DOCSLIB.ORG

Core Promoter Recognition Complex Changes Accompany Liver Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Core Promoter Recognition Complex Changes Accompany Liver Development Core promoter recognition complex changes accompany liver development Joseph A. D’Alessioa,b,c,1, Raymond Ngd, Holger Willenbringd,e, and Robert Tjianb,c,f,2 aJanelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, VA 20147; bDepartment of Molecular and Cell Biology, and cHoward Hughes Medical Institute, University of California, Berkeley, CA 94720; dEli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research, University of California, San Francisco, CA 94143; eDepartment of Surgery, Division of Transplantation, University of California, San Francisco, CA 94143; and fLi Ka Shing Center for Biomedical and Health Sciences, University of California, Berkeley, CA 94720 Contributed by Robert Tjian, January 19, 2011 (sent for review October 28, 2010) Recent studies of several key developmental transitions have muscle differentiation can proceed normally in the near absence brought into question the long held view of the basal transcrip- of intact TFIID provided an additional clue that core promoter tional apparatus as ubiquitous and invariant. In an effort to better complex switching may be more widespread than initially appre- understand the role of core promoter recognition and coactivator ciated (9, 10). In myotubes, an alternative core component, TAF3, complex switching in cellular differentiation, we have examined is retained and required for myogenic differentiation. An addi- changes in transcription factor IID (TFIID) and cofactor required tional recent example of the relative dispensability of TFIID for Sp1 activation/Mediator during mouse liver development. Here was the finding that inactivation of TAF10 has little or no affect we show that the differentiation of fetal liver progenitors to adult on adult hepatic gene expression (11). Thus, the notion of switch- hepatocytes involves a wholesale depletion of canonical cofactor ing or “remodeling” of the core promoter machinery may be more required for Sp1 activation/Mediator and TFIID complexes at both widespread than initially appreciated. the RNA and protein level, and that this alteration likely involves Almost simultaneously with the discovery of “atypical” TAFs silencing of transcription factor promoters as well as protein such as TAF4b, TBP-related factors (TRFs) or TBP-like proteins degradation. It will be intriguing for future studies to determine (TBPLs) were identified, further expanding potential core pro- if a novel and as yet unknown core promoter recognition complex moter recognition complex diversity. The first of these subunits, takes the place of TFIID in adult hepatocytes and to uncover TRF1, is restricted to Drosophila where it was shown to direct the mechanisms that down-regulate TFIID during this critical transcription by RNA polymerase III (12). The evolutionarily developmental transition. conserved TRF2 has been primarily examined during spermato- genesis, although its expression appears to be widespread TATA box-binding protein-associated factor ∣ hepatoblast ∣ hepatogenesis (13–15). Most recently, the vertebrate-specific TRF3 has been examined in oogenesis, hematopoiesis, and myogenesis. The ear- he precise and orderly differentiation of embryonic progeni- liest reports suggested that TRF3 may be widely expressed, albeit Ttors to committed adult cell types requires exquisite spatial at a low level, but significantly enriched in the developing oocyte and temporal control of gene expression. Until recently, the (16, 17). More detailed and simultaneous studies found that a dynamic changes in transcriptional output that accompany devel- unique TAF3-TRF3 complex may in some instances largely opmental transitions were assumed to depend exclusively on replace canonical TFIID in the regulation of hematopoietic and regulatory DNA and its associated sequence-specific activators myogenic genes, and that this change in core promoter recogni- and repressors, whereas core promoter recognition, coactivator, tion complexes was essential for both the myogenic transition in and chromatin modifier complexes were generally taken to be mice and hematopoietic differentiation in zebrafish and mouse ubiquitous and invariant from one cell type to the next. Indeed, cells (10, 18, 19). Importantly, the extensive down-regulation these so-called core factors are highly conserved from yeast to of canonical TFIID that accompanies myogenic development man (1). However, recent evidence suggests that several key de- is accompanied by the finding of a wholesale depletion of the velopmental transitions are accompanied by, and actually require, CRSP/Med coactivator complex (9). Most recently, ablation of dramatic changes in components of this general machinery includ- the TRF3 locus has revealed its essential role in germ cell devel- ing transcription factor IID (TFIID) composed of the TATA opment and the transcription of oogenic genes (20). As develop- box-binding protein (TBP) and its associated factors (TAFs), mental changes in the core promoter recognition machinery the cofactor required for Sp1 activation/Mediator (CRSP/Med) continue to be uncovered, yet other studies have revealed the complex, and the Brg1/Brm-associated factor (BAF) complex developmental dynamics of the chromatin remodeling machinery (for review, see 2). (for review, see ref. 21). The first evidence that some cell types may contain alterations Collectively these recent examples suggest that the long held “ ” of the general machinery came with the identification of germ- view of TFIID, BAF, and CRSP/Med complexes as general cell-specific TFIID subcomplexes in which key subunits are transcription factors that function at a majority of promoters replaced by paralogous components. Initially oogenesis and sper- in every cell type needs to be reconsidered. Historically these fac- matogenesis were found to require an altered TFIID in which tors have been studied in transformed or highly proliferative cell paralogous TAF4b replaces the canonical TAF4 (3, 4). Later types such as HeLa, and recent advancements in the purification spermatocytes were found to also express paralogous TAF7L that of more relevant primary cells have improved our ability to study may cooperate with TBP and TAF1 in the regulation of sperma- the dynamics of such factors in a physiologically and developmen- togenesis genes (5, 6). Although unique paralogs of other cano- nical TAFs have been identified, their tissue-specific expression Author contributions: J.A.D., H.W., and R.T. designed research; J.A.D. and R.N. performed and functional significance remain to be elucidated (7). The find- research; J.A.D. contributed new reagents/analytic tools; J.A.D., H.W., and R.T. analyzed ing that TAF8 is significantly up-regulated and may be required data; J.A.D. and R.T. wrote the paper. during adipogenesis is one of the few examples to date of a The authors declare no conflict of interest. canonical TAF that is normally associated with TFIID but Freely available online through the PNAS open access option. which may also have an independent developmental function (8). 1Present address: Igenica, Inc., Burlingame, CA 94010. The striking finding that some developmental programs such as 2To whom correspondence should be addressed. E-mail: [email protected]. 3906–3911 ∣ PNAS ∣ March 8, 2011 ∣ vol. 108 ∣ no. 10 www.pnas.org/cgi/doi/10.1073/pnas.1100640108 tally relevant context. To further broaden our understanding of of the cells in the fetal liver, whereas hepatocytes make up how core machinery switching contributes to developmental tran- approximately 60% of the adult liver mass. Toinvestigate whether sitions and to establish the role of TFIID and CRSP/Med changes differences in the core machinery existed between the distinct during the development of multiple cell types, we have examined stages of hepatogenesis represented by these two cell popula- the expression of TFIID and CRSP/Med subunits in additional tions, we established a protocol for the purification of hepato- primary cells and their associated developmental programs. Pre- blasts from E13.5 mouse embryos based on enzymatic digestion vious reports suggested that the adult mammalian liver might of individually dissected fetal livers followed by magnetic- contain unusually low levels of both TBP and TAF4, critical com- bead-based depletion of TER119+ erythrocytes and CD45+ leu- ponents of canonical TFIID (3, 17). Here we report dramatic kocytes. Both fluorescence-activated cell sorting and immuno- changes in the cellular levels of both TFIID and CRSP/Med fluorescence staining of CD45, TER119, E-Cadherin, and DLK1 during mouse liver development. showed these preparations to contain greater than 90% pure hepatoblasts, consistent with previous results (23). Adult hepato- Results and Discussion cytes from 8 to 10-wk-old mice were purified using established in Differential Expression of TFIID in Hepatoblasts and Hepatocytes. As a situ collagenase perfusion protocols (24). first step toward identifying additional developmental programs We compared the levels of TBP, multiple TAFs, and other gen- that may involve down-regulation of TFIID, we generated whole eral transcription factors in these highly purified hepatoblasts to cell extracts from adult mouse tissues and compared the TBP, those in hepatocytes by immunoblot (Fig. 1 A and B). Strikingly, TAF1, and TAF4 levels to those in myoblasts by immunoblotting. protein levels of TBP and every TAF subunit examined are Consistent with previous results, we find that the adult liver con- dramatically lower in adult hepatocytes
Load more

Recommended publications
  • Dynamics of Gene Silencing During X Inactivation Using Allele-Specific RNA-Seq Hendrik Marks1*, Hindrik H
    Marks et al. Genome Biology (2015) 16:149 DOI 10.1186/s13059-015-0698-x RESEARCH Open Access Dynamics of gene silencing during X inactivation using allele-specific RNA-seq Hendrik Marks1*, Hindrik H. D. Kerstens1, Tahsin Stefan Barakat3, Erik Splinter4, René A. M. Dirks1, Guido van Mierlo1, Onkar Joshi1, Shuang-Yin Wang1, Tomas Babak5, Cornelis A. Albers2, Tüzer Kalkan6, Austin Smith6, Alice Jouneau7, Wouter de Laat4, Joost Gribnau3 and Hendrik G. Stunnenberg1* Abstract Background: During early embryonic development, one of the two X chromosomes in mammalian female cells is inactivated to compensate for a potential imbalance in transcript levels with male cells, which contain a single X chromosome. Here, we use mouse female embryonic stem cells (ESCs) with non-random X chromosome inactivation (XCI) and polymorphic X chromosomes to study the dynamics of gene silencing over the inactive X chromosome by high-resolution allele-specific RNA-seq. Results: Induction of XCI by differentiation of female ESCs shows that genes proximal to the X-inactivation center are silenced earlier than distal genes, while lowly expressed genes show faster XCI dynamics than highly expressed genes. The active X chromosome shows a minor but significant increase in gene activity during differentiation, resulting in complete dosage compensation in differentiated cell types. Genes escaping XCI show little or no silencing during early propagation of XCI. Allele-specific RNA-seq of neural progenitor cells generated from the female ESCs identifies three regions distal to the X-inactivation center that escape XCI. These regions, which stably escape during propagation and maintenance of XCI, coincide with topologically associating domains (TADs) as present in the female ESCs.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Characterization of Genomic Copy Number Variation in Mus Musculus Associated with the Germline of Inbred and Wild Mouse Populations, Normal Development, and Cancer
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 4-18-2019 2:00 PM Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer Maja Milojevic The University of Western Ontario Supervisor Hill, Kathleen A. The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Maja Milojevic 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Genetics and Genomics Commons Recommended Citation Milojevic, Maja, "Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer" (2019). Electronic Thesis and Dissertation Repository. 6146. https://ir.lib.uwo.ca/etd/6146 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Mus musculus is a human commensal species and an important model of human development and disease with a need for approaches to determine the contribution of copy number variants (CNVs) to genetic variation in laboratory and wild mice, and arising with normal mouse development and disease. Here, the Mouse Diversity Genotyping array (MDGA)-approach to CNV detection is developed to characterize CNV differences between laboratory and wild mice, between multiple normal tissues of the same mouse, and between primary mammary gland tumours and metastatic lung tissue.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • AVILA-DISSERTATION.Pdf
    LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have.
    [Show full text]
  • Taf7l Cooperates with Trf2 to Regulate Spermiogenesis
    Taf7l cooperates with Trf2 to regulate spermiogenesis Haiying Zhoua,b, Ivan Grubisicb,c, Ke Zhengd,e, Ying Heb, P. Jeremy Wangd, Tommy Kaplanf, and Robert Tjiana,b,1 aHoward Hughes Medical Institute and bDepartment of Molecular and Cell Biology, Li Ka Shing Center for Biomedical and Health Sciences, California Institute for Regenerative Medicine Center of Excellence, University of California, Berkeley, CA 94720; cUniversity of California Berkeley–University of California San Francisco Graduate Program in Bioengineering, University of California, Berkeley, CA 94720; dDepartment of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104; eState Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, People’s Republic of China; and fSchool of Computer Science and Engineering, The Hebrew University of Jerusalem, Jerusalem 91904, Israel Contributed by Robert Tjian, September 11, 2013 (sent for review August 20, 2013) TATA-binding protein (TBP)-associated factor 7l (Taf7l; a paralogue (Taf4b; a homolog of Taf4) (9), TBP-related factor 2 (Trf2) (10, of Taf7) and TBP-related factor 2 (Trf2) are components of the core 11), and Taf7l (12, 13). For example, mice bearing mutant or promoter complex required for gene/tissue-specific transcription deficient CREM showed decreased postmeiotic gene expression of protein-coding genes by RNA polymerase II. Previous studies and defective spermiogenesis (14). Mice deficient in Taf4b, reported that Taf7l knockout (KO) mice exhibit structurally abnor- a testis-specific homolog of Taf4, are initially normal but undergo mal sperm, reduced sperm count, weakened motility, and compro- progressive germ-cell loss and become infertile by 3 mo of age −/Y mised fertility.
    [Show full text]
  • Taenia Solium TAF6 and TAF9 Binds to a Putative Downstream Promoter Element
    bioRxiv preprint doi: https://doi.org/10.1101/106997; this version posted February 8, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Taenia solium TAF6 and TAF9 binds to a putative Downstream Promoter Element present in TsTBP1 gene core promoter. Oscar Rodríguez-Lima1, #a, Ponciano García-Gutierrez2, Lucía Jimenez1, Angel Zarain-Herzberg3, Roberto Lazarini4 and Abraham Landa1*. 1Departamento de Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México. Ciudad de México, México. 2Departamento de Química, Universidad Autónoma Metropolitana–Iztapalapa. Ciudad de México, México. 3Departamento de Bioquímica, Facultad de Medicina, Universidad Nacional Autónoma de México. Ciudad de México, México. 4Departamento de Biología Experimental, Universidad Autónoma Metropolitana– Iztapalapa. Ciudad de México, México. #a Current address: Center for Integrative Genomics, Lausanne University, Lausanne, Switzerland. *Corresponding author: Abraham Landa, Ph.D. Universidad Nacional Autónoma de México. Departamento de Microbiología y Parasitología, Facultad de Medicina Edificio A 2do piso. Ciudad Universitaria. CDMX 04510, México Phone: (52 55) 56-23-23-57, Fax: (52 55) 56-23-23-82, Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/106997; this version posted February 8, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • The Function of TAF10 Proteins in Drosophila Melanogaster
    The function of dTAF10 proteins in Drosophila melanogaster Zoltán Gábor Páhi Ph.D. thesis summary Supervisors: Imre Miklós Boros Ph.D, D.Sc. Head of the Department Tibor Pankotai Ph.D. Assistant Professor Ph.D. School of Biology University of Szeged Faculty of Science and Informatics Department of Biochemistry and Molecular Biology Szeged 2017 1. Introduction As a first step of eukaryotic transcription initiation, the general transcription factor TFIID binds to the promoter region of transcribed genes. TFIID is a multiprotein complex consisting of TBP, which binds to the TATA box region, and several TAF proteins, which associate with TBP. TFIID is evolutionary well- conserved in human and Drosophila cells and it consists of double copies of five TAFs (TAF4, TAF5, TAF6, TAF9 and TAF12), which together create a two-fold symmetric structure. Then TAF8-TAF10 heterodimer joins to this complex and induces conformational changes by abolishing the two-fold symmetry. Further peripheral TAF proteins and TBP bind to the 7 TAF containing TFIID core, forming the functional complex. TAF proteins, however are parts not only the TBP, but the histone acetyl transferase (HAT) SAGA complex, as well. Drosophila dSAGA acetylates histone proteins by transferring acetyl groups from acetyl-coenzyme A to lysine side chains. The HAT enzyme of dSAGA is dGCN5, which on the other hand is also present in another histone acetyltransferase complex as well, that is designated as dATAC in Drosophila. Curiously, while dSAGA and dATAC complexes have very similar HAT modules, in which they share common subunits, such as dGCN5, dSGF29 and dADA3, they regulate different 1 biological processes.
    [Show full text]
  • Molecular Structure of Promoter-Bound Yeast TFIID
    ARTICLE DOI: 10.1038/s41467-018-07096-y OPEN Molecular structure of promoter-bound yeast TFIID Olga Kolesnikova 1,2,3,4, Adam Ben-Shem1,2,3,4, Jie Luo5, Jeff Ranish 5, Patrick Schultz 1,2,3,4 & Gabor Papai 1,2,3,4 Transcription preinitiation complex assembly on the promoters of protein encoding genes is nucleated in vivo by TFIID composed of the TATA-box Binding Protein (TBP) and 13 TBP- associate factors (Tafs) providing regulatory and chromatin binding functions. Here we present the cryo-electron microscopy structure of promoter-bound yeast TFIID at a resolu- 1234567890():,; tion better than 5 Å, except for a flexible domain. We position the crystal structures of several subunits and, in combination with cross-linking studies, describe the quaternary organization of TFIID. The compact tri lobed architecture is stabilized by a topologically closed Taf5-Taf6 tetramer. We confirm the unique subunit stoichiometry prevailing in TFIID and uncover a hexameric arrangement of Tafs containing a histone fold domain in the Twin lobe. 1 Department of Integrated Structural Biology, Equipe labellisée Ligue Contre le Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, Illkirch 67404, France. 2 Centre National de la Recherche Scientifique, UMR7104, 67404 Illkirch, France. 3 Institut National de la Santé et de la Recherche Médicale, U1258, 67404 Illkirch, France. 4 Université de Strasbourg, Illkirch 67404, France. 5 Institute for Systems Biology, Seattle, WA 98109, USA. These authors contributed equally: Olga Kolesnikova, Adam Ben-Shem. Correspondence and requests for materials should be addressed to P.S. (email: [email protected]) or to G.P.
    [Show full text]
  • SLIC-CAGE: High-Resolution Transcription Start Site Mapping Using Nanogram-Levels of Total RNA
    bioRxiv preprint doi: https://doi.org/10.1101/368795; this version posted July 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. SLIC-CAGE: high-resolution transcription start site mapping using nanogram-levels of total RNA Nevena Cvetesic1, 2*, Harry G. Leitch1,2, Malgorzata Borkowska1,2, Ferenc Müller3, Piero Carninci4,5, Petra Hajkova1,2 and Boris Lenhard1,2,6* 1Institute of Clinical Sciences, Faculty of Medicine, Imperial College London, London W12 0NN, UK 2MRC London Institute of Medical Sciences, London W12 0NN, UK 3Institute of Cancer and Genomic Sciences, University of Birmingham, Edgbaston B15 2TT, UK 4RIKEN Center for Life Science Technologies, Division of Genomic Technologies, Yokohama City, Kanagawa 230-0045, Japan 5RIKEN Omics Science Center, Yokohama City, Kanagawa 230-0045, Japan 6Sars International Centre for Marine Molecular Biology, University of Bergen, N-5008 Bergen, Norway *Correspondence to: Nevena Cvetesic Institute of Clinical Sciences, Faculty of Medicine, Imperial College London and MRC London Institute of Medical Sciences, London, W12 0NN, UK e-mail: [email protected] Boris Lenhard Institute of Clinical Sciences, Faculty of Medicine, Imperial College London and MRC London Institute of Medical Sciences, London, W12 0NN, UK e-mail: [email protected] Running title: TSS discovery using Super-Low Input Carrier-CAGE Keywords: cap analysis of gene expression; low input material; degradable nucleic acid carrier; promoters; gene expression profiling 1 bioRxiv preprint doi: https://doi.org/10.1101/368795; this version posted July 19, 2018.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC317351 MED6 (NM_005466) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MED6 (NM_005466) Human Untagged Clone Tag: Tag Free Symbol: MED6 Synonyms: ARC33; NY-REN-28 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_005466, the custom clone sequence may differ by one or more nucleotides ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAAGCCAAAA GGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTCAGACAAAA ATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACAAAGAAAGAG GCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAACAGACAGTGA GTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_005466 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete
    [Show full text]