cells that had not divided. In contrast, multiple peaks of and incubated them with anti-CD11c prelabeled DC to examine CFSElow OT-I cells were obvious in mice receiving OVA cells or the extent of association of the inoculum and the APC. As shown OVA peptide, the latter was used as a positive control (Fig. 4B). As in Fig. 5A (upper panels), CD11cϩ DC were clearly associated expected, those mice containing CFSElow cells also showed an with the labeled inoculum after 4 h coculture. A large fraction of increase in the frequency of OT-I cell in the spleen (Fig. 4A). Thus, the labeled material appeared to have been internalized by the cells this assay accurately reflects cross-presentation of cell-associated as determined by microscopic analysis (not shown). There were OVA to OT-I in vivo. also many CD11c-labeled cells, corresponding to free cells in the To determine whether the absence of CD36 on APC affected inoculum or cells taken up by non-DC (Fig. 5A, upper panels). To cross-presentation in this model, OT-I cells were transferred into determine the contribution of CD36 in this assay, DC fractions chimeric mice made by lethal irradiation and reconstitution with were prepared from the spleens of chimeras made by sublethal Downloaded from CD36Ϫ/Ϫ bone marrow (see Materials and Methods). Essentially irradiation, in which both CD36ϩ/ϩ (CD45.1Ϫ) and CD36Ϫ/Ϫ all APC (Ͼ 95% of splenic DC) in these mice were derived from (CD45.1ϩ) cells were clearly distinguishable from one another us- donor bone marrow and were CD36Ϫ/Ϫ (data not shown). Follow- ing the CD45.1 allelic marker (Fig. 5A, lower panels). These DC ing immunization with OVA cells, OT-I cell proliferation was were labeled with anti-CD45.1 and anti-CD8␣ and were mixed identical in mice reconstituted with CD36Ϫ/Ϫ marrow and in con- with labeled cells. When the DC were analyzed on the basis of http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. Cross-presentation of cell-associated OVA in vivo is not affected by the absence of CD36 on APC. A and B, CFSE-labeled OT-1 T cells were adoptively transferred into C57BL/6 mice, which were challenged the following day with Ag or control treatments as indicated. Splenocytes were isolated from mice on day 3 postchallenge, stained with anti-CD8 and H-2Kb/SIINFEKL tetramer, and analyzed by flow cytometry. A, Mixed contour/dot plots showing tetramerϩ/CD8ϩ cells (arrows) representing adoptively transferred OT-1 T cells. Note the difference in expansion of OT-1 T cells. B, Histograms showing CFSE profiles of gated tetramerϩ/CD8ϩ cells. C, Labeled OT-I T cells were transferred as described above into CD45.1 congenic B6.SJL mice fully reconstituted with either CD36ϩ/ϩ or CD36Ϫ/Ϫ bone marrow, which were then challenged with OVA cells. Histograms show CFSE profiles of tetramerϩ/CD8ϩ splenocytes from two individual mice per group. Data are from one of two experiments with similar results. ␣ ␤ ␣ ␤ 6062 DC CROSS-PRESENTATION IN THE ABSENCE OF CD36 OR v 3 AND v 5 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 5. Cell uptake is normal in CD36-deficient CD8␣ϩ DC. A, Flow cytometric analysis of cultures containing prestained, CD11c-MACS-enriched cells and PKH26-labeled or unlabeled allogeneic splenocytes as indicated. FACS plots represent total live (TOPROϪ) cells (contour plots, upper panel) or gated live CD8␣ϩ cells (dot plots, lower panel). In the latter cultures the percentage of PKH26ϩ cells within CD45.1 subsets was determined by setting quadrant gates. Data are representative of five experiments with DC from C57BL/6 mice (upper panel) or three experiments with DC from CD45.1/CD45.2 mixed bone marrow chimeric mice (lower panel). B, Frequencies of PKH26ϩCD8␣ϩ DC for WT and CD36Ϫ/Ϫ cells. Data are the mean of three independent experiments Ϯ SD.

CD8␣ expression, a remarkable 75% of CD8␣ϩ DC were associ- did not appear to be required for mouse CD8␣ϩ DC to bind and ␤ ␤ ated with labeled allogeneic cells in multiple experiments (Fig. internalize cellular material, we asked whether the 3 and 5 in- 5B). However, this proportion was unchanged between CD36Ϫ/Ϫ tegrins played any role in cross-presentation in the mouse system. ϩ/ϩ ␣ and CD36 cells (Fig. 5B) demonstrating that CD36 is not re- Despite the fact that v expression on splenic DC is low to unde- ␤ Ϫ␤ Ϫ quired for cellular uptake in this model. tectable (data not shown), DC were purified from 3 5 doubly deficient mice or from WT littermate controls and assayed for the ␣ ␤ ␣ ␤ v 3 and v 5 integrins are not essential for cross-presentation ϩ ability to cross-present OVA cells to OT-I T cells in vitro. As ␣ ϩ ϩ by CD8 DC shown in Fig. 6, both CD8␣ and CD4 DC types presented OVA ␣ ␤ ␣ ␤ ␣ ␤ ␣ ␤ v 3 and v 5 integrins in association with CD36 appear to be peptide equally well to OT-I independently of v 3 and v 5.As required for cellular uptake by human DC and are thought to be before, CD8␣ϩ DC and not CD4ϩ DC were the main DC subtype involved in cross-presentation by those cells (22, 23). Since CD36 responsible for OT-I activation after pulsing with cell-associated The Journal of Immunology 6063

finding that apoptotic monocytes can donate Ags for cross-presen- tation by DC in vitro and that cross-presentation in vivo increases after CTL-mediated apoptotic killing of Ag-bearing cells (22, 41). CD36 is prominent among the receptors involved in apoptotic cells uptake by phagocytes (35). CD36 recognizes thrombospondin, a soluble molecule that binds to an unknown ligand exposed on the surface of apoptotic cells and bridges the latter to the phagocyte ␣ ␤ (42). v 3 is thought to associate with CD36 to mediate the inter- nalization of apoptotic cells by macrophages and monocytes (42, ␣ ␤ 43). CD36 can also cooperate with v 5 in apoptotic cell inter- ␣ ␤ nalization, and this integrin, rather than v 3, may be the primary ␤ ␤ ␣ ␤ FIGURE 6. 3 and 5 integrins are not required for cross-presentation CD36 partner in human DC (22), although v 3 may be required ϩ ϩ ϩ by CD8␣ DC in vitro. Sorted CD8␣ and CD4 DC subsets from either for DC phagocytosis of late apoptotic bodies (23). Abs against ␤ Ϫ␤ Ϫ f Ⅺ 3 5 doubly deficient mice ( ) or WT littermate controls ( ) mice ␣ ␤ either CD36 or v 3 are sufficient to partially block apoptotic cell were cultured in the presence of APC-depleted OT-1 T cells and either phagocytosis by human M␾ (42Ð44), whereas anti-CD36 and anti- OVA cells (left) or OVA peptide (200 pM; right). Results represent ␣ ␤ , but not anti-␣ ␤ ,issufficient to partially block apoptotic [3H]thymidine uptake on day 3 of culture. Data are the mean of triplicate v 5 v 3 wells. All error bars are shown and represent 1 SD from the mean. Similar cell uptake by human DC (22). Similarly, apoptotic cell clearance is impaired in Drosophila croquemort mutants lacking CD36 (45).

data were obtained in a separate experiment comparing total DC from WT Downloaded from ␤ Ϫ␤ Ϫ ␤ ␤ and 3 5 doubly deficient mice. These studies demonstrate that CD36 and 3/ 5 integrins play an essential and nonredundant role in efficient apoptotic cell uptake across several species. The selective expression of CD36 by ␣ϩ ␤ Ϫ␤ Ϫ CD8 DC led us, therefore, to ask whether CD36 was respon- OVA. This cross-presentation was not altered when 3 5 dou- ␣ ␤ ␣ ␤ sible for the cross-presenting potency of that DC subset. However, bly deficient DC were used. We conclude that v 3 and v 5 are ␣ ␤ ␣ ␤ ϩ our results clearly indicate that CD36 and, likewise, v 3 and v 5 not essential for cross-presentation by CD8␣ DC. http://www.jimmunol.org/ are not essential for cross-presentation by DC in vitro and that CD36Ϫ/Ϫ APC are competent to carry out cross-presentation in Discussion vivo. These results suggest that CD36 or ␣ ␤ and ␣ ␤ play only Cross-presentation has been proposed to be critical for inducing v 3 v 5 a minor role in cross-presentation by mouse DC. Other receptors immunity to pathogens that do not infect APC as well as for main- for apoptotic cell uptake have been described, including the phos- taining tolerance to tissue Ags (4, 6). DC have been identified as phatidylserine (PS) receptor, class A scavenger receptor and CD14 the major cross-presenting APC in both human and mouse, and (46Ð48). It is possible that these are more critical than CD36 or cross-presentation by human DC has been reported to depend on ␤ ␤ ␣ ␤ ␣ ␤ 3/ 5 integrins for apoptotic cell uptake by murine DC. This uptake of apoptotic material via CD36, v 3, and/or v 5 (22, 23). would be consistent with the fact that the prevalent receptor used by guest on September 25, 2021 Here, using an in vitro cross-presentation assay, we confirm the for ingestion of apoptotic cells can vary from one cell type to observation first made in vivo by Den Haan and Bevan (20) that ϩ another or even change upon cell activation. For example, apopto- CD8␣ DC are the primary APC involved in the cross-presenta- ϩ tic cell phagocytosis by unstimulated human monocyte-derived tion of cell-associated Ags in mice. We show that CD8␣ DC M␾ depends primarily on the ␣ ␤ /CD36 mechanism, whereas selectively express CD36, but that CD36 is not necessary for cross- v 3 presentation of cell-associated Ag in vitro or in vivo or for uptake after glucan stimulation of the same cells the process becomes ␣ ␤ dependent on PS receptor/CD36 (49). Even blocking CD36 and of cell-based Ag in vitro. We further demonstrate that v 3 and ϩ ␣ ␤ ␣ ␤ ␣ v 5 together does not completely abrogate apoptotic cell uptake v 5 are also dispensable for cross-presentation by CD8 DC. Our data suggest that mouse DC use receptors for cell uptake and by human DC, again suggesting the involvement of additional re- cross-presentation that differ from those used by human DC or that ceptors (22). Further characterization of apoptotic cell receptors on mouse DC use a redundant set of receptors such that elimination of mouse DC will be necessary to address these questions. Neverthe- ␤ ␤ ␤ ␤ less, our data do not completely exclude a role for CD36 and 3/ 5 CD36 or both 3 and 5 integrins does not prevent function. Sim- ilar results have been obtained by Belz et al. (61), who also find integrins in cross-presentation. It is conceivable that these recep- CD36-independent cross-presentation in both cross-priming and tors operate with an unexpected degree of redundancy in mouse cross-tolerance models. DC such that an effect will be apparent only if all three have been Despite much speculation about their function, little is known eliminated. Experiments to address this question are in progress, about the molecular characteristics of murine DC subsets. Quan- but have been hampered by the lack of blocking Abs in the mouse titative differences in CD11b, CD24a, and F4/80 expression levels system. It also remains to be confirmed whether the lack of CD36 ϩ ␣ ␤ ␣ ␤ all can be used to discriminate between resting CD8␣ and or v 3/ v 5 dependence seen here for cross-presentation of in- CD8␣Ϫ DC. However, relatively few subset-restricted markers jected cells would apply in more physiological circumstances such have been described other than DEC-205 in CD8␣ϩ DC (37, 38). as, for example, after certain viral infections (50). Here, we suggest that CD36 can be used as an additional marker One clear difference between our experiments and others cited to discriminate among DC subsets. Indeed, we found that CD36 is above is that we used a live spleen cell-based inoculum that was expressed on the cell surface by virtually all CD8␣ϩ DC, but not not deliberately made apoptotic. This form of Ag has traditionally by most CD8␣Ϫ DC, although we cannot entirely exclude that it been used for induction of cross-priming in vivo (2, 32). Ex vivo may be expressed in a small number of DN DC (Fig. 1). Interest- culture and irradiation inevitably render some cells in the inoculum ingly, CD36 expression has not been previously described in mu- apoptotic (O. Schulz and C. Reis e Sousa, unpublished observa- rine DC, although it has been found in human monocyte-derived tions), and it may be that only those cells act as the source of Ag DC (22, 39) and in human dermal DC (40). by becoming targets for DC phagocytosis. Experiments are under The idea that cross-presentation by DC is linked to the uptake of way to determine whether DC cross-presentation of a homoge- apoptotic cells is an appealing hypothesis that is supported by the neous inoculum of apoptotic cells is also independent of CD36 and ␣ ␤ ␣ ␤ 6064 DC CROSS-PRESENTATION IN THE ABSENCE OF CD36 OR v 3 AND v 5

␤ ␤ 3/ 5 integrins. Nevertheless, it remains possible that cross-pre- 13. Norbury, C. C., L. J. Hewlett, A. R. Prescott, N. Shastri, and C. Watts. 1995. sentation need not necessarily involve apoptotic cell uptake. Al- Class I MHC presentation of exogenous soluble antigen via macropinocytosis in bone marrow macrophages. Immunity 3:783. though it can decrease human DC uptake of apoptotic cells by up 14. Norbury, C. C., B. J. Chambers, A. R. Prescott, H. G. Ljunggren, and C. Watts. ␣ ␤ 1997. Constitutive macropinocytosis allows TAP-dependent major histocompat- to 60% (22), the effect of CD36 and v 5 blockade on cross- ibility complex class I presentation of exogenous soluble antigen by bone mar- presentation has not been reported. Uptake of necrotic cells can row-derived dendritic cells. Eur. J. Immunol. 27:280. lead to cross-presentation in some systems (51, 52), and these ne- 15. Regnault, A., D. Lankar, V. Lacabanne, A. Rodriguez, C. Thery, M. Rescigno, crotic cells could be ingested via receptors other than those typi- T. Saito, S. Verbeek, C. Bonnerot, P. Ricciardi-Castagnoli, et al. 1999. Fc␥ re- ceptor-mediated induction of dendritic cell maturation and major histocompati- cally associated with phagocytosis of apoptotic cells. Furthermore, bility complex class I-restricted antigen presentation after immune complex in- cell uptake may even be dispensable for cross-presentation. Solu- ternalization. J. Exp. Med. 189:371. ble heat shock proteins can be released by necrotic cells (53, 54) 16. Rodriguez, A., A. Regnault, M. Kleijmeer, P. Ricciardi-Castagnoli, and S. Amigorena. 1999. Selective transport of internalized antigens to the cytosol for and carry donor Ags for MHC class I presentation by APC (55). MHC class I presentation in dendritic cells. Nat. Cell Biol. 1:362. One of the APC receptors involved in heat shock protein cross- 17. Albert, M. L., B. Sauter, and N. Bhardwaj. 1998. Dendritic cells acquire antigen presentation is CD91 (56), and it remains to be tested whether from apoptotic cells and induce class I-restricted CTLs. Nature 392:86. 18. Inaba, K., S. Turley, F. Yamaide, T. Iyoda, K. Mahnke, M. Inaba, M. Pack, CD91 deficiency decreases cross-presentation of cell-based inoc- M. Subklewe, B. Sauter, D. Sheff, et al. 1998. Efficient presentation of phago- ula, although, interestingly, CD91 can also be involved in the up- cytosed cellular fragments on the major histocompatibility complex class II prod- take of apoptotic cells (57). Exosomes produced by the donor cells ucts of dendritic cells. J. Exp. Med. 188:2163. 19. Kurts, C., M. Cannarile, I. Klebba, and T. Brocker. 2001. Dendritic cells are could also be involved in cross-presentation (58). However, pre- sufficient to cross-present self-antigens to CD8 T cells in vivo. J. Immunol. 166: liminary evidence from Trans-Well experiments suggests that con- 1439. ϩ Ϫ tact between the donor cells and DC is required for cross-presen- 20. den Haan, J. M., S. M. Lehar, and M. J. Bevan. 2000. CD8 but not CD8 Downloaded from dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192:1685. tation, arguing against a role for exosomes or soluble mediators of 21. Pooley, J. L., W. R. Heath, and K. Shortman. 2001. Cutting edge: intravenous cross-presentation in our experiments (O. Schulz and C. Reis e soluble antigen is presented to CD4 T cells by CD8Ϫ dendritic cells, but cross- ϩ Sousa, unpublished observations). presented to CD8 T cells by CD8 dendritic cells. J. Immunol. 166:5327. 22. Albert, M. L., S. F. Pearce, L. M. Francisco, B. Sauter, P. Roy, R. L. Silverstein, If CD36 is not involved in cross-presentation, what other func- and N. Bhardwaj. 1998. Immature dendritic cells phagocytose apoptotic cells via ϩ ␣ ␤ tion might it have on CD8␣ DC? Interestingly, cross-linking of v 5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359. CD36 or ␣ has been shown to dominantly suppress human DC http://www.jimmunol.org/ v 23. Rubartelli, A., A. Poggi, and M. R. Zocchi. 1997. The selective engulfment of ␣ ␤ activation by LPS and CD40 ligand (39). These receptors may also apoptotic bodies by dendritic cells is mediated by the v 3 integrin and requires mediate the immunosuppressive effects of apoptotic cells on intracellular and extracellular calcium. Eur. J. Immunol. 27:1893. monocytes and DC (39, 59). Therefore, it is possible that engage- 24. Hogquist, K. A., S. C. Jameson, W. R. Heath, J. L. Howard, M. J. Bevan, and ϩ F. R. Carbone. 1994. T cell receptor antagonist peptides induce positive selection. ment of CD36 on CD8␣ acts to counteract DC activation. This Cell 76:17. could contribute to preventing immune responses to peripheral 25. Reynolds, L. E., L. Wyder, J. C. Lively, D. Taverna, S. D. Robinson, X. Huang, D. Sheppard, R. O. Hynes, and K. M. Hodivala-Dilke. 2002. Enhanced patho- Ags during normal tissue turnover and might be exploited by some ␤ ␤ ␤ logical angiogenesis in mice lacking 3-integrin or 3- and 5-integrins. Nat. pathogens to escape immune responses (60). Med 8:27. 26. Febbraio, M., N. A. Abumrad, D. P. Hajjar, K. Sharma, W. Cheng, S. F. Pearce,

and R. L. Silverstein. 1999. A null mutation in murine CD36 reveals an important by guest on September 25, 2021 Acknowledgments role in fatty acid and lipoprotein metabolism. J. Biol. Chem. 274:19055. We are grateful to the National Institute of Allergy and Infectious Disease 27. Kamath, A. T., J. Pooley, M. A. O’Keeffe, D. Vremec, Y. Zhan, A. M. Lew, A. Tetramer Facility and the National Institutes of Health AIDS Research and D’Amico, L. Wu, D. F. Tough, and K. Shortman. 2000. The development, mat- Reference Reagent Program for supplying H-2Kb/SIINFEKL tetramers. uration, and turnover rate of mouse spleen dendritic cell populations. J. Immunol. 165:6762. We thank Ron Germain and Nancy Hogg for helpful comments on the 28. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, manuscript, and members of the Immunobiology Laboratory for discus- M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, and M. M. Davis. 1996. sions. We thank Bill Heath for communicating results before publication. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94. 29. Schulz, O., A. D. Edwards, M. Schito, J. Aliberti, S. Manickasingham, A. Sher, and C. Reis e Sousa. 2000. CD40 triggering of heterodimeric IL-12 p70 produc- References tion by dendritic cells in vivo requires a microbial priming signal. Immunity 1. Germain, R. N. 1986. Immunology: the ins and outs of antigen processing and 13:453. presentation. Nature 322:687. 30. Finnemann, S. C., and R. L. Silverstein. 2001. Differential roles of CD36 and 2. Bevan, M. J. 1976. Cross-priming for a secondary response to minor H antigens ␣ ␤ v 5 integrin in photoreceptor phagocytosis by the retinal pigment epithelium. with H-2 congenic cells which do not cross-react in the cytotoxic assay. J. Exp. J. Exp. Med. 194:1289. Med. 143:1283. 31. Moore, M. W., F. R. Carbone, and M. J. Bevan. 1988. Introduction of soluble 3. Bevan, M. J. 1976. Minor H antigens introduced on H-2 different stimulating protein into the class I pathway of antigen processing and presentation. Cell cells cross- react at the cytotoxic T cell level during in vivo priming. J. Immunol. 54:777. 117:2233. ϩ 32. Carbone, F. R., and M. J. Bevan. 1990. Class I-restricted processing and presen- 4. den Haan, J. M., and M. J. Bevan. 2001. Antigen presentation to CD8 T cells: tation of exogenous cell-associated antigen in vivo. J. Exp. Med. 171:377. cross-priming in infectious diseases. Curr. Opin. Immunol. 13:437. 33. Hubank, M., and D. G. Schatz. 1994. Identifying differences in mRNA expression 5. Heath, W. R., C. Kurts, J. F. Miller, and F. R. Carbone. 1998. Cross-tolerance: a by representational difference analysis of cDNA. Nucleic Acids Res. 22:5640. pathway for inducing tolerance to peripheral tissue antigens. J. Exp. Med. 187: ϩ Ϫ 1549. 34. Ruedl, C., and M. F. Bachmann. 1999. CTL priming by CD8 and CD8 den- 6. Heath, W. R., and F. R. Carbone. 2001. Cross-presentation, dendritic cells, tol- dritic cells in vivo. Eur. J. Immunol. 29:3762. erance and immunity. Annu. Rev. Immunol. 19:47. 35. Savill, J., and V. Fadok. 2000. Corpse clearance defines the meaning of cell 7. Bevan, M. J. 1987. Class discrimination in the world of immunology. Nature death. Nature 407:784. 325:192. 36. De Smedt, T., E. Butz, J. Smith, R. Maldonado-Lopez, B. Pajak, M. Moser, and ␣Ϫ ␣ϩ 8. Barnaba, V., A. Franco, A. Alberti, R. Benvenuto, and F. Balsano. 1990. Selec- C. Maliszewski. 2001. CD8 and CD8 subclasses of dendritic cells undergo tive killing of hepatitis B envelope antigen-specific B cells by class I-restricted, phenotypic and functional maturation in vitro and in vivo. J. Leukocyte Biol. exogenous antigen-specific T lymphocytes. Nature 345:258. 69:951. 9. Rock, K. L., S. Gamble, and L. Rothstein. 1990. Presentation of exogenous an- 37. Vremec, D., and K. Shortman. 1997. Dendritic cell subtypes in mouse lymphoid tigen with class I major histocompatibility complex molecules. Science 249:918. organs: cross-correlation of surface markers, changes with incubation, and dif- 10. Kovacsovics-Bankowski, M., K. Clark, B. Benacerraf, and K. L. Rock. 1993. ferences among thymus, spleen, and lymph nodes. J. Immunol. 159:565. Efficient major histocompatibility complex class I presentation of exogenous an- 38. Vremec, D., J. Pooley, H. Hochrein, L. Wu, and K. Shortman. 2000. CD4 and tigen upon phagocytosis by macrophages. Proc. Natl. Acad. Sci. USA 90:4942. CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J. Im- 11. Pfeifer, J. D., M. J. Wick, R. L. Roberts, K. Findlay, S. J. Normark, and munol. 164:2978. C. V. Harding. 1993. Phagocytic processing of bacterial antigens for class I MHC 39. Urban, B. C., N. Willcox, and D. J. Roberts. 2001. A role for CD36 in the presentation to T cells. Nature 361:359. regulation of dendritic cell function. Proc. Natl. Acad. Sci. USA 98:8750. 12. Reis e Sousa, C., and R. N. Germain. 1995. Major histocompatibility complex 40. Lenz, A., M. Heine, G. Schuler, and N. Romani. 1993. Human and murine dermis class I presentation of peptides derived from soluble exogenous antigen by a contain dendritic cells: isolation by means of a novel method and phenotypical subset of cells engaged in phagocytosis. J. Exp. Med. 182:841. and functional characterization. J. Clin. Invest. 92:2587. The Journal of Immunology 6065

41. Kurts, C., J. F. Miller, R. M. Subramaniam, F. R. Carbone, and W. R. Heath. 52. Subklewe, M., C. Paludan, M. L. Tsang, K. Mahnke, R. M. Steinman, and 1998. Major histocompatibility complex class I-restricted cross-presentation is C. Munz. 2001. Dendritic cells cross-present latency gene products from Epstein- biased towards high dose antigens and those released during cellular destruction. Barr virus-transformed B cells and expand tumor-reactive CD8ϩ killer T cells. J. Exp. Med. 188:409. J. Exp. Med. 193:405. 42. Savill, J., N. Hogg, Y. Ren, and C. Haslett. 1992. Thrombospondin cooperates 53. Basu, S., R. J. Binder, R. Suto, K. M. Anderson, and P. K. Srivastava. 2000. with CD36 and the vitronectin receptor in macrophage recognition of Necrotic but not apoptotic cell death releases heat shock proteins, which deliver undergoing apoptosis. J. Clin. Invest. 90:1513. a partial maturation signal to dendritic cells and activate the NF-␬B pathway. Int. 43. Savill, J., I. Dransfield, N. Hogg, and C. Haslett. 1990. Vitronectin receptor- Immunol. 12:1539. mediated phagocytosis of cells undergoing apoptosis. Nature 343:170. 54. Somersan, S., M. Larsson, J. F. Fonteneau, S. Basu, P. Srivastava, and 44. Fadok, V. A., J. S. Savill, C. Haslett, D. L. Bratton, D. E. Doherty, N. Bhardwaj. 2001. Primary tumor tissue lysates are enriched in heat shock pro- P. A. Campbell, and P. M. Henson. 1992. Different populations of macrophages teins and induce the maturation of human dendritic cells. J. Immunol. 167:4844. use either the vitronectin receptor or the phosphatidylserine receptor to recognize 55. Srivastava, P. K., A. Menoret, S. Basu, R. J. Binder, and K. L. McQuade. 1998. and remove apoptotic cells. J. Immunol. 149:4029. Heat shock proteins come of age: primitive functions acquire new roles in an 45. Franc, N. C., P. Heitzler, R. A. Ezekowitz, and K. White. 1999. Requirement for adaptive world. Immunity 8:657. croquemort in phagocytosis of apoptotic cells in Drosophila. Science 284:1991. 56. Basu, S., R. J. Binder, T. Ramalingam, and P. K. Srivastava. 2001. CD91 is a 46. Fadok, V. A., D. L. Bratton, D. M. Rose, A. Pearson, R. A. Ezekewitz, and common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. P. M. Henson. 2000. A receptor for phosphatidylserine-specific clearance of ap- Immunity 14:303. optotic cells. Nature 405:85. 57. Ogden, C. A., A. deCathelineau, P. R. Hoffmann, D. Bratton, B. Ghebrehiwet, 47. Platt, N., H. Suzuki, Y. Kurihara, T. Kodama, and S. Gordon. 1996. Role for the V. A. Fadok, and P. M. Henson. 2001. C1q and mannose binding lectin engage- class A macrophage scavenger receptor in the phagocytosis of apoptotic thymo- ment of cell surface calreticulin and CD91 initiates macropinocytosis and uptake cytes in vitro. Proc. Natl. Acad. Sci. USA 93:12456. of apoptotic cells. J. Exp. Med. 194:781. 48. Devitt, A., O. D. Moffatt, C. Raykundalia, J. D. Capra, D. L. Simmons, and 58. Wolfers, J., A. Lozier, G. Raposo, A. Regnault, C. Thery, C. Masurier, C. D. Gregory. 1998. Human CD14 mediates recognition and phagocytosis of C. Flament, S. Pouzieux, F. Faure, T. Tursz, et al. 2001. Tumor-derived exosomes apoptotic cells. Nature 392:505. are a source of shared tumor rejection antigens for CTL cross-priming. Nat. Med. 49. Fadok, V. A., M. L. Warner, D. L. Bratton, and P. M. Henson. 1998. CD36 is 7:297. required for phagocytosis of apoptotic cells by human macrophages that use 59. Voll, R. E., M. Herrmann, E. A. Roth, C. Stach, J. R. Kalden, and I. Girkontaite. Downloaded from ␣ ␤ either a phosphatidylserine receptor or the vitronectin receptor ( v 3). J. Immu- 1997. Immunosuppressive effects of apoptotic cells. Nature 390:350. nol. 161:6250. 60. Urban, B. C., D. J. Ferguson, A. Pain, N. Willcox, M. Plebanski, J. M. Austyn, 50. Sigal, L. J., S. Crotty, R. Andino, and K. L. Rock. 1999. Cytotoxic T-cell im- and D. J. Roberts. 1999. -infected erythrocytes modulate munity to virus-infected non-haematopoietic cells requires presentation of exog- the maturation of dendritic cells. Nature 400:73. enous antigen. Nature 398:77. 61. Belz, G. T., D. Vremec, M. Febbraio, L. Corcoran, K. Shortman, F. R. Carbone, 51. Kotera, Y., K. Shimizu, and J. J. Mule. 2001. Comparative analysis of necrotic and W. R. Heath. 2002. CD36 is differentially expressed by CD8ϩ splenic den- and apoptotic tumor cells as a source of antigen(s) in dendritic cell-based immu- dritic cells but is not required for cross-presentation in vivo. J. Immunol. 168:

nization. Cancer Res. 61:8105. 6066. http://www.jimmunol.org/ by guest on September 25, 2021