A Mtdna-Based Phylogeny of the Brown Algal Genus Fucus (Heterokontophyta; Phaeophyta)

Home , Fucus, Fucus ceranoides, Fucus distichus, Fucus radicans

Molecular Phylogenetics and Evolution 39 (2006) 209–222 www.elsevier.com/locate/ympev

A mtDNA-based phylogeny of the brown algal genus Fucus (Heterokontophyta; Phaeophyta)

James A. Coyer ¤, Galice Hoarau, Marie-Pierre Oudot-Le Secq, Wytze T. Stam, Jeanine L. Olsen

Department of Marine Biology, Centre for Ecological and Evolutionary Studies, University of Groningen, 9750 AA Haren, The Netherlands

Received 27 June 2005; revised 5 December 2005; accepted 12 January 2006 Available online 21 February 2006

Abstract

Species of Fucus are among the dominant seaweeds along Northern Hemisphere shores, but taxonomic designations often are con- founded by signiWcant intraspeciWc morphological variability. We analyzed intra- and inter-speciWc phylogenetic relationships within the genus (275 individuals representing 16 taxa) using two regions of the mitochondrion: a variable intergenic spacer and a conserved portion of the 23S subunit. Bayesian ML and MP analyses veriWed a shallow phylogeny with two major lineages (previously reported) and resolved some intra-lineage relationships. SigniWcant species-level paraphyly/polyphyly was observed within lineages 1A and 2. Despite higher species richness in the North Atlantic, a North PaciWc origin of the genus is supported by a gradient of decreasing haplotype and nucleotide diversities in F. distichus from the North PaciWc to the East Atlantic. © 2006 Elsevier Inc. All rights reserved.

Keywords: Fucus; mtDNA; Phylogeny; Center of origin; Hybridization; Trans-Arctic connectivity; Species-level paraphyly/polyphyly

1. Introduction www.algaebase.org). Causes of intraspeciWc morphological variation have been attributed to: (1) direct responses to A widely occurring group of marine organisms that con- single or combined abiotic factors (e.g., high temperatures, tinues to challenge notions of species identity is the brown wave stress, pollution, and salinity) (Jordan and Vadas, algal genus Fucus. Species are found in habitats ranging 1972; Kalvas and Kautsky, 1993, 1998; Knight and Parke, from the rocky intertidal to brackish salt marshes through- 1950; McLachlan et al., 1971; Powell, 1963; Ruuskanen and out the North PaciWc and North Atlantic Oceans (Bergs- Bäck, 1999; Sideman and Mathieson, 1983a, 1985; Tracy tröm et al., 2005; Lein, 1984b; Lüning, 1990; Wynne and et al., 1995); (2) localized mosaics of phenotypes linked to Magne, 1991). Most reproduce sexually, although two are genotypes adapted to speciWc environmental conditions hermaphroditic with variable levels of selWng (Coleman and (Kalvas and Kautsky, 1998; Knight and Parke, 1950; Brawley, 2005b; Engel et al., 2005; Coyer et al., unpub. McLachlan et al., 1971; Munda and Kremer, 1997; Scott data) and another two can reproduce asexually by vegeta- et al., 2001; Sideman and Mathieson, 1985), or (3) self-fer- tive propagation (Bergström et al., 2005; Malm et al., 2001; tilization (in the hermaphroditic species), hybridization, Tatarenkov et al., 2005). Nearly all species display signiW- and introgression (Burrows and Lodge, 1953; Coyer et al., cant morphological plasticity with over 125 subspecies, 2002b, 2006; Engel et al., 2005; Munda and Kremer, 1997). formae, varieties, ecotypes, and ecads described for just the Phylogenetic studies have utilized nuclear rDNA-SSU eight most commonly recognized species (http:// and LSU sequences to survey fucoid genera at the family level (Lee et al., 1998; Rousseau et al., 1997) and the more variable nrDNA-ITS (ITS) sequences to explore relation- * Corresponding author. Fax: +31 50 363 2261. ships at the genus level (Leclerc et al., 1998). In the most E-mail address: [email protected] (J.A. Coyer). comprehensive evolutionary study of the Fucaceae to date,

Serrão et al. (1999) also used ITS sequences, but included intergenic spacer (F 5Ј CGTTTGGCGAGAACCTTACC; several geographically separated specimens of each of 16 R 5Ј TACCACTGAGTTATTGCTCCC) were designed species and 6 genera of the family. Their study revealed that from the complete mitochondrial genome for F. vesiculosus Fucus was a monophyletic and derived genus in the family, (Oudot-Le Secq et al., 2006). The aligned fragment for the consisting of two distinct lineages: (1) F. serratus sister to F. intergenic spacer included 18 bp of the 3Ј end of the 23S gardneri, F. distichus, and F. evanescens, and (2) F. vesiculo- gene to the tRNA Val gene, encompassing also the tRNA sus, F. spiralis, F. ceranoides, and F. virsoides. Because ITS Lys gene at the 5Ј end of the tRNA Val gene. PCR reac- sequences are used widely in phylogenetic studies of plants tions (50 L total volume) contained 4 L of the Sephaglas and algae at the species level, the inability of ITS sequences resuspension (see Coyer et al., 2002c) as a DNA template, 1 V to resolve relationships within the two Fucus lineages was X Taq polymerase bu er (Promega), 2 mM MgCl2, 0.2 mM attributed to hybridization and/or incomplete lineage sort- of each dNTP, 1.6 M of each primer, 0.01% BSA, and ing or homogenization, both of which are typical of recent 0.015 U Taq polymerase (Promega). PCR was performed and rapid radiation (Serrão et al., 1999). with a GeneAmp PCR System 9700 thermocycler (Applied Over the past Wve years, studies in Fucus have shifted Biosystems) for the 23S subunit region (94 °C, 2 min; fol- from a predominantly phylogenetic perspective to popula- lowed by 94 °C, 30 s, 50 °C, 30 s, and 72 °C, 40 s for 40 tion genetics. The availability of microsatellite loci for the cycles; and a Wnal extension at 72 °C for 5 min) and the principal species (Coyer et al., 2002c; Engel et al., 2003; intergenic spacer (94 °C, 2 min; followed by 94 °C, 30 s, Wallace et al., 2004) has considerably advanced our under- 50 °C, 1 min, and 72 °C, 1 min for 40 cycles; and a Wnal standing of population structure and divergence, the evolu- extension at 72 °C for 5 min). tion of mating systems and asexual reproduction, and the AmpliWcation products were puriWed either by Wltration role of hybridization (Billard et al., 2005a,b; Coleman and using the GenElute PCR Clean-Up Kit (Sigma) or through Brawley, 2005a; Coyer et al., 2002a,b, 2004, 2006; Engel Sephadex G-50 (Amersham). Both forward and reverse et al., 2005; Tatarenkov et al., 2005; Wallace et al., 2004). strands were sequenced directly using the dGTP BigDye There remains, however, a need to clarify phylogenetic rela- Terminator Kit and visualized on the ABI 377 autosequ- tionships at the population-species interface. Recent encer (Applied Biosystems). Forward and reverse sequences sequencing of mitochondrial genomes for several species of were aligned and edited with SequenceNavigator software brown algae (Heterokontopyta) (Oudot-Le Secq et al., (Applied Biosystems) and by eye. Sequences were deposited 2001, 2002, 2006) has provided several potentially informa- in GeneBank (Accession Nos. for mtDNA spacer: tive regions for inter-and intra-species phylogenies. The AY659874–AY659915, AY941092–AY941094; for the objective of the present study was to evaluate and synthe- mtDNA 23S: AY65916–AY65926). size intra-and inter-speciWc phylogenetic relationships in Fucus using newly developed mitochondrial loci and a 2.3. Data analysis much more extensive sampling. The number of polymorphic sites, phylogenetically infor- 2. Materials and methods mative sites, and Wxed diVerences, as well as haplotype and nucleotide diversity, were determined using DNAsp4 (Rozas 2.1. Sample collection and DNA preparation et al., 2003). Aligned sequences (23S D22; intergenic spacer D275) were analyzed with Bayesian maximum likeli- Tissue was collected from mature individuals of 10 spe- hood using MRBAYES 3 (Ronquist and Huelsenbeck, 2003) cies and 5 subspecies of Fucus at 76 locations throughout and with maximum parsimony (MP) using PAUP* 4.0 (Beta) their respective distributions (Fig. 1 and Table 1). The spe- using a heuristic search with 1000 bootstraps (SwoVord, cies were the same as those comprising Lineages 1 and 2 of 2002). Aligned sequences of the intergenic spacer included Serrão et al. (1999), with the addition of F. cottonii and the the terminal 18 bp of the 23S subunit, but excluded the tRNA newly described F. radicans (Bergström et al., 2005). In Lys gene. For both analyses, indels were coded as a second many locations, multiple (2–11) specimens were collected. partition according to Barriel (1994), in which each indel is Somatic tissue was stored in silica crystals and DNA counted as a single event. The optimal model of sequence extracted and puriWed as described earlier (Coyer et al., evolution for the Bayesian analysis was determined for the 2002c). Morphological identiWcations were made by the 23S and intergenic spacer data sets using ModelTest (Posada senior author or by local phycological experts who col- and Crandall, 1998); for both regions, the optimal model was lected the specimens. HKY85 + . Two independent MCMCMC searches were run for each data set using diVerent random starting points 2.2. PCR primers and conditions (number of generations D2,000,000). Convergence was checked visually by plotting likelihood vs. generation for the Forward and reverse primers for the ca. 350 bp region of two runs. Based on this analysis, the burn-in was set to the mitochondrial 23S subunit (F 5Ј TAAGAMAG 1,000,000. Trees were rooted using the species Hesperophycus CGTAACAGCTCACT; R 5Ј GTGGCGGTTTAAGGT californicus as a sister-group, based on previous ITS analysis ACGG) and the 600–700 bp region of a mitochondrial (Serrão et al., 1999). J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 211

F. spiralis

F. vesiculosus (and F. mytilli)

F. distichus / evanescens

F. ceranoides * F. gardneri * * +

F.virsoides • F. gardneri, + F. virsoides, * F. cottonii, F. lutarius

F. serratus

Fig. 1. Species distributions and sampling locations. Panels on the left show the ranges of each species of Fucus examined (adapted from Lüning, 1990). Panels on the right indicate approximate location of samples collected for this study. Distinction among F. distichus, F. evanescens, and F. gardneri in the northeastern PaciWc remains unclear.

3. Results F. serratus, F. distichus, F. evanescens, and F. gardneri (Fig. 2), which corresponded to Lineage 1 of Serrão et al. (1999). The 3.1. Comparison of ITS and mtDNA markers remaining species (F. vesiculosus, F. spiralis, F. ceranoides, F. virsoides, and F. cottonii), which corresponded to Lineage 2 of The mtDNA spacer was nearly twice as informative as Serrão et al. (1999), formed a poorly supported group (Bayes- the ITS and 5 times more informative than the mtDNA 23S ian posterior probabilityD0.88; MP bootstraps D61%). (Table 2). A plot of ML distances vs. uncorrected distances Phylogenetic analysis of 275 sequences using the more for both ITS and mtDNA spacer regions, revealed no satu- variable mtDNA spacer region again recovered the two lin- ration (data not shown). Consequently, the mtDNA spacer eages, but in this case, Lineage 1 (including several subspe- region provides the highest resolution marker for Fucus cies and forms of F. distichus) was poorly supported phylogeny currently available. (posterior probability D 0.53; MP bootstrap D 83%) and Lineage 2 was maximally supported (posterior 3.2. Resolution of lineages probability D 1.0; MP bootstrap D 100%) (Fig. 3). The reversal of support, depending upon the marker used, is Phylogenetic analysis of 22 sequences of the conserved related to the sharing of two mtDNA indels between Line- mt23S subunit strongly resolved (Bayesian posterior age 1 and the outgroup that are not shared between Lin- probabilityD1.0; MP bootstrapD83%) a cluster consisting of eages 1 and 2 (Table 3). 212 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222

Table 1 Location and number of samples for Fucus specimens used in the study Species Location Latitude, longitude Number of mtDNA sequences examined Spacer 23S F. distichus Appledore Island, Maine (USA) 42° 58ЈN, 70° 37ЈW 4 (exposed); 5 (sheltered)¤ F. distichus Garðskagi (Iceland) 64° 04ЈN, 22° 42ЈW2 F. distichus Hornslund, Spitzbergen (Norway) 77° 00ЈN, 15° 33ЈE5 1 F. distichus subspp. anceps Appledore Island, Maine (USA) 42° 58ЈN, 70° 37ЈW2 1 F. distichus subspp. anceps Grense-Jakobselv (Norway) 69° 48ЈN, 30° 53ЈE1 F. distichus f. linearis Seltjarnarnes (Iceland) 64° 09ЈN, 21° 54ЈW3 F. distichus f. typical Sandgerði (Iceland) 64° 03ЈN, 22° 43ЈW 2 (exposed); 2 (sheltered)¤ 1 F. gardneri Knight Island, Prince William Sound, Alaska (USA) 60° 29ЈN, 147° 44ЈW2 F. gardneri Juneau, Alaska (USA) 58° 20ЈN, 134° 20ЈW5 F. distichus Auke Bay, Alaska (USA) 58° 24ЈN, 134° 40ЈW4 F. gardneri De Courcy Island, British Columbia (Canada) 49° 08ЈN, 124° 14ЈW8 1 F. evanescens Charatsunai, Muroran, Hokkaido (Japan) 42° 21ЈN, 140° 59ЈW11 1 F. evanescens Appledore Island, Maine (USA) 42° 58ЈN, 70° 37ЈW1 F. evanescens Nuuk (Greenland) 64° 11ЈN, 01° 42ЈW4 F. evanescens Garðskagi (Iceland) 64° 04ЈN, 22° 42ЈW8 F. evanescens Vatnsleysa (Iceland) 64° 03ЈN, 22° 06ЈW2 F. evanescens Tvøroyri, Suðuroy (Faeroes) 61° 34ЈN, 06° 49ЈW2 F. evanescens Trondheim (Norway) 63° 36ЈN, 10° 23ЈE2 F. evanescens Kirkenes (Norway) 69° 41ЈN, 30° 00ЈE2 F. evanescens Solovetski Islands, White Sea (Russia) 65° 00ЈN, 35° 21ЈE2 F. evanescens Fiskebäckskil (Kattegat Sea) (Sweden) 58° 15ЈN, 11° 29ЈE3 F. evanescens Kiel (Germany) 54° 20ЈN, 10° 08ЈE1 F. serratus Cape Fouchu, Nova Scotia (Canada) 43° 48ЈN, 66° 09ЈW3 F. serratus Inverness, Nova Scotia (Canada) 46° 20ЈN, 61° 25ЈW3 F. serratus Oban (Scotland) 56° 25ЈN, 05° 29ЈW4 2 F. serratus Rousay Island, Orkneys (Scotland) 59° 08ЈN, 02° 59ЈW2 F. serratus Seltjarnes (Iceland) 64° 09ЈN, 21° 54ЈW3 F. serratus Garðskagi (Iceland) 64° 04ЈN, 22° 42ЈW2 F. serratus Trondheim (Norway) 63° 36ЈN, 10° 23ЈE3 F. serratus Kirkenes (Norway) 69° 41ЈN, 30° 00ЈE1 F. serratus Solovetski Islands, White Sea (Russia) 65° 00ЈN, 35° 21ЈE2 F. serratus Blushøj (Kattegat Sea) (Denmark) 56° 10ЈN, 10° 12ЈE1 F. serratus Fiskebäckskil (Kattegat Sea) (Sweden) 58° 15ЈN, 11° 29ЈE1 1 F. serratus Kiel (Germany) 54° 20ЈN, 10° 08ЈE9 F. serratus Oskarshavn (Inner Baltic) (Sweden) 57° 16ЈN, 16° 25ЈE4 F. serratus Zeelandbrug, Zeeland (Netherlands) 51° 36ЈN, 03° 51ЈE1 F. serratus Le Croisic, Brittany (France) 47° 18ЈN, 02° 28ЈW9 F. serratus RoscoV, Brittany (France) 48° 43ЈN, 03° 59ЈW8 1 F. serratus La Coruña (Spain) 43° 21ЈN, 08° 25ЈE8 1 F. vesiculosus Appledore Island, Maine (USA) 42° 58ЈN, 70° 37ЈW5 1 F. vesiculosus Tasiluk, QaQortoq (Greenland) 60° 45ЈN, 46° 00ЈW1 F. vesiculosus Grindavik (Iceland) 63° 50ЈN, 22° 27ЈW8 F. vesiculosus Kirkenes (Norway) 69° 41ЈN, 30° 00ЈE2 F. vesiculosus Solovetski Islands, White Sea (Russia) 65° 00ЈN, 35° 21ЈE2 F. vesiculosus Oban (Scotland) 56° 25ЈN, 05° 29ЈW6 1 F. vesiculosus Amrum Island (Wadden Sea) (Germany) 54° 39ЈN, 08° 31ЈE6 F. vesiculosus Strandby (Kattegat Sea) (Denmark) 57° 30ЈN, 10° 31ЈE2 F. vesiculosus Fiskebäckskil (Kattegat Sea) (Sweden) 58° 15ЈN, 11° 29ЈE3 F. vesiculosus Grisslehamn (Inner Baltic Sea) (Sweden) 60° 04ЈN, 18° 50ЈE2 F. vesiculosus Hoek van Holland (The Netherlands) 51° 59ЈN, 04° 07ЈE2 F. vesiculosus RoscoV, Brittany (France) 48° 43ЈN, 03° 59ЈW1 1 F. vesiculosus Seili, Nauvo (Finland) 60° 12ЈN, 21° 55ЈE3 F. vesiculosus Le Croisic, Brittany (France) 47° 18ЈN, 02° 28ЈW12 F. vesiculosus Viana do Castelo (Portugal) 41° 41ЈN, 08° 50ЈW2 F. vesiculosus Trondheim (Norway) 63° 36ЈN, 10° 23ЈE3 F. vesiculosus f. mytilli Amrum Island (Wadden Sea) (Germany) 54° 39ЈN, 08° 31ЈE4 1 F. vesiculosus f. mytilli Nyborg (Norway) 70° 10ЈN, 28° 34ЈE2 F. radicans Umeå (Sweden) 63° 30ЈN, 20° 15ЈE2 F. radicans Öregrund (Sweden) 60° 20ЈN, 18° 30ЈE1 F. virsoides Isola, Gulf of Trieste (Slovenia) 45° 30ЈN, 13° 40ЈE10 1 F. spiralis Anacortes, Washington (USA) 48° 30ЈN, 122° 42ЈW3 F. spiralis Appledore Island, Maine (USA) 42° 58ЈN, 70° 37ЈW1 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 213

Table 1 (continued) Species Location Latitude, longitude Number of mtDNA sequences examined Spacer 23S F. spiralis Grindavik (Iceland) 63° 50ЈN, 22° 27ЈW3 1 F. spiralis Oban (Scotland) 56° 25ЈN, 05° 29ЈW6 1 F. spiralis Amrum Island (Wadden Sea) (Germany) 54° 39ЈN, 08° 31ЈE3 F. spiralis Le Croisic, Brittany (France) 47° 18ЈN, 02° 28ЈW7 F. spiralis Nantes, Brittany (France) 47° 14ЈN, 01° 35ЈW2 F. spiralis RoscoV, Brittany (France) 48° 43ЈN, 03° 59ЈW2 F. spiralis Viana do Castelo (Portugal) 41° 41ЈN, 08° 50ЈW2 F. ceranoides Kollafjörður (Iceland) 64° 12ЈN, 21° 43ЈW4 1 F. ceranoides RoscoV, Brittany (France) 48° 43ЈN, 03° 59ЈW4 1 F. ceranoides Hoek van Holland (The Netherlands) 51° 59ЈN, 04° 07ЈE2 1 F. lutarius Ile de Bréhat, Brittany (France) 48° 51ЈN, 03° 00ЈW3 F. cottonii Connemora (Ireland) 53° 23ЈN, 09° 19ЈW4 F. cottonii Baic de Morlaix, Brittany (France) 48° 40ЈN, 03° 56ЈW2 1 Hesperophycus californicus PaciWc Grove, CA (USA) 36° 36ЈN, 121° 56ЈW1 1 Five samples of F. distichus from Maine (USA) and two of F. distichus f. typica from Iceland (marked with an asterisk) were actually F. vesiculosus (see Fig. 5).

Table 2 from the east and west Atlantic. The lack of clear species Comparison of phylogenetic information between ITS, mtDNA 23S, and delineations reXects the high degree of hybridization and the mtDNA spacer introgression present in Lineage 2 (see below). ITS1 and 2 mtDNA 23S mtDNA spacer Fragment size 898 373 626 3.5. PaciWc–Atlantic diversity No. of polymorphic sites 144 16 94 No. of informative sites 25 8 40 Haplotype and nucleotide diversities of F. distichus No. of Wxed diVerences between: formed a clearly deWned gradient: highest in the PaciWc Fd and Fs 13 8 (0.823/0.00971), followed by declining levels in the Western Fd and Lineage 2 12 3 29 Fs and Lineage 2 9 5 20 (0.762/0.00550) and Central (0.348/0.00060) Atlantic, and lowest (0/0) in the Eastern Atlantic (Table 4). Only one hap- Abbreviations: Fd, F. distichus; Fs, F. serratus. lotype was present in Eastern Atlantic samples ranging from Spitzbergen to northern Germany (Kiel). In addition, 3.3. Lineage 1 the number of unique haplotypes ranged from nine in the North PaciWc, to three in the Western and Central Atlantic The tree based on the variable spacer region revealed (Fig. 4). The single haplotype present in the Eastern Atlan- two highly supported major clusters (A and B) within Line- tic was shared with the North PaciWc and Central Atlantic. age 1 (Fig. 4). Cluster A (posterior probability D 1.0; MP A similar diversity comparison was not possible for F. spi- bootstrap D 96%) consisted of F. distichus (including vari- ralis (Lineage 2), which also is found in both the North ous subspecies and formae), F. evanescens, and F. gardneri, PaciWc and North Atlantic, as sampling in the North PaciWc which we synonymized under F. distichus. The cluster was a was limited to one location (Washington State, USA). polytomy with three highly supported branches. No corre- lation was evident between groups and habitat or groups 4. Discussion and geographic regions. Cluster B was a monophyletic grouping (posterior Given that species identiWcations based on morphology probability D 1.0; MP bootstrap D 97%) of F. serratus col- are often unreliable in Fucus, even when made by experts, lected from throughout its biogeographic range (Spain to what can mtDNA, population divergence, and ecology/life Norway, Nova Scotia to the Baltic Sea). The cluster was history reveal about speciation in Fucus? Our mtDNA gene further partitioned into subgroups, which also were not tree revealed only three monophyletic groups or species: correlated with geographical region. The conserved 23S Lineage 1A (F. distichus), Lineage 1B (F. serratus), and region again revealed a monophyletic grouping of F. serra- Lineage 2 (F. vesiculosus, F. spiralis, F. cottonii, F. cerano- tus (posterior probability D 1.0; MP bootstrap D 95%). ides, and F. radicans). With respect to the polyphyly present in Lineages 1A and 2, a recent review of animal mtDNA 3.4. Lineage 2 clearly shows that species-level monophyly cannot be assumed and that species-level paraphyly and/or polyphyly In contrast, the tree based on the variable spacer region is much more widespread than is generally recognized revealed that Lineage 2 was a single major cluster (Fig. 5). (Funk and Omland, 2003). Necessary prerequisites for the All subgroups were poorly resolved except for one group detection of polyphyly include adequate sampling (multiple consisting of F. spiralis, F. vesiculosus, and F. ceranoides individuals from each of multiple species throughout their 214 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222

Hesperophycus

F. spiralis (Scotland); F. vesiculosus (Brittany); F. cottonii (Brittany)

F. vesiculosus v. mytili (Germany); F. ceranoides (Netherlands) 0.88 61 F. spiralis (Iceland) Lineage 2 1.00 F. vesiculosus (Scotland) 81 F. vesiculosus (Maine); F. virsoides (Mediterranean); F. ceranoides (Iceland, Brittany)

F. distichus (Iceland, Spitzbergen); F. evanescens (Japan)

F. distichus subspp. anceps (Maine, USA) 1.00 83 F. gardneri (Vancouver, Canada) Lineage 1

F. serratus (Brittany, Sweden, Spain, Scotland) 1.00 95 F. serratus (Scotland)

0.01

Fig. 2. Bayesian phylogenetic tree based on mtDNA 23S sequences. Numbers above and below the line are Bayesian posterior probability and MP bootstrap values (1000 replications), respectively. distributional ranges) and an adequate phylogenetic signal 2005) and at a smaller or local scale for F. vesiculosus, F. (e.g., mtDNA gene trees with high support values) (Barrac- spiralis, and F. ceranoides (Billard et al., 2005a; Coleman lough and Nee, 2001; Funk and Omland, 2003); conditions and Brawley, 2005a; Tatarenkov et al., 2005). that were met in our study. Potential explanations for dis- At the local scale, several isolation mechanisms (e.g., cordance between trees based on genes and morphology Coyne and Orr, 2004) are unmistakably at work among include philosophical diVerences among taxonomists (e.g., putatively single-species populations of Fucus. For exam- “splitters” vs. “lumpers”) and real biological diVerences ple, temporal asynchrony in the form of summer- and related to interspeciWc hybridization (Funk and Omland, autumn-reproducing populations of F. vesiculosus was 2003). found in the Baltic Sea along the mainland east coast of Although ITS and mtDNA sequence data were unable Sweden, whereas only summer-reproducing populations to satisfactorily distinguish morphologically based Fucus were present along the oVshore islands of Gotland and species within Lineage 2, microsatellite allele frequencies Öland (Berger et al., 2001). The patterns persisted for at have revealed clear separation among F. spiralis, F. vesicu- least 3 years and selection for an autumn-reproducing pop- losus, and F. ceranoides (Billard et al., 2005a), as well as ulation may be a contemporary response to eutrophication among F. vesiculosus and the newly described F. radicans (Berger et al., 2001). Furthermore, a recent study using Wve (Bergström et al., 2005). In Lineage 1A, however, neither microsatellite loci revealed signiWcant diVerentiation microsatellite allele frequencies (Coyer et al., unpub. data), between the summer- and autumn-reproducing F. vesiculo- nor mtDNA could distinguish F. distichus, F. evanescens, sus populations in central, but not northern, Öland (Tata- and F. gardneri. Consequently, we considered all the spe- renkov, pers. comm.). A similar summer–autumn pattern of cies, subspecies, and formae of Lineage 1A to be synony- reproduction was found for F. serratus in the same area of mous with F. distichus. Microsatellite allele frequencies can, the Baltic (Malm et al., 2001) and non-overlapping repro- however, distinguish between F. distichus and F. serratus ductive periods also have been observed among popula- (Coyer et al., 2002b, 2006). These examples illustrate that a tions within the F. distichus complex in the northeastern combination of allele frequency and genealogical coastal area of the US (Pearson and Brawley, 1996; Side- approaches provide a better means of characterizing species man and Mathieson, 1983a,b). of Fucus. Ecotypic divergences also exist within the genus and Another factor contributing to diYculties in delineating have long been studied. Examples include the widespread Fucus species may be levels of population diVerentiation. occurrence of Lineage 2 ecads (drifting individuals that Spatial isolation and restriction of gene Xow has lead to have not developed holdfasts) in salt marsh habitats large scale diVerentiation for F. serratus, F. vesiculosus, F. (reviewed in Wallace et al., 2004); the virtual identity of spiralis, and F. ceranoides (Coyer et al., 2003; Engel et al., mtDNA sequences in F. vesiculosus and F. ceranoides J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 215

Hesperophycus

Lineage 2

1.00 F. spiralis 100 F. vesiculosus F. vesiculosus f. mytilli F. virsoides F. ceranoides F. lutarius F. cottonii F. radicans

F. distichus F. distichus subspp. anceps 1.00 A F. distichus f. typica 96 F. distichus f. linearis F. evanescens F. gardneri

0.53 83 Lineage 1

B F. serratus 1.00 97

0.1

Fig. 3. Bayesian phylogenetic tree based on mtDNA intergenic spacer. Numbers above and below the line are Bayesian posterior probability and MP bootstrap values (1000 replications), respectively.

(Fig. 5) despite distinct diVerences in their habitat (salinity) 4.1. Hybridization and introgression and reproductive adaptations (Brawley, 1992; Khfaji and Norton, 1979); secondary evolution of asexual reproduc- Complicating the picture of the microsatellite-based spe- tion within lineages that are primarily sexual (Tatarenkov cies designations and various isolation mechanisms that et al., 2005); and common garden experiments for subspe- obviously are occurring, however, is the process of hybrid- cies of F. distichus that imply a genetic basis for the ization. As noted by Mallet (2005), hybridization and intro- observed diVerences in morphology (McLachlan et al., gression can counteract isolation mechanisms and seriously 1971; Sideman and Mathieson, 1983a, 1985). challenge the notion of biological species, as well as result 216 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222

Table 3 members of Lineage 2. Furthermore, mtDNA and micro- Indels among Fucus species within each lineage satellite allele frequencies have resolved F. serratus from F. 1234distichus (Lineage 1A), suggesting that the hybridization Size (bp) 153 8 111 9 reported between these species (Coyer et al., 2002b, 2006) is W X Lineage 1 not a signi cant source of gene ow and therefore, the spe- F. serratus 10/10/11cies are characterized by substantial but not complete F. distichus 10/10/11reproductive isolation (modiWed BSC of Coyne and Orr, Lineage 2 2004). F. spiralis 0? ? 0At the other end, lies the hermaphroditic members of F. vesiculosus 0? ? 0Lineage 1A (F. distichus), characterized by widespread para- Outgroup phyly/polyphyly (mtDNA), lack of species distinction with H. californicus 10 1 1microsatellite allele frequencies (Coyer et al., unpub. data), W Four indels were scored: 1, sequence present; 0, sequence absent; ?, dele- and widespread sel ng (Coleman and Brawley, 2005b; Coyer tion was imbedded within a larger deletion. et al., unpub. data; Engel et al., 2005). Such evidence of substantial gene Xow among Lineage 1A members has resulted in species-level paraphyly/polyphyly (Funk and Omland, in our designating all members as F. distichus. 2003). Hybridization between Fucus species is widespread, In between the two extremes of F. serratus and F. disti- having been observed in the Weld for decades, (Burrows and chus, lays Lineage 2. Although extensive paraphyly/poly- Lodge, 1953; Gard, 1910; Lein, 1984a; Sauvageau, 1909; phyly was revealed with mtDNA and hybridization among Scott and Hardy, 1994; Stomps, 1911) and veriWed by members is common, microsatellite analysis was able to recent molecular work on F. evanescens x F. serratus (Lin- diVerentiate several members of the Lineage (Billard et al., eages 1A and 1B) (Coyer et al., 2002b, 2006) and F. 2005b,c; Engel et al., 2005; Wallace et al., 2004). Conse- spiralis£ F. vesiculosus (Lineage 2) (Billard et al., 2005b; quently, eVective isolation barriers are beginning to form in Engel et al., 2005; Wallace et al., 2004). While the divergent Lineage 2. mating systems within the genus may contribute to the The glacial-relict F. virsoides (Lineage 2) is restricted to maintenance of the parental types, backcrossing and the the upper Adriatic Sea and thousands of kilometers from maintenance of introgressed genotypes can blur species dis- the nearest population of any other Fucus species. tinctions (Billard et al., 2005b; Engel et al., 2005). Although mtDNA was unable to signiWcantly resolve F. virsoides from other members of Lineage 2 and no hybrid- 4.2. Species designations within Fucus ization studies have been conducted between F. virsoides and any Fucus species, we provisionally retain F. virsoides Which species concept is most useful for Fucus? Most as an allopatric species. species concepts acknowledge the importance of isolating barriers, suVer from ambiguities, require subjective evalua- 4.3. Ocean of origin tions, and are unable to encompass sexual, asexual, and mixed modes of reproduction (BrookWeld, 2002; Coyne and A North Atlantic origin of the genus Fucus has been Orr, 2004; Kitcher, 1984). The most common “solution” is assumed because of higher species richness in the North to choose a concept based on characteristics of the taxon Atlantic as compared with the North PaciWc. Two lines of under study. As Coyne and Orr (2004) point out, one can evidence, however, support the alternative hypothesis of a consider speciation as the conversion of “genotypic cluster” North PaciWc origin followed by recent radiation in the species into “biological” species as a continuous process North Atlantic. First, the sister-taxa of Fucus are Hespero- that produces ever increasing barriers to gene Xow. Species phycus and Pelvetiopsis, genera which are restricted to the status, therefore involves a sliding scale: “bad” species, or northeast PaciWc (Abbott and Hollenberg, 1976; Serrão taxa having substantial gene Xow despite morphological et al., 1999). Second, the pattern of high haplotype and distinctness on one end and “good” species, or taxa charac- nucleotide diversity in the variable spacer mtDNA terized by substantial, but not necessarily complete repro- observed in F. distichus from the North PaciWc (Table 4) ductive isolation at the other (Coyne and Orr, 2004). suggests stable populations with a moderately long evolu- Species designations of intermediate taxa require variable tionary history; whereas the presence of only one haplotype degrees of subjective judgments. Although reproductive (shared with the North PaciWc and Central Atlantic) in F. isolation is a crucial focus for speciation, complete repro- distichus populations from throughout 2800 km of the ductive isolation is not a necessary criterion for species des- northeast Atlantic (Spitzbergen to northern Germany) is ignation (e.g., the modiWed biological species concept (BSC) indicative of a recent bottleneck or founder eVect (Grant of Coyne and Orr, 2004). and Bowen, 1998). A third line of evidence, albeit weaker, is A sliding scale is the best description of speciation in that indels are shared between Lineage 1 and the outgroup. Fucus. On one end lies F. serratus (Lineage 1B), a “good” The earliest time of dispersal must stem from the Wrst species as both mtDNA and ecological data suggest that opening of the Bering Strait 4.1–7.4 Myr BP (reviewed in substantial barriers to gene Xow exist between it and all Lindstrom, 2001). Since the opening, there have been >30 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 217

1.00 F. gardneri : Auke Bay, Alaska USA (3) 95 F. gardneri : Juneau, Alaska USA (3)

F. distichus : Garðskagi, Iceland F. distichus : Maine, USA (high intertidal exposed (2) F. gardneri : British Columbia, Canada (6) F. distichus : Spitzbergen, Norway (5) F. distichus : Garðskagi, Iceland 1.00 F. distichus f. linearis : Seltjarnarnes, Iceland (3) F. distichus f. typica : Sandgerði, Iceland (exposed) (2) 88 F. distichus subspp. anceps : Nyborg, Norway F. evanescens : Nuuk, Greenland (3) F. evanescens : Garðskagi, Iceland (8) F. evanescens : Faroes (2) 1.00 F. evanescens : Kirkenes, Norway (2) 96 F. evanescens : Trondheim, Norway (2) A F. evanescens : White Sea (2) F. evanescens : Kattegat Sea, Sweden (3) F. evanescens : Kiel, Germany

F. evanescens : Nuuk, Greenland F. evanescens : Vatnsleysa, Iceland (2) 1.00 F. gardneri : British Columbia, Canada 88 F. evanescens : Japan 1.00 F. evanescens : Japan (10) 72 0.53 F. gardneri : British Columbia, Canada 0.89 F. gardneri : Juneau, Alaska USA (2) 83 60 F. gardneri : Auke Bay, Alaska USA F. gardneri : Prince Williams Sound, Alaska USA (2)

0.85 F. distichus : Maine, USA (high intertidal exposed) (2) F. evanescens : Maine, USA F. distichus subspp. anceps : Maine, USA (high intertidal dwarf) (2)

F. serratus : Brittany (Le Croisic), France (7) F. serratus : Brittany (Le Croisic), France

0.95 F. serratus : Spain (7) 71 F. serratus : Brittany (Roscoff), France (2) F. serratus : Kiel, Germany (2) 1.00 F. serratus : Trondheim, Norway (3) 97 F. serratus : Garðskagi, Iceland (2) 0.98 F. serratus : Seltjarnes, Iceland (2) 62 F. serratus : Brittany (Roscoff), France F. serratus : Brittany (Le Croisic), France F. serratus : Kiel, Germany (7) B F. serratus : Kattegat Sea, Denmark F. serratus : Kattegat Sea, Sweden F. serratus : Inner Baltic Sea, Sweden (3) 0.58 F. serratus : Kirkenes, Norway F. serratus : White Sea (2) F. serratus : Orkneys, Scotland (2) F. serratus : Seltjarnes, Iceland F. serratus : Inner Baltic Sea, Sweden F. serratus : Spain F. serratus : Brittany (Roscoff), France (5) F. serratus : Inverness, Nova Scotia, Canada (3) F. serratus : Cape Forchu, Nova Scotia, Canada (3) F. serratus : The Netherlands

1.00 F. serratus : Oban, Scotland 87 F. serratus : Oban, Scotland F. serratus : Oban, Scotland (2) 0.99 62 0.1

Fig. 4. Detailed Bayesian phylogenetic tree of Lineage 1 (A and B) from Fig. 3. See Fig. 3 for legend. Parenthetical values indicate the number of individuals with identical sequences. glacial-interglacial episodes, the last being the last glacial zation undoubtedly have shaped extant distributions as evi- maximum (LGM) (18,000–20,000 years BP). Thus, a series denced by: (1) the glacial relict species F. virsoides, which of regional extinctions, refugial populations, and recoloni- currently is conWned to the northern Adriatic Sea in the 218 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222

F. virsoides : Slovenia (10)

F. vesiculosus : Wadden Sea, Germany (3) F. vesiculosus f. mytilli : Wadden Sea, Germany (4) F. ceranoides : Netherlands (2) F. vesiculosus : Maine, USA (3) 1.00 91 F. vesiculosus : Brittany (Le Croisic), France

0.95 F. spiralis : Portugal 61 F. spiralis : Portugal

F. spiralis : Brittany (Nantes), France (2)

1.00 0.66 F. spiralis : Oban, Scotland (3) 100 F. vesiculosus : Oban, Scotland (3)

F. cottonii : Brittany (Morlaix), France (2) F. cottonii : Ireland (4) 0.68

F. spiralis : Grindavik, Iceland (3) 0.95 F. spiralis : Oban, Scotland (3) F. spiralis : Brittany (Roscoff), France (2) F. spiralis : Brittany (Le Croisic), France (7) F. spiralis : Wadden Sea, Germany (3)

0.53 F. spiralis : Maine, USA

F. spiralis : Washington, USA (3)

F. vesiculosus : Portugal F. vesiculosus : Grindavik, Iceland F. ceranoides : Iceland (sheltered) (4) F. ceranoides : Brittany (Roscoff), France (4) F. lutarius : Brittany (Roscoff), France (3) F. distichus : Maine, USA (low intertidal sheltered) (2) F. distichus f. typica : Iceland (sheltered) (2) 0.92 F. vesiculosus f. mytilli : Nyborg, Norway (2) 52 F. vesiculosus : Tasiluk, Greenland F. vesiculosus : Grindavik, Iceland (6) 0.94 52 F. vesiculosus : Oban, Scotland (3) F. vesiculosus : Brittany (Roscoff), France F. vesiculosus : Brittany (Le Croisic), France (11) F. vesiculosus : Wadden Sea, Germany (3) F. vesiculosus : Kattegat Sea, Denmark (2) F. vesiculosus : Kattegat Sea, Sweden (3) F. vesiculosus : Inner Baltic Sea, Sweden (2) F. vesiculosus : Portugal F. vesiculosus : Trondheim, Norway (3) F. vesiculosus : Kirkenes, Norway (2) F. vesiculosus : Netherlands (2) F. vesiculosus : Finland (3) F. vesiculosus : White Sea (2) F. radicans : Umeå, Sweden (2) F. radicans : Öregrund, Sweden

F. vesiculosus : Grindavik, Iceland

F. vesiculosus : Maine, USA (2) F. distichus : Maine, USA (low intertidal sheltered) (3)

0.1

Fig. 5. Detailed Bayesian phylogenetic tree of Lineage 2 from Fig. 3. See Fig. 3 for legend. Parenthetical values indicate the number of individuals with identical sequences. Mediterranean (Serrão et al., 1999), and (2) the high allelic Hoarau et al., 2005), an area whose status as a glacial refu- and mtDNA haplotype diversity of F. serratus in the north- gium is also supported by recent studies of seagrass and red ern Brittany-southern Ireland area (Coyer et al., 2003; algae (Olsen et al., 2004; Provan et al., 2005). J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 219

Table 4 ditic, thereby greatly increasing the chances of successful Comparison of diversity between PaciWc and Atlantic Fucus distichus com- dispersal because only one individual is necessary to suc- plex cessfully colonize new habitats (Baker, 1955; Pannell and PaciWcAtlantic Barrett, 1998; Serrão et al., 1999), and (2) all species of Western Central Eastern Fucus have eight eggs per oogonium, whereas other Fucales N 30 7 21 18 have one to four (Serrão et al., 1999 and references therein), Nh 10 (9) 3 (3) 4 (3) 1 thus producing more potential progeny per dispersed indi- h 0.823 0.762 0.348 0.000 vidual. Our scenario of a North PaciWc to North Atlantic 0.00971 0.00550 0.00060 0.00000 pathway also implies, as suggested earlier by Clayton N, number of individuals sequenced, Nh, number of haplotypes, h, haplo- (1984), that hermaphroditism is ancestral to dioecy in the type diversity, , nucleotide diversity. Parenthetical values indicate the genus Fucus, particularly as F. distichus, F. spiralis, and the number of unique haplotypes in a region. The Eastern haplotype was present in the PaciWc and Central Atlantic. PaciWc: Japan, Alaska, and Canada sister genera Hesperophycus, Pelvetiopsis, and Pelvetia are (BC); Western Atlantic: US east coast (Maine); Central Atlantic: Green- hermaphroditic. Recent work with F. vesiculosus, F. spiralis, land and Iceland; Eastern Atlantic: Faroes and Northern Europe. and F. vesiculosus £ F. spiralis hybrids further indicates that evolution from hermaphroditism to dioecy is the most par- Two scenarios are hypothesized for the North PaciWc to simonious pathway in the genus (Billard et al., 2005b). North Atlantic dispersal. First, we speculate that an ances- The restricted range of F. spiralis in the North PaciWc tral hermaphroditic (see Engel et al., 2005; for discussion of (primarily around the US-Canadian border) suggests the moneicy and hermaproditism in Fucus) F. distichus ances- possibility of a human induced introduction (see also Lün- tor and F. spiralis ancestor (precursors to Lineages 1A and ing, 1990; Serrão et al., 1999). If an introduction is not the 2, respectively) both evolved in the North PaciWc from a case, then the only alternative explanations are: (1) wide- hermaphroditic Fucus ancestor, then dispersed through the spread extinction during the LGM, or (2) recent natural Arctic Ocean and radiated within the North Atlantic dispersal from the North Atlantic. (Fig. 6). The alternative scenario postulates that only the F. If widespread extinction of F. spiralis occurred during distichus ancestor existed in the North PaciWc, which dis- the LGM, its modern distribution may result from pro- persed into the North Atlantic and radiated into Lineages 1 cesses similar to that reported for the intertidal gastropod and 2. Implicit in the latter scenario is a second trans-Arctic Nucella in the northeastern PaciWc (Marko, 2004). Despite dispersal or introduction, namely F. spiralis from the North identical life history and larval dispersal potential, northern Atlantic to the North PaciWc. populations of the high intertidal N. ostrina were character- From a dispersal standpoint, it is important to realize ized by lower haplotype diversity, no pattern of isolation by that: (1) both F. distichus and F. spiralis are hermaphro- distance, and lower population size, whereas northern populations of the low intertidal (and often sympatric) N. lamellosa revealed a diversity of ancient private haplotypes, signiWcant isolation by distance, and signiWcant regional subdivision of populations (Marko, 2004). The patterns are consistent with the hypothesis that high intertidal dwelling N. ostrina recently colonized the northeastern PaciWc following widespread population loss during the LGM due to more exposure to cold temperature stress in air during low tides, a stress that N. lamellosa was able to minimize because of its lower position in the intertidal and which is reXected in higher population structure and diversity (Marko, 2004). The hypothesis of substantial population reduction of high intertidal species relative to lower intertidal species is also supported by additional invertebrate and vertebrate species in the northeastern PaciWc (Arndt and Smith, 1998; Edmands, 2001; Hickerson and Ross, 2001; Hrincevich and Foltz, 1996; Kwast et al., 1990; Kyle and Boulding, 2000; see also the analysis in Marko, 2004). Similarly, as F. spiralis typically is conWned to the high intertidal throughout much of its extant range, it is conceiv- able that most populations in the North PaciWc could not have survived the stress of cold air temperatures during the LGM and subsequent post-LGM recolonization from the Fig. 6. Proposed scenarios of evolution and radiation in the genus Fucus. few surviving populations in the southern refugia was H, hermaphroditic; D, dioecious. Intertidal position indicated in upper retarded because of competition with other intertidal panel. Fucales (e.g., genera Pelvetia, Hesperophycus, Pelvetiopsis, 220 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 and Silvetia) and the Gigartinales (intertidal red algae). On Forbord, T. Gabrielsen, K. Gunnarsson, L. Hansen, the the other hand, the mid-to-low intertidal F. distichus was Harts (B., E., A., C.), G.V. Helgason, J.B. Heiser, A. Ingólfs- aVorded a refuge in depth during the LGM and their persis- son, L. Kautsky, H. Kawai, B. Konar, T. LeGoV, K.A. tent existence is revealed by extant high levels of haplotype Miller, R. Nielsen, A. Peters, T. Ranta, T. Reusch, F. Rindi, and nucleotide diversity. This scenario assumes that coloni- E. Serrão, M. Skage, N. Simon, P. Sjödin, A. Tatarenkov zation of the North Atlantic by the F. spiralis ancestor and (for DNA from F. radicans), R. Väinölä, A. Wagner, the F. distichus ancestor occurred before the LGM. Walkers (L., P., J.), J. Watson, and J.M. Weslawski. The The hypothesis that F. spiralis evolved in the North study was supported in part by the BIOBASE Project Atlantic and dispersed naturally into the North PaciWc funded under EU MAST III (Control Number PL97-1267), seems unlikely. If dispersal occurred before the LGM, then the IHP (Improving Human Potential) Programme of the the high intertidal species most likely would have been European Commission (for work at the Sandgerði Marine forced into southern refugia along the western North Center in Iceland), the Foundation of Earth- and Life-Sci- American coast during the LGM, with subsequent recolo- ence (ALW) funded by the Netherlands Organization for nization of the northern areas after the ice receded. In this the Advancement of Research (NWO) (Grant No. case, a greater divergence in mtDNA sequences would be 813.04.008), and a Marie Curie Individual Fellowship expected between extant PaciWc and Atlantic populations QLK3-CT-2000-52053 (M.-P.O.-L.S). than what is observed. If on the other hand, dispersal occurred after the LGM, one would expect the species to be References distributed throughout the North PaciWc, not in the restricted pattern currently observed: absent from the Arc- Abbott, I.A., Hollenberg, G.J., 1976. Marine Algae of California. Stanford tic and Japan (Lüning, 1990), rare along the Aleutians University Press, Stanford. 827 pp. (pers. comm., K.A. Miller), absent or rare in southeastern Arndt, A., Smith, M.J., 1998. Genetic diversity and population structure in Alaska (pers. comm., S. Lindstrom), and common in the two species of sea cucumber: diVering patterns according to mode of British Columbia—Washington State area (Norris and development. Mol. Ecol. 7, 1053–1064. Baker, H.G., 1955. Self-compatibility and establishment after “long-dis- Conway, 1974). The extant distribution further argues tance” dispersal. Evolution 9, 347–349. against any current connectivity between the North PaciWc Barraclough, T.G., Nee, S., 2001. Phylogenetics and speciation. Trends and North Atlantic through the Bering Strait. Ecol. Evol. 16, 391–399. Regardless of whether a single (scenario 1) or double Barriel, V., 1994. Molecular phylogenies and nucleotide insertion-deletion. (scenario 2) trans-Arctic event involving an ancestral F. dis- CR Acad. Sci. III 317, 693–701. Berger, R., Malm, T., Kautsky, L., 2001. Two reproductive strategies in tichus and/or F. spiralis is postulated, the divergence of the Baltic Fucus vesiculosus (Phaeophyceae). Eur. J. Phycol. 36, 265–273. two lineages is strikingly similar (Fig. 6). Each contains her- Bergström, L., Tatarenkov, A., Johannesson, K., Jönsson, R.B., Kautsky, maphroditic and dioecious species in which the hermaphro- L., 2005. Genetic and morphlogical identiWcation of Fucus radicans sp. ditic species (F. spiralis, F. distichus) have both PaciWc and nov. (Fucales, Phaeophyceae) in the brackish Baltic Sea. J. Phycol. 41, Atlantic distributions. Furthermore, with respect to habitat, 1025–1038. Billard, E., Dauguin, C., Pearson, G.A., Serrão, E., Engel, C.R., Valero, M., each lineage has reciprocally specialist species (F. 2005a. Genetic isolation between three closely related taxa: Fucus vesi- spiralisD high intertidal; F. serratus D low intertidal/sub- culosus, F. spiralis and F. ceranoides. J. Phycol. 41, 900–905. tidal) and generalist species (F. vesiculosus D high to low Billard, E., Serrão, E., Pearson, G.A., Engel, C.R., Destombe, C., Valero, intertidal, with constant submergence in the Baltic, and M., 2005b. Analysis of sexual penotype and prezygotic fertility in natu- marine to brackish salinities; F. distichus D high intertidal ral populations of F. spiralis, F. vesiculosus (Fucaceae, Phaeophyceae) and their putative hybrids. Eur. J. Phycol. 40, 397–407. pools to low intertidal). Billard, E., Serrão, E.A., Pearson, G.A., Engel, C.R., Destombe, C., Valero, In conclusion, Fucus oVers many challenges to biologists M., 2005c. Hybridisation in the Fucus spiralis/F. vesiculosus species interested in phylogeny, phylogeography, and speciation. complex (Fucaceae, Phaeophyceae): sexual phenotype and prezygotic As conventional neutral loci are complemented with loci fertility. Eur. J. Phycol. 40, 397–407. known to be experiencing selection, the number and com- Brawley, S., 1992. Fertilization in natural populations of the dioecious brown alga Fucus ceranoides and the importance of the polyspermy plexity of Fucus entities is expected to increase, thereby block. Mar. Biol. (Berlin) 113, 145–157. revealing a more accurate picture of the rapidly evolving BrookWeld, J.F.Y., 2002. Review of Genes, Categories, and Species by Jody genus. Hey. Genet. Res. 79, 107–108. Burrows, E.M., Lodge, S.M., 1953. Culture of Fucus hybrids. Nature (Lon- Acknowledgments don) 172, 1009–1010. Clayton, M.N., 1984. Evolution of the Phaeophyta with particular refer- ence to the Fucales. In: Round, F.E., Chapman, D.J. (Eds.), Progress in We gratefully acknowledge S. Lindstrom, K.A. Miller, S. Phycological Research. Biopress, Bristol, pp. 11–46. Murray, and J. Rueness for insightful comments. We are Coleman, M.A., Brawley, S., 2005a. Spatial and temporal variability in dis- indebted also to the following colleagues for assistance and/ persal and population genetic structure of a rockpool alga. Mar. Ecol. or samples from throughout the Northern Hemisphere: C. Prog. Ser. 300, 63–77. Coleman, M.A., Brawley, S.H., 2005b. Are life history characteristics good Alstrom-Rapaport, K. Van Alstyne, J. Bangsholt, C. Bat- predictors of genetic diversity and structure? A case study of the inter- telli, J.A. and J.L. Berges, L. Bergström, E. Boon, N. Brady, tidal alga Fucus spiralis (Heterokontophyta; Phaeophyceae). J. Phycol. E. Calvert, M. Chevolot, M. Denny, C. Engel, J. Fehling, S. 41, 753–762. J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222 221

Coyer, J.A., Peters, A.F., Hoarau, G., Stam, W.T., Olsen, J.L., 2002a. Inher- Leclerc, M.C., Barriel, V., Lecointre, G., de Reviers, B., 1998. Low diver- itance patterns of ITS1, chloroplasts, and mitochondria in artiWcial gence in rDNA ITS sequences among Wve species of Fucus (Phaeophy- hybrids of the marine rockweeds, Fucus serratus and F. evanescens ceae) suggests a very recent radiation. J. Mol. Evol. 46, 115–120. (Heterokontophyta; Fucaceae). Eur. J. Phycol. 37, 173–178. Lee, W.L., Yoon, H.S., Boo, S.M., 1998. Phylogenetic relationships of Pel- Coyer, J.A., Peters, A.F., Hoarau, G., Stam, W.T., Olsen, J.L., 2002b. vetia and Pelvetiopsis (Phaerophyceae) based on small subunit ribo- Hybridisation of the marine seaweeds, Fucus serratus and F. evanescens somal DNA sequences. J. Plant Biol. 41, 103–109. (Heterokontophyta; Phaeophyceae) in a century-old zone of secondary Lein, T.E., 1984a. Hybrider mellom sagtang (Fucus serratus L.) og gjelv- contact. Proc. R. Soc. Lond. B. 269, 1829–1834. tang (Fucus distichus subsp. edentatus (Pyl.) Powell) i indre Oslofjord. Coyer, J.A., Veldsink, J.H., Stam, W.T., Olsen, J.L., 2002c. Characterization Blyttia 42, 71–77. of microsatellite loci in the marine rockweeds, Fucus serratus and F. Lein, T.E., 1984b. Distribution, reproduction, and ecology of Fucus cerano- evanescens (Heterokontophyta; Fucaceae). Mol. Ecol. Notes 2, 35–37. ides L. in Norway. Sarsia 69, 75–81. Coyer, J.A., Peters, A.F., Stam, W.T., Olsen, J.L., 2003. Post-ice age recolo- Lindstrom, S.C., 2001. The Bering Strait connection: dispersal and specia- nization and diVerentiation of Fucus serratus L. (Fucaceae: Pha- tion in boreal macroalgae. J. Biogeogr. 28, 243–251. eophyta) populations in Northern Europe. Mol. Ecol. 12, 1817–1829. Lüning, K., 1990. Seaweeds: Their Environment, Biogeography and Eco- Coyer, J.A., Hoarau, G., Stam, W.T., Olsen, J.L., 2004. Geographically-spe- physiology. John Wiley, NY. 537 pp. ciWc heteroplasmy of mitochondrial DNA in the seaweed, Fucus serra- Mallet, J., 2005. Hybridization as an invasion of the genome. Trends Ecol. tus (Heterokontophyta: Phaeophyceae, Fucales). Mol. Ecol. 13, 1323– Evol. 20, 229–237. 1326. Malm, T., Kautsky, L., Engkvist, R., 2001. Reproduction, recruitment and Coyer, J.A., Hoarau, G., Skage, M., Stam, W.T., Olsen, J.L., 2006. Origin of geographical distribution of Fucus serratus L. in the Baltic Sea. Bot. Fucus serratus (Heterokonotophyta; Fucaceae) populations on Iceland Mar. 44, 101–108. and The Faroes: a microsatellite-based assessment. Eur. J. Phycol., in press. Marko, P.B., 2004. What’s larvae to do with it? Disparate patterns of post- Coyne, J.A., Orr, H.A., 2004. Speciation. Sinauer Associates, Sunderland, glacial population structure in two benthic marine gastropods with MA. identical dispersal potential. Mol. Ecol. 13, 597–611. Edmands, S., 2001. Phylogeography of the intertidal copepod Tigriopus McLachlan, J., Chen, C.-M., Edelstein, T., 1971. The culture of four species californicus reveals substantially reduced population diVerentiation at of Fucus under laboratory conditions. Can. J. Bot. 49, 1463–1469. northern latitudes. Mol. Ecol. 10, 1743–1750. Munda, I.M., Kremer, B.P., 1997. Morphological variation and population Engel, C.R., Brawley, S., Edwards, K.J., Serrão, E., 2003. Isolation and structure of Fucus spp. (Phaeophyta) from Helgoland. Nova Hedwigia cross-species ampliWcation of microsatellite loci from the fucoid sea- 64, 67–86. weeds Fucus vesiculosus, F. serratus, and Ascophyllum nodosum(Hetero- Norris, R.E., Conway, E., 1974. Fucus spiralis L. in the northeast PaciWc. kontophyta, Fucaceae). Mol. Ecol. Notes 3, 180–182. Syesis 7, 79–81. Engel, C.R., Daguin, C., Serrão, E., 2005. Genetic entities and mating sys- Olsen, J.L., Stam, W.T., Coyer, J.A., Reusch, T.B.H., Billingham, M., tem in hermaphroditic Fucus spiralis and its close dioecious relative F. Boström, C., Calvert, E., Christie, H., Granger, S., La Lumière, R., vesiculosus (Fucaceae, Phaeophyceae). Mol. Ecol. 14, 2033–2046. Milchakova, N., Oudot-Le Secq, M.-P., Procaccini, G.A., Sanjabi, Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: B., Serrão, E., Veldsink, J.H., Widdicombe, S., Wyllie-Echeverria, S., frequences, causes, and consequences, with insights from animal mito- 2004. North Atlantic phylogeography and large-scale population chondrial DNA. Annu. Rev. Ecol. Syst. 34, 397–423. diVerentiation of the seagrass Zostera marina L. Mol. Ecol. 13, Gard, M., 1910. Sur un hybride de Fucus platycarpus et Fucus ceranoides. 1923–1941. CR Acad. Sci. III 151, 888–890. Oudot-Le Secq, M.-P., Fontaine, J.-M., Rousvoal, S., Kloareg, B., Loi- Grant, W.S., Bowen, B.W., 1998. Shallow population histories in deep evo- seaux-de Goër, S., 2001. The complete sequence of a brown algal mito- lutionary lineages of marine Wshes: insights from sardines and ancho- chondrial genome, the Ectocarpale Pylaiella littoralis (L.) Kjellm. J. vies and lessons for conservation. J. Hered. 89, 415–426. Mol. Evol. 53, 80–88. Hickerson, M.J., Ross, J.R.P., 2001. Post-glacial population history and Oudot-Le Secq, M.-P., Kloareg, B., Loiseaux-de Goër, S., 2002. The mito- genetic structure of the northern clingWsh (Gobbiesox maeandricus), chondrial genome of the brown alga Laminaria digitata: a comparative revealed from mtDNA analysis. Mar. Biol. (Berlin) 138, 407–419. analysis. Eur. J. Phycol. 37, 163–172. Hoarau, G., Coyer, J.A., Stam, W.T., Olsen, J.L., 2005. Post-glacial recolo- Oudot-Le Secq, M.-P., Loiseaux-de Goër, S., Stam, W.T., Olsen, J.L., 2006. nization patterns in the brown seaweed, Fucus serratus. European Soci- Complete mitochondrial genomes of the three brown algae (Hetero- ety for Evolutionary Biology, Krakow, Poland. konta: Phaeophyceae) Dictyota dichotoma, Fucus vesiculosus, and Des- Hrincevich, A.W., Foltz, D.W., 1996. Mitochondrial DNA sequence varia- marestia viridis. Curr. Genet. 49, 47–58. tion in a sea star (Leptasterius spp.) species complex. Mol. Phylogenet. Pannell, J., Barrett, S.C.H., 1998. Baker’s law revisited: reproductive assur- Evol. 6, 408–415. ance in a metapopulation. Evolution 52, 657–668. Jordan, A.J., Vadas, R.L., 1972. InXuence of environmental parameters on Pearson, G., Brawley, S., 1996. Reproductive ecology of Fucus distichus intraspeciWc variation in Fucus vesiculosus. Mar. Biol. (Berlin) 14, 248–252. (Phaeophyceae): an intertidal alga with successful external fertilization. Kalvas, A., Kautsky, L., 1993. Geographical variation in Fucus vesiculosus Mar. Ecol. Prog. Ser. 143, 211–223. morphology in the Baltic and North Seas. Eur. J. Phycol. 28, 85–91. Posada, D., Crandall, K.A., 1998. ModelTest: testing the model of DNA Kalvas, A., Kautsky, L., 1998. Morphological variation in Fucus vesiculo- substitution. Bioinformatics 14, 817–818. sus populations along temperature and salinity gradients in Iceland. J. Powell, H.T., 1963. Speciation in the genus Fucus L. and related genera. Mar. Biol. Ass. UK 78, 985–1001. Syst. Assoc. Publ. 5, 63–77. Khfaji, A.K., Norton, T.A., 1979. The eVects of salinity on the distribution Provan, J., Wattier, R.A., Maggs, C.A., 2005. Phylogeographic analysis of of Fucus ceranoides.. Estuar. Coast. Mar. Sci. 8, 433–439. the red seaweed Palmaria palmata reveals a Pleistocene marine glacial Kitcher, P., 1984. Species. Philos. Sci. 51, 308–333. refugium in the English Channel. Mol. Ecol. 14, 793–804. Knight, M., Parke, M., 1950. A biological study of Fucus vesiculosus L. and Ronquist, F.R., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phyloge- F. serratus L. J. Mar. Biol. Ass. UK 29, 439–514. netic inference under mixed models. Bioinformatics 19, 1572–1574. Kwast, K.E., Foltz, D.W., Stickle, W.B., 1990. Population genetics and sys- Rousseau, F., Leclerc, M.-C., de Reviers, B., 1997. Molecular phylogeny of tematics of the Leptasterius hexactis (Echinodermata, Asteroidea) spe- European Fucales (Phaeophyceae) based on partial large-subunit cies complex. Mar. Biol. (Berlin) 105, 477–489. rDNA sequence comparisons. Phycologia 6, 436–438. Kyle, C.J., Boulding, E.G., 2000. Comparative population genetic structure Rozas, J., Sánchez-DelBarrio, C., Messeguer, X., Rozas, R., 2003. DnaSP, of marine gastropods (Littorina spp.) with and without pelagic larval DNA polymorphism analysis by the coalescent and other methods. dispersal. Mar. Biol. (Berlin) 137, 835–845. Bioinformatics 19, 2496–2497. 222 J.A. Coyer et al. / Molecular Phylogenetics and Evolution 39 (2006) 209–222

Ruuskanen, A., Bäck, S., 1999. Morphological variation of northern Baltic Stomps, T.J., 1911. Etudes topographiques sur la variabilité de Fucus vesi- Sea Fucus vesiculosus L. Ophelia 59, 43–59. culosus L. platycarpus Thur., et ceranoides L. Recueil de l’Institut Bota- Sauvageau, C., 1909. Sur l’hybride des Fucus vesiculosus et Fucus serratus. nique “Leo Errera”, Bruxelles 8, 326–377. Comptes Rendus de la Société de Biologie, Paris 67, 832–833. SwoVord, D.L., 2002. PAUP: Phylogenetic Analysis Using Parsimony (¤ Scott, G.W., Hardy, F.G., 1994. Observations of the occurrence of hybrids and other methods) 4.0 Beta. Sinauer, Sunderland, MA. between two sympatric species of fucoid algae. Crypto. Algol. 15, 297–305. Tatarenkov, A., Bergström, L., Jönsson, R.B., Serrão, E.A., Kautsky, Scott, G.W., Hull, S.L., Hornby, S.E., Hardy, F.G., Owens, N.J.P., 2001. L., Johannesson, K., 2005. Intriguing asexual life in marginal popu- Phenotypic variation in Fucus spiralis (Phaeophyceae): morphology, lations of the brown seaweed Fucus vesiculosus. Mol. Ecol. 14, chemical phenotype and their relationship to the environment. Eur. J. 647–651. Phycol. 36, 43–50. Tracy, M., Freeman, D.C., Emlen, J., Graham, J., Hough, R.A., 1995. Serrão, E.A., Alice, L.A., Brawley, S.H., 1999. Evolution of the Fucaceae Developmental instability as a biomonitor of environmental stress: an (Phaeophyceae) inferred from nrDNA-ITS. J. Phycol. 35, 382–394. illustration using aquatic plants and macroalgae. In: Butterworth, F., Sideman, E.J., Mathieson, A.C., 1983a. Ecological and genealogical dis- Villalobos-Pietrini, R., Gonsebatt, M. (Eds.), Biomonitors and Bio- tinctions of a high intertidal, dwarf form of Fucus distichus (L.) Powell. markers as Indication of Environmental Change. Plenum Press, New J. Exp. Mar. Biol. Ecol. 72, 171–188. York, p. 348. Sideman, E.J., Mathieson, A.C., 1983b. The growth, reproductive phenol- Wallace, A., Klein, A.S., Mathieson, A.C., 2004. Determining the aYnities ogy and longevity of non-tide pool Fucus distichus (L.) Powell in New of salt marsh fucooids using microsatellite markers: evidence of England. J. Exp. Mar. Biol. Ecol. 68, 111–127. hybridization and introgression between two species of Fucus (Pha- Sideman, E.J., Mathieson, A.C., 1985. Morphological variation within and eophyta) in a Maine estuary. J. Phycol. 40, 1013–1027. between natural populations of non-tide pool Fucus distichus (Pha- Wynne, M.J., Magne, F., 1991. Concerning the name Fucus muscoides eophyta) in New England. J. Phycol. 21, 250–257. (Cotton) J. Feldmann et Magne. Crypto. Algol. 12, 55–65.