A Mtdna-Based Phylogeny of the Brown Algal Genus Fucus (Heterokontophyta; Phaeophyta)
Total Page：16
File Type：pdf, Size：1020Kb
Molecular Phylogenetics and Evolution 39 (2006) 209–222 www.elsevier.com/locate/ympev A mtDNA-based phylogeny of the brown algal genus Fucus (Heterokontophyta; Phaeophyta) James A. Coyer ¤, Galice Hoarau, Marie-Pierre Oudot-Le Secq, Wytze T. Stam, Jeanine L. Olsen Department of Marine Biology, Centre for Ecological and Evolutionary Studies, University of Groningen, 9750 AA Haren, The Netherlands Received 27 June 2005; revised 5 December 2005; accepted 12 January 2006 Available online 21 February 2006 Abstract Species of Fucus are among the dominant seaweeds along Northern Hemisphere shores, but taxonomic designations often are con- founded by signiWcant intraspeciWc morphological variability. We analyzed intra- and inter-speciWc phylogenetic relationships within the genus (275 individuals representing 16 taxa) using two regions of the mitochondrion: a variable intergenic spacer and a conserved portion of the 23S subunit. Bayesian ML and MP analyses veriWed a shallow phylogeny with two major lineages (previously reported) and resolved some intra-lineage relationships. SigniWcant species-level paraphyly/polyphyly was observed within lineages 1A and 2. Despite higher species richness in the North Atlantic, a North PaciWc origin of the genus is supported by a gradient of decreasing haplotype and nucleotide diversities in F. distichus from the North PaciWc to the East Atlantic. © 2006 Elsevier Inc. All rights reserved. Keywords: Fucus; mtDNA; Phylogeny; Center of origin; Hybridization; Trans-Arctic connectivity; Species-level paraphyly/polyphyly 1. Introduction www.algaebase.org). Causes of intraspeciWc morphological variation have been attributed to: (1) direct responses to A widely occurring group of marine organisms that con- single or combined abiotic factors (e.g., high temperatures, tinues to challenge notions of species identity is the brown wave stress, pollution, and salinity) (Jordan and Vadas, algal genus Fucus. Species are found in habitats ranging 1972; Kalvas and Kautsky, 1993, 1998; Knight and Parke, from the rocky intertidal to brackish salt marshes through- 1950; McLachlan et al., 1971; Powell, 1963; Ruuskanen and out the North PaciWc and North Atlantic Oceans (Bergs- Bäck, 1999; Sideman and Mathieson, 1983a, 1985; Tracy tröm et al., 2005; Lein, 1984b; Lüning, 1990; Wynne and et al., 1995); (2) localized mosaics of phenotypes linked to Magne, 1991). Most reproduce sexually, although two are genotypes adapted to speciWc environmental conditions hermaphroditic with variable levels of selWng (Coleman and (Kalvas and Kautsky, 1998; Knight and Parke, 1950; Brawley, 2005b; Engel et al., 2005; Coyer et al., unpub. McLachlan et al., 1971; Munda and Kremer, 1997; Scott data) and another two can reproduce asexually by vegeta- et al., 2001; Sideman and Mathieson, 1985), or (3) self-fer- tive propagation (Bergström et al., 2005; Malm et al., 2001; tilization (in the hermaphroditic species), hybridization, Tatarenkov et al., 2005). Nearly all species display signiW- and introgression (Burrows and Lodge, 1953; Coyer et al., cant morphological plasticity with over 125 subspecies, 2002b, 2006; Engel et al., 2005; Munda and Kremer, 1997). formae, varieties, ecotypes, and ecads described for just the Phylogenetic studies have utilized nuclear rDNA-SSU eight most commonly recognized species (http:// and LSU sequences to survey fucoid genera at the family level (Lee et al., 1998; Rousseau et al., 1997) and the more variable nrDNA-ITS (ITS) sequences to explore relation- * Corresponding author. Fax: +31 50 363 2261. ships at the genus level (Leclerc et al., 1998). In the most E-mail address: [email protected] (J.A. Coyer). comprehensive evolutionary study of the Fucaceae to date, 1055-7903/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2006.01.019 210 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 Serrão et al. (1999) also used ITS sequences, but included intergenic spacer (F 5Ј CGTTTGGCGAGAACCTTACC; several geographically separated specimens of each of 16 R 5Ј TACCACTGAGTTATTGCTCCC) were designed species and 6 genera of the family. Their study revealed that from the complete mitochondrial genome for F. vesiculosus Fucus was a monophyletic and derived genus in the family, (Oudot-Le Secq et al., 2006). The aligned fragment for the consisting of two distinct lineages: (1) F. serratus sister to F. intergenic spacer included 18 bp of the 3Ј end of the 23S gardneri, F. distichus, and F. evanescens, and (2) F. vesiculo- gene to the tRNA Val gene, encompassing also the tRNA sus, F. spiralis, F. ceranoides, and F. virsoides. Because ITS Lys gene at the 5Ј end of the tRNA Val gene. PCR reac- sequences are used widely in phylogenetic studies of plants tions (50 L total volume) contained 4 L of the Sephaglas and algae at the species level, the inability of ITS sequences resuspension (see Coyer et al., 2002c) as a DNA template, 1 V to resolve relationships within the two Fucus lineages was X Taq polymerase bu er (Promega), 2 mM MgCl2, 0.2 mM attributed to hybridization and/or incomplete lineage sort- of each dNTP, 1.6 M of each primer, 0.01% BSA, and ing or homogenization, both of which are typical of recent 0.015 U Taq polymerase (Promega). PCR was performed and rapid radiation (Serrão et al., 1999). with a GeneAmp PCR System 9700 thermocycler (Applied Over the past Wve years, studies in Fucus have shifted Biosystems) for the 23S subunit region (94 °C, 2 min; fol- from a predominantly phylogenetic perspective to popula- lowed by 94 °C, 30 s, 50 °C, 30 s, and 72 °C, 40 s for 40 tion genetics. The availability of microsatellite loci for the cycles; and a Wnal extension at 72 °C for 5 min) and the principal species (Coyer et al., 2002c; Engel et al., 2003; intergenic spacer (94 °C, 2 min; followed by 94 °C, 30 s, Wallace et al., 2004) has considerably advanced our under- 50 °C, 1 min, and 72 °C, 1 min for 40 cycles; and a Wnal standing of population structure and divergence, the evolu- extension at 72 °C for 5 min). tion of mating systems and asexual reproduction, and the AmpliWcation products were puriWed either by Wltration role of hybridization (Billard et al., 2005a,b; Coleman and using the GenElute PCR Clean-Up Kit (Sigma) or through Brawley, 2005a; Coyer et al., 2002a,b, 2004, 2006; Engel Sephadex G-50 (Amersham). Both forward and reverse et al., 2005; Tatarenkov et al., 2005; Wallace et al., 2004). strands were sequenced directly using the dGTP BigDye There remains, however, a need to clarify phylogenetic rela- Terminator Kit and visualized on the ABI 377 autosequ- tionships at the population-species interface. Recent encer (Applied Biosystems). Forward and reverse sequences sequencing of mitochondrial genomes for several species of were aligned and edited with SequenceNavigator software brown algae (Heterokontopyta) (Oudot-Le Secq et al., (Applied Biosystems) and by eye. Sequences were deposited 2001, 2002, 2006) has provided several potentially informa- in GeneBank (Accession Nos. for mtDNA spacer: tive regions for inter-and intra-species phylogenies. The AY659874–AY659915, AY941092–AY941094; for the objective of the present study was to evaluate and synthe- mtDNA 23S: AY65916–AY65926). size intra-and inter-speciWc phylogenetic relationships in Fucus using newly developed mitochondrial loci and a 2.3. Data analysis much more extensive sampling. The number of polymorphic sites, phylogenetically infor- 2. Materials and methods mative sites, and Wxed diVerences, as well as haplotype and nucleotide diversity, were determined using DNAsp4 (Rozas 2.1. Sample collection and DNA preparation et al., 2003). Aligned sequences (23S D22; intergenic spacer D275) were analyzed with Bayesian maximum likeli- Tissue was collected from mature individuals of 10 spe- hood using MRBAYES 3 (Ronquist and Huelsenbeck, 2003) cies and 5 subspecies of Fucus at 76 locations throughout and with maximum parsimony (MP) using PAUP* 4.0 (Beta) their respective distributions (Fig. 1 and Table 1). The spe- using a heuristic search with 1000 bootstraps (SwoVord, cies were the same as those comprising Lineages 1 and 2 of 2002). Aligned sequences of the intergenic spacer included Serrão et al. (1999), with the addition of F. cottonii and the the terminal 18 bp of the 23S subunit, but excluded the tRNA newly described F. radicans (Bergström et al., 2005). In Lys gene. For both analyses, indels were coded as a second many locations, multiple (2–11) specimens were collected. partition according to Barriel (1994), in which each indel is Somatic tissue was stored in silica crystals and DNA counted as a single event. The optimal model of sequence extracted and puriWed as described earlier (Coyer et al., evolution for the Bayesian analysis was determined for the 2002c). Morphological identiWcations were made by the 23S and intergenic spacer data sets using ModelTest (Posada senior author or by local phycological experts who col- and Crandall, 1998); for both regions, the optimal model was lected the specimens. HKY85 + . Two independent MCMCMC searches were run for each data set using diVerent random starting points 2.2. PCR primers and conditions (number of generations D2,000,000). Convergence was checked visually by plotting likelihood vs. generation for the Forward and reverse primers for the ca. 350 bp region of two runs. Based on this analysis, the burn-in was set to the mitochondrial 23S subunit (F 5Ј TAAGAMAG 1,000,000. Trees were rooted using the species Hesperophycus CGTAACAGCTCACT; R 5Ј GTGGCGGTTTAAGGT californicus as a sister-group, based on previous ITS analysis ACGG) and the 600–700 bp region of a mitochondrial (Serrão et al., 1999). J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 211 F. spiralis F. vesiculosus (and F. mytilli) F. distichus / evanescens F. ceranoides * F. gardneri * * + F.virsoides • F. gardneri, + F. virsoides, * F. cottonii, F. lutarius F. serratus Fig. 1. Species distributions and sampling locations. Panels on the left show the ranges of each species of Fucus examined (adapted from Lüning, 1990).