Universita' Degli Studi Di Padova

UNIVERSITA' DEGLI STUDI DI PADOVA

______SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE DELLE PRODUZIONI VEGETALI INDIRIZZO PROTEZIONE DELLE COLTURE - CICLO XX Dipartimento di Agronomia Ambientale e Produzioni Vegetali

INVESTIGATIONS ON THE PSYLLID (HEMIPTERA: PSYLLIDAE) VECTORS OF ‘ Candidatus Phytoplasma mali’ IN TRENTINO

Direttore della Scuola : Ch.mo Prof. Andrea Battisti

Supervisore : Ch.mo Prof. Vincenzo Girolami

Dottorando : Federico Pedrazzoli

DATA CONSEGNA TESI 2 febbraio 2009

To M. Elisabetta, an example of honesty, diligence and humanity

Declaration

I hereby declare that this submission is my own work and that, to the best of my knowledge and belief, it contains no material previously published or written by another person nor material which to a substantial extent has been accepted for the award of any other degree or diploma of the university or other institute of higher learning, except where due ac- knowledgment has been made in the text.

A copy of the thesis will be available at http://paduaresearch.cab.unipd.it/

Dichiarazione

Con la presente affermo che questa tesi è frutto del mio lavoro e che, per quanto io ne sia a conoscenza, non contiene materiale precedentemente pubblicato o scritto da un'altra perso- na né materiale che è stato utilizzato per l’ottenimento di qualunque altro titolo o diploma dell'università o altro istituto di apprendimento, a eccezione del caso in cui ciò venga rico- nosciuto nel testo.

Una copia della tesi sarà disponibile presso http://paduaresearch.cab.unipd.it/

Index

Index ...... 7 Summary...... 9 Riassunto ...... 13 Introduction...... 17 I. Phytoplasmas ...... 17 a) Morphology and ultrastructure...... 18 b) Molecular characterisation of phytoplasmas...... 19 c) Symptoms of phytoplasma-infected plants...... 20 d) Transmission and spread of phytoplasmas...... 20 e) Geographic and ecological distribution of phytoplasmas...... 21 f) Host specificity of phytoplasmas...... 22 g) Ecological niches and evolution of new phytoplasma strains ...... 23 h) Disease control ...... 24 II. Phytoplasma transmission by insect vectors...... 25 a) Taxonomic groups of phytoplasma vectors...... 26 b) Phytoplasma-insect vector interactions ...... 27 c) Phytoplasma-insect vector specificity...... 30 d) Transovarial transmission...... 32 e) Effects of phytoplasma on the vector ...... 32 f) Factors mediating the transmission efficiency ...... 34 g) Phytoplasma vector dispersal ...... 34 III. ‘Candidatus Phytoplasma mali’...... 37 a) Host plants...... 38 b) Symptoms...... 39 c) Diagnosis ...... 43 d) Transmission...... 47 e) The situation in Trentino ...... 48 IV. Transmission of ‘ Ca. Phytoplasma mali’ by psyllid vectors...... 49 a) The research on psyllid vectors in Trentino ...... 50 b) Other experiences ...... 52

7 c) Biology of psyllids ...... 54 d) Cacopsylla picta Förster (1848) ...... 60 e) Cacopsylla melanoneura Förster (1848) ...... 64 f) Biology of Cacopsylla picta and C. melanoneura in Trentino...... 69 V. Aims of the research ...... 71 VI. References...... 72 Chapter 1 Acquisition capacities of the overwintering adults of the psyllid vectors of 'Candidatus Phytoplasma mali' ...... 101 Chapter 2 Acquisition and transmission of ' Candidatus Phytoplasma mali' by its psyllid vectors in Trentino ...... 103 Chapter 3 Detection of ' Candidatus Phytoplasma mali' in different populations of Cacopsylla melanoneura Förster (Hemiptera: Psyllidae) ...... 133 Chapter 4 A preliminary study of the effects of ' Candidatus Phytoplasma mali' on the psyllid Cacopsylla melanoneura (Hemiptera: Psyllidae) ...... 149 Chapter 5 Characterization of microsatellite loci in Cacopsylla melanoneura Förster (Homoptera: Psyllidae) ...... 157 Chapter 6 Differences in populations of Cacopsylla melanoneura (Hemiptera, Psyllidae): insights from ecological and molecular studies ...... 161 Conclusions ...... 189 Aknowledgements...... 191

8 Summary

Phytoplasmas are cell wall-less, phloem-limited and so far uncultured bacteria which are associated with plant diseases of large economic impact. They are transmitted in a persistent propagative manner by phloem feeding insects like leafhoppers, planthoppers and psyllids. ‘Candidatus Phytoplasma mali’ is the etiological agent of apple proliferation (AP), a phytoplasma disease which may cause severe losses in many central-European apple growing regions including Trentino. AP can affect the vigour of the apple trees and fruits of infected trees can not be commercialised because of their small size and poor taste. Two psyllid species ( Cacopsylla picta and C. melanoneura ) and a leafhopper ( Fieberiella florii ) have been demonstrated to be able to transmit ‘ Ca . P. mali’. Whereas F. florii can be excluded as important vector of the disease in Trentino, contradictory data have been reported for the role of the two psyllid species in the natural disease spread. This research had therefore two specific aims: the study of the acquisition and transmission efficiencies of the two psyllid vectors and an analysis of the biology and genetics of populations of C. melanoneura applying bioassays and molecular tools. The acquisition and transmission efficiency of the different developmental instars of the two psyllids were studied in three consecutive years in experiments under controlled conditions, in which individuals were fed on micropropagated infected plants and then moved onto healthy test plants. The minimum acquisition access periods were established for the overwintered adults. After each trial, the insects were analysed by real-time PCR in order to estimate the phytoplasma level within the individuals. The experiments demonstrated that, in spite of a good acquisition efficiency found in all the developmental instars of the two species, only the nymphal stages and the new generation adults of C. picta were able to transmit the disease to healthy test plants. These results can be explained by a higher percentage of high-titre individuals found for C. picta but not for C. melanoneura . In contrast, overwintered adults of both species acquired the phytoplasma already after short acquisition access periods of one to four days, but no significant further multiplication after the acquisition was observed. Thus, these results revealed a relationship between the phytoplasma level in the individuals and their transmission efficiency and explain why C. picta is in Trentino a more efficient vector of AP than C. melanoneura .

9 Contradictory hypotheses have been proposed for the role of the oligophagous C. melanoneura in the epidemiology of AP. Therefore, the natural infection rate was studied by qualitative and quantitative PCR in overwintered adults collected from different plants (apple, hawthorn and conifers) in different areas (Trentino, Veneto, Aosta Valley and France). The analyses revealed different ratios of infected individuals among the different areas and even within the different areas of Trentino. Populations collected in northeastern Italy, where C. melanoneura was demonstrated to be an efficient vector, showed similar infection levels in samples collected from apple or hawthorn, while in Trentino only some populations captured on apple exhibited high natural infection rates. The presence of AP- infected individuals in samples collected on conifers demonstrates that the pathogen is retained within the insect body during winter. On the other hand, a positive correlation between the infection rate and the incidence of the disease in apple orchards was found indicating an acquisition of the phytoplasma within the same season. The effect of the infection of ‘ Ca. P. mali’ in C. melanoneura was studied in bioassays conducted under controlled conditions. The experiments demonstrated a detrimental effect of ‘ Ca. P. mali’ on the fitness of this psyllid species, affecting both the number of eggs laid and the hatching rate, whereas the survival of the overwintered adults and the development of the nymphal stages seemed not to be damaged. Detrimental effects of the pathogen on its vector may indicate a recent co-evolution between the phytoplasma and C. melanoneura as a vector. As for C. melanoneura two different host plants (hawthorn and apple) are known, host- switching experiments were carried out to investigate the relationships between the psyllid and the two plant species. This study revealed that the two populations are dependent on their native host plant for egg laying and also for the development of the juvenile instars. A molecular approach was therefore applied to assess the genetic bases of these differences. The genetic variability of the populations was studied using microsatellite markers developed for C. melanoneura and DNA sequences from the mitochondrial cytochrome oxidase subunit I. Data obtained from microsatellite analyses indicate a low, but statistically significant difference between the ‘apple’ and the ‘hawthorn’ populations. Mitochondrial DNA diversity was too low to differentiate the two populations. Furthermore, a genetic boundary was found separating the Aosta Valley populations from the others. Behavioural and ge-

10 netic results indicate a differentiation among C. melanoneura populations linked to the host plants. In conclusion, C. picta was confirmed as most efficient vector of AP whereas the contradictory data reported previously for C. melanoneura could be attributed to the existence of different populations with different transmission efficiencies and to a lower multiplication efficiency of the phytoplasma within the individuals of the Trentino population.

Riassunto

I fitoplasmi sono batteri floematici privi di parete cellulare, non coltivabili in vitro , che possono indurre malattie alle piante e quindi gravi danni economici. Sono trasmessi in mo- do persistente propagativo da insetti fitomizi, come cicadellidi, cixiidi e psillidi. ‘ Candida- tus Phytoplasma mali’ è l’agente eziologico degli scopazzi del melo (apple proliferation- AP), una malattia fitoplasmatica in grado di danneggiare molte regioni melicole dell’Europa centrale, incluso il Trentino. AP può alterare il vigore delle piante di melo e i frutti delle piante infette, a causa delle ridotte dimensioni e dello scarso sapore, perdono il loro valore commerciale. È stato dimostrato che due specie di psilla ( Cacopsylla picta e C. melanoneura ) ed una cicalina ( Fieberiella florii ) sono coinvolte nella trasmissione di ‘ Ca. Phytoplasma mali’. Mentre il ruolo di F. florii nell’epidemiologia di AP in Trentino non sembra essere rilevante, i dati sul coinvolgimento delle due psille sono contraddittori. Que- sta ricerca ha avuto perciò due scopi precisi: lo studio dell’efficienza di acquisizione e trasmissione nelle due psille e un approfondimento della biologia e delle differenze genetiche di popolazioni di C. melanoneura attraverso saggi biologici e mediante indagini molecolari. L’efficienza di acquisizione e di trasmissione nei diversi stadi di sviluppo delle due psille sono state studiate durante tre anni consecutivi in esperimenti condotti in condizioni controllate, in cui gli individui sono stati posti su piantine di melo infette micropropagate e successivamente spostati su piantine sane. Per gli adulti svernanti è stato stabilito il minimo periodo di acquisizione utile per infettare gli insetti. Dopo ogni esperimento gli insetti sono stati analizzati singolarmente in real-time PCR per quantificarne il livello di fitoplasma. Dagli esperimenti è risultato che, nonostante la buona efficienza di acquisizione riscontrata in tutti gli stadi di sviluppo delle due specie, solo gli stadi ninfali e gli adulti di nuova gene- razione di C. picta erano in grado di trasmettere la malattia alle piantine sane. Questi risultati possono trovare una spiegazione nell’elevata percentuale di individui con un alto livello di fitoplasma riscontrata in C. picta rispetto a C. melanoneura . Al contrario, gli adulti svernanti di entrambe le specie hanno dimostrato di acquisire il fitoplasma in periodi di tempo brevi (1-4 giorni), ma dopo l’acquisizione non è stata osservata negli insetti una significativa moltiplicazione del patogeno. Questi risultati hanno evidenziato una relazione tra il livello di fitoplasma presente negli insetti e la loro efficienza di trasmissione, da cui si può spie- gare il perché C. picta , in Trentino, sia un vettore più efficiente di C. melanoneura .

13 Per quanto riguarda il ruolo di C. melanoneura , specie oligofaga, nell’epidemiologia di AP sono state avanzate differenti ipotesi, tra loro contrastanti. Per questo motivo è stato studiato mediante PCR qualitativa e quantitativa il livello di infezione naturale in adulti svernanti raccolti da diverse piante (melo, biancospino e conifere) in differenti aree geogra- fiche (Trentino, Veneto, Valle d’Aosta, Francia). Le analisi hanno rivelato che le percentuali di individui infetti variano nelle diverse aree campionate e in Trentino persino in zone diverse. Le popolazioni provenienti dall’Italia nord-occidentale, dove si è dimostrato che questa specie è un vettore efficiente, hanno mostrato livelli di infezione simili in campioni raccolti su melo e su biancospino, mentre in Trentino solo alcune popolazioni, tra quelle rac- colte su melo, hanno mostrato elevate percentuali di individui infetti. La presenza del patogeno in individui raccolti su conifere dimostra che esso si mantiene all’interno dell’insetto durante l’inverno. D’altra parte, la correlazione riscontrata tra la percentuale di individui infetti e l’incidenza della fitoplasmosi nei meleti indicherebbe che gli adulti svernanti possono acquisire il fitoplasma anche una volta giunti nel frutteto. L’effetto dell’infezione di ‘ Ca. Phytoplasma mali’ sulle psille è stato studiato mediante prove biologiche condotte con C. melanoneura , in condizioni controllate. Gli esperimenti hanno dimostrato un effetto negativo del patogeno sulla fitness di questa specie poiché il numero di uova deposte e il tasso di schiusura delle uova diminuivano, mentre la sopravvi- venza degli adulti svernanti e lo sviluppo degli stadi giovanili non sembravano danneggiati dalla presenza del fitoplasma. L’effetto negativo di un patogeno sul suo vettore è una possibile indicazione di una recente co-evoluzione tra ‘ Ca. Phytoplasma mali’ e C. melanoneura . Poiché per C. melanoneura sono note due piante ospite (biancospino e melo), sono stati condotti esperimenti di host-switching per indagare le relazioni tra la psilla e le due specie vegetali. Questo studio ha dimostrato che entrambe le popolazioni sono dipendenti dal loro ospite primario sia per l’oviposizione, sia per lo sviluppo degli stadi ninfali. Per questo motivo è stato seguito un approccio molecolare per cercare di comprendere le basi genetiche di queste differenze. La variabilità genetica delle popolazioni è stata studiata mediante marker microsatelliti sviluppati per C. melanoneura e l’analisi delle sequenze del DNA mitocondriale (subunità I della citocromo ossidasi). I dati derivanti dai microsatelliti indicano una piccola, ma significativa, differenza tra la popolazione proveniente da melo e quella prove-

14 niente da biancospino. Le differenze nel DNA mitocondriale si sono rivelate troppo piccole per differenziare le due popolazioni. Inoltre è stata identificata una barriera genetica che se- para la popolazione della Valle d’Aosta da quelle di altre aree. Questi risultati di etologia e genetici indicano un differenziamento nelle popolazioni di C. melanoneura che è correlato alla pianta ospite. In conclusione, C. picta è stata dimostrata come specie con la più elevata efficienza di trasmissione di AP mentre i dati discordanti finora riportati per C. melanoneura , possono essere attribuiti all’esistenza di differenti popolazioni con differenti efficienze di trasmissione ed a una minore efficienza di moltiplicazione del fitoplasma all’interno delle popolazioni trentine.

Introduction

I. Phytoplasmas

Many different yellows, dwarf and witches' broom diseases caused by phytoplasmas occur throughout the world (Hogenhout et al. , 2008). Mulberry dwarf disease was first observed in Japan during the Tokugawa Period (1603-1868), and spread widely causing severe damage to mulberry plants (Okuda, 1972). Cases of paulownia witches' broom disease, rice yellow dwarf disease and yellows diseases have been reported since the early 1900s (Kunkel, 1926; Lee et al., 2000; Okuda, 1972). The causal agent of these diseases was thought to be a virus, because it could not be cultured in artificial media, was insect transmitted and the symptoms were often similar to those of viral diseases (Doi et al., 1967; Lee et al., 2000). However, no virus particles could consistently be visualised in diseased tissues or isolated from infected plants (Lee et al. , 1992a). The first evidence that some plant diseases are caused by non helical wall-less bacteria that morphologically resemble mycoplasmas was presented by Doi et al. (1967), which detected by electron microscopy mycoplasma-like bodies in a mulberry plant showing yellows symptoms. This finding led to a drastic change in the understanding of the etiology of many other yellows, dwarf and witches’ broom diseases (Hogenout et al. , 2008). As the structures that Doi et al. (1967) observed were similar to mycoplasmas observed in veterinary laboratories (Iida, 1972), the term ‘mycoplasma-like organisms’ (MLOs) was used to refer to the causal agents of several hundred plant syndromes, including those that turned out later to be phytoplasmas or spiroplasmas (Firrao et al. , 2004; Lee & Davis, 1992; McCoy et al., 1989). In 1989, the 16S rRNA gene sequence from a MLO (Oenothera vires- cence phytoplasma) belonging to the aster yellows group was compared with those of some species belonging to the class Mollicutes ( Acholeplasma laidlawii , Spiroplasma citri and several mycoplasmas) (Lim & Sears, 1989). Based on this analysis, it was suggested that the phytopathogenic MLO was a member of the class Mollicutes . These results were also confirmed by analysing several ribosomal protein (rp) sequences (Lim & Sears, 1991a,

17 1992; Toth et al., 1994) and 16S rRNA gene sequences from further MLOs (Gundersen et al. , 1994; Kirkpatrick et al. , 1994; Kuske & Kirkpatrick, 1992; Lim & Sears, 1989; 1991b; Namba et al. , 1993a, b; Seemüller et al., 1994). Phylogenetic analyses based on various conserved genes confirmed that MLOs represent a clearly distinct, monophyletic clade within the class Mollicutes , which encompasses small pleiomorphic bacteria that have di- verged from a Gram-positive ancestor, most likely a Clostridium or Lactobacillus spp., through genome reductions and the loss of the outer cell wall (Gundersen et al., 1994; Jomantiene et al. , 1998; Kuske & Kirkpatrick, 1992; Lee et al. , 1998, 2000; Lim & Sears, 1989; Namba et al., 1993b; Seemüller et al., 1994; Toth et al., 1994; Weisburg et al., 1989; Woese, 1987). Other members of the class Mollicutes include mycoplasmas, ureaplasmas, spiroplassmas and acholeplasmas (Razin et al. , 1998). In 1994, the trivial name ‘phytoplasma’ was adopted by the Phytoplasma Working Team at the 10th Congress of the Inter- national Organization of Mycoplasmology and subsequently used (Hogenhout et al. , 2008). Recently, it was proposed to place phytoplasmas within the novel genus ‘ Candidatus ( Ca. ) Phytoplasma’ (Firrao et al. , 2004). a) Morphology and ultrastructure of phytoplasmas Phytoplasmas are bacteria surrounded by a single unit membrane, but lacking rigid cell walls, and are sensitive to the antibiotic tetracycline (Doi et al. , 1967). They contain plasma, ribosomes and DNA strands. Their genome is small, averaging ~750 kb (Bai et al. , 2006; Gundersen et al. , 1996; Marcone et al. , 1999; Neimark & Kirkpatrick, 1993; Oshima et al. , 2004). Although phytoplasmas, in single cross sections, appear as rounded pleiomorphic bodies with an average diameter ranging from 200 to 800 m, other studies revealed a filamentous morphology, but their exact shape in diseased plants is unknown. Phytoplas- mas (and the three insect-transmitted plant pathogenic Spiroplasma spp.) have a unique biology among plant pathogenic bacteria, because they require replication in diverse hosts, plants (Kingdom Plantae) and insects (Kingdom Animalia), for their survival and spread in nature (Hogenhout et al. , 2008). In plants, phytoplasmas are found mainly in phloem sieve elements, mainly near the sieve plates, including both mature sieve tubes devoid of nuclei and immature phloem cells that still have nuclei. As phloem cells are living cells, this may be considered an intracellular collocation. In sap-sucking insect vectors, phytoplasmas must traverse insect gut cells, replicate in various tissues of the insect and traverse the salivary

18 gland cells in order to reach the saliva for subsequent introduction into plants. They can be found intra- and extracellularly in the insect tissues. Hence, phytoplasmas are intracellular as well as extracellular pathogens/symbionts of plants and insects (Hogenhout et al. , 2008; Kirkpatrick, 1991). b) Molecular characterisation of phytoplasmas Phytoplasmas, unlike most human and animal mycoplasmas, can not be cultured in vitro in cell-free artificial culture media. The phytoplasma genome reductions in fact resulted in the loss of most metabolic pathways, including those for ATP synthesis by F 0F1-type ATP synthases, and amino acid and nucleotide synthesis (Bai et al., 2006; Oshima et al., 2004). Phytoplasmas have to obtain these essential metabolites from their hosts, and hence will require these metabolites in their culture media as well (Hogenhout et al. , 2008). Therefore, they have not been proven to be causal agents according to Koch’s postulates. Nevertheless, MLOs are accepted now as the causal agent of the diseases, since they have been found only in diseased plants, and their occurrence correlates with experimental transmission of the disease (Fridlund, 1989). Traditionally, the identification and classification of phytoplasmas were based primarily on biological properties such as symptoms, plant host range and relationships with insect vectors (Chiykowski, 1991; Chiykowski & Sinha, 1989; Errampalli et al. , 1991; Kunkel, 1926; Shiomi & Sugiura, 1984). Recent advances in molecular-based biotechnology allowed to gain new knowledge about phytoplasmas and to develop systems for their accurate identification and classification (Lee et al. , 2000). Mono- and polyclonal antibodies as well as molecular probes, such as cloned phytoplasma DNA fragments developed in the 1980s (Chen et al. , 1992; Lee & Davis, 1992), have been used for the detection of various phytoplasmas in plants and insects and to study their genetic interrelationships (Lee et al. , 2000). As mentioned above, phylogenetic analyses of 16S rRNA and ribosomal protein gene sequences definitively placed phytoplasmas as members of the class Mollicutes . Fur- thermore, the phylogenetic analyses formed the basis for a provisional taxonomic system for phytoplasmas. Subsequently, universal (generic) oligonucleotide primers based on conserved 16S rRNA gene sequences were designed and used in polymerase chain reaction (PCR) assays that allowed, for the first time, detection of a broad range of phytoplasmas associated with plants and insect vectors (Ahrens & Seemüller, 1992; Deng & Hiruki, 1991;

19 Gundersen & Lee, 1996; Lee et al. , 1993b; Namba et al. , 1993a; Schneider et al. , 1993). A comprehensive classification scheme was constructed based on restriction fragment length polymorphism (RFLP) patterns of PCR-amplified 16S rDNA sequences (Lee et al. , 1993b, 1994). For the first time, the identities of numerous phytoplasmas associated with hundreds of diseases were determined unambiguously. This progress has greatly facilitated the studies on both ecology and genomic diversity of phytoplasmas and the epidemiology and physiology of phytoplasma diseases. c) Symptoms of phytoplasma-infected plants Plants infected by phytoplasmas exhibit an array of symptoms that suggest profound dis- turbances in the normal balance of plant hormones or growth regulators (Chang, 1998; Chang & Lee, 1995; Lee & Davis, 1992; McCoy et al. , 1989). Symptoms include vires- cence (the development of green flowers and the loss of normal flower pigments), phyllody (the development of floral parts into leafy structures), sterility of flowers, proliferation of auxiliary or axillary shoots resulting in a witches' broom appearance, abnormal elongations of internodes resulting in slender shoots, generalized stunting (small flowers and leaves and shortened internodes), discolorations of leaves or shoots, leaf curling or cupping, bunchy appearance of growth at the ends of the stems, and generalized decline (stunting, die back of twigs, and unseasonal yellowing or reddening of the leaves). The symptoms induced in diseased plants vary with the phytoplasma and with the stage of infection. Internally, phytoplasma infections can cause extensive phloem necrosis and, often, excess formation of phloem tissue, resulting in swollen veins. In general, symptoms induced by phytoplasmas have a clearly detrimental effect on plants, although some plant species are tolerant or resistant to these pathogens. Such plants may be symptomless or exhibit mild symptoms. Eco- nomic losses caused by phytoplasma infections range from partial reduction in yield and quality to nearly total crop loss (Lee et al. , 2000). d) Transmission and spread of phytoplasmas Phytoplasmas are phloem-limited plant pathogens that are found in the sieve elements of infected plants. Phytoplasma diseases are primarily spread – as far as known - by sap- sucking insect vectors belonging to the families Cicadellidae (leafhoppers) and Fulgoridae (planthoppers) (Banttari & Zeyen, 1979; Brcák, 1979; Grylls, 1979; Nielson, 1979; Tsai, 1979). For more information, see section II. (Phytoplasma transmission by insect vectors).

20 Phytoplasmas may overwinter in infected vectors, as well as in perennial plants that serve as reservoirs of phytoplasmas. Phytoplasmas have been detected in most organs of infected plants, where they colonize the sieve tubes of the phloem. Infestations of floral tissue by phytoplasmas have been observed but thus far there is no substantial evidence for seed transmission because the sieve tubes lack a direct connection to the seed (Christensen et al. , 2005). However, the presence of phytoplasma DNA has been detected in embryo tissues, suggesting the possible potential for seed transmission which remains to be demonstrated (Cordova et al. , 2003). However, phytoplasmas can be spread by vegetative propagation through cuttings, stor- age tubers, rhizomes, or bulbs (Lee & Davis, 1992). Phytoplasmas that cause many orna- mental and fruit tree diseases apparently are spread by vegetative propagation. Phytoplas- mas can be transmitted through grafts; they cannot, however, be transmitted mechanically by inoculation with phytoplasma-containing sap. e) Geographic and ecological distribution of phytoplasmas Phytoplasmas have been associated with diseases in several hundred plant species belonging to 98 families and with numerous homopterous insect vectors, primarily belonging to the family Cicadellidea (Lee et al. , 2000). Geographically, the occurrence of phytoplasmas is worldwide and they have been reported in at least 85 nations (McCoy et al. , 1989). The recent development of specific molecular probes, sensitive PCR assays, and comprehensive classification schemes has greatly advanced the diagnostics of diseases caused by phytoplasmas. For the first time, the identities of phytoplasmas associated with a wide range of insect vectors and plant diseases can now be accurately determined and numerous diseases of previously unknown etiologies were found to be caused by phytoplasmas (Lee et al. , 2000). Evidently, similar symptoms can be induced by different types of phytoplasmas, whereas different types of symptoms can be induced by closely related phytoplasmas (Davis & Sinclair, 1998; Martini et al. , 1998). Recent results have revealed that phytoplasmas are more diverse than previously thought and that they are not distributed uniformly over all continents (Lee et al. , 1994; Seemüller et al. , 1998). Many seem to be restricted to one continent or to a specific geographical region. For example, the apple proliferation subgroups 16SrX-A and 16SrX-B and the stolbur subgroup 16SrXII-A are restricted to the

21 European continent (Lee et al. , 1992b). Geographical isolation of some phytoplasmas seems to be correlated with the distribution of their host plants and the insect vectors that are native in the particular region (Lee et al. , 2000). The uniqueness of the vegetation and insect species on a given continent or in a particular geographical region, however, tends to diminish as transcontinental or interregional activities increase. Micro- and macro-ecosystems on each continent can change owing to a lack of conservation or through the introduction of foreign germplasms (e.g. weeds and cultivated crops) and/or insects. Thus, the phytoplasma associated with an original host plant can become dispersed and redistributed throughout geographical regions or continents. Many phytoplasmas apparently have spread well beyond the regions where they originated, especially if similar vegetation and insect vectors existed in the new ecological niches. Some phytoplasmas [e.g. aster yellows (AY) phytoplasma subgroup 16SrI-B] have become dispersed worldwide, whereas others have become isolated in new ecological niches and have evolved independently from parental strains (Lee et al. , 2000). f) Host specificity of phytoplasmas The natural host ranges of phytoplasmas in insect vectors and plants vary with the phytoplasma strain (Brcák, 1979; McCoy et al. , 1989; Tsai, 1979). Experimentally, some phytoplasmas can be transmitted by polyphagous vector(s) to a wide range of host plants. For example, North American aster yellows phytoplasmas (16SrI-A, -B) were transmitted experimentally by the polyphagous leafhopper Macrosteles fascifrons Stål and other vectors to 191 plant species belonging to 42 families (McCoy et al. , 1989). However, it appears that the range of plant species that can be infected by a given phytoplasma in nature is determined largely by the number of insect vector species that are capable of transmitting the phytoplasma and by the feeding behaviours (monophagous, oligophagous, and polyphagous) of these vectors. Phytoplasmas which are transmitted by polyphagous insect vectors are capable of causing diseases in a wide variety of plant species, whereas phytoplasmas which are transmitted by the monophagous or oligophagous vectors cause diseases in only a few plant species (Lee et al. , 1992b). Experimentally, a given plant species can potentially be infected by more than one type of phytoplasma. For example, periwinkle can harbour many phytoplasmas and is therefore commonly used to maintain collections of phytoplasma isolates. However, in nature, the

22 ability for a given plant species to harbour more than one type of phytoplasma depends not only on its susceptibility to phytoplasma infection, but also on the vector-phytoplasma- plant interaction. In this three-way interaction, insect vectors appear to play an active role; their feeding behaviour and preference for certain host plants probably are, in most cases, the primary factors that determine the final niches for each phytoplasma (Lee et al. , 2000). g) Ecological niches and evolution of new phytoplasma strains Phytoplasmas with a wide range of host plants and insect vectors can have multiple ecological niches in nature. When various phytoplasmas share common vectors and/or host plants, the constituent phytoplasma populations in the common pool may fluctuate from one host (either plant or insect vector) to another because of the differential susceptibility of various plant and insect vector species to each phytoplasma. As a result, the predominant phytoplasma strains vary with different plant and insect hosts. Some phytoplasma strains, present in extremely low titres in one niche (host), may flourish in another ecological niche (Lee et al. , 1992b). Opportunities for these various phytoplasmas in the common pool to interact with one another and to exchange their genetic information may also contribute to the evolution of new strains. New strains that evolve within a given phytoplasma group may become isolated in new habitats, each with its own specific plant or insect vectors, which are rarely shared with other members of the group. Evidently, many subgroups have become associated with specific ecological niches (i.e. with specific plant hosts and insect vectors) (Lee et al. , 1992b). Hence, frequent interactions among constituent phytoplasma populations in a common pool and isolation of new strains in new habitats may predispose the formation of a widely diverse phytoplasma group that comprises many distinct subgroups. A given plant species or an insect vector potentially can harbour two or more distinct types of phytoplasmas. Mixed phytoplasma infections in a single plant are evident in nature (Alma et al. , 1996; Bianco et al. , 1993; Lee et al. , 1995; Lee et al. , 1993a; Lee et al. , 1998; Loi et al. , 1995; Marcone et al. , 1996b). The presence of dual or multiple phytoplasmas in a single plant has been verified convincingly by nested PCR assays with a universal primer pair followed by phytoplasma group-specific primer pairs (Alma et al. , 1996; Bianco et al. , 1993; Lee et al. , 1995, Lee et al. , 1993a). Such studies have revealed that a single plant is often infected by a predominant phytoplasma and by one or more other phytoplasmas that

23 are present in lower titres. Thus, frequent interactions among phytoplasmas within the same group or between groups may have occurred during evolution, possibly giving rise to new phytoplasma strains. Whether horizontal exchange of genetic information actually occurs among phytoplasma strains sharing common plant hosts and insect vectors is unclear. However, RFLP patterns of genomic DNA among some subgroups indicate that intermedi- ate strains that share DNA sequences across two subgroups may exist (Lee et al. , 1992a). For strains in some subgroups, however, horizontal gene transfer between subgroups may be unlikely or very limited because of their narrow ranges of plant and insect vector hosts. A major gap in knowledge of phytoplasma ecology is the lack of information about the insect hosts of phytoplasmas. Insect vectors are unknown for most phytoplasmas. h) Disease control In controlling phytoplasma diseases, the primary concern is often prevention rather than treatment. Phytoplasma-associated diseases have been managed by planting healthy stocks or disease-resistant varieties, through control of insect vectors, and by applying certain cultural practices to eliminate the sources of phytoplasmas. Among these disease management strategies, traditional vector control methods are in- sufficient to control the disease (Weintraub, 2007). Insecticidal control is never complete because not all vectors can be eliminated before transmitting the pathogen to healthy plants and this is true especially if insects have fed on infected plants before entering the crop. The cost of in-crop insecticides can be reduced by knowing when vectors are likely to arrive and applying only necessary sprays (D’Arcy & Nault, 1982). Even though chemical control of vectors will continue, vector management or management of phytoplasma spread within the plant is now shifting to habitat management, the use of genetically modified crops (Wein- traub & Beanland, 2006) and the exploitation of natural resistances in new breeding pro- grams. Habitat management can reduce pest incidence. The type of mulching materials used around the trees can influence the abundance of vectors (Howard & Oropeza, 1998). Also the identification and the increase of natural enemies can be used to manage the vector incidence (Weintraub & Beanland, 2006).

24 The breeding of disease-resistant cultivars may provide a more direct and efficient way to combat many phytoplasma diseases (Carraro et al. , 1998a; Sinclair et al. , 1997; Thomas & Mink, 1998). However, the introduction of disease-resistance genes to cultivated crops through traditional breeding is very time-consuming, and it has been difficult to identify resistance genes in crop plants or their close relatives. Recent advances in producing genetically engineered plants through gene-transferring vectors permit the speeding up of these breeding processes (Lee et al. , 2000). Introducing foreign genes or regulating the domestic genes in these transgenic plants could provide protection from the vector insects or the pathogenic phytoplasma. In the first case, transgenic plants may produce defensive compounds, for example plant lectins, that are toxic to vectors, reducing their survival, development and fecundity (Powell et al. , 1995; Nagadhara et al. , 2004). Also the rootstock may affect vector response to plants, by releasing volatiles that influence the reaction of insects (Sharon et al. , 2005). Alteration of the gene expressions of plants may also interfere with the growth of phytoplasmas and/or modify the host response to phytoplasma infections. As a result, disease symptoms may be attenuated. Expression of engineered antibodies in plants has shown some promise in controlling a phytoplasma disease (Chen et al. , 1994; Le Gall et al. , 1998).

II. Phytoplasma transmission by insect vectors

Insect vectors are the most important means of spread of plant viruses and mycoplasmalike and rickettsia-like organisms in nature, because only few of them are sufficiently stable to dispread on their own. Insects not only protect the pathogen, but also create feeding wounds that serve as entry points into susceptible plants. The evolutionary development of the close and complex relationships among plant hosts, insect vectors and these pathogens probably required aeons (D’Arcy & Nault, 1982).

25 a) Taxonomic groups of phytoplasma vectors Among all the insect species known, insects from only one order, the Hemiptera, stand out as successful vectors (Fig. 1). Unlike the Hemiptera, in the phytophagous insects from the holometabolous orders immature stages differ greatly from the adults, often showing different habitats and feeding behaviours. In the hemimetabolous Hemiptera, on the contrary, nymphs and adults feed similarly and are in the same physical location. In this group the highly adapted piercing-sucking mouthparts, with the rostrum arising from the posterior part of the head, allow a selective feeding in the mesophyll, phloem or xylem and therefore the transmission of the pathogens residing in these tissues (D’Arcy & Nault, 1982). Fur- thermore, their feeding is non-destructive, promoting successful inoculation of the plant vascular system without damaging conductive tissues and eliciting defensive responses (Weintraub & Beanland, 2006).

order HEMIPTERA

suborder Heteroptera Auchenorrhyncha Sternorrhyncha

infraorder Pentatomomorpha Cimicomorpha Cicadomorpha Fulgoromorpha Psyllomorpha

superfamily Pentatomoidea Tingoidea Membracoidea Fulgoroidea Psylloidea family Pentatomidae Tingidae Cicadellidae Cixiidae Psyllidae Delphacidae Derbidae Flatidae

Fig. 1 - Families of the Hemiptera involved in the phytoplasma transmission (modified from Weintraub & Beanland, 2006).

Phytoplasmas are phloem-limited; therefore, only phloem-feeding insects can potentially acquire and transmit the pathogen. However, within the groups of phloem-feeding insects, only a small number, primarily in three taxonomic groups, have been confirmed as vectors of phytoplasmas. The superfamily containing the largest number of vector species is the

26 Membracoidea, within which all known vectors to date are confined to Cicadellidae. The second largest group is the Fulgoromorpha, in which four families of vector species are found: Cixiidae, Delphacidae, Derbidae and Flatidae. The smallest suborder is Sternorrhyn- cha, in which only two genera in the Psyllidae are confirmed vectors. Cacopsylla spp. transmit AP group (16SrX) phytoplasmas to pome and stone fruit trees. The other psyllid genus has one vector species, Bactericera trigonica Hodkinson, which transmits a stolbur (Stål) (Sr16XII) phytoplasma to carrots (Font et al. , 1999). It was once believed that an insect must feed in the phloem in a non-destructive manner in order to transmit a phytoplasma, but there are heteropteran vectors that have a more destructive feeding pattern (Mitchell, 2004; Okuda et al. , 1998). Two heteropteran families, Pentatomidae and Tingidae, have confirmed vector species (Weintraub & Beanland, 2006). b) Phytoplasma-insect vector interactions Among the three transmission patterns known for the Hemipteran vectors (nonpersistent or styletborne, semipersistent and persistent or circulative), all phytoplasmas are transmitted in a persistent manner. The term “persistent” means that the insect remains inoculative for life (Fletcher et al. , 1998). The pathogen, acquired from the diseased plants, enters in the body cavity via the midgut, and thus is retained through molts. At this point, the phytoplasma circulates within the body of the vector [hence the term “circulative” introduced by Black (1959)] and usually has a latent period, that is a period of time during which no transmission occurs (D’Arcy & Nault, 1982). “Circulative-nonpropagative” has been used to describe pathogens that do not multiply in the vector, and “circulative-propagative” to describe pathogens that do. According to Watson & Roberts (1939), these pathogens can be retained in their vectors for long periods of time. Circulative-nonpropagative pathogens have shorter latent periods (a few hours or days) in their vectors than circulative-propagative ones (several days or weeks). A pathogen that multiplies is often retained for the life of the vector and is sometimes passed to progeny through transovarial transmission (D’Arcy & Nault, 1982). Multiplication may take place in both hemolymph and salivary glands (Fletcher et al. , 1998). Many pathogens transmitted in this manner, such as phytoplasmas, are confined to the phloem or xylem of plants and therefore cannot be transmitted mechanically.

27 Acquisition takes place passively during feeding in the phloem of infected plants. The acquisition access period (AAP) is the feeding duration necessary to acquire a sufficient titre of phytoplasma. The AAP can be as short as a few minutes but is generally measured in hours, and the longer the AAP, the greater the chance of acquisition (Purcell, 1982). The AAP may also depend on the titre of phytoplasmas in the plants, but it is still unknown how. The time that elapses from initial acquisition to the ability to transmit the phytoplasmas is known as the latent period (LP) and is sometimes called the incubation period. The LP is temperature dependent and ranges from a few to 80 days (Murral et al. , 1996; Nagaich et al. , 1974). During the LP the phytoplasmas move through and replicate in the competent vector's body. Phytoplasmas attach to the membranes of the midgut epithelial cells, on or between microvilli, and initiate invasion of the midgut. Then, they can pass intracellularly through the epithelial cells and replicate within a vesicle, or they can pass between two midgut cells (Lefol et al. , 1994) and through the basement membrane to enter the hemocoel. Phytoplasmas can accumulate to high densities also outside the basal lamina of these epithelial cells in the hemocoel, haemocytes and particularly at muscle fibres and tracheae that form the outer layer of the midgut (Hogenhout et al. , 2008). Phytoplasmas circulate in the hemolymph, where they may infect other tissues such as the Malpighian tubules (Lehrminier et al. , 1990), fat bodies and brain (Lefol et al. , 1994; Nakashima & Hayashi, 1995), or reproductive organs (Kawakita et al. , 2000); replication in these tissues, albeit not essential for transmission, may be indicative of a longer coevolutionary relationship between host and pathogen. Lefol et al. (1993) demonstrated surface protein involvement, and some level of specificity, in attachment of phytoplasma particles to insect host cells. Using double dot blot DNA hybridization assays, they demonstrated that Flavescence dorée phytoplasma acquired from infected broad bean ( Vicia faba L.) strongly binds to the alimentary tract tissues, hemolymph, and salivary glands but not to muscles or genital organs of its insect hosts, Scaphoideus titanus and Euscelidius variegatus . Other nonvector species also showed strong phytoplasma-insect tissue binding; however, the tissues of non-hemipteran species did not react. The molecular factors related to the movement of phytoplasmas through the various insect tissues are unknown; however, Oshima et al. (2001) developed a non-insect-transmissible onion yellows phytoplasma and have shown that its gemone size

28 (870 kbp) is smaller than that of the wild-type phytoplasma (1000 kbp), which suggests that the mechanism of binding to insect cells has been lost. To be transmitted to plants, phytoplasmas must penetrate specific cells of the salivary glands and high levels must accumulate in the posterior acinar cells of the salivary gland before they can be transmitted (Kirkpatrick, 1991). Individual phytoplasma cells appear to reside directly, and probably to multiply, in the cytoplasm of salivary gland cells, sometimes close to the nucleus (Hogenhout et al. , 2008). Similarly to spiroplasmas (Kwon et al ., 1999), phytoplasmas probably enter the canaliculi at the centre of secretory cells, before reaching the main salivary duct that leads to the stylet's salivary canal. They are then introduced into the plant phloem elements along with the insect salivary secretions during feeding (Hogenhout et al. , 2008). At each point in this process, should the phytoplasmas fail to enter or exit a tissue, the insect would become a dead-end host and would be unable to transmit the phytoplasmas. To illustrate this point, Wayadande et al. (1997) showed that in the salivary glands alone there are three barriers that pathogens must traverse before they can be ejected with the saliva: the basal lamina, the basal plasmalemma, and the apical plasmalemma. Leafhoppers can be infected with a phytoplasma and yet be unable to transmit it to healthy plants (Lefol et al. , 1993; Vega et al. , 1993; Vega et al. , 1994), perhaps because of the salivary gland barriers. Phytoplasma transmission from a competent host during feeding can be indirectly ‘observed’ and separated into its component stages by electrical penetration graph monitoring. In this technique, a low-voltage current is introduced into the test plants by the monitor and the insect is connected to the monitor, so that the electrical circuit is closed when the stylets penetrate the leaf. As the insect’s resistant to the applied signal varies with the different activities of the stylets, the resulting voltage changes can be detected and quantified. Types of stylet movements, salivation, ingestion, and egestion appear as different waveforms (Backus et al. , 2005). Phytoplasmas (or other circulative pathogens) are introduced into the phloem probably via watery saliva as the leafhopper stylets penetrate sieve element membranes (Lett et al. , 2001). Both the duration and frequency of this particular and other behaviours can be rigorously quantified using electrical penetration graph monitoring (Backus

29 et al. , 2005). This technique allows the detailed study of all elements of insect transmission of phytoplasmas as well as other plant pathogens. Some of the same leafhopper species that are competent to transmit phytoplasmas can also transmit viruses, rickettsia-like organisms, and spiroplasmas. It is unknown whether the receptors that allow penetration of these different pathogens into insect midgut cells are the same (Weintraub & Beanland, 2006). Phytoplasmas cannot be cultured in vitro (Mar- cone et al. , 1999), but the closely related group spiroplasmas can; hence, more is known about the biology of spiroplasma-insect vector interactions (Bové et al. , 2003; Fletcher et al. , 1998). c) Phytoplasma-insect vector specificity The interaction between insects and phytoplasmas is complex and variable. The complex sequence of events required for an insect to acquire and subsequently transmit phytoplasmas to plants suggests a high degree of fidelity between insect vector species and the phytoplasmas that they transmit. However, as said in section I. (Host specificity of phytoplasmas), numerous phytoplasmas can be transmitted by several different insect species (Ebbert et al. , 2001; Lee et al. , 1996). In addition, a single vector species may transmit two or more phytoplasmas, and an individual vector can be infected with dual or multiple phytoplasma strains (Lee et al. , 1996; Weintraub & Beanland, 2006). Vector-host plant interactions also play an important role in determining the spread of phytoplasmas. As reported in section I. (Host specificity of phytoplasmas), polyphagous vectors have the potential to inoculate a wider range of plant species, depending on the resistance to infection of each host plant. Several studies (Bosco et al. , 1997; Marzachì et al. , 1998) have shown that even insects that normally do not feed on certain plant species can acquire and transmit phytoplasmas to those plants under laboratory conditions. Hence, in many cases, the host range of a vector, rather than lack of phytoplasma-specific cell membrane receptors, limits the spread of phytoplasmas by that species (Weintraub & Beanland, 2006). Bosco et al. (1997) found that leafhoppers are not able to acquire equally phytoplasmas from different infected plant species. Chrysanthemum yellows (CY) phytoplasma is successfully transmitted by three leafhoppers ( Euscelidius variegatus Kirschbaum , Macroste- les quadripunctulatus Kirschbaum , and Euscelis incisus Kirschbaum). All three leafhopper

30 species acquire from infected and transmit to uninfected chrysanthemum, respectively. However, only two species ( M. quadripunctulatus and E. variegatus ) acquire CY after feeding on CY-infected periwinkle and subsequently transmit CY to uninfected plants. None of the leafhoppers acquire the phytoplasma from CY-infected celery, a dead-end host . Dead-end hosts are plants that can be inoculated and subsequently become infected with phytoplasmas, but from which insects can not acquire phytoplasmas. Several other dead-end hosts have been identified [e.g., Cyclamen persicum L. for aster yellows (Alma et al. , 2000), grapevine for the stolbur (Stol) phytoplasma associated with bois noir and Ver- gilbungskrankheit grapevine yellows (GY) (Weintraub & Beanland, 2006; Maixner et al. , 2007)]. The mechanisms that prevent phytoplasma acquisition from dead-end plant hosts are not well understood. One factor may be the absence or the uneven distribution of phytoplasmas in some plant parts (Wei et al. , 2004; Siddique et al. , 1998). Behavioural studies may also provide an explanation. Leafhoppers alter feeding patterns depending on the plant host (Backus et al. , 2005), and changes in feeding behaviour may influence the titre of ingested phytoplasmas (or whether the phytoplasmas are ingested at all) (Khan & Saxena, 1984 ). Leafhoppers do not feed as readily in the phloem of non-preferred host plants (Chiykowski & Sinha, 1988), which suggests a mechanism to explain why only some plants are phytoplasma acquisition hosts. Finally, phytoplasma symptoms are correlated with plant hormo- nal imbalances (Pecho & Vizarova, 1990) and altered carbohydrate and amino acid movement in plants (Choi et al. , 2004; Lepka et al. , 1999); hence, the infection may cause sys- temic changes but phytoplasma may not be present in symptomatic plant parts. Alterna- tively, biochemical imbalances caused by phytoplasma infection may impede phytoplasma acquisition (Weintraub & Beanland, 2006). There are no reports of vectors selectively acquiring one phytoplasma from a host plant infected with more than one phytoplasma strain, even though in short AAPs on plants infected by more than one strain of phytoplasma, insects can acquire and subsequently transmit a single strain (Zhang et al. , 2004). This is probably a result of short feeding periods rather than selective acquisition or transmission. Multiple phytoplasma infections in plants can complicate transmission studies performed to determine vector identity. Zhang et al.

31 (2004) provide a useful methodology to compensate for confounding dual or multiple infections (Weintraub & Beanland, 2006). d) Transovarial transmission Although plant pathogenic viruses and symbiotic prokaryotes can be transovarially transmitted, phytoplasmas were not thought to be directly transmitted from female vector to progeny. However, in recent years, several studies have reported instances of transovarial transmission of phytoplasma. In Scaphoideus titanus Ball (a vector of GY in Europe) infected females were allowed to lay eggs on healthy host plants; nymphs and adults, transferred on healthy plants, resulted infected and transmitted the phytoplasma (Alma et al. , 1997). Kawakita et al. (2000) observed by electron microscopy the phytoplasma in the ova- ries and other tissues of a leafhopper ( Hishimonoides sellatiformis Ishihara) and confirmed their presence by PCR. They also found phytoplasmas in eggs laid on mulberry shoots by infective leafhoppers and in first-instar nymphs hatched from these eggs. Working with the same leafhopper, Mitsuhashi et al. (2002) found Wolbachia coexisting in all tissues with the phytoplasma, suggesting that this other prokaryote may have mediated infection by the phytoplasma. Infective individuals of the leafhopper Matsumuratettix hiroglyphicus Ma- tsumura have been reared for two generations on phytoplasma-free sugarcane grown from tissue culture (Hanboonsong et al. , 2002). The presence of ‘ Ca. Phytoplasma prunorum’ was recently detected also in eggs laid by infected females of the vector psyllid Cacopsylla pruni Scopoli on healthy plum twigs, and subsequently also in nymphs and newly emerged adults. In one case, the plant where these insects were reared tested positive by nested PCR (Tedeschi et al. , 2006). In all of these cases there is absolute fidelity between insect vector and the phytoplasmas; actually these species do not transmit any additional phytoplasmas (Weintraub & Beanland, 2006). e) Effects of phytoplasma on the vector The phytoplasma-insect relationship can be beneficial, deleterious, or neutral in terms of its impact on the fitness of the insect host (Weintraub & Beanland, 2006). Early reports suggested that infection by phytoplasmas was harmful to insect hosts (Severin, 1946). More recent reports suggest that phytoplasmas may confer some increased fitness to their insect hosts. Beanland et al. (2000) determined that exposure to one strain of AY increases both the lifespan and fecundity of female Macrosteles quadrilineatus Forbes; however, exposure

32 to another strain of AY increases the lifespan of test insects but not the number of offspring produced. The corn leafhopper, Dalbulus maidis Delong and Wolcott, is a specialist of corn that cannot live on unrelated hosts such as healthy aster ( Callistephus chinensis Nees). However, when reared on several strains of AY-infected aster, its lifespan is increased. Once exposed to AY-infected asters, D. maidis can feed and survive on healthy aster as well (Purcell, 1988). The effects of phytoplasma infection on the insect hosts have implica- tions for the incidence and spread of disease. Vector individuals with longer lifespan have the opportunity to infect more plants and produce more offspring (Weintraub & Beanland, 2006). Phytoplasma infection can have different effects on different species of vectors. Madden et al. (1984) reported that maize bushy stunt phytoplasma had a less deleterious effect on its primary vector, Dalbulus elimatus Ball , than on a secondary vector, D. maidis . Environ- mental factors, such as temperature, can also mediate the effects of phytoplasma infection on the insect host. Garcia-Salazar et al. (1991) reported that X-disease phytoplasma infection can be deleterious to the vector Paraphlepsius irroratus at low temperatures but not at temperatures ranging from 25 to 30°C. Those phytoplasmas that reduce the fitness of their host insects may have had a shorter evolutionary relationship with that insect species, as selection would reduce the deleterious effects on insect hosts. Only those phytoplasmas that do not kill their hosts would survive to be introduced into a plant host and subsequently acquired by another vector (Weintraub & Beanland, 2006). It can be difficult to distinguish whether the phytoplasma affects directly the insects or damages them indirectly by altering the food represented by infected plant hosts (Christen- sen et al. , 2005; Weintraub & Beanland, 2006). However, if phytoplasma-infected insects are transferred to uninfected plants at frequent intervals (i.e., before phytoplasma infection alters the host plant), the effects of phytoplasmas on insect survival and fecundity can be observed. Phytoplasma infection may alter the infected plant and make it a more suitable host for the insect (for example, reduction of the plant's chemical defences). Alternatively, phytoplasma infection may increase the titre of available nutrients, such as free amino acids and sugars, in plants. Fitness benefits may increase the relative attraction of infected plant hosts. Todd et al. (1990) reported a higher attraction to yellow plants by leafhoppers: because symptoms of phytoplasma infection in plants usually include chlorosis, infected

33 plants are likely more attractive to insects, including vector species (Weintraub & Beanland, 2006). f) Factors mediating the transmission efficiency For years investigators have found that leafhopper gender can influence the acquisition and transmission dynamics of phytoplasma (Beanland et al. , 1999; Chapman, 1949, Chi- ykowski & Sinha, 1970; Swenson, 1971). Beanland et al. (1999) reported that females of the leafhopper M. quadrilineatus were more efficient in transmitting AY to lettuce than males, even though they determined that female leafhoppers were less likely than males to acquire phytoplasma during feeding. The male and female leafhoppers used in these trials may have transmitted at an equal rate if they had been tested at an older age, as Lefol et al. (1994) observed phytoplasma at an earlier age and at a higher titre in male E. variegatus salivary glands than in those of female E. variegatus . Behavioural differences between male and female vector insects can account for observed gender differences and can affect plant disease dynamics (Hunt et al. , 1993). Males move around more on each plant, and also more frequently from plant to plant, in search of females. Although early reports suggested that vector age did not influence vector capacity (Chi- ykowski & Sinha, 1988), more recent investigations suggest that age is an important factor. Newly hatched nymphs of E. variegatus do not acquire CY with the same efficiency as fifth-instar nymphs (Palermo et al. , 2001). In some cases, transmission is increased when phytoplasmas are acquired by nymphs than by adults (Moya-Raygoza & Nault, 1998; Mur- ral et al. , 1996). Phytoplasma strain and environmental conditions are factors that may interact with vector age in the capacity of leafhoppers to transmit phytoplasmas (Murral et al. , 1996). g) Phytoplasma vector dispersal The spatial distribution and movement of insect vectors play a fundamental role in the epidemiology of phytoplasma associated diseases. It is axiomatic that an insect would not leave suitable host plants and disperse unless constrained by biotic (e.g., crowding, developmental stage, a genetic tendency to engage a migratory behaviour) or abiotic factors (Weintraub & Beanland, 2006). Brcák (1979) observed Hyalesthes obsoletus Signoret to remain on bindweed ( Convolvulus arvensis ) until the plants were spent; only then did they disperse to alternative host plants nearby. At the field scale, movement of vectors can be in-

34 fluenced by the dispersion of host plants. According to Power (1992), shorter distances between preferred plants increase the likelihood that an insect moves from one to the other. Vector movement and dispersal also influence the insect-pathogen interaction, and some species may acquire phytoplasma en route and infect crops at the end of the migration (Hoy et al. , 1992). As an additional layer to this complex system, there are primary and minor insect vectors; the primary vector transmits the phytoplasma to the economic crop, whereas the minor vector(s) inoculates non-crop plant hosts that serve as reservoirs of the phytoplasma. Although these two classes of vectors have seldom been identified for any crop- phytoplasma system, they are likely important in most plant diseases (Weintraub & Beanland, 2006). Vegetation composition, habitat diversity, and the nature of ecotones in and near a phytoplasma-vulnerable crop can have profound effects on the presence and dispersal of vectors, their natural enemies, and other insects. For instance, Nicholls et al. (2001) found that corridors of plants and forest edges affect the distribution and the number of predator species that move into the vineyards. While forests and plant corridors may increase predatory species and biodiversity, they may also augment the movement of phytoplasma vector species into nearby vineyards. The study of the movement of phloem-feeding insects across forest-crop ecotones may suggest which species are responsible for infecting cultivated plants with phytoplasmas (Weintraub & Beanland, 2006). Lessio & Alma (2004) examined the movement of S. titanus , within an Italian vineyard and reported that planting densities and canopy thickness affect vector movement. Furthermore, they found that S. titanus did not disperse significantly beyond 24 m from the vineyard. Their findings suggest that increasing the distance between wild hosts of S. titanus and vineyards may reduce the movement of this insect to cultivated vines. Furthermore, the weed composition around a field affects also the level of infected vectors, as shown by Langer et al. (2003) for H. obsoletus , the vector of GY in grapes: a higher percentage of infected leafhoppers is associated with a prevalence of Convolvulus arvensis L. The seasonal movement of vectors from wild host plants in the forest habitat to cultivated ones in the crop may be important in the incidence and spread of phytoplasma diseases in other cropping systems as well (McClure, 1980a, b; Whitney & Meyer, 1988).

35 Within-crop vegetation, such as the types of plants found in an orchard floor, can also influence the entry and tenure of vector species that colonize trees (McClure, 1982). In some cases, where the climate mitigates against the abundance of weeds in the vicinity of crops, vectors must disperse or migrate over large areas to find suitable plant hosts and it is possible to find significant clustering of individuals in some locations, from where they seasonally move toward the crops (Orenstein et al. , 2003). Spatial Characteristics of Phytoplasma-Infected Crops: Spatial patterns of phytoplasma-infected plants within orchards have been investigated by several groups, and a clustered pattern of plants has been observed (Beanland et al. , 2005; Constable et al. , 2004; Madden et al. , 1995; Wolf, 2000). In each system, insects are the suspected agents of spreading the disease-causing phytoplasmas. In this cases, infective insects move into an orchard, feed upon and subsequently inoculate a plant, engage in small-scale movement to adjacent plants, and feed and infect them before engaging in more long-range movement out of the immediate area. The distribution of phytoplasma-infected plants can give clues to the identity, behaviour, and source of vector insects (Weintraub & Beanland, 2006). For instance, Jarausch et al. (2001) predicted that aerial vectors were responsible for the spatial distribution of ESFY-infected Prunus trees in France because the disease was initially found in various locations in the orchard with no apparent border effects. Human-Mediated Spread of Phytoplasmas: Human activities have introduced vector species into previously unoccupied areas, resulting in devastating phytoplasma-caused plant diseases. Emblematic is the case of grapevine yellows. The phytoplasma causing Flaves- cence dorée is probably endemic to Europe. When the eggs of the monovoltine Vitis specialist S. titanus were unintentionally brought to Europe on imported grapevine canes from North America, GY became an epidemic disease in France—and is spreading as the leafhopper disperses. Although S. titanus transovarially transmits phytoplasma (see above), it is doubtful that a phytoplasma new to Europe was transmitted from North America with the leafhopper. S. titanus likely acquired the phytoplasma from infected plants in the vicinity of vineyards to initiate the epidemic, or perhaps vines were infected at very low levels before S. titanus arrived. Species in the genera Euscelis and Euscelidius can also transmit GY and may serve as the minor vectors in this disease system (Weintraub & Beanland, 2006).

36 III. ‘Candidatus Phytoplasma mali’

Apple Proliferation (AP) disease represents one of the most severe problems in Italian apple orchards. It is known also in other European regions, but it was first described in Italy (Rui, 1950). The geographical distribution of this quarantine disease has only been reported from the EPPO region (Fig. 2). In particular, it is signalled in Albania, Austria, Bosnia and Herzegovina, Bulgaria, Croatia, Czech Republic, France, Germany, Greece, Hungary, Italy, Moldova, Norway, Poland, Romania, Slovakia, Slovenia, Spain, Switzerland, Turkey, UK (eradicated), Ukraine. It was found, but not established, in Denmark and Netherlands (EPPO/CABI, 1996). However, there are unconfirmed reports from India and South Africa (Seemüller, 1990).

Fig. 2 - Geographical distribution of apple proliferation disease (from http://pqr.eppo.org/datas/PHYPMA/PHYPMA.pdf )

The etiological agent of this disease is a phytoplasma named ‘ Candidatus Phytoplasma mali’ (Seemüller & Schneider, 2004).

37 Besides apple proliferation, two other economically important diseases of temperate fruit trees are caused by phytoplasmas: pear decline (PD) and European Stone Fruit Yellows (ESFY). The agents of these diseases have been studied very intensively, using both molecular and biological methods. The three pathogens are phylogenetically closely related (interspecific differences in the 16S rDNA sequences ranging from 1,0 to 1,5%) and form, together with the PYRL phytoplasma, a cluster designated ‘Apple proliferation strain cluster’ (Seemüller et al. , 1994, 1998) or group 16SrX (Lee et al. , 1998, 2000) (Seemüller & Schneider, 2004). Strains: In 2000, a detailed restriction fragment length polymorphisms (RFLP) analysis was carried out on a 1812 bp non-ribosomal fragment amplified by PCR (PCR-RFLP) from various isolates of ‘ Ca. Phytoplasma mali’ (Jarausch et al. , 2000). After the enzymatic di- gestion, three different RFLP groups can be distinguished: AT-1, AT-2 and AP. Among all the restriction enzymes that were used, Rca I and Hinc II are the key sites on the ‘Ca. P. mali’-specific PCR product which generate the three polymorphic restriction profiles (Jarausch et al. , 2000). The apple proliferation subtypes are very closely related and, owing to the analyses conducted, no geographic prevalence of a given subtype was observed in the seven European countries sampled (France, Germany, Spain, Switzerland, Austria, Roma- nia and Italy). In Trentino, the AT-2 strain is more widespread, while the presence of AT-1 strain is characteristic of some areas in the southern part of the region. The presence of the AP strain is extremely rare (Cainelli, 2007). a) Host plants ‘Ca. Phytoplasma mali’ occurs in a wide range of species of the genus Malus (Kartte & Seemüller, 1991) and has been detected occasionally in plants such as Pyrus communis L., Pyrus pyrifolia Burm. f., Prunus armeniaca L., Prunus avium L., Prunus domestica L., Prunus salicina Lindell, Corylus avellana L., Crataegus monogyna Jacq., Quercus robur L., Quercus rubra L., Carpinus betulus L., Convolvolus arvensis L. (Del Serrone et al. , 1998; Lee at al. , 1995; Marcone et al. , 1996a; Mehle et al. , 2007; Schneider at al. , 1997; Seemüller, 2002) by serological and DNA based techniques (Seemüller & Schneider, 2004). Recently, ‘ Ca. Phytoplasma mali’ was reported also in herbaceous plants, such as dahlia ( Dahlia cultorum Thorsrud et Reisaeter), Oriental hybrids of Lilium plants (Kamin- ska & Śliwa, 2008a, b).

38 b) Symptoms Apple proliferation causes symptoms on shoots, leaves, fruits and roots. The clearest sign of the infection is witches’ brooms, small fruits, late growth of terminal buds in fall (Bovey, 1963). Diagnostic symptoms are witches’ brooms and enlarged stipules. On trees: In general, affected trees lack vigour, shoots are thin and the bark, which is sometimes fluted lengthwise, has a reddish-brown colour. Necrotic areas appear on the bark and some branches may wither (EPPO/CABI, 1996). On buds: During the first 2-3 years following infection, in late summer the axillary buds on the upper part of some shoots grow prematurely. The lack of apical dominance in affected shoots causes the witches’ brooms (Fig. 3-4). The secondary shoots form an angle with the main shoot of less than 45° (Fridlund, 1989). Witches’ brooms generally appear successively on various parts of the tree, or all at once over the whole tree, rather than repeatedly on the same branch (EPPO/CABI, 1996). Sometimes enlarged stipules develop on the apex leaves of shoots exhibiting early stages of witches’ brooms. Depending on the cultivars, witches’ brooms may be prevalent at the apex of the main branches (Golden Deli- cious) or near the crown of the tree (Cox Orange Pippin). They may appear also on root suckers (Fridlund, 1989). On leaves: An early, red, fall coloration of leaves occurs on diseased trees of some cultivars, and by the end of the growing season, infected trees may show late shoot growth (Fridlund, 1989). In many cases, especially with trees on calcareous soils, besides the reddening there is a chlorosis of the leaves (EPPO/CABI, 1996). The terminal bud is not closed and dormant, but develops a rosette of light green leaves with enlarged stipules. The same symptoms also occur on the brooms (Fridlund, 1989). Bud break occurs earlier in the spring on diseased trees and an early defoliation often occurs (EPPO/CABI, 1996). The stipules are greatly enlarged, dentate or notched on the first leaves and appear similar to a true leaf. The enlarged stipules at the base of shoots are characteristic of the disease. Normally during spring, healthy trees of culinary apple cultivars develop leaves with small and narrow stipules (Fig. 5). Broader stipules also may appear on leaves of healthy trees, but not before summer (Fridlund, 1989). Leaves of trees with symptoms of the infection are more susceptible to powdery mildew fungus than those of healthy trees (Maszkiewicz et al. , 1979). During summer or fall, infec-

39 tions with powdery mildew are favoured by the development of susceptible young leaves on the brooms and on late growth of other terminal buds. On flowers: Delayed, sometimes until late summer or autumn, but most of the blossoms of infected trees are normal. A few phylloid flowers have been observed on cv. Cox’s Or- ange; the stamen were converted to petals, some of the petals to leaves and the calyx lobes were enlarged and dentated (EPPO/CABI, 1996). On fruits: The fruits of infected trees are smaller than normal and have longer peduncles (Fig. 6). In the acute stage of the disease the main weight of the fruit is reduced by 30 to 60% (Fridlund, 1989). In addition, flavour is poor, both sugar and acidity being reduced. The peduncles are longer and thinner and both the calyx end and the peduncular cavities are shallower and broader, thus giving the fruit a flattened appearance. Seeds and seed cavities are smaller (EPPO/CABI, 1996). On roots: Some alterations occur in the roots. Small roots are reduced in length, gnarled, and very crooked. When the trees are severely infected, the finer roots become en- tangled into dense tufts, while the larger ones do not elongate. Subterraneous witches’ brooms may also arise from large roots near the trunk. This deformations of the smaller roots prevent adequate tree nutrition (Fridlund, 1989). Only witches’ brooms, including their early stage, and the enlarged stipules on basal leaves are distinguishing symptoms of the disease. The other symptoms may be caused by other disorders. Witches’ brooms usually appear only during the first few years of the disease, but enlarged stipules can occur for up to 5 years following the infection (Schmid, 1965). One or more years without witches’ brooms or enlarged stipules may occur between years with symptoms. Trees with masked infections will show symptoms again after severe pruning (Fridlund, 1989). Diseased trees may die but, in mild infections, they may recover after the shock symptoms of the first 2-3 years (EPPO/CABI, 1996). A partial recovery of infected trees can occur as well as the total disappearance of symptoms (Schmid, 1965). Fruit size may start to increase a few years following new infections if these new infections do not occur within 8 years after tree planting and the plant may, subsequently, produce normal fruits again. However, if infection of a tree occurs early in its life, it will always grow poorly, and its fruit will remain small (Fridlund, 1989).

40 The strain of the causal agent affects the intensity of damage and the ability to recover. Differences in sensitivity to the disease exist among apple cultivars (Zawadzka, 1976). Ex- tremes in sensitivity among cultivars are less than the extremes which occur among reactions of the same cultivar to different strains of the pathogen (Kunze, 1976).

Fig. 3 – Typical wintry symptoms: witches’ Fig. 4 - Witches’ brooms: the most evident brooms and anomalous development of the symptom of the disease. shoots.

Fig. 5 – Spring symptoms on the young Fig. 6 - Symptoms on fruits, which are leaves with enlarged and narrow stipules. smaller than normal and have longer peti- oles.

42 c) Diagnosis Indexing procedures: Since phytoplasmas can not be readily cultured and purified, only inoculation to woody indicators was used until recently for detection. Test plants can be grafted onto indicator apple Malus x domestica cv. ‘Charden’, ‘Golden Delicious’ or ‘Rode Schone van Boskoop’. These cultivars can express symptoms after a period of dormancy. After this period, which can be forced in cold room at 5°C ± 4°C, plants are pruned, leaving one or two buds above the graft, in order to concentrate the level of phytoplasma in the young and vigorous shoots after re-growth. One or two months after pruning, the first symptoms may be observed (enlarged stipules, presence of witches’ brooms). In the greenhouse this method can be applied in spring on actively growing plants; in the field, indicators are inoculated at the end of summer or in autumn (OEPP/EPPO, 2006). The normal chip budding method used for detecting fruit tree viruses is not always reliable for the detection of latent infections of apple proliferation, because of the uneven distribution of the pathogen within the aerial parts (Fridlund, 1989). Since the pathogen occurs regularly in the roots, transmission tests to sensitive indicator cultivars should use root pieces as inoculum (Seidl, 1965). The most sensitive indicator is Golden Delicious, but this indicator grows poorly on root pieces of trees to be tested. Therefore, the indicator and the root piece to be tested are both grafted to a healthy apple seedling (Fridlund,1989). DAPI staining: Fluorescence microscopy is an easier method for detecting the pathogen. Thin microtome sections (20 µm) of young tissues (petiole of leaves, phloem tissue of shoots, branches and roots) are treated with 1 µg/ml 4,6-diamidino-2-phenilindole (DAPI) solution, a fluorescent stain reacting specifically with deoxyribonucleic acid (DNA). Sec- tions are then observed under a fluorescence microscope at 460 nm (Seemüller, 1976). Since conducing sieve tubes do not contain nuclei or mitochondria, no fluorescence occurs. However, if sieve tubes are infected with MLOs, fluorescence occurs because of their DNA. Small brightly fluorescent particles can be observed in the colonised sieve tubes, usually in a star-like arrangement, sometimes in clusters, or, by the end of the year, in stringlike aggregations. Often the fluorescence occurs only in some sieve tubes because the number of the phytoplasmas can be low, and their presence is quite irregular. Roots are the most suitable parts from which to detect MLOs by fluorescence microscopy. Correlation between DAPI fluorescence in sieve tubes and the presence of MLOs as shown by electron microscopy occurred, although these techniques were not applied simultaneously to the

43 same samples (Behnke, 1980; Cazelles, 1978; Fridlund, 1989). This method, previously the only one available, requires good experience of observing slides and is not always sufficiently sensitive. The advantages include rapidity and low cost, even though it is not specific (OEPP/EPPO, 2006). ELISA: The availability of monoclonal antibodies (mabs) specific for ‘ Ca. P. mali’ (Loi et al. , 2002) allows direct ELISA to be used, which is particular useful when a large number of samples has to be checked. The most reliable results can be obtained when leaf midribs or stems collected from late spring to end of summer (June – end of September) are tested. ELISA should be performed according to the manufactorer’s instructions (Bioreba). The vegetal material consists in fresh midribs of leaves or phloem tissue extracted from branches or roots. The samples can be either macerated in a mortar with an isolation buffer (Jiang & Chen, 1987) and submitted to differential centrifugations or directly minced in the mortar with extraction buffer. The samples containing unknown amounts of the antigens are then specifically immobilized on a plate coated with purified monoclonal antibodies. After the antigen is immobilized, the detection antibody is added, forming a complex with the antigen. The detection antibody is detected by a secondary antibody which is linked to an enzyme (alkaline phosphatase) through bioconjugation (Guesdon et al. , 1979). After the final wash step the plate is developed by adding an enzymatic substrate to produce a visible signal, read at 405nm, which indicates the quantity of antigen in the sample. A simplified procedure can be successively adopted in routinely analyses, which is called DAS-ELISA: the two mabs can be directly conjugated with the enzyme and used, diluted in conjugate buffer (Loi et al. , 2002). In cooler climates and in cases of latent infections, ELISA may not be sensitive enough to detect the relatively low concentrations (OEPP/EPPO, 2006). However from July to No- vember, when the phytoplasma colonisation of the canopy is high (Seemüller, 1988), the results obtained using ELISA and PCR on the same trees are similar. During this period, the serological technique can substitute for PCR, especially for large-scale diagnosis such as health selection programmes when the number of samples for examination is high. By adopting the DAS–ELISA, the preparation of the samples is made easy and rapid, since DNA extraction is not necessary (Loi et al. , 2002).

44 Immunofluorescence (IF): This technique is the combination of microscopical and serological approaches for the detection of ‘ Ca. P. mali’. Microtome 20 µm thin sections, as for DAPI staining, are treated with monoclonal antibody tissue culture supernatant and incubated. Then, after washing, FITC (fluorescein-isothiocyanate) – antimouse conjugate is added and incubated again (30 min at 37°C). The samples are washed and observed under an epifluorescence microscope. The specificity of IF increases the detectability of phytoplasmas both on roots and stems compared to DAPI (Loi et al. , 2002). IF can be coupled with DAPI staining thus analysing the same section with both methods. In this case it is possible to compare the two methods and at the same time to apply two different diagnostic techniques on the same sample (Loi et al. , 2002). PCR detection (OEPP/EPPO, 2006) : The available molecular techniques are both sensitive and specific. DNA is extracted from ‘ Ca. P. mali’ following Ahrens & Seemüller (1992), or a simplified version, using apple shoots or roots, and the extract is amplified by PCR. Different types of universal primers are able to amplify phytoplasma DNA extracted from phloem. The most frequently used are the ones described by Lorenz et al. (1995) and Lee et al. (1998). Both are able to amplify a product by PCR from any phytoplasma, including ‘ Ca. P. mali’. If universal primers fU5/rU3 (Lorenz et al. , 1995) or R16F2n/R16R2 (Lee et al. , 1998) are used, the amplification product may be digested by restriction enzyme Alu I to ensure that the phytoplasma belongs to the group AP (Seemüller et al. , 1998) or to the group 16SrX (subgroup A) (Lee et al. , 1998). If AP- or 16SrX-group specific primers fO1/rO1 (Lorenz et al. , 1995) are used, the amplification product may be digested by the restriction enzymes Ssp I and Sfe I (Lorenz et al. , 1995) to differentiate ‘ Ca. P. mali’ from ‘ Ca. P. pyri’ and ‘ Ca. P. prunorum’. If a set of ‘ Ca. P. mali’-specific primers AP5/4 (Jarausch et al. , 1994; 1995) is used following the same protocol, then RFLP analysis in not required. However, with these specific primers the test has a slightly reduced sensitivity. Real-time PCR: In recent years, a new approach based on the traditional PCR was developed: the real-time PCR, also called quantitative PCR (qPCR). As suggested by the name, this technique is used to amplify and simultaneously quantify a targeted DNA mole- cule. It enables both detection and quantification (as absolute number of copies or relative

45 amount when normalized to DNA input or additional normalizing genes) of a specific sequence in a DNA sample. A fluorescent reporter is added to the reaction mixture and, after each PCR cycle (that is in real time), the levels of fluorescence are measured by a fluorescence detection system. The signal increases in direct proportion to the amount of PCR product in a reaction. At the beginning, the fluorescence level remains at low levels which are not detectable, but during the exponential phase there is a cycle, called threshold cycle (Ct), at which enough product is accumulated and a detectable signal is yield. By recording the fluorescence emis- sion at each cycle of the reaction, it is possible to monitor the PCR reaction during the exponential phase when the reagents are not limited and therefore the amount of PCR product correlates to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. The DNA concentration in the samples can be determined with reference to a standard curve, resulting by the amplification of serial dilutions of the PCR target. The standard curve is constructed by plotting the log of the starting quantity of template against the Ct value obtained during the amplification of each dilution. Different dyes have been used for the quantification of ‘ Ca. Phytoplasma mali’ (Cainelli, 2007): DNA-binding dyes (such as SYBR Green I) (Jarausch et al. , 2004) and dye labeled, sequence-specific oligonucleotide probes (TaqMan probes) (Baric & Dalla-Via, 2004). The DNA binding dye SYBR Green I binds non-specifically double-stranded DNA (dsDNA), and upon excitation emits light. Thus, the fluorescent signal, which is proportional to the amount of dsDNA present, increases during the reaction, as a PCR product ac- cumulates. The advantages are that it is inexpensive, easy to use, and sensitive. The disad- vantage is that SYBR Green I will bind to any double-stranded DNA in the reaction, including primer-dimers and other non-specific reaction products, which may result in an overestimation of the target concentration. A melting curve analysis can be performed to identify the reaction products, including non-specific ones. After the amplification reaction, a melting curve is generated by increasing the temperature in small increments and monitoring the fluorescence at each temperature step. As the dsDNA denatures, the fluorescence decreases and the negative first derivate of the change in fluorescence is plotted as a function of temperature. A characteristic peak at the amplicon melting temperature (Tm, the

46 temperature at which the 50% of the base pairs of a DNA duplex are separated) distin- guishes it from other products which melt at different temperatures, such as primer-dimers (Cainelli, 2007). TaqMan probes depend on the 5'- nuclease activity of the DNA polymerase used for PCR to hydrolyze an oligonucleotide that is hybridized to the target amplicon. TaqMan probes are oligonucleotides that have a fluorescent reporter dye attached to the 5'-end and a quencher coupled to the 3'-end. These probes are designed to hybridize to an internal region of a PCR product. In the unhybridised state, the proximity of the reporter and the quencher molecules prevents the detection of fluorescent signal from the probe. During PCR, when the polymerase replicates a template on which a TaqMan probe is bound, the 5'- nuclease activity of the polymerase cleaves the probe. This decouples the reporter and the quencher, resulting in a fluorescence signal. Thus, fluorescence increases in each cycle, proportional to the amount of amplified product in the sample. The advantages of this method includes high specificity, a high signal-to-noise ratio, and the ability to perform multiplex reaction, while disadvantages are that initial costs of the probe may be high and the assay design may not be trivial (Cainelli, 2007). d) Transmission The natural means of transmission of apple proliferation is partly unknown. Recently the transmission of the disease from apple to apple by the formation of root bridges was demonstrated either under natural and experimental conditions (Ciccotti et al. , 2007; Baric et al. , 2008). Another common mean of transmission consists in grafting buds or scions. The colonisation of the aerial part of the canopy is irregular and varies during the year, while in roots the pathogen is always present with the same titre. The efficiency of transmission is therefore not always the same, unless root pieces are used as inoculum (Fridlund, 1989). There is one report of graft transmission from apple to pear, but this has not been confirmed by subsequent experiments. Also Sorbus aucuparia L. (unpublished data produced at IASMA) can be inoculated by grafting, but the infection is not permanently established. On the other hand, phytoplasmas can not be transmitted mechanically by inoculation with phytoplasma- containing sap (Lee et al. , 2000). Pruning cut, slash or the contact with pruning shears used

47 on infected plants are not risky for the propagation of the disease (Seidl & Komárková, 1974). Other reports regard the transmission to herbaceous plants, such as Catharanthus roseus (L.) G. Don. (a universal host plant for phytoplasmas), using Cuscuta sp. (Marwitz et al. , 1974; Heintz, 1986). On the contrary, apple proliferation is not transmitted trough pollen or seeds (Seidl & Komárková, 1974). An important mean of transmission of the disease is represented by phloem feeding insects, belonging to the Homoptera order. It has been proved that at least three species are involved in the transmission of apple proliferation: the psyllids Cacopsylla picta Förster and C. melanoneura Förster and the leafhopper Fieberiella florii Stål. e) The situation in Trentino The first report of the presence of apple proliferation in Trentino dates back to the 1950s and regards observations carried out in nurseries (Refatti & Ciferri, 1954). Afterwards, the incidence of the disease was unsteady and the intensity of symptoms varied depending on the vegetative season. At the beginning of the 1990s, in some areas of the Valli del Noce (Val di Non and Val di Sole) the presence of apple proliferation increased remarkably, affecting several varieties, such as Golden Delicious, Florina and Renetta del Canada, grafted on different rootstocks (seedlings, M11, M7, M106 and also M26 and M9). In 1996 the presence of Golden Delicious orchards with a high percentage of symptomatic trees was signalled also in the northern part of Trento (Vindimian & Delaiti, 1996; Vindimian et al. , 2000). Since1994, the first monitoring activity of the evolution of AP has been conducted in the apple orchards of Val di Non and Val di Sole. The trees have been examined by visual observation of the typical symptoms of the disease. In the same years, as a consequence of the increasing number of infected plants, also the uprooting and substitution of these plants has started. Since 1998, also many other farms across the whole region have been mapped in order to follow up the spreading of the disease, to study the early symptoms in plants and to evaluate the effectiveness of the control measures (Mattedi et al. , 2007; Vin- dimian, 2002). Some general considerations result by preliminary observation. First, the incidence of the disease seems to depend on the altitude, being higher in the more elevated areas. Moreover, the variety of the tree and the vigour of the rootstock seem to play an im-

48 portant role in the susceptibility. Renetta del Canada and the vigorous rootstocks are very sensitive, but these two characteristics are typical of the old plantations and thus it is very difficult to distinguish these effects from the age effect. Anyway, as a general consideration, it is possible to state that the older orchards (15-20 years old) of both Val di Non and Val d’Adige are highly infected, regardless of the control strategy applied, even though the symptom expression is decreasing with years. In the younger orchards, on the other hand, where the disease was rapidly spreading until 2005, this trend is changing at present. In Val di Non the renewal of the old infected trees compli- cates the interpretation of the control strategies, because in most of the cases it is applied only in small areas. Where the substitution of the trees is carried out constantly and on vast surfaces and the vectors are treated, the situation seems to be encouraging (Mattedi et al. , 2007).

IV. Transmission of ‘ Ca. Phytoplasma mali’ by psyllid vectors

The agronomic importance of the Hemiptera genus Cacopsylla is linked to the role of several species in the transmission of phytoplasma diseases. Whilst other phytoplasmas are transmitted by either leafhoppers (Cicadellidae) or planthoppers (Cixiidae), the three fruit tree phytoplasmas, which are phylogenetically related and belong to the same cluster, are vectored by Cacopsylla spp. ‘Ca. Phytoplasma pyri’, the etiological agent of pear decline, is transmitted by Cacop- sylla pyricola Förster (Davies et al. , 1992; Hibino et al. , 1971; Jensen et al. , 1964) and C. pyri L. (Carraro et al. , 1998b; Garcia-Chapa et al. , 2005; Lemoine, 1991). The vector of ‘ Ca. Phytoplasma prunorum’, the etiological agent of European stone fruit yellows, is C. pruni Scopoli (Carraro et al. , 1998c). The first investigations about the transmission of ‘ Ca. P. mali’ by insect vectors focus- sed on spittlebug and leafhopper species. The species reported as vectors are Philaenus spumarius L. (Hemiptera: Cercopidae) and Artianus interstitialis Germar (Hemiptera: Ci- cadellidae), which were able to transmit apple proliferation phytoplasma from infected cel-

49 ery to apple seedlings and from infected to healthy celery (Marenaud et al. , 1978; Hegab & El-Zohairy, 1986; Nemeth, 1986). However, other experiments conducted with P. spumarius did not confirm the previous results (Refatti et al. , 1986). Also the leafhopper Fie- beriella florii Stål (Hemiptera: Cicadellidae), already known in North America as one of the most important vectors of X-disease (Gold & Silvester, 1982; Van Steenwyk et al. , 1990), was used in transmission trials conducted in Germany at the end of the 1980s. The infection of apple plants was ascertained by observation of symptom expression and fluorescence microscopy (Krczal et al. , 1989). Furthermore, the presence of ‘Ca. Phytoplasma mali’ in F. florii sampled from symptomatic plants was verified by PCR by Bliefernicht & Krczal (1995). These results were recently confirmed by Tedeschi & Alma (2006) who obtained the transmission of the phytoplasma by this leafhopper in north-western Italy. In their transmission trials, nymphs originating from mass rearing were used. After an acquisition access period on infected apple plants and an incubation period in healthy plants, the insects were moved in groups of 10 individuals/plant and left for inoculation access periods of 10 days. As result, 6 out of the 32 plants used were tested positive by nested PCR and both the fifth instar nymphs and the adults were able to transmit the phytoplasma. Moreover, the role of aphids in the transmission of apple proliferation has been investigated, since the presence of AP was detected in Aphis pomi De Geer, Dysaphis (Pomaphis) plantaginea Passerini and Eriosoma lanigerum Hausmann collected in the field. Phyto- plasma load in insects was assessed by real-time PCR and the vector capacity was evaluated by transmission experiments. The analysis demonstrated the acquisition of the pathogen by aphids, but the titres found in aphids appear definitely lower than those detected in infectious psyllids and also the transmission trials have never resulted in positive test plants to date (Cainelli, 2007; Cainelli et al. , 2007). a) The research on psyllid vectors in Trentino In Trentino, attention for the vectors of ‘ Ca. Phytoplasma mali’ began to increase in 1995, when the disease spread in apple orchards of the whole region, especially in the Val di Non and Val di Sole. As in these areas F. florii is unknown, its involvement as an AP vector could be excluded (Frisinghelli et al. , 2000; Mattedi et al. , 2008). On the other hand, the presence of psyllids in Trentino orchards is reported since the 1970s, even though these phytophagous insects have never been considered dangerous (Tomasi et al. , 2000). Never-

50 theless, a notable increase in psyllid presence was observed at the same time as apple proliferation incidence spread. A correlation between these insects and the disease was therefore hypothesised (Frisinghelli et al. , 2000). Accurate observations and a regular monitoring activity on the presence of psyllids has started in 1995 in the orchards of Trentino (Frisinghelli et al. , 2000). The methods used for captures were: a) visual control of shoots and leaves for eggs and the nymphal stages; b) sweep-netting (frappage): the branches of trees are hit with padded sticks and the insects falling down are collected into a rectangular funnel (40 x 65 cm) with a plastic box at the base. The psyllid species collected in apple orchards of Trentino are listed in Tab. 1 (Mat- tedi et al. , 2007, 2008).

Tab. 1 – Psyllid species collected in apple orchards of Trentino (modified from Mattedi et al. , 2007). Species Diffusion in Trentino Cacopsylla melanoneura Förster everywhere C. picta Förster Val di Non and Val di Sole; rare elsewhere C. mali Schmidberger Val di Non and Val di Sole, Valsugana C. pyri Linné C. saliceti group

C. peregrina Förster C. pruni Scopoli C. affinis Löw everywhere C. bruneipennis Edwards C. breviantennata Flor C. crataegi Schrank Trioza urticae Linné Bactericera albiventris Förster

Among all these species, some were only occasionally present, but others showed high population levels. In particular, C. melanoneura and C. picta were regularly present in the orchards of several areas of Trentino. In 1997 C. picta , a species that was constantly present in orchards with a high infection level, was used in transmission trials (Forno et al. , 2002; Frisinghelli et al. , 2000). Overwintering adults, reared on infected apple plants, generated nymphs and adults that were then transferred onto healthy plants for about 25 days. As result, some plants used in the experiments showed symptoms of the disease and were tested

51 positive for the presence of the phytoplasma in the molecular analyses. Correspondingly, the insects used in the transmission were found to be infected by PCR analysis. This was the first report of a psyllid as a vector of ‘ Ca. Phytoplasma mali’. Owing to these findings, also other psyllid species were collected in the field and analysed in order to verify the presence of ‘Ca. Phytoplasma mali’. Moreover, transmission trials were repeated between 1999 and 2004 using C. picta , C. melanoneura and C. mali , the three species that were tested positive in the PCR assay (Forno et al. , 2002; Mattedi et al. , 2007, 2008). Over a six-years period, the springtime generation of C. picta transmitted repeatedly the disease (transmission rate 4.1%), while C. melanoneura was able to transmit only once with the overwintering adults (transmission rate 0.36%) (Mattedi et al. , 2008). These results are consistent with experiments in which the natural infection was studied in the field. Potted bait plants were exposed in several orchards during the presence of the different generations of psyllids. Between 2002 and 2003, the springtime generation of C. picta repeatedly appeared as vector for ‘ Ca. P. mali’ (Mattedi et al. , 2007, 2008). b) The experience in other regions • North-eastern Italy: C. picta is known to be the most important vector of ‘ Ca. Phyto- plasma mali’ in north-eastern Italy (Carraro et al. , 2001, 2008). Insect collections in infected orchards in Friuli Venezia Giulia showed high percentages of infected individuals in all developmental stages (45% in overwintering adults and 14% in springtime generation, respectively) (Carraro et al. , 2008). Despite a high natural infection level, overwintering adults showed a lower transmission rate compared to the springtime generation where the two percentages were quite similar. Thus, it can be concluded that the springtime generation is more efficient in the transmission of ‘ Ca. Phytoplasma mali’ (Carraro et al. , 2008). In 2001, after the epidemic spreading of apple proliferation in the orchards of South Ty- rol, a survey was conducted in the province of Bolzano. Individuals were collected by frappage, classified and then analysed by PCR in pools of 10 individuals. The most abundant species in South Tyrol is C. melanoneura , which showed an infection rate of about the 30% (Poggi Pollini et al. , 2002).

52 • North-western Italy: Field observations and laboratory experiments conducted in Piemonte and in Val d’Aosta by the University of Turin between 1999 and 2001 indicate C. melanoneura as the main vector of ‘ Candidatus Phytoplasma mali’ in north-western Italy (Tedeschi et al . 2002). Furthermore, these researches pointed out the crucial role of overwintering adults in the transmission of the disease, with a transmission efficiency of 29.4%, due to the high percentage of naturally infected individuals, the long period spent in the orchard and the high population density (Tedeschi et al. , 2002, 2003). However, also the springtime generation as well (nymphal stages and new generation adults) was able to transmit the phytoplasma, especially after an experimental acquisition on infected apple plants. In this case, the transmission efficiencies rose from 0 to 16.7% and from 7.1 to 12.5%, respectively (Tedeschi et al. , 2004). Furthermore, as hawthorn has always been considered as the primary host plant of C. melanoneura , surveys were conducted in order to evaluate the relationship among apple plants, the causal agent ‘ Ca. P. mali’, the psyllid and hawthorn. Together with C. melanoneura , also other psyllid species ( C. peregrina Förster, C. affinis Löw and in smaller number C. crataegi Schrank) were collected and analysed. In all the three species the presence of AP-group phytoplasmas was revealed (Tedeschi et al. , 2005). • Germany: The first report of psyllids as a vector of apple proliferation refers to C. picta and dates back to 2003, when a transmission efficiency between the 10% (in 2001) and the 17.5% (in 2002) was obtained (Jarausch et al. , 2003). In the subsequent years, different transmission trials were conducted in order to evaluate the transmission efficiency of the different generations of the insect. Between 2002 and 2007, both overwintering adults and springtime generation transmitted the disease (Jarausch et al. , 2004; 2008; Jarausch-Wehrheim et al ., 2005). The mean transmission efficiencies ranged from 8% and 45% for the overwintering adults and from 4% to 20% for the springtime generation, respectively (Jarausch et al. , 2004; 2008). These data suggest that C. picta , even at a relatively low population density, may be an important vector for apple proliferation in south-western Germany and that the overwintering adults are more efficient vectors than the springtime generation. Several studies were conducted in Germany also on the role of C. melanoneura in the epidemiology of apple proliferation. As in Germany the main host plant of this species is

53 hawthorn ( Crataegus monogyna Jacq.), the natural infection rate was calculated in individuals collected on both host plants. Regarding the individuals collected on apple, a number of 500 individuals was analysed and the 0.7% of overwintering adults tested positive. On the other hand, none of the new generation adults resulted AP-infected. Tests carried out on the populations collected on hawthorn revealed no naturally infected psyllids, even though in forced acquisition trials 3 out of 1800 individuals (0.2%) tested positive. Transmission trials conducted with both populations seem to exclude the possibility that C. melanoneura is involved in spreading the disease in Germany (Jarausch, 2003; Jarausch-Wehrheim et al. , 2005). c) Biology of psyllids Relatively little attention has been focused on the Psylloidea, but these insects, like aphids, are of considerable importance as pests of cultivated crops and trees or as vectors of plant diseases (Hodkinson, 1974). Host range: Plants may play a different role in hosting psyllid species and this allows the definition of the following categories (Conci et al. , 1995). The host plants of a psyllid species are the plants on which the insect is able to lay eggs and develop. The shelter plants (usually conifers) are the plants which adults compulsory migrate to in autumn for spending winter in a reduced trophic activity. Occasional plants are species where insects may be accidentally transported by wind or other causes, but that normally have no importance for their biology. In relation to the host plant range, psyllids have been divided by Conci et al. (1995) in four categories. Monophagous species are species whose young stages can develop exclusively on one botanic species. Strictly oligophagous species live on some congeneric plants. Widely oligophagous species live on plants belonging to kindred genera of the same family. Polyphagous species live on plants of different families. The host range of the Psylloidea is restricted almost exclusively to the perennial dicoty- ledonous plants (Eastop, 1972). Psyllids are generally narrowly host specific (Gegechkori, 1968). An analysis of the Czechoslovakian fauna done by Vondracek (1957) shows that very few species occur in more than one host plant genus and none occurs on more than one host family. Furthermore, closely related species usually occur on closely related host plants. Exceptions to this rule seem to be the genera Cacopsylla and Trioza , which exhibit a

54 world-wide distribution on a variety of host plants and an extension of their host range on to distantly related plants: C. mali Schmidberger, C. peregrina Förster and C. sorbi L. are restricted to the Rosaceae whereas the closely related C. ulmi Förster occurs on Ulmus in the Ulmaceae (Heslop-Harrison, 1948). Heslop-Harrison (1937) observed that certain psyllid species exhibit host plant divergence throughout their range, thus feeding on different species in different regions. On the other hand, some psyllids exhibit divergence while the host plant does not. Thus, it appears that psyllid evolution at the species level has followed fairly closely the evolution of the higher plants, and that host plant specificity, if used carefully, can be a useful aid in predicting the relationships of the psyllids and vice versa (Hodkinson, 1974). Feeding and effects on the host plants: Psyllids are phloem feeders. The damages to the host plants are usually attributable to the nymphal stage (Annecke & Cilliers, 1963; Clark, 1963a; White, 1970b). Visible damages to plants range from localised necrosis of plant tissue to severe galling of leaf and steam tissue and malformation of meristematic tissue. Furthermore, there is a reduction in nitrogen and pigment concentration of infested plants (Eyer, 1937). Anyway, feeding damage by most species is not so severe (Hodkinson, 1974). In Cacopsylla mali nymphs the stylet bundle is propelled into the plant tissue by the stylet muscles and not by the labial movement (Pollard, 1970). Innervation of the mandibulary stylets suggests that psyllids are able to actively locate suitable plant tissue (Forbes, 1972). Salivary injection causes tissue breakdown with a release of soluble aminoacids (Eyer, 1937). White (1970b) suggested that this is a mechanism by which psyllids amelio- rate their food source. Effects of psyllids on the host plants can be manifested in two ways: as developmental differences between host plant species and as developmental differences within a host plant species due to variability in nutritive status. Within the host plant range of a species, certain hosts can be more favourable than others (Moran, 1968; Pande, 1972).Within a single host plant species, favourability for psyllid development is related directly to the quality of the available plant sap (Hodkinson, 1974). In Strophingia ericae Curtis only the 20% of the ingested phloem sap is assimilated and the honeydew excreted is almost pure carbohydrate (Hodkinson, 1973a). This suggests that phloem sap is not a highly nutrition food source and

55 changes in quality of sap, particularly changes in aminoacid concentration, should quickly affect psyllid development. There are evidences that the soluble nitrogen sources in plant tissues and the age of leaves may influence the survival and the growth of nymphs, and the fecundity and life span of adults (Catling, 1969c, 1971; Hodkinson, 1973a; Pande, 1972; Thanh-Xuan, 1972; White, 1969). In general, it seems that younger, more vigorous plants, perhaps with a higher nitrogen content, support higher psyllid populations than older plants (Catling, 1969a; Watmough, 1968a). Developmental biology: All psyllids pass through an egg and five nymphal instars before becoming adult. Most of the species are strictly bisexual, with the male the het- erogametic sex (Bhattacharya, 1972; Walton, 1960). The only exception seems to be Psylla myrtilli Wagner, which is claimed to be parthenogenetic (Lauterer, 1963; Linnavuori, 1951). The external sex organs appear post-embryonically and develop continuously throughout the nymphal instars (Zucht, 1972). By the fifth instar, male and female nymphs are morphologically distinct (Ball & Jensen, 1966; Hodkinson, 1973a; Ossiannilsson, 1970; Walton, 1960). In adult females maturation of eggs may occur quickly and oviposition can commence within five days of emergence (Burts & Fischer, 1967). However, females that hibernate probably delay egg development until spring. Under tropical conditions generations are continuous throughout the year, with growth rates governed by prevailing climatic factors and host plant condition (Atwal et al. , 1970; Pande, 1972). In north temperate and arctic regions, psyllids have evolved mechanisms to survive during winter, when the host plants are dormant. Overwintering diapause eggs are usually laid on the buds of the host plant, while overwintering larvae inhabit favourable mi- croclimates on the host plant (Hodkinson, 1974). Many psyllids overwinter as adults, but most species leave the host plants and disperse onto shelter plants, particularly conifers, moving back onto their true host plants to mate and oviposit in spring (Schaefer, 1949). In Italy, Picea abies (L.) Karsten has been shown to be preferred by many psyllids species, but a certain attractiveness has been evidenced also by Picea alba Miller, Pinus nigra Arnold, P. sylvestris L., P. mugo Turra, P. cembra L., Cupressus sempervirens L., Juniperus communis L., J. oxycedrus L. and Taxus baccata L. (Conci et al. , 1995). It is not known whether overwintering adults feed on shelter plants, though a consideration at their mois- ture requirements would suggest they do (Hodkinson, 1974).

56 Hatching of eggs in the spring occurs at or about bud burst and nymphs move directly onto the flush of new foliage (Przybylski, 1970). Biology of the immature stages: • Eggs possess a basal pedicel which is inserted into the host plant tissue. It has been suggested that females of Trioza erytreae Del Guercio (Moran & Buchan, 1975) and Cacopsylla pyricola Förster (Horton, 1990) anchor their eggs in soft leaf tissues with the pedicel. Water is taken up from the plant through the pedicel and eggs quickly desiccate if the water source is removed (White, 1968). Fur- thermore, physiological changes in the leaf tissue may affect the mechanism of water absorption (Catling, 1971). Eggs can be laid superficially on a leaf or bud surface, be deeply embedded in the plant tissue or laid in leaf axils (Hodkinson, 1974). When laid in protection situations, they suffer less predation than those laid superficially (Watmough, 1968a). • Nymphs are highly susceptible to desiccation, particularly at high temperatures and especially at the moult (Atwal et al. , 1970; Catling & Annecke, 1968; Green & Catling, 1971; Hodkinson, 1973b; Pletsch, 1947). Nymphs have evolved various mechanisms to reduce water loss. They range from behavioural devices (e.g. active feeding in the early morning) to enveloping protective structures, such as galls (cecidia) or nests made by honeydew or wax (Hodkinson, 1974). Gall- forming activity is very often optional in psyllids; thus various species, which are usually considered as cecidium-producers, may also develop in some cases without causing galls. For many of these species , effects on plants highly depend on the infestation level and consequent cecidia may be abundantly and frequently noted only with high population densities. On the contrary, a few species always produce cecidia through their activity, and their nymphs cannot survive outside their own galls (Conci et al. , 1995). Biology of adults: • Dispersal and host selection: Adults show a very restricted ability to fly distances under their own power, and therefore active migrations usually cover just a few tens of meters (Clark, 1962, Conci et al. , 1995). However, certain psyllids disperse long distances (even many kilometres) on air currents by passive migra-

57 tions (Conci et al. , 1995). Long-range dispersal by wind is most apparent in the north temperate species which disperse in the fall to seek shelter plants (Hodkin- son, 1972); a wind-assisted dispersal over short distances is common in many species (Clark, 1962; Kristoffersen & Anderbrant, 2007; Rasmy & McPhee, 1970; Watmough, 1968b). The mechanism of host plant selection is still unknown, but the innervation of the mandibulary stylets suggests it is probably chemo-gustatory (Hodkinson, 1974) and some psyllids seem to be attracted to volatile chemicals from host plants (Lapis & Borden, 1993; Moran & Brown, 1973; Soroker et al. , 2004) or deterred by non-host volatiles (Nehlin et al. , 1994). • Mating and oviposition: In many species, mating is a straightforward act in which males approach females from the side, rotate the abdomen and grasp the female valves with their parameres before inserting the aedeagus (Cook, 1963; Hodkinson, 1971). The signals used by males to locate females are still largely unknown. Many psyllids stridulate, and this may serve to bring the sexes together, particularly at low densities (Campbell, 1964; Heslop-Harrison, 1960; Ossiannilsson, 1950; Percy, 2005; Percy et al. , 2006; Taylor, 1985; Tishechkin, 1989; White, 1970a; Yang et al. , 1986). Rapid wing-vibrations are generally associated with the sound production, but the exact mechanism has not been definitely established (Ossiannilsson, 1992). Taylor (1985) described a possible stridulatory organ, consisting of teeth on the axillary cords of the meso- and me- tascutellum, with corresponding rows of teeth under the second anal veins of both wings. Besides acoustic communication, it is likely that also visual (Krysan, 1990) and olfactory (Soroker et al. , 2004; Horton & Landolt, 2007) cues may contribute. Substrate-borne acoustic signals and visual cues are both likely to be effective over relatively short distances, meaning that any long-distance communication between male and female (if present) must require some other type of communication system (Horton & Landolt, 2007). In most species copulation lasts no longer than about 30 min, although it can last up to four hours (Hodkin- son, 1971; Pande, 1971; White, 1970a; and Burts & Fisher, 1967, respectively). In Cacopsylla pyricola Förster, a female must mate repeatedly to produce eggs to her full capacity. However, each male is capable of fully inseminating four fe-

58 males (Burts & Fischer, 1967). In the same species, females use to perform a set- tling-probing and abdomen bend activities on leaves before starting oviposition. It is likely that in this way they receive from plants cues which give them information about the host plant before starting oviposition (Horton & Krysan, 1991). In Trioza eugeniae Froggatt, females respond to the presence of previously laid eggs on a leaf by laying fewer eggs, probably to avoid competition of nymphs. They also avoid laying eggs on damaged areas that can become necrotic because it could result in increased egg mortality. These inhibitions appear to result from tactile or chemical cues (Luft & Paine, 1997). Parasites and predators: Several families belonging to Diptera and Hymenoptera are the recorded parasites of psyllids (Jensen, 1957). In the Diptera, Cecidomyiid midges are parasitic of the adult psyllids (Lal, 1934), whereas the Hymenoptera are quite all nymphal parasites (Robinson, 1961a, b, c). There are no records of egg parasitism in the Psylloidea (Hodkinson, 1974). The parasite species recorded for psyllids are almost exclusively parasitic on Psylloidea, although there is little evidence for parasite-host specificity within this group (Jensen, 1957). Little is known about psyllid-parasite relationships. Hymenopterous parasites generally attack specific nymphal instars (Moran et al. , 1969; Onillon, 1969; Cat- ling, 1969b; Clark, 1964). In general, psyllid predators are not specific and feed opportunistically on psyllids (Cat- ling, 1970). A possible exception may be Anthocoris sarothamni Douglas & Scott, a predator of Arytaina sp. in Britain, which feeds selectively on psyllids and which has a higher fecundity and longevity when fed on psyllids in preference to aphids (Anderson, 1962; Dempster, 1963). Besides Heteroptera Anthocoridae, the most important and diffused predators of psyllids in Italy, also Coleoptera Coccinellidae, Neuroptera Chrysopidae and Diptera Syrphidae are reported by Conci et al. (1995). Other biological control agents: various fungal species of the genus Entomophthora (Fungi Entomophthorales) are known since a long time to be effective on psyllids (Conci et al. , 1995). With particular reference to Italy, the activity of an Entomophthora sp. on Ca- copsylla pyri L. was reported in Piemonte (Arzone, 1979) and of E. sphaerosperma Fresen- ius on various pear-feeding psyllids of the genus Cacopsylla (Tremblay, 1981).

59 In this context, the generic predacious activity shown on psyllids by various zoological groups, such as mites (especially in the family Trombidiidae), spiders or birds, is also not to be neglected for the very important role played by these factors in some peculiar ecosystems (Conci et al. , 1995). Intraspecific mechanisms: Population density seems to condition the nymphal mortality in some species, and it was hypothesized that group feeding, up to a certain density, causes disproportionate breakdown of plant tissues which enhances the food supply to individuals (Watmough, 1968a; White, 1970b). In Trioza eugeniae Froggatt, a high density of nymphs on a leaf may be advantageous as long as the carrying capacity of the leaf is not exceeded: it causes an increase of leaf distortion and improve abiotic conditions for developing nymphs by raising the relative humidity levels or reducing exposure of nymphs to direct insolation. At high nymphal density, on the other hand, competition supersedes any potential benefit (Luft et al. , 2001). A parallel situation exists with regard to adult fecundity (Hodkinson, 1974). At high densities, female fecundity decreases with increasing density (Clark, 1963b; Thanh-Xuan, 1973; Watmough, 1968a). However, at low densities, fecundity and life span of adult females in Cacopsylla pyri L. increase with increasing density (Thanh-Xuan, 1971). d) Cacopsylla picta Förster (1848) This species is more commonly known under the name C. costalis Flor (1861), but it has been synonymised with C. picta by Lauterer & Burckhardt (1997). This species occurs together with C. mali Schmidberger in summer, and the two species can be easily mistaken (Lauterer, 1999). Young adults (Figs. 7 and 8) are light green, with a mesothorax yellowish banded. Later their colour is dirty yellow or orange-coloured with more or less extensive dark brown or black markings. The abdomen is black with red segment borders (Ossiannilsson, 1992). During hibernation the body coloration changes to black-brown (Lauterer, 1999). Fore- wings are colourless, veins in old specimens are dark brown or black; pterostigma fuscous. The overall length of males is 2.86-3.24 mm, of females 3.14-3.43 mm (Ossiannilsson, 1992).

60 5th instar nymphs (Fig. 8) are light green, wing pads with a pale violet tinge. Abdominal margin has 3 pairs of sectasetae. The ocular seta is more or less simple, 0.03-0.04 mm in length. The length of the body is 1.57-2.19 mm (Ossiannilsson, 1992). Biology : The species is narrowly oligophagous on Malus domestica Borkh., Malus sylvestris Mill., Malus cv and Prunus armeniaca L. (Conci et al. , 1992; Lauterer, 1999; Os- siannilsson, 1992). Harisanow (1966) studied the biology of C. picta in Bulgaria. Accord- ing to his account this species is univoltine, overwintering as adult on Pyrus communis L., Prunus domestica L., Persica vulgaris Mill., Amygdalus communis L., Ulmus campestris L. and other plants (Lauterer, 1999; Ossiannilsson, 1992). In spring the adults migrate to apple trees where oviposition and larval development take place. According to Lauterer (1999), a female may lay approximately 160 eggs. 10-14 days after becoming adult, the new generation of insects moves on first to annual herbs, e.g. Brassica , Mentha , Vicia , Phaseolus , Pisum , as well as grasses, e.g. Avena ; later to perennial shelter plants (Lauterer, 1999; Ossiannilsson, 1992). Such temporary seasonal migrations to herbaceous plants have not been observed by other authors in the genus Cacopsylla as yet (Harisanov, 1966). According to Conci et al. (1992), C. picta overwinters on conifers. These data are confirmed by Flor (1861), which collected specimens on Pinus abies L. in August. Ossiannilsson (1992) in Uppland found one male on Picea abies (L.) H. Karst. at the end of November. The host location and the migration behaviour of C. picta seems to be mediated by the chemical cues emitted by plants, and the preference of the insects switches between the volatiles of the host and the shelter plants during the course of the year (Gross & Mekonen, 2005).

Fig. 7 – Cacopsylla picta . Female: (a) head in frontal aspect; (b) left antenna in dorsal aspect. Male: (c) left forewing, (d) terminalia from the left; (e) left paramere from the left; (f) same from behind; (g) terminal part of aedeagus from the left. Scale: 0.1 mm (modified from Ossiannilsson, 1992).

c b

Fig. 8 – Cacopsylla picta . Female: (a) terminalia from the left; (b) proctiger from above; (c) subgenital plate from below. 5 th instar nymph: (d) left antenna from above; (e) left wing- pads from above; (f) abdominal dorsum (left) and venter (right); (g) circumanal pore rings from below. Scale: 0.1 mm for (g); 0.5 mm for the rest (modified from Ossiannilsson, 1992).

63 e) Cacopsylla melanoneura Förster (1848) C. melanoneura is a holopaleartic species distributed everywhere with its host plants. Young adult specimens (Figs. 9 and 10) are orange-coloured, pronotum and genal cones are whitish, forewing veins are yellow. Later, they are largely dark brown with a reddish tinge, head and pronotum are partly lighter, mesonotum with pale spots and bands, forewing veins are dark brown or black. Forewings alone veins have broad spinule-free bands becoming broader apically. Overall length of males is 2.52-3.10 mm, of females is 2.95- 3.30 mm (Ossiannilsson, 1992). 5th instar nymphs (Fig. 10) are entirely light green, or green to dirty green with yellow- brownish sclerites. Wing pads are often whitish. The number of marginal setae on forewing-pads is variable. On abdominal margin there are 3 pairs of sectasetae. The body length is 1.33-2.00 mm. Ocular seta is more or less rod-like or spine-like, length is 0.011- 0.017 mm (Ossiannilsson, 1992). Biology : This species is widely oligophagous on Rosaceae Maloideae such as Crataegus spp. ( Crataegus monogyna Jacq., Crataegus oxyacantha L., Crataegus maxi- mowiczii C.K.Schneid), Malus spp. and Pyrus communis L. (Conci et al. , 1992; Ossiannils- son, 1992). It is reported also on conifers and many other shelter and occasional plants of different families (Conci et al. , 1992; Lauterer et al. , 1999). Lazarev (1974) studied the biology of C. melanoneura on apple plants in Crimea. Over- wintering adults live for 9-10 months long on Pinus spp. in higher altitudes (250-1400 m a.s.l.), performing long-distance migrations between stands of pines and apple trees. The migrations take place during budding of the host plant. Each female lays about 200 eggs. Embryonic development lasts 7-20 days and larvae hatch at the time of maximum flowering of apple trees. The larvae develop over one month and then the new generation adults appear. After complete sclerotisation (i.e. about 5 days after their last skinning) the adults migrate to mountain elevations on to pine trees. Ossiannilsson (1992) described the life cycle of C. melanoneura on hawthorn in Swe- den, where the stages are slightly delayed in time and the migration of the new generation adults to conifers does not begin before July.

64 In Moravia, in Querceto-Carpinetum associations and particularly in floodplain forests, however, in absence of conifers, most of the population may hibernate on other broadleaved trees, hiding under bark scales and on sprouts (Lauterer, 1999). Apparently, the long-distance seasonal migrations of young adults to mountain elevations shortly after having completed sclerotisation are limited to the warmer southern parts of Europe. In the conditions of central Europe the migrations are apparently shorter (Lau- terer, 1999). Mass occurrence of new generation adults in Moravia was observed by the author in the 1 st decade of June, whereupon their number dropped abruptly. This early emigra- tion from the host plants to other plants agrees with the observation of Lazarev (1974), but in Moravia the migration to the shelter plants seems to be gradual, and the species first mi- grates on occasional plants and then to conifers. Thus, for this species, three migration phases can be distinguished (Lauterer, 1999). The role of chemical signals in the migration behaviour and the orientation of C. melanoneura was studied with psyllids collected from both apple and hawthorn by Gross & Mekonen (2005) and by Mayer & Gross (2007). The behavioural responses of the insects corresponded with the different phases of the migratory behaviour, the overwintered adults showing strong positive responses for apple or hawthorn odours, while the newly emerged adults showing strong responses for spruce volatiles. Attempts at copulation and copulating adults were observed already during June but, apparently, fertilisation does not take place until copulations after hibernation between March and May (Lauterer, 1999). About one week after the last skinning and completed sclerotisation, the adults enter dormancy of the parapause type with aestivation, later passing into a diapause during hibernation. Reactivation and development of sexual glands only occur after the cold phase in winter (Lauterer, 1999). The altitude of hibernation and aestivation places differs according to the latitude: in Moravia the majority of individuals can be found between 160 and 450 m a.s.l., while at higher altitudes the occurrence is only sparse; the populations of the southern European regions most often hibernate and aestivate on dwarf pines in high mountain altitudes. The distribution of this species seems to be partly conditioned by its thermophily, but first of all by

65 the composition of vegetation (especially the presence of hawthorn, which is more present in warmer biogeographical units) (Lauterer, 1999). C. melanoneura frequently hibernates together with the salicicolous psyllids (the so- called C. saliceti group) and with C. affinis Löw. In its host plants it occurs together with C. affinis , C. peregrina Förster, and the phonologically delayed C. crataegi Schrank (Lauterer, 1999). In the Crimea, members of the population which lives on apple trees will not develop if transferred to hawthorn and die within several days (Lazarev, 1974).

Fig. 9 – Cacopsylla melanoneura . Male: (a) head in frontal aspect; (b) left antenna in dorsal aspect; (c) left forewing; (d) cell m 1 of forewing; (e) terminalia from the left; (f) left paramere from behind; (g) terminal part of aedeagus from the left. Scale: 1 mm for (c); 0.5 mm for (a) and (b); 0.1 mm for (e), (f) and (g) (modified from Ossiannilsson, 1992).

a b d

Fig. 10 – Cacopsylla melanoneura . Female: (a) terminalia from the left; (b) proctiger from above, (c) subgenital plate from below. 5 th instar nymph: (d) left antenna from above; (e) left wing-pads from above; (f) left half of caudal part of abdominal dorsum; (g) circumanal pore rings from below. Scale: 0.1 mm for (g); 0.5 mm for the rest (modified from Ossian- nilsson, 1992).

68 f) Population dynamics of Cacopsylla picta and C. melanoneura in Trentino The monitoring activity carried out in Trentino since 1999 permitted to have a clear im- age of the biology of the two psyllids in the environment of Trentino (Mattedi et al. , 2007, 2008). C. picta is predominant in the upper Val di Non, with population densities reaching 7 overwintering adults/branch in 2003, but it is nearly absent in Val d’Adige (0.06 overwintering adults/branch in the same year). At the beginning of the observations it was believed to be limited to Val di Non and Val di Sole, but since 1999 the presence of this species has been observed also in Val d’Adige, even though only sporadically (Mattedi et al. , 2007). The populations of C. melanoneura show an inverse trend, with the highest density in the bottom valley environments (up to 2 overwintering adults/branch in Val d’Adige and 0.64 overwintering adults/branch in Val di Non in 2003) (Mattedi et al. , 2007, 2008). Owing to the regular captures in the different areas of the region it was also possible to establish the population dynamics for the two species (Fig. 11 a and b). After several years of observations, it could be stated that the biology of the insects remained similar despite different population densities. Overwintering adults migrate from not yet identified shelter plants into apple orchards between the end of January and February for C. melanoneura and between the end of March and the beginning of April for C. picta . Both species reproduce on apple. C. melanoneura begins oviposition between the end of February and the beginning of March and this activity lasts about 30-40 days. At the end of March the first neanids appear and the new generation adults emerge at the end of April. As the adults develop, they migrate to other shelter plants and this species disappears from the orchard before the end of June. In C. picta oviposition begins mid-April and lasts 30-50 days. Eggs hatch from the end of April and nymphal instars develop until June, when the first springtime adults emerge. The springtime generation leaves the host plant before the end of July.

1/4 6/4 12/4 19/4 26/4 3/5 10/5 18/5 24/5 31/5 7/6 14/6 21/6 29/6 8/7 14/7 21/7 28/7

overwintering adults eggs nymphs springtime adults a)

26/1 9/2 23/2 9/3 23/3 6/4 20/4 4/5 18/5 1/6 15/6 29/6

overwintering adults eggs nymphs springtime adults b)

Fig. 11 – Population dynamics of the psyllid vectors of apple proliferation in 2002: (a) sum of all captures of C. picta in Val di Non; (b) sum of all captures of C. melanoneura in Val d’Adige (modified from Mattedi et al., 2007, 2008).

70 IV. Aims of the research

The present research was part of a larger research project (SMAP: Scopazzi del Melo – Apple Proliferation) funded by the Province of Trento and aiming to investigate the epidemic spreading of apple proliferation in Trentino and to establish short-term and long-term control strategies against the disease. Within this project, the present work focused on a better understanding of the role played by C. picta and C. melanoneura in the epidemiology of apple proliferation, as many aspects these two psyllids in vectoring the disease remained to be clarified because of their peculiar biology and the differences in the transmission efficiencies reported for the different areas where the spreading of apple proliferation was investigated so far. Therefore, the first aim of this research was to determine the phytoplasma acquisition and transmission efficiencies of both psyllid species in Trentino in order to enable a better risk assessment for the control of these vectors. For this, the following objectives were established: • assessing the transmission efficiency of the different developmental instars of the two species, • assessing the acquisition capacities of the different developmental instars of the two species, • assessing the minimum acquisition access periods of the overwintered adults of the two species, • evaluating the multiplication efficiency of the phytoplasma within the insects by applying quantitative real-time PCR, • analysing the relationships between the phytoplasma level in the insects and their infectivity. A second aim of this work was the study of the differences in populations of C. melanoneura collected in different geographical areas from different host and shelter plants (apple, hawthorn and conifers) in order to explain the differences in transmission efficiency reported for this species. This part of the work should verify: • the correlation between the host plant and the infection level in the insect,

71 • the differences in the natural infection rates among different populations, • the role of alternative host plants of the psyllid in the epidemiology of apple proliferation, • the influence of ‘ Ca. Phytoplasma mali’ on the fitness of this psyllid species, • the existence of different populations collected from apple and hawthorn by applying bioassays and genetic analyses with mitochondrial and microsatellite markers.

V. References

Ahrens U. and Seemüller E. (1992) Detection of DNA of plant pathogenic mycoplasmalike organisms by a polymerase chain reaction that amplifies a sequence of the 16S RNA gene. Phytopathology , 82: 828-832. Alma A., Bosco D., Danielli A., Bertaccini A., Vibio M. and Arzone A. (1997) Identifica- tion of phytoplasmas in eggs, nymphs and adults of Scaphoideus titanus Ball reared on healthy plants. Insect Molecular Biology , 6: 115-121. Alma A., Davis R.E., Vibio M., Danielli A., Bosco D., Arzone A. and Bertaccini A. (1996) Mixed infection of grapevines in northern Italy by phytoplasmas including 16S rRNA RFLP subgroup 16SrI-B strains previously unreported in this host. Plant Disease , 80: 418-421. Alma A., Marzachì C., d'Aquilio M. and Bosco D. (2000) Cyclamen ( Cyclamen persicum L.): a dead-end host species for 16Sr-IB and -IC subgroup phytoplasmas. Annals of Ap- plied Biology , 136: 173-178. Anderson N.H. (1962) Growth and fecundity of Anthocoris spp. Reared on various prey (Heteroptera: Anthocoridae). Entomologia Experimentalis et Applicata , 5: 40-52. Annecke D.P. and Cilliers C.J. (1963) The citrus psylla, Trioza erytreae (Del Guercio) and its parasites in South Africa. South African Journal of Agricultural Science , 6: 187-192. Arzone A. (1979) Indagini sui limitatori naturali di Psylla pyri (L.) in Piemonte. Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri”, Portici, 36: 131-149. Atwal A.S., Chaudhary J.P. and Ramzan M. (1970) Studies on the development and popu-

72 lation of citrus psylla, Diaphorina citri Kuwayama (Psyllidae: Homoptera). Journal of Research Punjab Agricultural University , 7: 333-338. Backus E.A., Serrano M.S. and Ranger C.M. (2005) Mechanisms of hopperburn: an over- view of insect taxonomy, behavior, and physiology. Annual Review of Entomology , 50: 125-151. Bai X., Zhang J., Ewing A., Miller S.A., Jancso Radek A., Shevchenko D.V., Tsukerman K., Walunas T., Lapidus A., Campbell J.W. and Hogenhout S.A. (2006) Living with genome instability: the adaptation of phytoplasmas to diverse environments of their insect and plant hosts. Journal of Bacteriology , 188: 3682-3696. Ball J.C. and Jensen D.D. (1966) Sexual dimorphism in mymphs of Psylla pyricola (Hemiptera: Psyllidae). Annals of the Entomological Society of America , 58: 1292- 1294. Banttari E.E. and Zeyen R.J. (1979) Interactions of mycoplasmalike organisms and viruses in dually infected leafhoppers, planthoppers, and plants. In: Leafhopper Vectors and Plant Disease Agents , pp. 327-347. K. Maramorosch and K.F. Harris. Academic Press, New York (USA). Baric S. and Dalla-Via J. (2004) A new approach to apple proliferation detection: a highly sensitive real-time PCR assay. Journal of Microbiological Methods , 57: 135-145. Baric S., Kerschbamer C., Vigl J. and Dalla-Via J. (2008) Translocation of apple proliferation phytoplasma via natural root grafts – a case study. European Journal of Plant Pa- thology , 121:207-211. Beanland L., Hoy C.W., Miller S.A. and Nault L.R. (1999) Leafhopper transmission of the aster yellows phytoplasma: Does sex matter? Environmental Entomology , 28: 1101- 1106. Beanland L., Hoy C.W., Miller S.A. and Nault L.R. (2000) Influence of aster yellows phytoplasma on the fitness of the aster leafhopper (Homoptera: Cicadellidae). Annals of the Entomological Society of America , 93: 271-276. Beanland L., Madden L.V., Hoy C.W., Miller S.A. and Nault L.R. (2005) Temporal distribution of aster leafhopper sex ratios and spatial pattern of aster yellows phytoplasma disease in lettuce : Insect transmission of plant pathogens. Annals of the Entomological Society of America , 98(6): 756-762.

73 Behnke H.D., Schaper U. and Seemüller E. (1980) Elektronenmikroskopischer Nachweis von mykoplasmaähnlichen Organismen bei Birnbäumen mit pear-decline Symptomen in der Bundesrepublik Deutschland. Phytopathologische Zeitschrift , 97: 89-93. Bhattacharya A.K. (1972) Chromosomes of the psyllids (Sternorrhyncha, Homoptera). Current Sciences , 41: 295-296. Bianco P.A., Davis R.E., Prince J.P., Lee I.-M., Gundersen D.E., Fortusini A. and Belli G. (1993) Double and single infections by aster yellows and elm yellows MLOs in grapevines with symptoms characteristic of flavescence dorée. Rivista di Patologia Vegetale , 3: 69-82. Black L.M. (1959) Biological cycles of plant viruses in insect vectors. In : The Viruses , vol. 2, Plant and Bacterial Viruses , pp. 157-185. F.M. Burnet and W.M. Stanley, eds. Aca- demic Press, New York (USA). Bliefernicht K. and Krczal G. (1995) Epidemiological studies on apple proliferation disease in Southern Germany. Acta Horticulturae , 386: 444-447. Bosco D., Minucci C., Boccardo G. and Conti M. (1997) Differential acquisition of chrysanthemum yellows phytoplasma by three leafhopper species. Entomologia Experimen- talis et Applicata , 83: 219-224. Bové J.M., Renaudin J., Saillard C., Foissac X. and Garnier M. (2003) Spiroplasma citri , a plant pathogenic mollicute: relationships with its two hosts, the plant and the leafhopper vector. Annual Review of Phytopathology , 41: 483-500. Bovey R. (1963) Apple proliferation. In: Virus diseases of apples and pears . Technical Communication, Commonwealth Bureau of Horticulture and Plantation Crops No. 30, pp. 63-67. Brcák J. (1979) Leafhopper and planthopper vectors of plant disease agents in central and southern Europe. In: Leafhopper Vectors and Plant Disease Agents , pp. 97-154. K. Maramorosch and K.F. Harris. Academic Press, New York (USA). Burts E.C. and Fischer W.R. (1967) Mating behavior, egg production, and egg fertility in the pear psylla. Journal of Economic Entomology , 60: 1297-1300. Cainelli C. (2007) Population dynamics of apple proliferation in Trentino . 171 pp. Ph.D. Thesis, Università degli Studi di Verona (Italy). Cainelli C., Forno F., Mattedi L. and Grando M.S. (2007) Can apple aphids be vectors of

74 “Candidatus Phytoplasma mali”? IOBC/wprs Bulletin , 30 (4): 261-266. Campbell K.G. (1964) Sound production by Psyllidae ( Hemiptera). Journal of the Entomo- logical Society of Australia , 1: 3-4. Carraro L., Ferrini F., Ermacora P., Loi N. and Labonne G. (2008) Infectivity of Cacop- sylla picta (Syn. Cacopsylla costalis ), vector of ‘ Candidatus Phytoplasma mali’ in north east Italy. Acta Horticulturae , 781: 403-407. Carraro L., Loi N., Ermacora P. and Osler R. (1998a) High tolerance of European plum varieties to plum leptonecrosis. European Journal of Plant Pathology , 141-145. Carraro L., Loi N., Ermacora P., Gregoris A. and Osler R. (1998b) Transmission of pear decline by using naturally infetced Cacopsylla pyri. Acta Horticulturae , 472: 665-668. Carraro L., Osler R., Loi N., Ermacora P. and Refatti E. (1998c) Transmission of European stone fruit yellows phytoplasma by Cacopsylla pruni . Journal of Plant Pathology , 80: 233-239. Carraro L., Osler R., Loi N., Ermacora P. and Refatti E. (2001) Fruit tree phytoplasma diseases diffused in nature by psyllids. Acta Horticulturae , 550: 345-350. Catling H.D. (1969a) The bionomics of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). 1. The influence of the flushing rhythm of citrus and factors which regulate flushing. Journal of the Entomological Society of South Af- rica , 32: 191-208. Catling H.D. (1969b) ) The bionomics of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae).2. The influence of parasites and notes on the species involved. Journal of the Entomological Society of South Africa , 32: 209-223. Catling H.D. (1969c) The bionomics of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). 3. The influence of extremes of weather on survival. Journal of the Entomological Society of South Africa , 32: 272-290. Catling H.D. (1970) The bionomics of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). 4. The influence of predators. Journal of the Entomo- logical Society of South Africa , 33: 341-348. Catling H.D. (1971) The bionomics of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). 5. The influence of host plant quality. Journal of the Entomological Society of South Africa , 34: 381-391.

75 Catling H.D. and Annecke D.P. (1968) Ecology of citrus psylla in the Letaba district of Northern Transvaal. South African Citrus Journal , n° 410, 6 pp. Cazelles O. (1978) Mise en évidence, par fluorescence, des mycoplasmes dans les tubes criblés intacts isolés des plantes infectées. Phytopathologische Zeitschrift , 91: 314-319. Chang C.J. (1998) Pathogenicity of aster yellows phytoplasma and Spiroplasma citri on periwinkle. Phytopathology , 88: 1347-1350. Chang C.J. and Lee I.-M. (1995) Pathogenesis of diseases associated with mycoplasmalike organisms. In: Pathogenesis and Host Specificity in Plant Diseases, 1: 237-246. U.S. Singh, R.P. Singh and K. Kohmoto (eds.). Elsevier, New York (USA). Chapman R.K. (1949) Some factors affecting the transmission of aster-yellows virus by the six-spotted leafhopper, Macrosteles divisus (Uhl.). 138 pp. Ph.D. Thesis, University of Wisconsin, Madison (USA). Chen K.H., Credi R.C., Loi N., Maixner M. and Chen T.A. (1994) Identification and grouping of mycoplasmalike organisms associated with grapevine yellows and clover phyllody diseases based on immunological and molecular analyses. Applied and Envi- ronmental Microbiology , 60: 1905-1913. Chen T.A., Lei J.D. and Lin C.P. (1992) Detection and identification of plant and insect mollicutes. The Mycoplasmas , 5: 393-424, R.F. Whitcomb and J.G. Tully (eds). Aca- demic Press, New York (USA). Chiykowski L.N. (1991) Vecto-pathogen-host plant relationships of clover phyllody mycoplasmalike organism and the vector leafhopper Paraphlepsius irroratus. Canadian Journal of Plant Pathology , 13: 11-18. Chiykowski L.N. and Sinha R.C. (1970) Sex and age of Macrosteles fascifrons in relation to the transmission of the clover proliferation causal agent. Annals of the Entomological Society of America , 63: 1614-1617. Chiykowski L.N. and Sinha R.C. (1988) Some factors affecting the transmission of eastern peach X-mycoplasmalike organism by the leafhopper Paraphlepsius irroratus . Cana- dian Journal of Plant Pathology , 10: 85-92. Chiykowski L.N. and Sinha R.C. (1989) Differentiation of MLO disease by means of symptomatology and vector transmission. Zentralblatt für Bakteriologie, Para- sitenkunde, Infektionskrandheiten und Hygiene Supplement , 20: 280-287.

76 Choi Y.H., Tapias E.C., Kim H.K., Lefeber A.W.M., Erkelens C ., Verhoeven J.Th.J., Brzin J., Zel J. and Verpoorte R. (2004) Metabolic discrimination of Catharanthus roseus leaves infected by phytoplasma using 1H-NMR spectroscopy and multivariate data analysis. Plant Physiology , 135: 2398-1410. Christensen N.M., Axelsen K.B., Nicolaisen M. and Schulz A. (2005) Phytoplasmas and their interactions with hosts. Trends in Plant Science , 10 (11): 526-535. Ciccotti A.M., Bianchedi P.L., Bragagna P., Deromedi M., Filippi M., Forno F. and Mat- tedi L. (2007) Transmission of ‘ Candidatus Phytoplasma mali’ by root bridges under natural and experimental conditions. Bulletin of Insectology , 60 (2): 387-388. Clark L.R. (1962) The general biology of Cardiaspina albitextura (Psyllidae) and its abundance in relation to weather and parasitism. Australian Journal of Zoology , 10: 537- 586. Clark L.R. (1963a) On the density and distribution of newly established nymphs of Cardi- aspina albitextura (Psyllidae) at times of high abundance. Proceedings of the Linnean Society of New South Wales , 88: 67-73. Clark L.R. (1963b) The influence of population density on the number of eggs laid by females of Cardiaspina albitextura (Psyllidae). Australian Journal of Zoology , 11: 190- 201. Clark L.R. (1964) The intensity of parasite attack in relation to the abundance of Cardi- aspina albitextura (Psyllidae). Australian Journal of Zoology , 12: 150-173. Conci C., Rapisarda C. and Tamanini L. (1992) Annotated catalogue of the Italian Psyl- loidea . First Part ( Insecta Homoptera ). Atti Accademia Roveretana degli Agiati , a. 242, ser. VII, vol. II, B: 33-135. Conci C., Rapisarda C. and Tamanini L. (1995) Annotated catalogue of the Italian Psyl- loidea . Second Part ( Insecta Homoptera ). Atti Accademia Roveretana degli Agiati , a. 245, ser. VII, vol. V, B: 5-207. Constable F.E., Jones J., Gibb K.S., Chalmers Y.M. and Symons R.H. (2004) The incidence, distribution and expression of Australian grapevine yellows, restricted growth and late season leaf curl diseases in selected Australian vineyards. Annals of Applied Biology , 144: 205-218. Cook P.P. Jr. (1963) Mating behaviour of Psylla pyricola Förster (Hom. Psyllidae). The

77 Pan-Pacific Entomologist , 39: 175. Cordova I., Jones P., Harrison N.A. and Oropeza C. (2003) In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease. Molecular Plant Pathology , 4: 99-108. D'Arcy C.J. and Nault L.R. (1982) Insect transmission of plant viruses and mycoplasmalike and rickettsialike organisms. Plant Disease , 66: 99-104. Davies D.L., Guise C.M. and Adams A.N. (1992) Parry’s disease of pears is similar to pear decline and is associated with mycoplasma-like organisms transmitted by Cacopsylla pyricola . Plant Pathology , 41: 195-203. Davis R.E. and Sinclair W.A. (1998) Phytoplasma identity and disease etiology. Phytopa- thology 88: 1372-1376. Del Serrone P., La Starza S., Krystai L., Kolber M. and Barba M. (1998) Occurrence of apple proliferation and pear decline phytoplasmas in diseased pear trees in Hungary. Journal of Plant Pathology , 80: 53-58. Dempster J.P. (1963) The natural prey of three species of Anthocoris (Heteroptera: Antho- coridae) living on broom ( Sarothamnus scoparius L.). Entomologia Experimentals et Applicata , 6: 149-155. Deng S. and Hiruki C. (1991) Amplification of 16S rRNA genes from culturable and non- culturable mollicutes. Journal of Microbiological Methods , 14: 53-61. Doi Y., Terenaka M., Yora K. and Asuyama H. (1967) Mycoplasma of PTL group-like mi- croorganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches’ broom, aster yellows, or Pawlonia witches’ broom. Annals of The Phyto- pathological Society of Japan , 33: 259-266. Eastop V.F. (1972) Deductions from the present day host plants of aphids and related insects. Symposia of the Royal Entomological Society of London , 6: 157-178. Ebbert M.A., Jeffers D.P., Harrison H.A. and Nault L.R. (2001) Lack of specificity in the interaction between two maize stunting pathogens and field collected Dalbulus leafhoppers. Entomologia Experimentalis et Applicata , 101: 49-57. EPPO (2008) Distribution maps of quarantine pests for Europe. Phytoplasma mali. http://pqr.eppo.org/datas/PHYPMA/PHYPMA.pdf . EPPO/CABI (1996) Apple proliferation phytoplasma. In: Quarantine Pests for Europe , 2 nd

78 edn, pp. 959-962. Wallingford (GB): CAB International. Errampalli D., Fletcher J. and Claypool P.L. (1991) Incidence of yellows in carrot and lettuce and characterization of mycoplasmalike organisms isolated in Oklahoma. Plant Disease , 75: 579-584. Eyer J.R. (1937) Physiology of psyllid yellows of potatoes. Journal of Economic Entomol- ogy , 30: 891-898. Firrao G., Andersen M., Bertaccini A., Boudon E., Bove J.M., Daire X., Davis R.E., Fletcher J., Garnier M., Gibb K.S., Gundersen-Rindal D.E., Harrison N., Hiruki C., Kirkpatrick B.C., Jones P., Kuske C.R., Lee I.-M., Liefting L., Marcone C., Namba S., Schneider B., Sears B.B., Seemuller E., Smart C.D., Streten C. and Wang K. (2004) ‘Candidatus Phytoplasma’, a taxon for the wall-less, non-helical prokaryotes that colonize plant phloem and insects. International Journal of Systematic and Evolutionary Microbiology , 54: 1243-55. Fletcher J., Wayadande A., Melcher U. and Ye F. (1998) The phytopathogenic mollicute- insect vector interface: a closer look. Phytopathology , 88: 1351-1358. Flor G. (1861) Zur Kenntnis der Rhynchoten. Beschreibung neuer Arten aus der Familie Psyllodea Burm. Bulletin de la Société Impériale des Naturalistes de Moscou , 34: 331- 422. Font I., Abad P., Albinana M., Espino A.I., Dally E.L., Davis R.E. and Jorda C. (1999) Amarilleos y enrojecimientos en zanahoria: una enfermedad a diagnostico. Boletín de Sanidad Vegetal-Plagas , 25: 405-415. Forbes A.R. (1972) Innervation of the stylets of the pear psylla, Psylla pyricola (Homoptera: Psyllidae), and the greenhouse whitefly, Trialeurodes vaporariorum (Homoptera: Aleyrodidae). Journal of the Entomological Society of British Columbia , 69: 27-30. Forno F., Branz A., Mattedi L., Bragagna P., Cainelli C., Forti D. and Vindimian M.E. (2002) Un triennio di prove di trasmissione di AP tramite psille. ATTI Giornate Fitopa- tologiche , 2: 613-616. Fridlund P.R. (1989) Virus and viruslike diseases of pome fruits and simulating noninfec- tious disorders . Cooperative Extension, College of Agriculture and Home Economics, Washington State University. Pullman, Washington (USA).

79 Frisinghelli C., Delaiti L., Grando M.S., Forti D. and Vindimian M.E. (2000) Cacopsylla costalis (Flor 1861), as a vector of apple proliferation in Trentino. Journal of Phytopa- thology , 148: 425-431. Garcia-Chapa M., Sabaté J., Laviña A. and Batlle A. (2005) Role of Cacopsylla pyri in the epidemiology of pear decline in Spain. European Journal of Plant Pathology , 111(1): 9-17. Garcia-Salazar C., Whalon M.E. and Rahardja U. (1991) Temperature-dependent pathogenicity of the X-Disease mycoplasma-like organism to its vector: Paraphlepsius irroratus (Homoptera: Cicadellidae). Environmental Entomology , 20: 179-184. Gegechkori A.M. (1968) Materials for the study of the diet of the Psyllidae (Homoptera: Psylloidea) – narrowly specialized phytophages. Soobshcheniya Akademii Nauk Gruz- insko ĭ SSR , 52: 509-514. [in Russian] Gold R.E. and Silvester E.S. (1982) Pathogen strains and leafhopper species as factors in the transmission of western X-disease agent under varying light and temperature conditions. Hilgardia , 50 (3): 1-43. Green G.C. and Catling H.D. (1971) Weather-induced mortality in the citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae), a vector of green virus, in some citrus producing areas of southern Africa. Agricultural Meteorology , 8: 305-317. Gross J. and Mekonen N. (2005) Plant odours influence the host finding behaviour of apple psyllids ( Cacopsylla picta ; C. melanoneura ). IOBC/wprs Bulletin , 28: 351-355. Grylls N.E. (1979) Leafhopper vectors and the plant disease agents they transmit in Austra- lia. In: Leafhopper Vectors and Plant Disease Agents , pp.179-231. K. Maramorosch and K.F. Harris. Academic Press, New York (USA). Guesdon J.L., Terninck T. and Avrameas S. (1979) The use of avidin–biotin interaction in immunoenzymatic techniques. Journal of Histochemistry & Cytochemistry , 27: 1131- 1139. Gundersen D.E. and Lee I.-M. (1996) Ultrasensitive detection of phytoplasmas by nested- PCR assays using two universal primer pairs. Phytopathologia Mediterranea , 35: 114- 151.

80 Gundersen D.E., Lee I.-M., Rehner S.A., Davis R.E. and Kingsbury D.T. (1994) Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification. Journal of Bacteriology , 176: 5244-5254. Gundersen D.E., Lee I.-M., Schaff D.A., Harrison N.A., Chang C.J., Davis R.E. and Kingsbury D.T. (1996) Genomic diversity and differentiation among phytoplasma strains in 16S rRNA groups I (aster yellows and related phytoplasmas) and III (X- disease and related phytoplasmas). International Journal of Systematic Bacteriology , 46: 64-75. Hanboonsong Y., Choosai C., Panyim S. and Damak S. (2002) Transovarial transmission of sugarcane white leaf phytoplasma in the insect vector Matsumuratettix hiroglyphicus (Matsumura). Insect Molecular Biology , 11: 97-103. Harisanow A. (1966) Biologische Untersuchungen über den südlichen Apfelbatfloh – Psyl- la costalis Flor. Nauchni Trudove . Vissh Selskostopanski Institut "Vasil Kolarov", 15: 261-270. Hegab A.M. and El-Zohairy M.M. (1986) Retransmission of mycoplasma-like bodies associated with apple proliferation disease between herbaceous plants and apple seedlings. Acta Horticulturae , 193: 343. Heintz W. (1986) [ Cuscuta odorata – an effective vector for mycoplasma-like organisms (MLO)]. Nachrichtenblatt des Deutschen Pflanzenschutzdiensts , 38: 138-141. Heslop-Harrison G. (1937) Observations on the biology of certain British Psyllidae. Ento- mologist , 70: 1-4. Heslop-Harrison G. (1948) Observations on the British Psyllidae II. A preliminary note on the Psylla sorbi-mali-peregrina complex of the Homopterous family Psyllidae; an al- leged instance of poecilogony. Entomologist's Monthly Magazine , 84: 199-202. Heslop-Harrison G. (1960) Sound production in the Homoptera with special reference to sound producing mechanisms in the Psyllidae. Annals and Magazine of Natural His- tory , (13) 3: 633-640. Hibino H., Kaloostian G.H. and Schneider H. (1971) Mycoplasma-like bodies in the pear psylla vector of pear decline. Virology , 43: 34-40. Hodkinson I.D. (1971) Studies on the ecology of Strophingia ericae (Curtis) (Homoptera: Psylloidea) . 109 pp. Ph.D. Thesis, University of Lancaster (UK).

81 Hodkinson I.D. (1972) Long range dispersal of certain species of Psyllidae in the Northern Pennines. Entomologist's Monthly Magazine , 108: 21-22. Hodkinson I.D. (1973a) The biology of Strophingia ericae (Curtis) (Homoptera, Psyllidae) with notes on its primary parasite Tetrastichus actis (Walker) (Hym., Eulophidae). Norsk Entomologisk Tidsskrift , 20: 237-243. Hodkinson I.D. (1973b) The population dynamics and host plant interactions of Strophin- gia ericae (Curt.) (Homoptera: Psylloidea). Journal of Animal Ecology , 42: 565-583. Hodkinson I.D. (1974) The biology of the Psylloidea (Homoptera): a review. Bulletin of Entomological Research , 64: 325-339. Hogenhout S.A., Oshima K., Ammar E.-D., Kakizawa S., Kingdom H.N. and Namba S. (2008) Phytoplasmas: bacteria that manipulate plants and insects. Molecular Plant Pa- thology , 9 (4): 403-423. Horton D.R. (1990) Distribution and survival of eggs of summerform pear psylla (Homop- tera: Psyllidae) affected by leaf midvein. Environmental Entomology , 19: 656-661. Horton D.R. and Krysan J.L. (1991) Host acceptance behavior of pear psylla (Homoptera: Psyllidae) affected by plant species, host deprivation, habituation, and egg load. Annals of the Entomological Society of America , 84: 612-627. Horton D.R. and Landolt P.J. (2007) Attraction of male pear psylla, Cacopsylla pyricola , to female-infested pear shoots. Entomologia Experimentalis et Applicata , 123: 177-183. Howard F.W. and Oropeza C. (1998) Organic mulch as a factor in the nymphal habitat of Myndus crudus (Hemiptera: Auchenorrhyncha: Cixiidae). Florida Entomologist , 8: 92- 97. Hoy C.W., Heady S.E. and Koch T.A. (1992) Species composition, phenology, and possible origins of leafhoppers (Cicadellidae) in Ohio vegetable crops. Journal of Economic Entomology , 85: 2336-2343. Hunt R.E., Parr J.C. and Haynes K.F. (1993) Influence of leafhopper (Homoptera: Cicadel- lidae) gender and female mating status on plant disease dynamics within a simple habitat. Environmental Entomology , 22: 109-115. Iida T. (1972) Discovery of a plant pathogenic mycoplasma. Plant Protection , 26: 175-176. Jarausch B. (2003) Welche Rollen spielen Blattsaugerarten bei der Übertragung von Apfel- triebsucht-Phytoplasmen in deutschen Apfelanlagen? Obstbau , 4: 205-206.

82 Jarausch B., Fuchs A., Schwind N. and Jarausch W. (2008) Efficienza di trasmissione delle psille: l’esperienza in Germania. In: Scopazzi del melo Apple Proliferation , pp. 127-135. C. Ioriatti and W. Jarausch (eds.). Fondazione Edmund Mach, San Michele all’Adige, TN (Italy). Jarausch B., Schwind N., Jarausch W. and Krczal G. (2003) First report of Cacopsylla picta as a vector of apple proliferation phytoplasma in Germany. Plant Disease , 87: 101. Jarausch B., Schwind N., Jarausch W. and Krczal G. (2004) Overwintering adults and springtime generation of Cacopsylla picta (synonym C. costalis ) can transmit apple proliferation phytoplasmas. Acta Horticulturae , 657: 409-413. Jarausch W., Danet J.L., Labonne G., Dosba F., Broquaire J.M., Saillard C. and Garnier M. (2001). Mapping the spread of apricot chlorotic leaf roll (ACLR) in southern France and implication of Cacopsylla pruni as a vector of European stone fruit yellows (ESFY) phytoplasmas. Plant Pathology , 50 (6): 782-790. Jarausch W., Peccerella T., Schwind N., Jarausch B. and Krczal G. (2004) Establishment of a quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta Horticulturae , 657: 415-420. Jarausch W., Saillard C., Dosba F. and Bové J.M. (1994) Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of apple proliferation, MLO. Applied and Environmental Microbiology , 60: 2916-2923. Jarausch W., Saillard C., Dosba F. and Bové J.M. (1995) Specific detection of mycoplasma-like organisms in European fruit trees by PCR. Bulletin OEPP/EPPO Bulle- tin , 25: 219-225. Jarausch W., Saillard C., Helliot B., Garnier M. and Dosba F. (2000) Genetic variability of apple proliferation phytoplasmas as determined by PCR-RFLP and sequencing of a non-ribosomal fragment. Molecular and Cellular Probes , 14: 17-24. Jarausch-Wehrheim B., Schwind N., Jarausch W., Peccerella T. and Krczal G. (2005) Iden- tificazione di Cacopsylla picta (syn. Cacopsylla costalis ) come vettore del fitoplasma apple proliferation in Germania. Petria , 15 (1/2): 43-45. Jensen D.D. (1957) Parasites of the Psyllidae. Hilgardia , 27: 71-99.

83 Jensen D.D., Griggs W.H., Gonzales C.Q. and Schneider H. (1964) Pear decline virus transmission by pear psylla. Phytopathology , 54: 1346-1351. Jiang Y.P. and Chen T.A. (1987) Purification of mycoplasmalike organisms from lettuce with aster yellows disease. Phytopathology , 77: 949-953. Jomantiene R., Davis R.E., Maas J. and Dally E.L. (1998) Classification of new phytoplasmas associated with diseases of strawberry in Florida, based on analysis of 16S rRNA and ribosomal protein gene operon sequences. International Journal of System- atic Bacteriology , 48: 269-277. Kaminska M. and Śliwa H. (2008a) First report of ‘ Candidatus Phytoplasma mali’ in oriental lilies and its association with leaf scorch in Poland. Plant Pathology , 57: 363. Kaminska M. and Śliwa H. (2008b) Mixed infection of dahlia plants in Poland with apple proliferation and aster yellows phytoplasmas. Plant Pathology , 57: 363. Kawakita H., Saiki T., Wei W., Mitsuhashi W., Watanabe K. and Sato M. (2000) Identifi- cation of mulberry dwarf phytoplasmas in the genital organs and eggs of leafhopper Hishimonoides sellatiformis . Phytopathology , 90 (8): 909-914. Khan Z.R. and Saxena R.C. (1984) Technique for demonstrating phloem or xylem feeding by leafhoppers (Homoptera: Cicadellidae) and planthoppers (Homoptera: Delphacidae) in rice plant. Journal of Economic Entomology , 77: 550-552. Kirkpatrick B.C. (1991) Mycoplasma-like organisms: plant and invertebrate pathogens. In: The Prokaryotes , pp. 4050-4067. A. Balows, H.G. Trüper, M. Dworkin, W. Harder and K.H. Schliefer (eds.). Springer-Verlag Press, New York (USA). Kirkpatrick B.C., Smart C.D., Gardner S.L., Gao J.L., Ahrens U., Maurer R., Schneider B., Lorenz K-H., Seemüller E., Harrison N.A., Namba S. and Daire X. (1994) Phylogenetic relationships of plant pathogenic MLOs established by 16/23S rDNA spacer sequences. IOM Letters , 3: 228-229. Krczal G., Krczal H. and Kunze L. (1989) Fieberiella florii (Stål), a vector of apple proliferation agent. Acta Horticulturae , 235: 99-104. Kristoffersen L. and Anderbrant O. (2007) Carrot psyllid ( Trioza apicalis ) winter habitats – insights in shelter plant preference and migratory capacity. Journal of Applied Ento- mology , 131: 174-178.

84 Krysan J.L. (1990) Laboratory study of mating behaviour as related to diapause in overwintering Cacopsylla pyricola (Homoptera: Psyllidae). Environmental Entomology , 19: 551-557. Kunkel L.O. (1926) Studies on aster yellows. American Journal of Botany , 23: 646-705. Kunze L. (1976) The effect of different stains of apple proliferation on the growth and crop of infected trees. Mitteilungen aus der Biologischen Bundesanstalt für Land und Forst- wirtschaft . Berlin-Dahlem, 170: 107-115. Kuske C.R. and Kirkpatrick B.C. (1992) Phylogenetic relationships between the western aster yellows mycoplasmalike organisms and other prokaryotes established by 16S rRNA gene sequence. International Journal of Systematic Bacteriology , 42: 226-233. Kwon M., Wayadande A. and Fletcher J. (1999) Spiroplasma citri movement into the intes- tines and salivary glands of its leafhopper vector, Circulifer tenellus . Phytopathology , 89: 1144-1151. Lal K.B. (1934) Insect parasites of Psyllidae. Parasitology , 26: 325-334. Langer M., Darimont H. and Maixner M. (2003) Characterization of isolates of Vergil- bungskrankheit-phytoplasma by RFLP-analysis and their association with grapevine, herbaceous host pants and vectors. Proc. 14 th ICVG Conference . Locorotondo, Italy, pp. 66–67. Lapis E.B. and Borden J.H. (1993) Olfactory discrimination by Heteropsylla cubana (Ho- moptera: Psyllidae) between susceptible and resistant species of Leucaena (Leguminon- sae). Journal of Chemical Ecology , 19: 83-90. Lauterer P. (1963) A contribution to the knowledge of the psyllid fauna of Czechoslovakia. Casopis Moravskeho Musea Brne , 48: 145-156. [in Czech] Lauterer P. (1999) Results of investigations on Hemiptera in Moravia, made by Moravian Museum (Psylloidea 2). Acta Musei Moraviae, Scientae Biologicae (Brno), 84: 71-151. Lauterer P. and Burckhardt D. (1997) Central and West European willow feeding jumping plant-lice of the genus Cacopsylla (Hemiptera: Psylloidea). Entomological Problems , 28: 81-94. Lazarev M.A. (1974) Leaf-bugs (Homoptera: Psyllidae) of the apple and pear in the orchards of the Crimea. (Morphology, biology, control) . Published degree dissertation. Academy of Sciences of the Moldavian SSR, Kishinyov. [in Russian]

85 Le Gall F., Bové J.M. and Garnier M. (1998) Engineering of a single-chain variable- fragment (scFv) antibody specific for the stolbur phytoplasma (mollicute) and its expression in Escherichia coli and tobacco plants. Applied and Environmental Microbiol- ogy , 64: 4566-4572. Lee I.-M. and Davis R.E. (1992) Mycoplasmas which infect plants and insects. In: My- coplasmas: Molecular biology and Pathogenesis , pp. 379-390. J. Maniloff, R.N. McEl- hansey, L.R. Finch and J.B. Baseman (eds). American Society of Microbiology, Wash- ington, DC (USA). Lee I.-M., Bertaccini A., Vibio M. and Gundersen-Rindal D.E. (1995) Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathol- ogy , 85: 728-735. Lee I.-M., Danielli A., Bertaccini A., Vibio M. and Bartoszyk I.M. (1996) Multiple phytoplasmas detected in two species of Homoptera feeding on pear trees with decline symptoms. International Organization of Mycoplasmology Letters , 4: 199. Lee I.-M., Davis R.E, Chen T.A., Chiykowski L.N., Fletcher J., Hiruki C. and Schaff D.A. (1992a) A genotype-based system for identification and classification of mycoplasmalike organisms (MLOs) in the aster yellows MLO strain cluster. Phytopathology , 82: 977-986. Lee I.-M., Davis R.E. and Gundersen-Rindal D.E. (2000) Phytoplasma: phytopathogenic mollicutes. Annual Review of Microbiology , 54: 221-255. Lee I.-M., Davis R.E., Sinclair W.A., DeWitt N.D. and Conti M. (1993a) Genetic related- ness of mycoplasmalike organisms detected in Ulmus spp. in USA and Italy by means of DNA probes and polymerase chain reactions. Phytopathology , 83: 829-833. Lee I.-M., Gundersen D.E., Davis R.E. and Chiykowski L.N. (1992b) Identification and analysis of a genomic strain cluster of mycoplasmalike organisms associated with Ca- nadian peach (eastern) X-disease, western X-disease, and clover yellow edge. Journal of Bacteriology, 174: 6694-98. Lee I.-M., Gundersen D.E., Hammond R.W. and Davis R.E. (1994) Use of mycoplasmalike organism (MLO) group-specific oligonucleotide primers for nested-PCR assays to detect mixed-MLO infections in a single host plant. Phytopathology , 84: 559-566.

86 Lee I.-M., Gundersen-Rindal D.E., Davis R.E. and Bartoszyk I.M. (1998) Revised classification scheme of phytoplasmas based on RFLP analyses of 16S rRNA and ribosomal protein gene sequences. International Journal of Systematic Bacteriology , 48: 1153- 1169. Lee I.-M., Hammond R.W., Davis R.E. and Gundersen D.E. (1993b) Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology , 83: 834-842. Lefol C., Caudwell A., Lherminier J. and Larrue J. (1993) Attachment of the Flavescence dorée pathogen (MLO) to leafhopper vectors and other insects. Annals of Applied Biol- ogy , 123: 611-622. Lefol C., Lherminier J., Boudon-Padieu E., Larrue J., Louis C. and Caudwell A. (1994) Propagation of Flavescence dorée MLO (mycoplasma-like organism) in the leafhopper vector Euscelidius variegatus Kbm. Journal of Invertebrate Pathology , 63: 285-293. Lemoine J. (1991) Dépérissement du poirier: rôle de Psylla pyri dans sa dissémination. Ar- boriculture Fruitière , 442: 28-32. Lepka P., Stitt M., Moll E. and Seemüller E. (1999) Effect of phytoplasmal infection on concentration and translocation of carbohydrates and amino acids in periwinkle and tobacco. Physiological and Molecular Plant Pathology , 55: 59-68. Lessio F. and Alma A. (2004) Dispersal patterns and chromatic response of Scaphoideus titanus Ball (Homoptera Cicadellidae), vector of the phytoplasma agent of grapevine Flavescence dorée. Agricultural and Forest Entomology , 6: 121-127. Lett J.M., Granier M., Grondin M., Turpin P., Molinaro F., Chiroleu F., Peterschmitt M. and Reynaud B. (2001) Electrical penetration graphs from Cicadulina mbila on maize, the fine structure of its stylet pathways and consequences for virus transmission efficiency. Entomologia Experimentalis et Applicata , 101: 93-109. Lherminier J., Prensier G., Boudon-Padieu E. and Caudwell A. (1990) Immunolabeling of grapevine Flavescence dorée MLO in salivary glands of Euscelidius variegatus : a light and electron microscopy study. Journal of Histochemistry and Cytochemistry , 38: 79- 86.

87 Lim P.O. and Sears B.B. (1989) 16S rRNA sequence indicates that plant-pathogenic mycoplasmalike organisms are evolutionarily distinct from animal mycoplasmas. Journal of Bacteriology , 171: 5901-5906. Lim P.O. and Sears B.B. (1991a) DNA sequence of the ribosomal protein genes rpl2 and rps19 from a plant-pathogenic mycoplasmalike organism. FEMS Microbiology Letters , 84: 71-74. Lim P.O. and Sears B.B. (1991b) The genome size of a plant-pathogenic mycoplasmalike organism resembles those of animal mycoplasmas. Journal of Bacteriology , 173: 2128- 2130. Lim P.O. and Sears B.B. (1992) Evolutionary relationships of a plant-pathogenic mycoplasmalike organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences. Journal of Bacteriology , 174: 2606-2611. Linnavuori R. (1951) Hemipterological observations. Suomen Hyonteistieteellinen Ai- kakauskirja (Annales Entomologici Fennici) , 17: 51-65. Loi N., Carraro L., Musetti R., Pertot I. and Osler R. (1995) Dodder transmission of two different MLOs from plum trees affected by a “leptonecrosis”. Acta Horticulturae , 386: 465-470. Loi N., Ermacora P., Carraro L., Osler R. and Chen T.A. (2002) Production of monoclonal antibodies against apple proliferation phytoplasma and their use in serological detection. European Journal of Plant Pathology , 108: 81-86. Lorenz K.H., Schneider B., Ahrens U. and Seemüller E. (1995) Detection of apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and non ribosomal DNA. Phytopathology , 85: 771-776. Luft P.A. and Paine T.D. (1997) Behavioral cues associated with oviposition by Trioza eugeniae . Entomologia Experimentalis et Applicata , 84: 293-299. Luft P.A., Paine T.D. and Walker G.P. (2001) Interactions of colonisation density and leaf environments on survival of Trioza eugeniae nymphs. Ecological Entomology , 26: 263- 270. Madden L.V., Nault L.R., Heady S.E. and Styer W.E. (1984) Effect of maize stunting mollicutes on survival and fecundity of Dalbulus leafhopper vectors. Annals of Applied Bi- ology , 105(3): 431-441.

88 Madden L.V., Nault L.R., Nurral D.J. and Apelt M.R. (1995) Spatial pattern analysis of the incidence of aster yellows disease in lettuce. Researches on Population Ecology , 37: 279-289. Maixner M., Johannesen J., Michel K., Lux B. and Seitz A. (2007) Host plant specificity of Hyalesthes obsoletus and consequences for “bois noir” epidemiology. Bulletin of Insec- tology , 60 (2): 399-400. Marcone C., Neimark H., Ragozzino A., Lauer U. and Seemuller E. (1999) Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopa- thology , 89: 805-810. Marcone C., Ragozzino A. and Seemüller E. (1996a) Association of phytoplasmas with the decline of European hazel in southern Italy. Plant Pathology , 45: 857-863. Marcone C., Ragozzino A., Schneider B., Lauer U., Smart C.D. and Seemüller E. (1996b) Genetic characterization and classification of two phytoplasmas associated with spar- tium witches'-broom disease. Plant Disease , 80: 365-371. Marenaud C., Mazy K. and Lansac M. (1978) La prolifération du pommier: une maladie curieuse et dangereuse. PHM Revue Horticole , 188: 41-51. Martini M., Vibio M., Sfalanga A. and Bertaccini A. (1998) Molecular and ecological diversity of phytoplasmas belonging to the elm yellows group in Italy towards their tenta- tive epidemiology. Program and Abstracts, 12 th International Organisation of My- coplasmology Conference . Sydney, Australia, p. 130. Marwitz R., Petzold H. and Kunze L. (1974) [Investigation on the transfer of the possible causal agent of apple proliferation to a herbaceous host] Phytopathologische Zeitschrift , 81: 85-91. Marzachì C., Verati F. and Bosco D. (1998) Direct PCR detection of phytoplasmas in experimentally infected insects. Annals of Applied Biology , 133: 45-54. Maszkiewicz J., Blaszczak W. and Millikan D.F. (1979) Investigation on the apple proliferation disease I. Increased susceptibility of affected leaf tissue to Podosphaera leuco- tricha . Phytoprotection , 60: 47-54. Mattedi L., Forno F. and Varner M. (2007) Scopazzi del melo. Conoscenze ed osservazioni di campo . 144 pp. Arti Grafiche La Commerciale-Borgogno, Bolzano (Italy).

89 Mattedi L., Forno F., Cainelli C., Grando M.S. and Jarausch W. (2008) Research on Can- didatus Phytoplasma mali transmission by insect vectors in Trentino. Acta Horticul- turae, 781: 369-374. Mayer C.J. and Gross J. (2007) Different host plant odours influence migration behaviour of Cacopsylla melanoneura (Förster), an insect vector of the apple proliferation phytoplasma. IOBC/wprs Bulletin , 30: 28. McClure M.S. (1980a) Role of wild host plants in the feeding, oviposition, and dispersal of Scaphytopius acutus (Homoptera: Cicadellidae) a vector of peach X-disease. Environ- mental Entomology , 9: 283-292. McClure M.S. (1980b) Spatial and seasonal distribution of leafhopper vectors of peach X- disease in Connecticut. Environmental Entomology , 9: 668-672. McClure M.S. (1982) Factors affecting colonization of an orchard by leafhopper (Homop- tera: Cicadellidae) vectors of peach X-disease. Environmental Entomology , 11: 695- 699. McCoy R.E., Caudwell A., Chang C.J., Chen T.A., Chiykowski L.N., Cousin M.T., Dale De Leeuw G.T.N., Golino D.A., Hackett K.J., Kirkpatrick B.C., Marwitz R., Petzolt H., Sinha R.H., Sugiura M., Whitcomb R.F., Yang I.L., Zhu B.M. and Seemuller E. (1989) Plant diseases associated with mycoplasmalike organisms. In The Mycoplasmas , 5: 545- 640. R.F. Whitcomb, J.G. Tully (eds.). Academic Press, New York (USA). Mehle N., Brzin J., Boben J., Hren M., Frank J., Petrovi č N., Gruden K., Dreo T., Žežlina I., Seljak G. and Ravnikar M. (2007) First report of ‘ Candidatus Phytoplasma mali’ in Prunus avium , P. armeniaca and P. domestica . Plant Pathology , 56: 721. Mitchell P.L. (2004) Heteroptera as vectors of plant pathogens. Neotropical Entomology , 33: 519-545. Mitsuhashi W., Saiki T., Wei W., Kawakita H. and Sato M. (2002) Two novel strains of Wolbachia coexisting in both species of mulberry leafhoppers. Insect Molecular Biol- ogy , 11: 577-584. Moran V.C. (1968) The development of the citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae), on Citrus limon and four indigenous host plants. Journal of the Entomological Society of South Africa , 31: 391-402.

90 Moran V.C. and Brown R.P. (1973) The antennae, host plant chemoreception and probing activity of the citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). Journal of the Entomological Society of South Africa , 36: 191-202. Moran V.C. and Buchan P.R. (1975) Oviposition by the citrus psylla, Trioza erytreae (homoptera: Psyllidae), in relation to leaf hardness. Entomologia Experimentalis et Appli- cata , 18: 96-104. Moran V.C., Brothers D.J. and Case J.J. (1969) Observations on the biology of Tetrastichus flavigaster Brothers & Moran (Hymenoptera: Eulophidae), parasitic on psyllid nymphs (Homoptera). Transactions of the Entomological Society of London, 121: 41-58. Moya-Raygoza G. and Nault L.R. (1998) Transmission biology of maize bushy stunt phytoplasma by the corn leafhopper (Homoptera:Cicadellidae). Annals of the Entomologi- cal Society of America , 91: 668-676. Murral D.J., Nault L.R., Hoy C.W., Madden L.V. and Miller S.A. (1996) Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper (Homoptera: Cicadellidae). Journal of Economic Ento- mology , 89:1223-1232. Nagadhara D., Ramesh S., Pasalu I.C., Kondala Rao Y., Sarma N.P., Reddy V.D. and Rao K.V. (2004). Transgenic rice plants expressing the snowdrop lectin gene (gna) exhibit high-level resistance to the whitebacked planthopper ( Sogatella furcifera ). Theoretical and Applied Genetics , 109 (7): 1399-1405. Nagaich B.B., Puri B.K., Sinha R.C., Dhingra MK. and Bhardwaj V.P. (1974) My- coplasma-like organisms in plants affected with purple top-roll, marginal flavescence and witches' broom diseases of potatoes. Phytopathologische Zeitschrift , 81: 273-379. Nakashima K. and Hayashi T. (1995) Multiplication and distribution of rice yellow dwarf phytoplasma in infected tissues of rice and green rice leafhopper Nephotettix cincticeps . Annals of the Phytopathological Society of Japan , 61: 451-455. Namba S., Kato S., Iwanami S., Oyaizu H., Shiozawa H. and Tsuchizaki T. (1993a) Detec- tion and differentiation of plant-pathogenic mycoplasmalike organisms using polymerase chain reaction. Phytopathology , 83: 786-791.

91 Namba S., Oyaizu H., Kato S., Iwanami S. and Tsuchizaki T. (1993b) Phylogenetic diversity of phytopathogenic mycoplasmalike organisms. International Journal of Systematic Bacteriology , 43: 461-467. Nehlin G., Valterova I. and Borg-Karlsson A.K. (1994) Use of conifer volatiles to reduce injury caused by carrot psyllid ( Trioza apicalis ) Förster (Homoptera, Psylloidea). Jour- nal of Chemical Ecology , 20: 771-783. Neimark H. and Kirkpatrick B.C. (1993) Isolation and characterization of full-length chromosomes from non-culturable plant-pathogenic Mycoplasma-like organisms. Molecular Microbiology , 7: 21-28. Nemeth M. (1986) Virus, mycoplasma, and rickettsia diseases of fruit trees. 841 pp. Mar- tinus Nijhoff, Dordrecht (The Netherlands). Nicholls C.I., Parrella M. and Altieri M.A. (2001) The effects of a vegetational corridor on the abundance and dispersal of insect biodiversity within a northern California organic vineyard. Landscape Ecology , 16: 133-148. Nielson M.W. (1979) Taxonomic relationships of leafhopper vectors of plant pathogens. In: Leafhopper Vectors and Plant Disease Agents , pp. 3-27. K. Maramorosch and K.F. Harris. Academic Press, New York (USA). OEPP/EPPO (2006) Bulletin OEPP/EPPO , 36: 121-125. Okuda S. (1972) Occurrence of diseases caused by mycoplasma-like organisms in Japan. Plant Protection , 26: 180-183. Okuda S., Nakano Y., Goto T. and Natsuaki T. (1998) 16SrDNAs of Paulownia witches' broom phytoplasma transmitted by Halyomorpha mista . 7th International Congress of Plant Pathology , Pap. No. 3.7.33. Edinburgh, Scotland. Onillon J.C. (1969) Étude du complexe parasitaire Trioza urticae L. (Homoptère: Psylli- dae) Tetrastichus upis Walk. (Hyménopt. Tetrastichidae). Annales de Zoologie, Écolo- gie Animale , 1: 55-65. Orenstein S., Zahavi T., Nestel D., Sharon R., Barkalifa M. and Weintraub P.G. (2003) Spatial dispersion patterns of potential leafhopper and planthopper (Homoptera) vectors of phytoplasma, and their associated phytoplasmas, in wine vineyards. Annals of Ap- plied Biology , 142: 341-348.

92 Oshima K., Kakizawa S., Nishigawa H., Jung H.Y., Wei W., Suzuki S., Arashida R., Naka- ta D., Miyata S., Ugaki M. and Namba S. (2004) Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nature Genetics , 36: 27-29. Oshima K., Shiomi T., Kuboyama T., Sawayanagi T., Nishigawa H., Kakizawa S., Miyata S., Ugaki M. and Namba S. (2001) Isolation and characterization of derivative lines of the onion yellows phytoplasma that do not cause stunting or phloem hyperplasia. Phy- topathology , 91: 1024-1029. Ossiannilsson F. (1950) Sound-production in Psyllids (Hem. Hom.). Opuscula Ento- mologica , 15: 202. Ossiannilsson F. (1970) Contributions to the knowledge of Swedish psyllids (Hem. Psyl- loidea) 1-4. Entomologia Scandinavica , 1: 135-144. Ossiannilsson F. (1992) The Psylloidea (Homoptera) of Fennoscandia and Denmark . 346 pp., Fauna Entomologica Scandinavica, 26, E.J. Brill, Leiden (The Netherlands). Palermo S., Arzone A. and Bosco D. (2001) Vector-pathogen-host plant relationships of chrysanthemum yellows (CY) phytoplasma and the vector leafhoppers Macrosteles quadripunctulatus and Euscelidius variegatus . Entomologia Experimentalis et Appli- cata , 99: 347-354. Pande Y.D. (1971) Biology of the citrus psylla, Diaphorina citri Kuw. (Hemiptera: Psylli- dae). Israel Journal of Entomology , 6: 307-311. Pande Y.D. (1972) Seasonal fluctuations in the abundance and host preference of Dia- phorina citri Kuw. in relation to certain species of citrus. Indian Journal of Agricultural Research , 6: 51-54. Pecho L. and Vizarova G. (1990) Plant hormones in tissues of healthy and mycoplasma- infected currants. Ochrana Rostlin , 26: 181-186. Percy D.M. (2005) Other Psyllid Songs. http://www.psyllids.org/otherPsyllidSOUND.htm . Percy D.M., Taylor G.S. and Kennedy M. (2006) Psyllid communication: acoustic diversity, mate recognition and phylogenetic signal. Invertebrate Systematics , 20: 431-445. Pletsch D.J. (1947) The potato psyllids Paratrioza cockerelli (Sulc.). Its biology and control. Montana Agricultural Experiment Station Bulletin , n° 446, 95pp.

93 Poggi Pollini C., Zelger R., Wolf M., Bissani R. and Giunchedi L. (2002) Indagine sulla presenza di psillidi infetti dal fitoplasma degli scopazzi del melo (AP=apple proliferation) in provincia di Bolzano. ATTI Giornate Fitopatologiche , 2: 607-612. Pollard D.G. (1970) The mechanism of stylet movement in Psylla mali Schmidberger (Homoptera: Psyllidae). Zoological Journal of the Linnean Society , 49: 295-307. Powell K.S., Gatehouse A.M.R., Hilder V.A., Van Damme E.J.M., Peumans W.J., Boon- jawat J., Horsham K. and Gatehouse J.A. (1995) Different antimetabolid effects of related lectins towards nymphal stages of Nilaparvata lugens . Entomologia Experimen- talis et Applicata , 75: 61-65. Power A.G. (1992) Host plant dispersion, leafhopper movement and disease transmission. Ecological Entomology , 17: 63-68. Przybylski Z. (1970) Studien über die Synchronisierung phytophänologischer Erscheinun- gen mit der Entwicklung des Apfelsaugers – Psylla mali Schmidt.(Psyllidae). Ekologia Polka , 18: 13-40. Purcell A.H. (1982) Insect vector relationships with prokaryotic plant pathogens. Annual Review of Phytopathology , 20: 397-417. Purcell A.H. (1988) Increased survival of Dalbulus maidis , a specialist on maize, on non- host plants infected with mollicute plant pathogens. Entomologia Experimentalis et Ap- plicata , 46: 187-196. RasmyA.M. and McPhee A.W. (1970) Studies on the pear psylla in Nova Scotia. The Ca- nadian Entomologist , 102: 586-591. Razin S., Yogev D. and Naot Y. (1998) Molecular biology and pathogenicity of mycoplasmas. Microbiology and Molecular Biology Reviews , 62: 1094-1156. Refatti E. and Ciferri R. (1954) La virosi del tipo a scopazzi in vivai di melo. Annali della Sperimentazione Agraria , 8:1543-1556. Refatti E., Osler R., Loi N. and Roggero P. (1986) Reasearch on transmission of apple proliferation. Acta Horticulturae , 193: 345-350. Robinson D.M. (1961a) The parasites of the Psyllidae. 2. Parapsyllaephagus adulticolus gen. et sp. nov., the first hymenopterous parasite of an adult psyllid (Homoptera). An- nals and Magazine of Natural History , (13) 4: 117-121.

94 Robinson D.M. (1961b) The parasites of the Psyllidae. 3. Some notes on the biology and host relationships of Parapsyllaephagus adulticolus Robinson (Hymenoptera). Annals and Magazine of Natural History , (13) 4: 155-159. Robinson D.M. (1961c) Parapsyllaephagus adulticolus Robinson, an invalid synonym of Sectiliclava cleone (Walker) (Insecta: Hymenoptera). Annals and Magazine of Natural History , (13) 4: 755. Rui D. (1950) Una malattia inedita: la virosi a scopazzi del melo. Humus , 6 (11): 7-10. Schaefer H.A. (1949) Biologische und ökologische Beobachtungen an Psylliden (Hemipte- ra). Verhandlungen der Naturforschenden Gesellschaft in Basel , 60: 25-41. Schmid G. (1965) Five and more years of observations on the proliferation virus of apples in the field. Zastita Bilja , 16: 285-291. Schneider B., Marcone C., Kampmann M., Ragozzino A., Lederer W., Cousin M.T. and Seemüller E. (1997) Characterization and classification of phytoplasmas from wild and cultivated plants by RFLP and sequence analysis of ribosomal DNA. European Journal of Plant Pathology , 193: 675-686. Schneider B., Ahrens U., Kirkpatrick B.C. and Seemüller E. (1993) Classification of plant- pathogenic mycoplasma-like organisms using restriction-site analysis of PCR-amplified 16S rDNA. Journal of General Microbiology , 139: 519-527. Seemüller E. (1976) Investigations to demonstrate mycoplasma-like organisms in diseased plants by fluorescence microscopy. Acta Horticulturae , 67: 109-111. Seemüller E. (1988) Colonization patterns of mycoplasma-like organisms in trees affected by apple proliferation and pear decline. In: Tree Mycoplasmas and Mycoplasma Dis- eases , pp. 179-192. C. Hiruki (ed.). The University of Alberta Press, Edmonton, Alberta (Canada). Seemüller E. (1990) Apple proliferation. In: Compendium of apple and pear diseases , pp. 67-68. American Phytopathological Society, St. Paul, Minnesota (USA). Seemüller E. (2002) Apple proliferation: etiology, epidemiology and detection. ATTI Gior- nate Fitopatologiche , 1: 3-6. Seemüller E. and Schneider B. (2004) ‘ Candidatus Phytoplasma mali’, ‘ Candidatus Phyto- plasma pyri’ and ‘ Candidatus Phytoplasma prunorum’, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. International

95 Journal of Systematic and Evolutionary Microbiology , 54: 1217-1226. Seemüller E., Marcone C., Lauer U., Ragozzino A. and Göschl M. (1998) Current status of molecular classification of the Phytoplasmas. Journal of Plant Pathology , 80: 3-26. Seemüller E., Schneider B., Mäurer R., Ahrens U., Daire X., Kison H., Lorenz K.H., Firrao G., Avinent L., Sears B.B. and Stackebrandt E. (1994) Phylogenetic classification of phytopathogenic mollicutes by sequence analysis of 16S ribosomal DNA. International Journal of Systematic Bacteriology , 44: 440-446. Seidl V. (1965) The possibility of using root grafting method of testing for apple proliferation virus disease. Zastita Bilja , 16: 323-327. Seidl V. and Komárková (1974) Studies on natural spread of proliferation disease of apple. Phytopathologische Zeitschrift , 81: 301-313. Severin H.H.P. (1946) Longevity, or life histories, of leafhopper species on virus-infected and on healthy plants. Hilgardia , 17: 121-133. Siddique A.B.M., Gurthrie J.N., Walsh K.B., White D.T. and Scott P.T. (1998) Histopa- thology and within-plant distribution of the phytoplasma associated with Australian pa- paya dieback. Plant Disease , 82: 1112-1120. Sinclair W.A., Whilow T.H. and Griffiths H.M. (1997) Heritable tolerance of ash yellows phytoplasma in green ash. Canadian Journal of Forest Research , 27: 1928-1935. Sharon R., Soroker V., Wesley S.D., Zahavi T., Harari A. and Weintraub P.G. (2005). Vitex agnus-castus is a preferred host plant for phytoplasma vector, Hyalesthes obsoletus . Journal of Chemical Ecology , 31: 1051-1063. Shiomi T. and Sugiura M. (1984) Grouping of mycoplasma-like organisms transmitted by the leafhopper vector, Macrosteles orientalis Virvaste, based on host range. Annals of the Phytopathological Society of Japan , 50: 149-157. Soroker V., Talebaev S., Harari A.R. and Wesley S.D. (2004) The role of chemical cues in host and mate location in the pear psylla Cacopsylla bidens (Homoptera: Psyllidae). Journal of Insect Behavior , 17: 613-626. Swenson K. (1971) Relation of age, sex and mating of Macrosteles fascifrons to transmission of aster yellows. Phytopathology , 61: 657-659. Taylor K.L. (1985) A possible stridulatory organ in some Psylloidea (Homoptera). Journal of the Australian Entomological Society , 24: 77-80.

96 Tedeschi R. and Alma A. (2004) Transmission of apple proliferation phytoplasma by Ca- copsylla melanoneura (Homoptera: Psyllidae). Journal of Economic Entomology , 97 (1): 8-13. Tedeschi R. and Alma A. (2006) Fieberiella florii (Homoptera: Auchenorrhyncha) as a vector of " Candidatus phytoplasma mali". Plant Disease , 90 (3): 284-290. Tedeschi R., Bertignolo L. and Alma A. (2005) Role of the hawthorn psyllid fauna in relation to the apple proliferation disease. Petria, 15: 47-49. Tedeschi R., Bosco D. and Alma A. (2002) Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in northwestern Italy. Journal of Economic Entomolgy , 95 (3): 544-551. Tedeschi R., Ferrato V., Rossi J. and Alma A. (2006) Possibile phytoplasma transovarial transmission in the psyllids Cacopsylla melanoneura and Cacopsylla pruni . Plant Pa- thology , 55: 18-24. Tedeschi R., Visentin C., Alma A. and Bosco D. (2003) Epidemiology of apple proliferation (AP) in northwestern Italy: evaluation of the frequency of AP-positive psyllids in naturally infected populations of Cacopsylla melanoneura (Homoptera: Psyllidae). An- nals of Applied Biology , 142: 285-290. Thanh-Xuan N. (1971) Effet du groupement sur la reproduction et la longévité de Psylla pyri L. (Insectes, Homoptera Psyllidae). Comptes Rendus Hebdomadaires des Séances de l'Académie des Sciences , Paris, sér. D 272: 1782-1784. Thanh-Xuan N. (1972) Influence de la nature des plantes hôtes sur la longévité et la fé- condité de Psylla pyri L. (Insectes, Homoptera, Psyllidae). Comptes Rendus Hebdoma- daires des Séances de l'Académie des Sciences , Paris, sér. D 274: 546-548. Thanh-Xuan N. (1973) Action du surpeuplement sur la reproduction de Psylla pyri L. (In- sectes, Homoptère, Psyllidae). Comptes Rendus Hebdomadaires des Séances de l'Aca- démie des Sciences , Paris, sér. D 276: 2389-2390. Thomas P.E. and Mink G.I. (1998) Tomato hybrids with nonspecific immunity to viral and mycoplasma pathogens of potato and tomato. HortScience , 33: 764-765. Tishechkin D.Y. (1989) Sound signaling of psyllids (Homoptera, Psyllinea) in the Moskow region. Vestnik Moskovskogo Univeriteta, Biologiya , 44: 20-24.

97 Todd J.L., Harris M.O. and Nault L.R. (1990). Importance of color stimuli in host-finding by Dalbulus leafhoppers. Entomologia Experimentalis et Applicata , 54: 245-250. Tomasi F., Branz A., Grando M.S., Forno F., Forti D. and Vindimian M.E. (2000) Indivi- duazione di fitoplasmi del gruppo AP nelle psille presenti nei frutteti. L’Informatore Agrario , 38: 51-54. Toth K.F., Harrison N. and Sears B.B. (1994) Phylogenetic relationships among members of the class Mollicutes deduced from rps3 gene sequences. International Journal of Sys- tematic Bacteriology , 44: 119-124. Tremblay E. (1981) Entomologia Applicata , vol. II, parte I. 312 pp. Liguori Ed., Napoli (I- taly). Tsai J.H. (1979) Vector transmission of mycoplasmal agents of plant diseases. In: The My- coplasmas , 3: 265-307. R.F. Whitcomb and J.G. Tully (eds.). Academic Press, New York (USA). Van Steenwyk R.A., Havens D.M. and Freeman R. (1990) Evaluation of trap types for two vectors of western X-Disease: Colladonus montanus and Fieberiella florii (Homoptera: Cicadellidae). Journal of Economic Entomology , 83: 2279-2283. Vega F.E., Davis R.E., Barbosa P., Dally E.L., Purcell A.H. and Lee I.-M. (1993) Detection of a plant pathogen in a nonvector insect species by the polymerase chain reaction. Phy- topathology , 83: 621-624. Vega F.E., Davis R.E., Dally E.L., Barbosa P., Purcell A.H. and Lee I.-M. (1994) Use of a biotinylated DNA probe for detection of the aster yellows mycoplasmalike organism in Dalbulus maidis and Macrosteles fascifrons (Homoptera: Cicadellidae). Florida Ento- mologist , 77: 330-334. Vindimian M.E. (2002) Scopazzi del melo: diffusione in Trentino e ricerche in atto. ATTI Giornate fitopatologiche , 1: 7-12. Vindimian M.E. and Delaiti L. (1996) Indagine sistematica sugli scopazzi del melo. Terra Trentina , 11: 30-33. Vindimian M.E., Branz A., Tomasi F. and Gatto P. (2000) Untersuchungen zum Besen- wuchs des Apfelbaumes. Obstbau Weinbau , 10: 294-296. Vondrá ček K. (1957) Mery-Psylloidea. Fauna ČSR , vol. 9, 431 pp. Praha: Nakladatelstvi Československá Akademie Véd. [In Czeck]

98 Walton B.C.J. (1960) The life cycle of the hackberry gall-former, Pachypsylla celtidi- sgemma (Homoptera: Psyllidae). Annals of the Entomological Society of America , 53: 265-277. Watmough R.H. (1968a) Population studies on two species of Psyllidae (Homoptera: Ster- norrhyncha) on broom ( Sarothamnus scoparius (L.) Wimmer). The Journal of Animal Ecology , 37: 283-314. Watmough R.H. (1968b) Notes on the biology of Artytaina spartiophila Förster and A. gen- istae Latreille (Homoptera: Psyllidae) on broom ( Sarothamnus scoparius (L.) Wimmer) in Britain. Journal of the Entomological Society of South Africa , 31: 115-122. Watson M.A. and Roberts F.M. (1939) A comparative study of the transmission of Hyoscyamus virus 3, potato virus Y, and cucumber virus 1, by the vectors Myzae persi- cae (Sulz.), M. circonflexus (Buckton) and Macrosiphum gei (Koch). Proceedings of the Royal Society of London , Ser. B, Biological Sciences, vol. 127 (849): 543-576. Wayadande A.C., Baker G.R. and Fletcher J. (1997) Comparative ultrastructure of the salivary glands of two phytopathogen vectors, the beet leafhopper, Circulifer tenellus (Baker), and the corn leafhopper, Dalbulus maidis Delong and Wolcott (Homoptera: Cicadellidae). International Journal of Insect Morphology and Embryology , 26:113- 120. Wei W., Kakizawa S., Suzuki S., Jung H.Y., Nishigawa H., Miyata S., Oshima K., Ugaki M., Hibi T. and Namba S. (2004) In planta dynamic analysis of onion yellows phytoplasma using localized inoculation by insect transmission. Phytopathology , 94: 244-50. Weintraub P.G. (2007) Insect vectors of phytoplasmas and their control – an update. Bulle- tin of Insectology , 60 (2): 169-173. Weintraub P.G. and Beanland L. (2006) Insect vectors of phytoplasmas. Annual Review of Entomology , 51: 91-111. Weisburg W.G., Tully J.G., Rose D.L., Petzel J.P., Oyaizu H., Yang D., Mandelco L., Sechrest J., Lawrence T.G., Van Etten J., Maniloff J. and Woese C.R. (1989) A phylogenetic analysis of the mycoplasmas: basis for their classification. Journal of Bacteri- ology , 171: 6455-6467. White T.C.R. (1968) Uptake of water by eggs of Cardiaspina densitexta (Homoptera: Psyl- lidae) from leaf of host plant. Journal of Insect Physiology , 14: 1669-1683.

99 White T.C.R. (1969) An index to measure weather-induced stress of trees associated with outbreaks of psyllids in Australia. Ecology , 50: 905-909. White T.C.R. (1970a) Some aspects of the life history, host selection, dispersal, and oviposition of adult Cardiaspina densitexta (Homoptera: Psyllidae). Australian Journal of Zoology , 18: 105-117. White T.C.R. (1970b) The nymphal stage of Cardiaspina densitexta (Homoptera: Psylli- dae) on leaves of Eucalyptus fasciculosa . Australian Journal of Zoology , 18: 273-293. Whitney S.P. and Meyer J.R. (1988) Movement between wild and cultivated blueberry by two species of sharpnosed leafhoppers. Journal of Entomological Science , 23: 88-95. Woese C.R. (1987) Bacterial evolution. Microbiological Reviews , 51: 221-271. Wolf T.K. (2000) Grapevine yellows research in Virginia. Wines & Vines , Oct., 28-35. Zawadzka B.F. (1976) Reaction of apple cultivars to infection by apple proliferation disease. Acta Horticulturae , 67: 113-120. Zhang J., Hogenhout S.A., Nault L.R., Hoy C.W. and Miller S.A. (2004) Molecular and symptom analyses of phytoplasma strains from lettuce reveal a diverse population. Phy- topathology , 94: 842-849. Zucht B. (1972) Bau und Entwicklung der ausseren Genitalorgane bei Psylliden (Homopte- ren). Zoologische Jahrbücher. Abteilung für Anatomie und Ontogenie der Tiere , 89: 167-231.

100 Chapter 1

101

102 Chapter 2

Acquisition and transmission of ‘ Candidatus Phytoplasma mali’

by its psyllid vectors in Trentino

Manuscript for Annals of Applied Biology

1,3 1 1 1 Federico PEDRAZZOLI , Valeria GUALANDRI , Flavia FORNO , Luisa MATTEDI , Valeria

1 1 1,2 3 MALAGNINI , Rosaly ZASSO , Antonella SALVADORI , Vincenzo GIROLAMI , Claudio IO-

1 1,4 RIATTI , Wolfgang JARAUSCH

1FEM- IASMA Research Centre, Plant Protection Department, via E. Mach, 1 - 38010 San Michele all’Adige

(TN), Italy

2University of Trento, Trento Computer and Management Sciences Department, via Inama, 1 – 38100 Trento,

Italy

3University of Padua, Department of Environmental Agronomy and Crop Science, viale dell’Università, 16 –

35020 Legnaro (PD) – Italy

4 RLP AgroScience, AlPlanta-Institute for Plant Research, Breitenweg, 71 - Neustadt an der Weinstrasse,

Germany

Corresponding author : Federico Pedrazzoli, ([email protected]), FEM-

IASMA Research Centre, Plant Protection Department, via E. Mach, 1 – 38010 S. Michele all’Adige (TN), Italy.

Running title: Acquisition and transmission of ‘ Ca. Phytoplasma mali’

103 Abstract: ‘Candidatus Phytoplasma mali’, the causal agent of apple proliferation (AP) disease, is naturally transmitted in a circulative, propagative manner by the psyllids Cacop- sylla picta and C. melanoneura . The acquisition capacity and the transmission efficiency in the overwintered adults, nymphal instars and the springtime generation of the two species was studied under controlled conditions. Overwintered adults, collected in the field, were allowed to feed on infected micropropagated apple plants for definite acquisition access periods. One half of the individuals were analysed directly after the acquisition period and one half was transferred onto healthy test plants to assess the multiplication of the pathogen during the latent period. The acquisition capacity of juvenile instars and the springtime generation adults was assessed by allowing them to develop on AP-infected plant. After the trials, the phytoplasma concentration inside the insects was quantified by real-time PCR using SYBR Green technology. The transmission efficiency was tested in controlled experiments with overwintered adults and new generation developmental stages. Although the majority of insects from both species acquired the phytoplasma, transmission to healthy test plants was only obtained with juvenile instars and the springtime generation adults of C. picta . These results can be explained by a higher percentage of high-titre individuals found for C. picta but not for C. melanoneura . In contrast, overwintered adults of both species acquired the phytoplasma equally well already after one day but no significant further multiplication in the latent period was observed. Thus, these results confirm a relationship between the phytoplasma level in the individuals and their transmission efficiency and explain why C. picta is in Trentino a more efficient vector of AP than C. melanoneura .

Keywords: Apple Proliferation, Cacopsylla picta , Cacopsylla melanoneura, vector, phytoplasma quantification

104 Introduction Apple proliferation (AP) is a phytoplasma-associated disease that represents a serious problem in Italian apple orchards. It is known also in other European regions, but it was first described in Italy (Rui, 1950). The most typical symptoms of AP are witches’ brooms and unusually enlarged stipules of the leaves. Early leaf reddening, and smaller and flattened fruits, with longer peduncles, are good indications of the disease (EPPO/CABI, 1996). The etiological agent of AP, ‘ Candidatus Phytoplasma mali’ (Seemüller & Schneider, 2004), belongs to a 16Sr DNA cluster designated ‘Apple proliferation strain cluster’ (Seemüller et al. , 1998) or group 16SrX (Lee et al. , 1998, 2000) together with two other economically important phytoplasma diseases of temperate fruit trees: pear decline (PD) and European Stone Fruit Yellows (ESFY). Phytoplasma diseases are transmitted in a persistent-propagative manner by phloem feeding insects belonging to the Hemiptera order (Lee et al. , 2000) and the genus Cacop- sylla has been proven to play a crucial role in the transmission of the diseases belonging to the apple proliferation cluster. C. pyricola Förster (Jensen et al. , 1964; Davies et al. , 1992) and C. pyri L. (Carraro et al. , 1998a) are involved in the transmission of PD, while C. pruni Scopoli has been demonstrated to be the vector of ESFY (Carraro et al. , 1998b). Up to now, two psyllid species have been reported as responsible of the transmission of ‘Ca. P. mali’: Cacopsylla picta Förster (Frisinghelli et al. , 2000) and C. melanoneura För- ster (Tedeschi et al. , 2002). C. picta is narrowly oligophagous on Malus spp. and Prunus armeniaca L. and univoltine (Conci et al. , 1992; Ossiannilsson, 1992; Lauterer, 1999). In spring the overwintered adults migrate to their host plants, where they lay eggs and nymphs develop. The new generation adults move first to annual herbs and grasses, later to perennial shelter plants like conifers where overwintering takes place (Ossiannilsson, 1992; Lauterer, 1999). C. melanoneura is widely oligophagous on Rosaceae Maloideae such as Crataegus spp., Malus spp. and Pyrus communis L. (Conci et al. , 1992; Ossiannilsson, 1992). Overwinter- ing adults migrate from shelter plants during budding of the host plants. Females lay eggs and larvae hatch at the time of maximum flowering of apple trees. The larvae develop over

105 one month and then the new generation adults appear. After complete sclerotisation, the adults also migrate to conifers as shelter plants (Ossiannilsson, 1992; Lauterer, 1999;). The different role of the two species for the spread of AP was studied in different apple growing areas across Europe and yielded contradictory data. C. picta is reported as an efficient vector of ‘ Ca. P. mali’ in Germany with a natural infection rate of overwintered adults of about 10% (Jarausch et al. , 2007). In transmission trials carried out between 2002 and 2006 overwintered adults transmitted the phytoplasma constantly at higher rates (8 – 45%) than springtime generation adults (5 – 25%) (Jarausch et al. , 2003; 2004; 2007). C. picta is also known to be the most important vector of ‘ Ca. P. mali’ in Friuli-Venezia Giulia (northeastern Italy). All the developmental stages showed high percentages of naturally infected individuals (45% in overwintered adults and 14% in springtime generation adults, respectively). Transmission trials demonstrated that the springtime generation is more efficient than the overwintered adults (Carraro et al. , 2001a, 2008). The latter result confirms the data obtained in Trentino (northern Italy). Transmission rates of the springtime generation ranging from 10% to 60% were already reported by Frisinghelli et al. (2000). In further studies, carried out between 1999 and 2004, the springtime generation of C. picta transmitted repeatedly the disease (transmission rate 4.1%) while no transmission was obtained with overwintered adults (Mattedi et al. , 2008). These results are consistent with bait plant trials in which the natural infection period was determined in the field. Between 2002 and 2003, only the springtime generation of C. picta transmitted apple proliferation to the test plants (Mattedi et al. , 2008). Researches conducted in Piedmont and Aosta Valley, on the other hand, demonstrated that C. melanoneura is a vector of ‘ Ca. P. mali’ in north-western Italy. The natural infection rate of C. melanoneura resulted between 2.8% and 3.6% in overwintered adults and up to 0.8% in the springtime generation. However, much higher values reaching 45% were detected in very heavily infected orchards (Tedeschi et al. , 2003). Overwintered adults seem to play a crucial role in the transmission of the disease exhibiting transmission rates ranging from 29.4% to 88.9%, but also nymphal stages and new generation adults transmitted the phytoplasma (transmission rates of 16.7% and 12.5%), especially after an experimental acquisition on infected apple plants (Tedeschi et al. , 2002; Tedeschi and Alma, 2004). In contrast, C. melanoneura could not be confirmed as vector in Germany (Jarausch et al. , 2004,

106 2007). In transmission trials carried out from 2002 to 2006 no transmission event could be recorded (Mayer et al. , 2009). Transmission trials conducted with C. melanoneura in Tren- tino from 1999 to 2004 resulted in only one successful transmission by the overwintered adults in 2002, corresponding to a mean transmission rate of 0.36% over a six-years period (Mattedi et al. , 2008). In recent years, new molecular approaches based on real-time PCR were developed to study in more detail the relationship among vector, pathogen and plant. This technique allow both detection and quantification of a specific sequence of the pathogen in total DNA extracts of plants or insects. When applied as quantitative PCR (qPCR) on insects, the method enables a thorough examination of the multiplication efficiency of the phytoplasma inside the insect. For quantification of ‘ Ca. P. mali’ a qPCR assay based on SYBR TM Green technology is available which already has been successfully applied to quantify the phytoplasma in psyllids (Jarausch et al. , 2004; 2007; Mayer et al. , 2009). The objective of the present study was to enable a better risk assessment of the role of both psyllid species for ‘ Ca. P. mali’ transmission in Trentino by analysing the acquisition and multiplication efficiency in the overwintered adults, the transmission efficiency of the different developmental stages and the correlation between phytoplasma concentration within insects and their transmission efficiency. Preliminary data of this research have already been published as extended abstract (Pedrazzoli et al. , 2007).

Materials and methods

Plant material The plant material used for the experiments was produced by micropropagation (Ciccotti et al. , 2003). All test plants used in the experiments were of apple cv. Golden Delicious. For acquisition trials, ex vitro plants infected with the subtype AT-2 (strain PM6), the most abundant in Trentino, were used (Cainelli, 2007). For transmission trials, healthy ex vitro apple plants of 10-12 leaves stage were used.

107 Experimental conditions All the experiments were conducted under controlled conditions in a climatic chamber with 16 h light and 20°C and 8 h dark and 15°C. Insects were caged on single apple plants planted in plastic pots (10 cm diameter) in plexiglas cylindrical vessels (height 27 cm, diameter 10.5 cm). The top of each vessel was closed with an insect-proof net. To recollect the insects at the end of the experiments, also the ground of the pots was covered with an insect-proof net.

Insect populations Different insect populations were used for the experiments. Captures took place in spring, at the beginning of the oviposition, when the overwintered generation normally reaches a peak. C. picta . The collection of overwintered adults took place in 2005 in Val di Non in two orchards in Cles (TN) and Cagnò (TN) with a high presence of diseased apple plants. In 2006, as the population levels decreased dramatically, insect collection was carried out in an orchard in South Tyrol (Lana, BZ). In 2007, insects were collected again in Cles (TN) and Cagnò (TN). C. melanoneura . The overwintered adults of C. melanoneura used in the experiments conducted in 2005 were collected in Oltrecastello (Val d’Adige, TN). In 2006, the natural population densities of C. melanoneura dropped to very low levels in almost all the areas of Trentino and therefore the population of Oltrecastello was supplemented with individuals coming from Vigalzano (Valsugana, TN).

Acquisition trials In 2005 and 2006, acquisition experiments were conducted with the overwintered adults of the two species. In both years C. picta was collected at the beginning of May; C. melanoneura was collected between the end of March and the beginning of April. Insects were caged in numbers of 10-15 individuals on infected apple plants for specific acquisition access periods (1, 2, 4 and 6 days, respectively). After acquisition, the surviving insects were recollected. One half of the individuals was immediately frozen for subsequent PCR analysis and one half was moved in numbers of 5 individuals/plant onto healthy apple plants. The insects were kept on the test plants as long as they survived (up to 3-4 weeks) to allow the multiplication of the phytoplasma within the insect body.

108 Transmission trials Between 2005 and 2007, transmission experiments were conducted in order to verify the transmission efficiencies of the different developmental stages of C. picta and C. melanoneura . The healthy test plants used in the acquisition experiments were analysed for phytoplasma infection to verify the transmission efficiency of the overwintered adults. A total number of 33 test plants was used for C. picta (16 in 2005 and 17 in 2006, respectively) and 40 test plants were used with C. melanoneura (20 in 2005 and 20 in 2006). For the springtime generation, neanids were reared from eggs laid on infected plants. Between 10 and 30 third and fourth instars were delicately transferred with a thin paint brush onto a healthy test plant and left there until the adult stage. As soon as imagines emerged they were transferred to a new test plant. The number of replications with C. picta was 5 in 2005, 5 in 2006 and 6 in 2007; the number of plants used with C. melanoneura was 3 in 2005 and 5 in 2006. The transmission efficiency of the new adults was tested with newly developed adults which were born on infected plants but were transferred as third or fourth instar to a healthy test plant (previous experiment) and with insects born and developed until adulthood on infected plants. 5 new generation individuals were caged on each healthy test plant as long as they survived (up to 3-4 weeks). The replications were 28 in 2005, 11 in 2006 and 5 in 2007 for C. picta and 23 in 2005 and 17 in 2006 for C. melanoneura . All insects which were found again at the end of the experiments were subjected to subsequent PCR analysis. After the experiments, each apple plant was transferred to a bigger pot, treated with insecticides and maintained in an insect-proof screen house until fall. Inspection of visual symptoms and sampling of branches for molecular analyses took place between October and November in the year of the experiments and in the following year.

DNA extraction and molecular analyses Insects. Each psyllid was immediately frozen at -80°C by the end of the experiment. For DNA extraction, samples were first lyophilised in a vacuum pump for about 24 h and then homogenised. Total DNA was extracted from single samples as described by Cainelli (2007), with a pre-warmed (60°C) extraction buffer consisting in 3% w/v CTAB, 1.4 M NaCl, 20 mM EDTA, 1.0 M Tris-HCl, 0.2% v/v 2-mercaptoethanol (Doyle & Doyle, 1990). After a 30 min. incubation at 60°C the solution was chloroform/isoamyl alcohol ex-

109 tracted and the DNA in the supernatant was precipitated with a 2/3 volume of cold isopro- panol. After centrifugation the pellet was washed with a wash-buffer (76% v/v EtOH and

10 mM NH 4Ac), dried and re-suspended in 50 µl sterile MQ water. The extracted DNA was then analysed in real-time PCR following the method developed by Jarausch et al. (2004), which is based on the dsDNA binding dye SYBR TM Green I. The AP-specific primer pair AP3/AP4 was used to amplify and subsequently quantify a non- ribosomal DNA fragment of the phytoplasma within the insects (Jarausch et al. , 1994). Reactions were carried out in a total volume of 20 µl containing 10-100 ng of template DNA, 2x Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and 300 nM of each primers. Amplification and detection were performed using a DNA Engine Opticon fluorescence detection system (MJ Research, Waltham, MA, USA). Cycle conditions for qPCR were: 2 min 50°C, 10 min 95°C, 40 cycles of 15 s at 95°C, 30 s at 57°C and 30 s at 67°C. After the run, a melting curve analysis from 50°C to 90°C was performed. For each sample, two replications were run and a mean value of the copy number was calculated. Two replications of a reagent blank were used as negative controls in each experiment. To quantify the phytoplasma titre in samples, a standard curve was prepared. The target sequence of the primers AP3/AP4, cloned in the plasmid vector pUC1196, was used as standard (Jarausch et al ., 2004). The plasmid was purified from E. coli cells by standard methods (Sambrook & Russell, 2001) and the concentration of the extracted DNA was finally measured by the BioPhotometer photometer (Eppendorf, Hamburg, Germany). The corresponding number of copies was calculated. From this plasmid stock solution, serial 10-fold dilutions were prepared ranging from 10 8 target copies/ l to 10 1 copies/ l. Dilu- tions were made in total DNA extracted from phytoplasma-negative insects. Plant material. Phloem tissue was taken with a scalpel from the branches of test plants. Before DNA extraction, samples were frozen at -80°C, lyophilised and then homogenised as for insects. Total DNA was purified from about 20 mg of dry phloem tissue with the Freedom EVO® workstation (TECAN, Männedorf, Switzerland) the commercial kit Nu- cleoSpin® 96 Plant (Macherey-Nagel, Düren, Germany). This kit extracts DNA with lysis buffers containing chaotropic salts, denaturing agents and detergents. The lysis mixture is

110 then cleared by filtration in order to remove polysaccharides, contaminations and residual cellular debris. To detect ‘ Ca. P. mali’, PCR amplifications were performed on the extracts. The fAT/rAS primer pair generated from the 16S ribosomal DNA spacer region sequence, which amplifies a DNA fragment approximately 500 bp long from all the phytoplasmas belonging to the AP group (except ESFY) was used (Smart et al. , 1996). Another PCR assay was conducted on samples using the AP3/AP4 primer pair derived from the sequence of a 1.8 kbp chromosomal DNA fragment of the phytoplasma, which amplifies a 162 bp fragment (Jarausch et al. , 1994). The PCR assays were performed with 100-150 ng DNA, 0.375 µM each primer and the 2x Go Taq® Green Master Mix (Promega, Madison, WI, USA) in a final reaction volume of 20 µl. PCR parameters were the following: 2 min at 95°C (initial denaturation), 30 sec at 95°C, 30 sec at 60°C with fAT/rAS and at 57°C with AP3/AP4, respectively, 30 sec at 72°C and 5 min at 72°C for final extension. The amplifications were performed in a Gene Amp® PCR System 9700 (Applied Bio- systems, Foster City, CA; USA) and the number of cycles was 35 for fAT/rAS and 40 for AP3/AP4, respectively. DNA from infected plants and a reagent blank were included in each experiment as controls. The PCR products were analysed by electrophoresis on 1.5% w/v agarose gels stained with SYBR® Safe DNA gel stain (Invitrogen, Carlsbad, CA; USA) and visualised on UV- illumination with the molecular imager Gel Doc XR System (BIO-RAD, Hercules, CA, USA).

Data analysis After a logarithmic transformation, the phytoplasma titres detected by real-time PCR were subjected to ANOVA using Statigraphics Plus 4.1 in order to verify differences between the species in the acquisition of the pathogen. The amount of phytoplasma acquired by the overwintered adults during different acquisition periods was analysed, by comparing the only acquisition and the multiplication of the pathogen following the acquisition. More- over, the differences in the phytoplasma titre between the overwintered adults and spring-

111 time generation of the two species were studied, in order to relate the phytoplasma levels with the transmission efficiency.

Results The ‘ Ca. P. mali’ acquisition and transmission efficiencies of local populations of C. picta and C. melanoneura were studied in Trentino in 2005 - 2007. According to their pre- dominance, C. picta populations were captured in Val di Non (Trentino) and Lana (South Tyrol) and C. melanoneura populations were caught in Val d’Adige and Valsugana (Tren- tino). In any case, overwintered adults were placed on AP-infected test plants for direct acquisition studies or for breeding of new generation instars or adults. Homogenous, standardised conditions were maintained throughout the experiments by using micropropagated apple plants either as healthy test plants or as defined infection source when infected with the specific ‘ Ca. P. mali’ strain PM6. The natural phytoplasma infection rates in the overwintered populations used were analysed in additional samples not included in the experiments. They were 5.17% in 2005 and 0% in 2007 for C. picta collected in Cles (Val di Non, TN) and 9.09% for C. picta collected in Lana (South Tyrol) in 2006, 1.54% in 2005 and 23.87% in 2006 for C. melanoneura collected in Oltrecastello (Val d’Adige, TN) and 10.42% for C. melanoneura collected in 2006 in Vigalzano (Valsugana, TN) (V. Malagnini, personal communication). After the different acquisition and transmission trials all psyllids were tested for phytoplasma infection by PCR. Between 2005 and 2007, a total number of 434 samples of C. picta and 516 samples of C. melanoneura were analysed. Almost all insects in each cate- gory (overwintered adults, neanids and springtime adults) resulted AP-infected by PCR, indicating a good acquisition capacity of the two species under the experimental conditions adopted (Tab. 1). The overwintering adults of both species showed the highest number of uninfected insects.

Analysis of the acquisition efficiency of overwintered adults The acquisition efficiency of overwintered adults was studied by allowing naturally captured psyllids of both species to feed on AP-infected apple plants for defined acquisition access periods (AAP) of 1 day, 2 days, 4 days and 6 days. One half of the insects was di-

112 rectly tested for phytoplasma presence after the respective AAP and the other half was transferred to healthy apple plants to enable further phytoplasma multiplication in those individuals which acquired the phytoplasma (multiplication period, MP). Quantitative real- time PCR was applied to determine the phytoplasma concentration in the individual insects in order to estimate the acquisition efficiency after short sucking periods and the multiplication efficiency of the phytoplasma in the different species. The experiments were carried out with an identical experimental setup in two consecutive years, 2005 and 2006. Addi- tional experiments were carried out with C. picta in 2007 under the same conditions. The real-time PCR analyses showed a broad range in the phytoplasma titre detected in the overwintered adults of the two species, ranging from 10 2 to 10 7 and from 10 4 to 10 8 copies of phytoplasma/insect in C. picta and from 10 2 to 10 5 and from 10 4 to 10 7 copies/insect in C. melanoneura in 2005 and 2006, respectively. High phytoplasma concentrations were detected in some individuals of both species already after short acquisition periods (up to 4x10 7 and 2x10 8 copies/insect in C. picta and up to 5x10 5 and 2x10 7 copies/insect in C. melanoneura in 2005 and 2006, respectively). As in the control samples naturally infected individuals were observed for all populations of both species these individuals with high phytoplasma concentrations were considered as naturally infected prior to the acquisition experiment and, therefore, these individuals were excluded from further analysis (exclusion limits for C. picta were 8.41x10 6 copies/insect in 2005 and 6.90x10 7 copies/insect in 2006 and for C. melanoneura 3.49x10 5 copies/insect in 2005 and 1.04x10 7 copies/insect in 2006). The values of all other insects were subjected to statistical analyses to compare the phytoplasma level in both species after the different acquisition periods. The mean phytoplasma concentrations in both species after the different AAPs are shown in Tab. 2. The statistical analysis conducted on the data of 2005 showed for C. picta no significant differences in the phytoplasma levels among the AAPs of 2, 4 and 6 days (p=0.6350). On the other hand, in C. melanoneura a highly significant difference emerged between the phytoplasma titre detected after the AAPs 1 and 4 days (p=0.0001). Data of 2006 indicate a statistically significant difference in C. picta among the phytoplasma titres acquired during the different AAPs (p=0.0129), with an increase in the phytoplasma titre between AAPs 1-2 days and 4 days. On the contrary, the mean phytoplasma concentration in C. melanoneura varied not significantly among the AAPs tested (p=0.6122).

113 Analysis of the multiplication efficiency of ‘Ca. P. mali’ in overwintered adults After forced acquisition feeding of overwintered adults of both psyllid species on AP- infected apple plants for 1, 2, 4 or 6 days psyllids were transferred in groups of 5 individuals to healthy test plants. They were kept on these plants for at least 3 weeks to allow further multiplication of the phytoplasma inside the insect. After this MP all insects were recollected and analysed for phytoplasma infection and phytoplasma concentration quantitative real-time PCR. In order to assess a potential multiplication of the phytoplasma, the mean phytoplasma concentrations measured in the individuals tested directly after the respective AAP were compared to the mean values of those individuals which were kept after the acquisition period for the supplementary multiplication period on healthy test plants. The mean phytoplasma concentrations in both species after the different acquisition + multiplication periods are shown in Tab. 2. The one-way ANOVA on data collected in 2005 showed a significant increase in the phytoplasma concentration in C. picta only for the AAP of 2 days (p=0.0004) while values for 4 days (p=0.6859) and for 6 days (p=0.5305) were not significantly higher after the MP. In C. melanoneura a significant multiplication could be observed for the AAPs of 1 day (p=0.0254) and 4 days (p=0.0004), but not for the AAP of 6 days (p=0.1192). The data of 2006 confirm only partially an increase in the mean phytoplasma concentration after short AAPs in C. melanoneura : it was not significant after 1 day ( (p=0.9894) but significant after 2 days (p=0.0254). No significant differences were found for C. picta (p=0.9369 for 1 day, p=0.6315 for 2 days, p=0.1990 for 4 days). Phytoplasmas are transmitted by their insect vectors in a persistent propagative manner and the phytoplasma has to multiply inside the insect body to a certain concentration and reach the salivary glands before the insect gets infective and is able to transmit the phytoplasma to a plant. As this threshold concentration is unknown for ‘ Ca. P. mali’ vectors the obtained data were analysed in a different way. All individuals of the different acquisition and acquisition + multiplication experiments were grouped in classes of different phytoplasma concentration. The results of this analysis are shown in Fig. 1 for the data of 2005 and in Fig. 2 for the data obtained in 2006. Only few individuals were found in the class with the highest phytoplasma concentration (> 10 6 in 2005 and >10 7 in 2006). For C. picta there was no obvious increase in high-titre individuals after the different MPs in both years,

114 apart from the 4 days acquisition period in 2005. Similar results were obtained for C. melanoneura besides 1 and 4 days acquisition periods in 2005.

Analysis of the acquisition efficiency of neanidal instars Overwintered adults of both species were allowed to breed on AP-infected apple plants. Thus, developing neanidal instars fed all their life time on infected plant. The efficiency of phytoplasma acquisition by these developmental stages was again analysed by quantitative real-time PCR by testing batches of neanids collected from infected plants. C. picta was tested in batches of 10 individuals in 2005 and 2006. The mean phytoplasma titre calculated from the data of 2005 was 7.54x10 5 ± 1.84x10 5 copies/batch (mean value ± standard error). The neanids analysed in 2006 showed a mean phytoplasma titre of 1.83x10 7 ± 1.69x10 7 copies/batch, but one out of the three batches collected in 2006 tested negative. In 2007, due to the very low population densities, neanids were tested singularly. Despite this, the mean phytoplasma titre obtained was in the same range as in the previous years (4.65x10 6 ± 2.34x10 6 copies/insect). The two batches of five individuals of C. melanoneura tested in 2005 revealed a mean phytoplasma titre of 4.60x10 4 ± 1.73x10 4 copies/batch, while the four batches of 10 individuals analysed in 2006 showed a mean phytoplasma titre of 1.90x10 6 ± 1.29x10 6 copies/batch. Fig. 3 shows the repartition of the batches or individuals into different phytoplasma concentration classes. In each year, neanidal instars of C. picta were present in the highest concentration classes reaching a maximum of 2.19x10 6 copies in 2005, 3.53x10 7 in 2006 and 1.32x10 7 in 2007, respectively. In contrast, neanidal instars of C. melanoneura constantly reached lower phytoplasma concentrations.

Analysis of the acquisition efficiency of springtime adults In the breeding experiments also springtime generation adults were obtained which had developed entirely on AP-infected plant. The real-time PCR conducted on the new generation adults in 2005 revealed a mean phytoplasma titre of 6.78x10 6 ± 1.69x10 6 copies/insect (mean value ± standard error) for C. picta and of 2.02x10 5 ± 6.65x10 4 copies/insect for C. melanoneura . In 2006 C. picta reached a mean titre of 6.20x10 6 ± 3.89x10 6 copies/individual while C. melanoneura 1.42x10 7 ± 1.13x10 7. These high mean value and standard error in C. melanoneura are due to few individuals, which reached extremely high phytoplasma levels (up to 10 8 copies). The new generation individuals of C. picta analysed in 2007 showed a mean phytoplasma titre of 2.48x10 7 ± 1.54x10 7 copies/individual.

115 The percentage of individuals belonging to the different classes of phytoplasma titre are represented in Fig. 4, where data collected in the different years are compared for each species and each developmental stage. Apart from the individuals of C. melanoneura which showed extremely high concentrations in 2006, the percentage of new adults of C. picta belonging to the highest concentration class (>10 7 ) was every year higher than for new adults of C. melanoneura .

Analysis of the transmission efficiency The transmission efficiency of overwintered adults was tested by analysing the healthy apple plants which were used to assess the phytoplasma multiplication efficiency of overwintered adults. Specific transmission trials were carried out for neanidal instars and new generation adults born on infected plant. All test plants used in transmission trials were monitored for specific symptoms of the disease between October and November and branches were sampled for the PCR assay in the year of the experiment as well as in the year after. In the trials conducted in 2005, 5 out of 61 plants used to test the infectiveness of the neanids and the springtime generation of C. picta were tested positive in 2005 as well as 2006 (Tab. 3). None of the apple plants used in the experiments with C. melanoneura showed symptoms nor was tested positive in 2005 and 2006 (Tab. 3). In the trials carried out in 2006, 33 apple plants were used with C. picta and 42 with C. melanoneura , but none showed symptoms of the disease nor resulted infected in the PCR assay in 2006 or 2007 (Tab. 3). Finally, also the plants used in 2007 for transmission trials with C. picta did not show symptoms or tested positive in 2007 and 2008. Thus, although the majority of insects used in the transmission trials was shown to be infected with the phytoplasma, transmission events could be recorded only for neanids and springtime adults of C. picta born on infected plant. In 2005, transmission with neanids was very efficient reaching a rate of 60% while the transmission rate of new adults was only 7%. The individuals of the groups of insects which transmitted the phytoplasma to healthy test plants were analysed for their phytoplasma concentration. The mean phytoplasma titre detected in the new generation adults re-collected from the psyllid-infected test plants was even lower than that detected in the psyllids re-collected from non-infected plants (2.57x10 6

116 ± 1.14x10 6 copies/insect and 6.83x10 6 ± 1.84x10 6 copies/insect, respectively). By looking at the distribution of the insects in the phytoplasma titre classes, a higher percentage of the insects re-collected from the infected plants is in the classes above 10 6 copies/insect compared to the insects coming from healthy plants (40% vs. 28.13%, respectively) (Fig. 5).

Discussion Two psyllid species are acknowledged as principal vectors of apple proliferation disease: Cacopsylla picta and Cacopsylla melanoneura . However, contradictory data have been reported for their role as vectors of ‘Ca. P. mali’ so far. C. picta was first reported as a vector of apple proliferation in Trentino (Frisinghelli et al. , 2000; 2007) and has since then been confirmed as efficient vector in Germany (Jarausch et al. , 2003) and Friuli-Venezia Giulia (North-eastern Italy) (Carraro et al. , 2001a; 2008). In contrast, C. melanoneura has only been proven to efficiently transmit ‘ Ca. P. mali’ with all its developmental stages in northwestern Italy (Tedeschi et al. , 2002; Tedeschi and Alma, 2004) but has to be regarded as a non-vector for AP in Germany (Mayer et al. , 2009). The phytoplasma-vectoring capacity of the population of C. melanoneura in Trentino remained unclear as only one successful transmission over a six-years period could be obtained (Mattedi et al. , 2008). Furthermore, diverse results were also obtained regarding the transmission efficiency of the overwintered adults and new generation developmental stages of C. picta : whereas in Germany both generations transmit and overwintered adults exhibited even higher transmission efficiencies (Jarausch et al. , 2004, 2007), in Trentino transmission has almost exclusively been observed with new generation stages (Frisinghelli et al. , 2000; Mattedi et al. , 2008). Thus, the objective of the present study was to gain deeper insight into the role of both psyllid species and their developmental stages for ‘ Ca. P. mali’ transmission in Trentino. For this, transmission trials were carried out under controlled, standardised conditions in order to exclude as much as possible external influences on the result. An experimental design according to Jarausch et al. (2004) was used which is based on homogenous micropropagated plant material and the use of one specific phytoplasma strain. Even though the experimental conditions adopted in this research were very restrictive for the insects, the transmission rates obtained are consistent with the results of the previous

117 studies carried out in Trentino in cages in the greenhouse (Mattedi et al. , 2008): transmission of ‘ Ca. P. mali’ occurred only with juvenile instars and springtime adults of C. picta (4.7% over a three-years period compared to 4.1% over a six-years period). Not a single transmission event was observed with C. melanoneura . This result is also in agreement with the period of natural AP transmission in the orchards as determined by bait plant trials (Mattedi et al. , 2008). In these studies, natural transmission could only be observed during the period of migration of springtime adults of C. picta . Despite the negative transmission results very high percentages of all developmental stages of both psyllid species were able to acquire the phytoplasma from AP-infected test plants. This indicates that all individuals sucked on the test plants and that observed differences in the acquisition efficiency and the phytoplasma concentration can be attributed rather to the individual psyllid than to the experimental conditions. The detailed analysis of the acquisition efficiency of C. picta and C. melanoneura was focused on the overwintered adults because in this generation most of the incertitude regarding their effective risk for the disease spread remained. The results obtained demonstrate that a short acquisition period of just one day is sufficient for both species to acquire the phytoplasma. Short acquisition periods of 2-4 days have also been shown to be sufficient for C. pruni , the vector of ‘ Ca. Phytoplasma prunorum’, to acquire the phytoplasma from infected plants (Carraro et al. , 2001b). Quantitative real-time PCR was applied to better differentiate the acquisition efficiencies of both species at the various acquisition access periods. Although a slight increase in the mean phytoplasma concentration per insect could be observed for both species with longer acquisition periods, this increase was not always statistically significant. Furthermore, the mean phytoplasma concentrations were in a similar range for both species indicating that their phytoplasma acquisition capacity is equivalent. Thus, both species reached already their maximum acquisition capacity within one day which is an indication for an efficient vector (Marzachì et al. , 2004). After acquisition the phytoplasma move through and replicate in the competent vector's body (Weintraub & Beanland, 2006). It has to invade the salivary glands and multiply in there before it can be transmitted by the insect to a new plant. This period is known as latent period and in the case of psyllid vectors it can be between 2 and 5 weeks as determined

118 by Carraro et al. (2001b) for C. pruni . The multiplication efficiency of ‘ Ca. P. mali’ in C. picta and C. melanoneura was therefore assessed by keeping a part of the insects for 3-4 weeks on healthy plants after the varying acquisition access periods. A comparison of the mean phytoplasma concentrations in the insects directly after acquisition and in those which completed the latent period showed only a weak significant increase in phytoplasma concentration after short AAPs but not after longer AAPs. Thus, the phytoplasma is retained in the insect body at a certain concentration which may reflect phytoplasma multiplication in midgut and/or haemocoel. If invasion of the salivary gland – and thus transmissi- bility – is accompanied by further phytoplasma multiplication, only those individuals exhibiting high phytoplasma concentrations can be used to assess vector efficiency. However, in most of the cases, the analysis of the data by phytoplasma concentration classes did neither reveal a significant increase of high-titre individuals after the multiplication period. This result might be a possible explanation for the absence of effective transmissions with the overwintered adults of both species. Similar data have been reported for the acquisition of ‘ Ca. Phytoplasma prunorum’ by overwintered adults of its psyllid vector Cacopsylla pruni . The psyllids readily acquired the phytoplasma already after 1 day AAP but the mean phytoplasma concentration measured by qPCR in the insects did not increase after AAPs from 1 to 21 days (Thébaud et al. , 2008). Only few data are available to estimate a phytoplasma threshold concentration above which an individual insect has to be considered infective. Jarausch et al. (2007) reported that individuals of C. picta which successfully transmitted ‘ Ca. P. mali’ had phytoplasma concentrations in the range of 10 6 to 10 8 copies per insect. Naturally infected overwintered adults of C. picta exhibited phytoplasma concentrations between 10 7 and 10 9 copies per insect in Trentino (Cainelli et al. , 2007) and a mean phytoplasma concentration of 3.25x10 8 copies per insect in Germany (Mayer et al. , 2009). Similar phytoplasma concentrations were reported by Thébaud et al. (2008) who measured phytoplasma concentrations between 10 7 and 10 8 copies per individual of C. pruni which transmitted ‘ Ca. P. prunorum’ to healthy test plants. These data can be confirmed in the present study by the analysis of the individuals of the new generation of C. picta which transmitted the phytoplasma. A higher percentage of individuals with phytoplasma concentrations above 10 6 copies per insect was found on in-

119 fected plants than on non-infected plants. However, not all high-titre individuals transmitted successfully the phytoplasma. This observation indicates that besides phytoplasma loads above a certain threshold also the number of insects with a sufficient phytoplasma titre plays a crucial role in the infection process. This has already been hypothesized by Fris- inghelli et al. (2000) and observed for the transmission of pear decline by Davies et al. (1992). The failure of ‘Ca. P. mali’ transmission by overwintered adults of C. picta as well as by all developmental stages of C. melanoneura can thus be explained. The juvenile instars of both species, when developed on infected plants, showed high titres of phytoplasma and in particular new generation individuals of C. picta were found at higher percentages in the upper phytoplasma concentration classes compared to overwintered adults. This difference was not observed with C. melanoneura . Generally, juvenile instars of C. melanoneura did not reach so high phytoplasma concentration classes as C. picta , which is consistent with the results of the transmission trials. Although all transmission trials failed, the data obtained in the present study indicate that the population of C. melanoneura used might have the potential to transmit the phytoplasma. This is in contrast to the results obtained for the population of C. melanoneura in Germany where experimental transmission trials never succeeded, corresponding with an extremely low natural infection rate of C. melanoneura and only low phytoplasma concentrations in the scarce infected individuals (Jarausch et al., 2004, 2007; Mayer et al. , 2009). However, C. picta represents a much higher risk for the natural spread of AP disease as indicated by the repeatedly successful transmission trials. The data of the present study indicate that this risk is due to a relative small number of individuals in which the phytoplasma reaches very high concentrations. A certain amount of phytoplasma injection into the healthy plant seems to be necessary before the infection can develop. In this regard sucking behaviour as well as concentration of high-titre individuals on a tree may be deci- sive. The results of this study further demonstrate that ‘ Ca. P. mali’ can be readily acquired from infected plants by both species and, thus, natural infection rates determined by qualitative PCR might be directly linked to the infection status of the orchard where the psyllids have been captured. However, our data demonstrate that qualitative PCR detection of ‘ Ca. P. mali’ in a potential vector species is not informative for a risk assessment because the amount of infective individuals is overestimated. For this, quantitative PCR has to be ap-

120 plied. The determination of a threshold level for the phytoplasma concentration in the insect to discriminate between efficient, occasional and non-vectors would be very helpful.

Aknowledgements The authors thank A.M. Ciccotti, I. Battocletti, P.L. Bianchedi, M. Deromedi and M. Filippi (IASMA-FEM, S. Michele all’Adige, Trento) for the plant material, W. Waldner (Breatungsring, Lana, Bolzano) and M. Fontanari (C.R.A. Istituto Sperimentale per la Frut- ticoltura, SOP, Trento) for the insects and C. Cainelli (Centro per la Sperimentazione Agraria e Forestale Laimburg, Ora, Bolzano) for the scientific advice. The authors further thank Gabriele Stoppa for critical review of the statistical analyses and Barbara Jarausch for critical review of the manuscript. This research was conducted within the SMAPII project, financed by the Province of Trento.

References Cainelli C. (2007) Population dynamics of apple proliferation in Trentino . 171 pp. Ph.D. Thesis, Università degli Studi di Verona (Italy). Cainelli C., Forno F., Mattedi L. and Grando M.S. (2007) Can apple aphids be vectors of Candidatus Phytoplasma mali? IOBC/WPRS Bulletin 30: 261-266. Carraro L., Ferrini F., Ermacora P., Loi N. and Labonne G. (2008) Infectivity of Cacop- sylla picta (Syn. Cacopsylla costalis ), vector of ‘ Candidatus Phytoplasma mali’ in north east Italy. Acta Horticulturae , 781: 403-407. Carraro L., Loi N. and Ermacora P. (2001b) Transmission characteristics of the European Stone Fruit Yellows phytoplasma and its vector Cacopsylla pruni. European Journal of Plant Pathology , 107: 695-700. Carraro L., Loi N., Ermacora P., Gregoris A. and Osler R. (1998a) Transmission of pear decline by using naturally infetced Cacopsylla pyri . Acta Horticulturae , 472: 665-668. Carraro L., Osler R., Loi N., Ermacora P. and Refatti E. (1998b) Transmission of European stone fruit yellows phytoplasma by Cacopsylla pruni . Journal of Plant Pathology , 80:

121 233-239. Carraro L., Osler R., Loi N., Ermacora P. and Refatti E. (2001a) Fruit tree phytoplasma diseases diffused in nature by psyllids. Acta Horticulturae , 550: 345-350. Ciccotti A.M., Gatto P. and Vindimian M.E. (2003) Differente comportamento in vitro ed ex vitro di due cultivar di melo micropropagate infettate con fitoplasma AP (Apple Pro- liferation). Petria , 13 (3): 165-172. Conci C., Rapisarda C. and Tamanini L. (1992) Annotated catalogue of the Italian Psyl- loidea . First Part ( Insecta Homoptera ). Atti Accademia Roveretana degli Agiati , a. 242, ser. VII, vol. 2, B: 33-135. Davies D.L., Guise C.M. and Adams A.N. (1992) Parry’s disease of pears is similar to pear decline and is associated with mycoplasma-like organisms transmitted by Cacopsylla pyricola . Plant Pathology , 41: 195-203. Doyle J.J. and Doyle J.L. (1990) Isolation of plant DNA from fresh tissue. Focus, 12 (1): 13-15. EPPO/CABI (1996) Apple proliferation phytoplasma. In: Quarantine Pests for Europe , 2 nd edn, pp. 959-962. Wallingford (GB): CAB International. Frisinghelli C., Delaiti L., Grando M.S., Forti D. and Vindimian M.E. (2000) Cacopsylla costalis (Flor 1861), as a vector of apple proliferation in Trentino. Journal of Phytopa- thology , 148: 425-431. Jarausch, B., Fuchs, A., Scwind, N., Krczal, G. and Jarausch, W. (2007) Cacopsylla picta as most important vector for „ Candidatus Phytoplasma mali“ in Germany and neighbour- ing regions. Bulletin of Insectology 60 (2): 189-190. Jarausch B., Schwind N., Jarausch W. and Krczal G. (2003) First report of Cacopsylla picta as a vector of apple proliferation phytoplasma in Germany. Plant Disease , 87: 101. Jarausch B., Schwind N., Jarausch W. and Krczal G. (2004) Overwintering adults and springtime generation of Cacopsylla picta (synonym C. costalis ) can transmit apple proliferation phytoplasmas. Acta Horticulturae , 657: 409-413. Jarausch W., Peccerella T., Schwind N., Jarausch B. and Krczal G. (2004) Establishment of a quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta Horticulturae , 657: 415-420.

122 Jarausch W., Saillard C., Dosba F. and Bové J.M. (1994) Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of apple proliferation, MLO. Applied and Environmental Microbiology , 60: 2916-2923. Jensen D.D., Griggs W.H., Gonzales C.Q. and Schneider H. (1964) Pear decline virus transmission by pear psylla. Phytopathology , 54: 1346-1351. Lauterer P. (1999) Results of investigations on Hemiptera in Moravia, made by Moravian Museum (Psylloidea 2). Acta Musei Moraviae, Scientae Biologicae (Brno), 84: 71-151. Lee I.-M., Davis R.E. and Gundersen-Rindal D.E. (2000) Phytoplasma: phytopathogenic mollicutes. Annual Review of Microbiology , 54: 221-255. Lee I.-M., Gundersen-Rindal D.E., Davis R.E. and Bartoszyk I.M. (1998) Revised classification scheme of phytoplasmas based on RFLP analyses of 16S rRNA and ribosomal protein gene sequences. International Journal of Systematic Bacteriology , 48: 1153- 1169. Mattedi L., Forno F., Cainelli C., Grando M.S. and Jarausch W. (2008) Research on Can- didatus Phytoplasma mali transmission by insect vectors in Trentino. Acta Horticul- turae, 781: 369-374. Marzachì C., Milne R.G. and Bosco D. (2004) Phytoplasma-Plant-Vector Relationship. In: Recent Research and Development in Plant Pathology , eds. Pandalai, S.G. and Gayathri, A., pages 211-241. Research Signpost, Kerala, India. Mayer C.J., Jarausch B., Jarausch W., Vilcinskas A. and Gross, J. (2009) Cacopsylla melanoneura has no relevance as vector of apple proliferation in Germany. Phytopa- thology (in press). Ossiannilsson F. (1992) The Psylloidea (Homoptera) of Fennoscandia and Denmark . 346 pp., Fauna Entomologica Scandinavica, 26, E.J. Brill, Leiden (The Netherlands). Pedrazzoli F., Gualandri V., Forno F., Mattedi L., Malagnini V., Salvadori A., Stoppa G. and Ioriatti C. (2007). Acquisition capacities of the overwintering adults of the psyllid vectors of Candidatus phytoplasma mali. Bulletin of insectology , 60: 195-196. Rui D. (1950) Una malattia inedita: la virosi a scopazzi del melo. Humus , 6 (11): 7-10. Sambrook J. and Russell D.W. (2001) Preparation of plasmid DNA by alkaline lysis with SDS: Minipreparation. In: Molecular cloning - a laboratory manual , pp.1.32-1.34; p.

123 A1.16. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (USA). Seemüller E. and Schneider B. (2004) ‘ Candidatus Phytoplasma mali’, ‘ Candidatus Phyto- plasma pyri’ and ‘ Candidatus Phytoplasma prunorum’, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology , 54: 1217-1226. Seemüller E., Marcone C., Lauer U., Ragozzino A. and Göschl M. (1998) Current status of molecular classification of the Phytoplasmas. Journal of Plant Pathology , 80: 3-26. Smart C.D., Schneider B., Blomquist C.L., Guerra L.J., Harrison N.A., Ahrens U., Lorenz K.-H., Seemüller E. and Kirkpatrick B.C. (1996) Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Applied and Environmental Microbiology , 62 (8): 2988-2993. Tedeschi R. and Alma A. (2004) Transmission of apple proliferation phytoplasma by Ca- copsylla melanoneura (Homoptera: Psyllidae). Journal of Economic Entomology , 97 (1): 8-13. Tedeschi R., Bosco D. and Alma A. (2002) Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in northwestern Italy. Journal of Economic Entomolgy , 95 (3): 544-551. Tedeschi R., Visentin C., Alma A. and Bosco D. (2003) Epidemiology of apple proliferation (AP) in northwestern Italy: evaluation of the frequency of AP-positive psyllids in naturally infected populations of Cacopsylla melanoneura (Homoptera: Psyllidae). An- nals of Applied Biology , 142: 285-290. Thébaud G., Yvon M., Labonne G. and Alary, R. (2008) European stone fruit yellows: consequences of the life cycle of the vector and of the multiplication of the phytoplasma in the insect on the epidemiology of the disease. Acta Horticulturae, 781: 423-428. Weintraub P.G. and Beanland L. (2006) Insect vectors of phytoplasmas. Annual Review of Entomology , 51: 91-111.

124 Table 1 - Number of psyllids analysed by PCR for ‘ Ca. P. mali’ infection in acquisition and transmission trials between 2005 and 2007.

2005 2006 2007 TOT. infected/ % infected/ % infected/ % infected/ % total infected total infected total infected total infected C. picta overwintered a- 159/161 98.76 109/113 96.46 268/274 97.81 dults neanids (batches) 10/10* 100 2/3* 66.67 5/5** 100 17/18 94.44 springtime adults 108/108 100 19/20 95.00 14/14 100 141/142 99.30 C. melanoneura overwintered a- 242/261 92.72 121/128 94.53 363/389 93.34 dults neanids (batches) 2/2*** 100 4/4* 100 6/6 100 springtime adults 59/59 100 59/62 95.16 118/121 97.52

* neanids analysed in batches of 10 individuals. ** neanids analysed as single individuals. *** neanids analysed in batches of 5 individuals.

125

Table 2 - Mean phytoplasma concentrations in C. picta and C. melanoneura after different acquisition access periods and supplementary multiplication periods.

C. picta C. melanoneura Year Acquisition maximum mean mean access phytoplasma phytoplasma concentration phytoplasma concentration period multiplication period per insect per insect

2005 1 day 1 day nd 2.09E+04 ± 3.72E+03 2 days 2 days 1.09E+04 ± 2.08E+03 nd 4 days 4 days 8.61E+04 ± 3.42E+04 5.71E+04 ± 1.86E+04 6 days 6 days 9.12E+04 ± 7.24E+04 8.63E+04 ± 2.83E+04 1 day + multiplication 3 weeks nd 4.82E+04 ± 8.68E+03 2 days + multiplication 3 weeks 8.28E+04 ± 2.01E+04 nd 4 days + multiplication 3-4 weeks 2.66E+05 ± 1.68E+05 1.38E+05 ± 2.09E+04 6 days + multiplication 4 weeks 1.06E+05 ± 7.44E+04 1.01E+05 ± 1.97E+04 2006 1 day 1 day 3.54E+05 ± 6.36E+04 8.27E+05 ± 1.35E+05 2 days 2 days 3.06E+05 ± 9.29E+04 8.53E+05 ± 1.50E+05 4 days 4 days 5.15E+07 ± 5.05E+07 7.07E+05 ± 1.15E+05 6 days 6 days nd nd 1 day + multiplication 3 weeks 3.47E+05 ± 5.89E+04 7.52E+05 ± 1.53E+05 2 days + multiplication 3 weeks 4.67E+05 ± 1.17E+05 2.15E+06 ± 6.16E+05 4 days + multiplication 3-4 weeks 8.86E+05 ± 3.80E+05 nd 6 days + multiplication 4 weeks 6.42E+05 ± 1.18E+05 4.97E+05 ± 1.22E+05 nd = not determined

126 Table 3 - Results of ‘Ca. P. mali’ detection by AP-specific PCR assays in test plants used in transmission trials in 2005, 2006 and 2007 with C. picta and C. melanoneura.

overwintered neanids new generation TOT. year of adults adults trial C. picta 2005 0/28* 3/5 2/28 5/61 2006 0/17 0/5 0/11 0/33 2007 - 0/6 0/5 0/11 TOT. 0/45 3/16 2/44 5/105 C. melanoneura 2005 0/32 0/3 0/23 0/58 2006 0/20 0/5 0/17 0/42 TOT. 0/52 0/8 0/40 0/100 * number of PCR-positive plants per total number of tested plants

127 Overwintered C. picta

100 80 <1.E+04 60 1.E+04-1.E+05 % 40 1.E+05-1.E+06 >1.E+06 20

0 acq. acq. + mult. acq. acq. + mult. acq. acq. + mult.

2 4 6 (a) Acquisition periods

Overwintered C. melanoneura

100 80 1.E+02-1.E+03 60 1.E+3-1.E+04 % 40 1.E+04-1.E+05 1.E+05-1.E+06 20

0 acq. acq. + mult. acq. acq. + mult. acq. acq. + mult.

1 4 6 (b) Acquisition periods

Figure 3 - Acquisition trials conducted in 2005. Percentage of overwintered adults belonging to different phytoplasma concentration classes: comparison between only acquisition and acquisition + multiplication after different acquisition access periods in C. picta (a) and in C. melanoneura (b).

128

Overwintered C. picta

100

80 1.E+04-1.E+05 60 1.E+05-1.E+06 % 40 1.E+06-1.E+07 20 >1.E+07 0 acq. acq. + acq. acq. + acq. acq. + acq. acq. + mult. mult. mult. mult.

1 2 4 6 (a) Acquisition periods

Overwintered C. melanoneura

100 80 1.E+04-1.E+05 60

% 1.E+05-1.E+06 40 1.E+06-1.E+07 20 0 acq. acq. + acq. acq. + acq. acq. + acq. acq. + mult. mult. mult. mult.

1 2 4 6 (b) Acquisition periods

Figure 2 – Acquisition trials conducted in 2006. Percentage of overwintered adults belonging to different phytoplasma concentration classes: comparison between only acquisition and acquisition + multiplication after different acquisition access periods in C. picta (a) and in C. melanoneura (b).

129

100 80 1.E+04-1.E+05 60 1.E+05-1.E+06 % 1.E+06-1.E+07 40 1.E+07-1.E+08 20 0 2005 2006 2007 2005 2006

C. picta C. melanoneura

Figure 3 – Percentage of neanids of C. picta and C. melanoneura in different phytoplasma concentration classes: in 2005 batches of C. picta were composed of 10 insects and batches of C. melanoneura of five insects; in 2006 batches of both species were composed of 10 individuals and in 2007 singular neanids of C. picta were tested.

130

C. picta

80 70 60 <1.E+04 50 1.E+04-1.E+05 % 40 1.E+05-1.E+06 30 1.E+06-1.E+07 20 >1.E+07 10 0 2005 2006 2005 2006 2007 overw. ad. new gen. (a)

C. melanoneura

80 70 60 <1.E+04 50 1.E+04-1.E+05 % 40 1.E+05-1.E+06 30 1.E+06-1.E+07 20 >1.E+07 10 0 2005 2006 2005 2006

overw. ad. new gen. (b)

Figure 4 – Percentage of psyllids belonging to the different phytoplasma concentration classes: (a) C. picta and (b) C. melanoneura . For each species, the values measured in the overwintered adults and in the springtime generation adults in the different years are reported.

131

30 <1.E+04 1.E+04-1.E+05

% 20 1.E+05-1.E+06 1.E+06-1.E+07 >1.E+07 10

0 from healthy plants from infected plants

Figure 5 – Percentage of psyllids belonging to the different phytoplasma concentration classes in C. picta individuals re-collected from test plants which tested AP-positive and from plants which resulted healthy.

132 Chapter 3

Detection of ‘ Candidatus Phytoplasma mali’ in different populations of Cacopsylla melanoneura Förster (Hemiptera: Psyllidae)

Manuscript for Annals of Applied Biology

1 1 1 1 Valeria MALAGNINI , Federico PEDRAZZOLI , Valeria GUALANDRI , Rosaly ZASSO , Elisa 1 1 2 2 1 BOZZA , Federica FIAMINGO , Alberto POZZEBON , Nicola MORI , Claudio IORIATTI

1FEM- IASMA Research Centre, Plant Protection Department, via E. Mach, 1 -38010 San Michele all’Adige (TN), Italy 2University of Padua, Department of Environmental Agronomy and Crop Science, viale dell’Università, 16 – 35020 Legnaro (PD) – Italy

Corresponding author: Valeria Malagnini, ([email protected]), FEM-IASMA Research Centre, Plant Protection Department, via E. Mach, 1 – 38010 S. Michele all’Adige (TN), Italy.

Running title: Detection of ‘ Ca. P. mali’ in C. melanoneura

133 Abstract: Cacospylla melanoneura is one of the vectors of ‘ Candidathus Phytoplasma mali’, which is the causal agent of apple proliferation (AP) disease. In 2006 and 2007, overwintering adult psyllids were collected from different host plants (apple, hawthorn and conifers) in different localities to assess the natural infection of C. melanoneura. AP phytoplasma was detected in insects through the use of PCR amplification with specific primers (AP3/AP4). The insects collected in one of the geographic areas were also examined using quantitative PCR. Eleven percent of the psyllids collected from apple in the Trentino region were infected with AP phytoplasma, as compared with 18.83% of the psyllids collected from apple in the Aosta Valley and none of the psyllids collected from apple in the Veneto region. The percentage of AP-positive overwintering adults was higher in the Aosta Valley than in the Trentino region. Furthermore, considering the level of AP presence in the monitored orchards, a positive correlation between the infection rates in the insects and the percentage of symptomatic plants was observed. Data obtained by PCR amplification of C. melanoneura collected from conifers showed that a percentage (10.5%) of the insects collected in the Trentino region tested positive for AP phytoplasma, while none of the psyllids collected in France tested positive. The results of the qualitative PCR analyses indicated a generally low titer of AP-phytoplasma. Data obtained in this work demonstrate that ‘ Ca . P. mali’ may overwinter in the bodies of C. melanoneura and that there are differences in the infection proportion among populations.

Keywords: Apple Proliferation, Phytoplasma, Psyllids, Cacopsylla melanoneura

Introduction The agronomic importance of the Hemiptera genus Cacopsylla is linked to the roles played by several of these species in the transmission of phytoplasma-associated diseases. Apple proliferation (AP) disease is one of the more severe problems in Italian apple orchards. In northeastern Italy, symptoms of AP have been observed since the 1950s (Rui, 1950), but the disease has only recently become widespread, particularly in Trentino (northeastern Italy), where it has struck the cultivars Golden Delicious, Florina and Renetta Canada (Vindimian and Delaiti, 1996). Apple proliferation causes important economic losses, as infected trees produce small fruits with poor flavor. The etiological agent, ‘ Can-

134 didatus Phytoplasma mali’ (Seemüller and Schneider, 2004), can be transmitted by Cacop- sylla melanoneura (Förster), which has been demonstrated to be the main vector of the disease in northwestern Italy (Tedeschi et al ., 2002). On the contrary, Mattedi et al . (2005) reported a low efficiency of AP transmission by C. melanoneura , and no transmission was observed in studies in Germany (Jarausch, 2003; Jarausch-Wehrheim et al. , 2005). The biology of C. melanoneura in the apple orchards of Trentino has been studied in detail (Mattedi et al. , 2007; 2008). The presence of this species on apple is mainly limited to bottom valley environments. Overwintering adults migrate into apple orchards between the end of January and February. Oviposition begins between the end of February and the beginning of March and this activity lasts about 30-40 days. The first neanids appear at the end of March and the new generation of adults emerges at the end of April. As the adults develop, they migrate to other shelter plants and disappear from the orchard before the end of June. During the same period, C. melanoneura is also found on hawthorn (Ossiannilsson, 1992) and high population densities have been reported on hawthorn in some locations (Pedrazzoli et al. , 2005). Recently, experiments conducted in northwestern Italy found that some C. melanoneura collected from hawthorn carried AP-group phytoplasma (Tedeschi et al. , 2005). Besides hawthorn and apple, C. melanoneura has also been found on other plants, particularly on conifers, on which the new generation of adults is thought to overwinter (Conci et al. , 1992; Ossiannilsson, 1992; Lauterer, 1999). To date, several studies have been conducted on the overwintering habits of this species in Trentino (Pedrazzoli et al. , 2005; Mat- tedi et al. , 2007). A regular presence has been found on conifers [ Picea abies (L.) Karsten and Pinus spp.] in only a few high-altitude locations (Pedrazzoli et al. , 2005). As the studies conducted to date have assigned different roles to C. melanoneura in the transmission of ‘ Ca. Phytoplasma mali’, it is possible that different populations, character- ized by a different level of infectivity, exist. To examine these differences thoroughly, we performed molecular analyses of overwintered C. melanoneura collected from different plant species (apple, hawthorn and conifers) in several areas of Italy and France. In the present work, we report the results of these investigations, underlining the correlation between the infection level in the different plants and in the insects.

135 Materials and methods

Insect collection The research was conducted in the Trentino and Veneto regions (northeastern Italy), the Aosta Valley (northwestern Italy) and France between 2005 and 2007, as reported in Table 1. Overwintering adults of C. melanoneura were collected from apple trees and hawthorn bushes at the end of March and from conifers during December and January, using the beat tray method. The specimens were identified using Ossiannilsson’s keys (1992).

Molecular analyses Individual specimens were frozen, lyophilized, homogenized, and then stored at -80°C until their DNA could be extracted. Total genomic DNA was extracted from the samples following the CTAB (cetyltrimethylammonium bromide) method (Doyle and Dolyle, 1990).

Phytoplasma quantification. The large populations of C. melanoneura collected from apple in Borgo (TN-Italy) (up to 10 individuals/branch) allowed for the thorough investigation of the presence of phytoplasma in individual insects. The total genomic DNA from 940 insects was purified as described above and all of the individual DNA samples were PCR- analyzed. In the samples which tested positive for the presence of the phytoplasma, the absolute phytoplasma titer was then quantified using real-time PCR, following the method based on SYBR TM Green I developed by Jarausch et al. (2004). The non-ribosomal DNA fragment of ‘ Ca. P. mali’ amplified by the AP-specific primer pair AP3/AP4 (Jarausch et al. , 1994) served as the reaction target. Reactions were carried out in a total volume of 20 µl containing 10-100 ng of template DNA, 2x Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and 300 nM of each primer. Amplification and detection were performed using the DNA Engine Opticon fluorescence detection system (MJ Research, Waltham, MA, USA). Cycle conditions for real-time PCR were: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 15 s at 95°C, 30 s at 57°C and 30 s at 67°C. After the run, a melting curve analysis from 50°C to 90°C was performed. For each sample, two replications were run and the mean copy number was calculated. Two replications of a reagent blank were used as negative controls in each experiment. The phytoplasma titer in the samples was derived by extrapolating from a standard curve, based on serial 10-fold dilutions (from 10 8 copies/µl to 10 1 copies/µl) of the target sequence, cloned

136 into the plasmid vector pUC1196 (Jarausch et al ., 2004). To prepare the standard curve, the plasmid was purified from E. coli cells by standard methods (Sambrook and Russell, 2001) and the concentration of the extracted DNA was measured using the BioPhotometer photometer (Eppendorf, Hamburg, Germany). The total DNA extracted from AP-negative insects was serially diluted from the plasmid stock solution.

Phytoplasma detection. To assess the presence of ‘ Ca . P. mali’, all of the collected insects were subjected to PCR amplification of a non-ribosomal DNA region of 162 bp with the specific primers AP3/AP4 (Jarausch et al. , 1994). The PCR assays were performed with 100-150 ng DNA, 0.375 µM of each primer and the 2x Go Taq® Green Master Mix (Promega, Madison, USA), in a final reaction volume of 20 µl. The PCR parameters were as follows: an initial denaturation of 2 min at 95°C and 40 cycles with 30 sec at 95°C, 30 sec at 57°C, 30 sec at 72°C and a final extension of 5 min at 72°C. Amplifications were performed in a Gene Amp® PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The total DNA extracted from infected insects and a reagent blank were included in the experiments as controls. PCR products were analyzed by electrophoresis on 1.5% w/v agarose gels stained with SYBR® Safe DNA gel stain (Invitrogen, Carlsbad, CA, USA) and visualized under UV light with the Gel Doc XR System molecular imager (BIO-RAD, Hercules, CA, USA; Fig. 1).

Data analysis Combining the data obtained for the same individuals in the qPCR and in the estimation of the band thickness and brightness on agarose gel, three infection classes were obtained: not infected (negatived samples), low (titres below 10 6 copies/insect) and highly infected (above 10 6 copies/insect). For each population, the proportion of individuals belonging to each class was calculated. To test the relationships between the frequencies of the class infection and population, data were analyzed using a log-linear model with a Likelihood ratio χ2 test (α = 0.05) considering the total number of insect analyzed per site as offset variable (Agresti, 2002) with the GENMOD procedure of SAS (SAS Institute, 1999). Due to the presence of cells with zero count, a small constant (0.5) was added to cell counts to ensure convergence of fitting algorithms (Agresti, 2002). A pairwise Wald χ2 test ( α = 0.05) on the differences between the least-squares means of each infection class estimated for the different populations was performed using the DIFF option in the LSMEAN statement (SAS In-

137 stitute, 1999). Sampled areas were classed according to the estimated percentage of symptomatic plants: low, middle, high and very high. The correlation between the proportion of infected insects and the presence of symptomatic plants in apple orchards was analysed applying the median test for the correlation between two variables proposed by Blomqvist (1951). This analysis was not carried out for the other plant species, as no symptoms were detected on hawthorn and conifers.

Results Among the 940 insects sampled in Borgo, 90 were AP-infected (9.6%). This percentage is consistent with the natural infection rate observed among the 96 individuals previously analyzed. Real-time PCR analysis revealed a mean titer of 9.60 × 10 6 ± 2.11 × 10 6 (S.E.) copies of phytoplasma/insect, with 18.99% of individuals in the range of 10 5-10 6 copies/ind., 53.16% in the range of 10 6-10 7 copies/ind. and 27.85% of individuals with more than 10 7 copies/ind. The results of PCR amplifications performed on the different C. melanoneura populations are reported in Table 2, where the percentages of infected individuals and the mean infection levels are listed for each population. The analysis evidenced significant differences in the incidence of the infection among all populations (Likelihood ratio χ2 = 116.95; df = 28; p < 0.0001). Considering the different classes separately, only the low infected classes showed differences among populations. Regarding populations collected from apple in Trentino, data showed differences in the percentage of AP-infected psyllids, which ranged from 3% (Vervò) to 24% (Oltrecastello), even if only Oltrecastello population is significantly different from the others in the low infected class (Table 2).. Few AP-infected psyllids were found among populations collected from hawthorn and none of the examined hawthorn hedgerows ever showed disease symptoms or tested positive for the presence of the pathogen (unpublished data). A relatively large number of AP-positive insects were collected in the Aosta Valley, from both apple (18.63%) and hawthorn (15%). No significant differences emerged between the apple population of Aosta Valley and apple populations of Trentino. Similar results were obtained as regarding hawthorn populations in the comparison of Aosta Valley and Trentino (Table 2). PCR amplification revealed no infected insects among the psyllids

138 collected in two different areas in the Veneto region. Eight to 13% of the psyllids collected on conifers in northeastern Italy were infected; whereas none of those collected in France tested positive for AP phytoplasma (Table 2). Considering the low infected class, insects collected on conifers were comparable with psyllids collected on apple in Trentino and Aosta Valley (Table 2). A positive correlation was found between the proportion of AP-infected psyllids and the infection level of the apple orchards were captures took place (P=0.0143; Fig. 2).

Discussion The present work provides evidence that the overwintering populations of C. melanoneura in northern Italy can carry ‘ Ca. P. mali’, since the PCR analyses revealed the presence of AP-infected psyllids. Moreover, the detection of ‘ Ca. P. mali’ in psyllids collected from conifers during the winter demonstrates that the phytoplasma overwinters in the bodies of this insect vector, as suggested by Tedeschi et al. (2003). These results are consistent with the behavior of other psyllid vectors of phytoplasma, such as C. pyricola and C. pyri which may retain infectivity during the winter season (Davies et al. , 1998; Carraro et al. , 2001). Data collected during this project suggest that some overwintering C. melanoneura adults are already infected, even in high percentages, with ‘ Ca . P. mali’ when they come back to the apple orchards. However, psyllids could also acquire the phytoplasma after a period of feeding on infected trees. Psyllids were collected in the Trentino region at the peak of overwintering adults, when the population densities are the highest, so that they had spent a few weeks of feeding on highly infected apple trees. A period of four days is sufficient for C. melanoneura to acquire AP phytoplasma (Pedrazzoli et al. , 2007). At the end of March, when captures took place, ‘ Ca. P. mali’ is present in the aerial part of apple trees with an uneven distribution which in some cases reaches high concentration levels (Pedraz- zoli et al. , 2008a). Among Trentino populations collected from apple the percentages of infected psyllids are variable; the mean proportion of AP-positive insects (10.84%) among overwintering psyllids collected in 2006 on apple was comparable to the rates already reported for overwintering C. melanoneura adults in the Trentino region (Pedrazzoli et al. ,

139 2008b). The highest infection levels for Trentino populations are comparable to that of Aosta Valley population. In both cases, psyllids were collected in orchards with highly symptomatic apple trees. On the other hand, lower infection rates were detected in populations collected in low symptomatic plantations; moreover, in the Veneto region there was no evidence of AP-infected psyllids, but there were also few AP-symptomatic apple trees (data not shown). These data suggest a positive correlation between the infection rates in plants and insects, which was confirmed also by the statistical analysis. As a consequence, the uprooting of diseased trees seems to be a useful phytosanitary measure to reduce the inoculum source. Regarding the level of infection among the psyllids collected on hawthorn, the percentages obtained for the Trentino region (mean value 1.75%) are lower than that for the Aosta Valley (15.1%), even though no significant differences were found among data. The pro- portions of infected psyllids reported in this study for populations from Aosta Valley are similar in individuals collected on both hosts. This result is consistent with preliminary ecological observations carried out in northwestern Italy, indicating that the populations of C. melanoneura collected from apple can survive and reproduce also on hawthorn, while C. melanoneura collected from hawthorn seems to be more selective (R. Tedeschi, personal communication). A certain exchange in the populations could therefore take place, resulting in a more homogeneous infection level in the insects. The populations of Trentino, on the contrary, are more linked to their original host plants, showing a significant reduced fitness when moved onto the alternative host plant (Malagnini et al. , in preparation), and this could reflect also the different percentages of infected individuals for the two plant species in this region. The infection rates observed in this survey for the populations collected from apple and hawthorn in Aosta Valley are higher than those previously reported for the same region (Tedeschi et al . 2003; 2008; Tedeschi and Alma, 2007). These different data could reflect the use of different primers (AP3/AP4 vs. P1/P7, followed by nested PCR with fO1/rO1 primers) in the molecular analyses and/or the different number of psyllids analyzed (Tedeschi et al. , 2003; Tedeschi and Alma, 2007), the size of the sampled populations or the period of collection and the infection levels of the plants.

140 The quantity of phytoplasma, as estimated on agarose gel, was generally lower in the psyllids collected in Trentino than in the psyllids collected in the Aosta Valley, with the exception of the population of Borgo and Oltrecastello. The agarose gel estimation suggested the presence of quite high titers of ‘ Ca. P. mali’ in these populations, comparable to those found in the Aosta Valley population. These results were also confirmed by the real-time PCR analysis for Borgo population. The results obtained in this work suggest the presence of a high variability in the infection level within the different populations of C. melanoneura in northern Italy and even within the Trentino region. These differences could depend on the affinity between the phytoplasma and the insects, due to the presence of various ‘ Ca. P. mali’ strains (AT-2 is predominant in Trentino, while AT-1 is more widespread in Aosta Valley), or to the characteristics of the psyllid populations (Cainelli, 2007; Malagnini et al. , 2008). Furthermore, the differences in the natural infection rates could explain the differences observed in previous transmission trials carried out in Aosta Valley and Trentino regions (Tedeschi and Alma, 2004; Mattedi et al. , 2005; 2007; 2008). This hypothesis is also supported by data obtained in Germany where C. melanoneura never transmitted the phytoplasma ‘ Ca. P. mali’ (Jarausch et al. , 2004); in this region overwintering adults of C. melanoneura collected in apple orchards show a very low infection rate (Jarausch et al. , 2008). Further studies of transmission efficiency should take into account these differences among populations of C. melanoneura .

Acknowledgements The authors thank Dr. R. Tedeschi (University of Turin, Italy), Phytosanitary Service of the Veneto Region (Italy), as well as Dr. N. Sauvion and Dr. G. Labonne (INRA, Montpellier, France) for the insects. This research was financed by the Province of Trento.

141 References Agresti A. (2002) Categorical Data Analysis , 2nd edition, (Wiley Interscience ed.) pp. 734. Blomqvist N. (1950) On a measure of dependence two random variables. The Annals of Mathematical Statistics, 21 , 593-600. Cainelli C. (2007) Population dynamics of apple proliferation in Trentino . 171 pp. Ph.D. Thesis, Università degli Studi di Verona (Italy). Carraro L., Loi N., Emarcora P. (2001) The ‘life cycle’ of pear decline phytoplasma in the vector Cacospylla pyri. Journal of Plant Pathology , 83 , 87-90. Conci C., Rapisarda C., Tamanini L. (1992) First Part ( Insecta Homoptera ). In Annotated Catalogue of the Italian Psylloidea , a. 242, ser. VII, vol. 2, B, pp. 33-135. Calliano (TN), Italy: Atti Accademia Roveretana degli Agiati. Davies D.L., Clarck M.F., Adams A.N. (1998) The epidemiology of pear decline in the UK. Acta Horticulturae , 472 , 669-672. Doyle J.J., Doyle J.L. (1990) Isolation of plant DNA from fresh tissue. Focus , 12 (1), 13-15. Jarausch B. (2003) Welche Rollen spielen Blattsaugerarten bei der Übertragung von Apfel- triebsucht-Phytoplasmen in deutschen Apfelanlagen? Obstbau , 4, 205-206. Jarausch B., Fuchs A., Schwind N., Jarausch W. (2008) Efficenza di trasmissione delle psille: l’esperiena in Germania. In Scopazzi del melo , pp. 127-135. Eds C. Ioriatti, W. Ja- rausch. Trento, Italy: Fondazione Edmund Mach. Jarausch W., Peccerella T., Schwind N., Jarausch B., Krczal G. (2004) Establishment of a quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta Horticulturae , 657 , 415-420. Jarausch W., Saillard C., Dosba F., Bové J.M. (1994) Differentiation of mycoplasma-like organism (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO. Applied and Environmental Microbiology , 60 (8), 2916-2923. Jarausch-Wehrheim B., Schwind N., Jarausch W., Peccerella T., Krczal G. (2005) Identifi- cazione di Cacopsylla picta (syn. Cacopsylla costalis ) come vettore del fitoplasma apple proliferation in Germania. Petria , 15 (1/2), 43-45.

142 Lauterer P. (1999) Results of investigations on Hemiptera in Moravia made by Moravian Museum (Psylloidea 2). Acta Musei Moraviae, Scientae Biologicae (Brno), 84 , 71- 151. Mattedi L., Forno F., Cainelli C., Grando M.S. (2005) Research of possible vectors of apple proliferation in Trentino (abstract). Proceedings of the Workshop: 3 rd National Meet- ing on Phytoplasma Disease. Petria , 15 , 39-41. Mattedi L., Forno F., Cainelli C., Grando M.S., Jarausch, W. (2008) Research on Candida- tus Phytoplasma mali transmission by insect vectors in Trentino. Acta Horticulturae, 781 , 369-374. Mattedi L., Forno F., Varner M. (2007) Scopazzi del melo. In Conoscenze ed osservazioni di campo , p. 144. Bolzano, Italy: Arti Grafiche La Commerciale - Borgogno. Ossiannilsson F. (1992) The Psylloidea (Homoptera) of Fennoscandia and Denmark. In Fauna Entomologica Scandinavica , vol. 26, p. 346. Eds N. P. Kristensen, V. Michel- sen. Leiden, The Netherlands: E.J. Brill. Pedrazzoli F., Ciccotti A.M., Bianchedi P.L., Salvadori A., Zorer R. (2008a) Seasonal colonisation behaviour of Candidatus Phytoplasma mali in apple trees in Trentino. Acta Horticulturae , 781 , 483-488. Pedrazzoli F., Forno F., Mattedi L., Cainelli C., Branz A., Gualandri V., Malagnini V., Bragagna, P., Deromedi M., Filippi M., Ciccotti A.M., Zasso R., Grando M.S., Ioriatti C., Jarausch W. (2008b) Vettori presenti in Trentino e loro efficienza di trasmissione. In Scopazzi del melo , pp. 106-126. Eds C. Ioriatti, W. Jarausch. Trento, Italy: Fonda- zione Edmund Mach. Pedrazzoli F., Forno F., Malagnini V., Mattedi L. (2005) Indagini bioecologiche su Cacop- sylla melanoneura (Förster) (Homoptera: Psyllidae). XX Congresso Nazionale Italiano di Entomologia. 13-18 Giugno 2005, pp. 251. Pedrazzoli F., Gualandri V., Forno F., Mattedi L., Malagnini V., Salvadori A.., Stoppa G., Ioriatti C. (2007) Acquisition capacities of the overwintering adults of the psyllid vectors of ‘ Candidatus Phytoplasma mali’. Bulletin of Insectology 60 (2), 195-196. Rui D. (1950) Una malattia inedita: la virosi a scopazzi del melo. Humus , 6(11), 7-10.

143 Sambrook J., Russell D.W. (2001) Preparation of plasmid DNA by alkaline lysis with SDS: Minipreparation. Molecular Cloning - a laboratory manual , vol. 1, pp.1.32-1.34; vol. 3, p. A1.16. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press. SAS Institute, Inc., 1999.: SAS/STAT User’s Guide, Version 8. SAS Institute, Inc., Cary, NC

Seemüller E., Schneider B. (2004) ‘ Candidatus Phytoplasma mali’, ‘ Candidatus Phyto- plasma pyri’ and ‘ Candidatus Phytoplasma prunorum’, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology, 54 , 1217-1226. Tedeschi R., Alma A. (2007) ‘ Candidatus Phytoplasma mali’: the current situation of insect vectors in northwestern Italy. Bulletin of Insectology 60 (2), 187-188. Tedeschi R., Alma A. (2004) Transmission of apple proliferation phytoplasma by Cacop- sylla melanoneura (Homoptera: Psyllidae). Journal of Economic Entomology 97 (1), 8- 13. Tedeschi R., Bertignolo L., Alma A. (2005) Role of the hawthorn psyllid fauna in relation to the apple proliferation disease. Petria, 15 , 47-49. Tedeschi R., Bosco D., Alma A. (2002) Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in northwestern Italy. Journal of Economic Entomology , 95 , 544-551. Tedeschi R., Lauterer P., Brusetti L., Tota F., Alma A Composition, abundance and phytoplasma infection in the hawthorn psyllid fauna of northwestern Italy. European Jour- nal of Plant Pathology , On-line first: 2 September 2008. DOI: 10.1007/s10658-008- 9367-1. Tedeschi R., Visentin C., Alma A., Bosco D. (2003) Epidemiology of apple proliferation (AP) in northwestern Italy: Evaluation of the frequency of AP-positive psyllids in naturally infected populations of Cacopsylla melanoneura (Homoptera: Psyllideae). Annals of Applied Biology , 142 , 285-290. Vindimian E., Delaiti L. (1996) Indagine sistematica sugli scopazzi del melo. Terra trentina , 13 (11), 30-33.

144

Table 1 - Samples of Cacopsylla melanoneura populations collected from different host plants at different locations. HOST SAMPLE COUNTRY LOCALITY LOCATION PLANT SIZE 46°3’N Borgo (Trentino) 96 11°29’E 46°4'N Oltrecastello (Trentino) 113 11°9'E 46°11'N S. Michele (Trentino) 96 11°8'E 46°18'N Vervò (Trentino) 90 11°7'E Apple Italy 46°4’N Vigalzano (Trentino) 96 11°14’E 45°44'N Aosta (Aosta Valley) 59 7°18'E 45°42’N Schio (Veneto) 12 11°24’E 45°39’N Brentino Belluno (Veneto) 15 10°53’E 46°21'N Cles (Trentino) 96 11°2'E 46°11'N Mezzolombardo (Trentino) 63 11°6'E Hawthorn Italy 46°26'N Rumo (Trentino) 44 11°1'E 45°44'N Chambave(Val d'Aosta) 53 7°33'E 46°4’N Sopramonte (Trentino) 49 11°4’E Italy 46°2’N Conifers Vason (Trentino) 38 11°3’E 44°5'N France L'Espérou 20 3°32'E

145 Table 2 - Proportion of AP-infected psyllids collected from different host plants in different localities. Different letters mean significant differences to Wald χ2 test ( α = 0.05).

INSECTS INFECTION LEVEL OF LOCALITY infection % not infected low infected highly infected SAMPLED AREA Borgo (Trentino) 11.46% 88.54% a 6.25% b 5.21% a very high

Oltrecastello (Trentino) 23.87% 76.13% a 16.80% a 7.07% a high

S. Michele (Trentino) 5.14% 94.86% a 4.10% b 1.04% a middle

Vervò (Trentino) 3.33% 96.67% a 3.33% b 0.00% a middle

Vigalzano (Trentino) 10.42% 89.58% a 10.42% ab 0.00% a high

Aosta (Val d'Aosta) 18.63% 81.37% a 13.55% ab 5.08% a very high

Schio (Veneto) 0.00% 100.00% a 0.00% c 0.00% a low

Verona (Veneto) 0.00% 100.00% a 0.00% c 0.00% a low

Cles (Trentino) 2.08% 97.92% a 2.08% bc 0.00% a no

Mezzolombardo (Trentino) 3.17% 96.83% a 3.17% bc 0.00% a no

Rumo (Trentino) 0.00% 100.00% a 0.00% c 0.00% a no

Chambave(Val d'Aosta) 15.10% 84.90% a 7.55% b 7.55% a no

Sopramonte (Trentino) 8.16% 91.84% a 6.12% b 2.04% a no

Vason (Trentino) 13.15% 86.85% a 7.89% a 5.26% a no

L'Espérou (France) 0.00% 100.00% a 0.00% c 0.00% a no

146 ←162 bp

Ld high high neg. neg. low low high high high high high Ld Figure 1 - Agarose gel electrophoresis of PCR amplifications with primer pair AP3/AP4. Ld = molecular size marker (100 bp DNA Ladder, New England Biolabs, Inc., Beverly, MA, USA); high = high titer; low = low titer; neg. = negative sample.

10 % of infectedof% insects 5

0 0 1 2 3 4 class

Figure 2 - Scatter diagram of the observed infection percentage in the insect populations and the corresponding infection level in the orchards (1= low infection, 2= middle infection, 3= high infection, 4= very high infection). The broken lines indicate the sample medi- ans of the values.

147

Chapter 4

A preliminary study of the effects of ‘ Candidatus Phytoplasma mali’ on the psyllid Cacopsylla melanoneura (Hemiptera: Psyllidae)

Short note submitted to Journal of Invertebrate Pathology

Valeria Malagnini a* , Federico Pedrazzoli a, Valeria Gualandri a, Flavia Forno a, Rosaly Zass a, Alberto Pozzebon b, Claudio Ioriatti a a FEM-IASMA Research Centre, Plant Protection Department, via E. Mach, 1 - 38010 San Michele all’Adige (TN) – Italy; b University of Padua, Department of Environmental Agronomy and Crop Science, viale dell’Università, 16 – 35020 Legnaro (PD) – Italy

* Corresponding author: Valeria Malagnini FEM-IASMA Research Centre, Plant Protec- tion Department, via E. Mach, 1 – 38010 San Michele all’Adige (TN) – Italy; tel. 00390461615510; e-mail: [email protected]

149 Abstract: Cacopsylla melanoneura is a univoltine psyllid vector of ‘ Candidatus Phyto- plasma mali’, the etiological agent of apple proliferation (AP), a severe disease in European apple orchards. The influence of ‘ Ca. P. mali’ on the fitness of C. melanoneura was studied. In the spring of 2007, male-female pairs of field-collected adults were exposed to ‘ Ca. P. mali’-infected or healthy ‘Golden Delicious’ apple shoots. Exposure to these diseased shoots did not affect the life span of the adult psyllids. However, significantly fewer eggs were laid on the diseased shoots. Furthermore, fewer of the eggs that were laid on the infected plants hatched. Data suggest a detrimental effect of AP phytoplasma on the fitness of C. melanoneura .

Key words : apple proliferation disease, apple psyllids, Golden Delicious

Introduction Phytoplasmas and their vectors interact in various ways, ranging from the beneficial to the deleterious (Severin, 1946, Beanland et al., 2000). Survival and fecundity are often the main parameters in studies of vector-mollicute interactions (Weintraub and Beanland, 2006). Data on changes in the life span and fecundity of vectors are available for a few strains of phytoplasma belonging to the X-disease (‘Ca. P. pruni’) and the aster yellows (‘Ca. P. asteris’) groups, as well as for Spiroplasma spp. (Jensen, 1959; Madden and Nault, 1983; Garcia-Salazar et al ., 1991; Ebbert and Nault, 2001). In general, pathogens and hosts evolve toward less deleterious interactions, such as reduced pathogenicity, which can be compensated for by more efficient transmission (Purcell, 1982). Phytoplasma infection can make infected plants more suitable hosts for insects, by reducing their chemical defenses or increasing the availablity of nutrients (Weintraub and Beanland, 2006). Consequently, infected plants are more attractive to insects (Todd et al., 1990). Very little is known about the effects of phytoplasmas on the psyllid genus Cacopsylla (Hemiptera: Psyllidae), which is involved in the transmission of phytoplasmas belonging to the apple proliferation (AP) group.

150 This study investigated the interaction between ‘ Candidatus Phytoplasma mali’, the etiological agent of AP disease, and Cacopsylla melanoneura Förster, which is vector of this disease in northwestern Italy (Tedeschi et al., 2002). In particular, we studied the effects of ‘ Ca. P. mali’on the longevity of overwintered adults, the amount of egg laying, the rate of egg hatching and the timing of juvenile developmental stages.

Materials and methods

Phytoplasma and plants The apple shoots used in our assays were collected from two-year-old ‘Ca. P. mali’- infected or healthy ‘Golden Delicious’ apple trees, which were grown from micropropagated material, as described by Ciccotti et al. (2003). The diseased plants from which we collected shoots were infected with strain AT-2 of ‘ Ca. P. mali’, which is the most widespread strain of this pathogen in Trentino, Italy (Cainelli, 2007). Potted plants were also infected with the same strain.

Bioassay The effect of AP disease on C. melanoneura was studied by evaluating the survival and reproductive performance of overwintered females. Sweep netting was used to collect insects from an apple orchard in Trentino (northeastern Italy) in late March 2007. Male and female insects were paired up and placed on healthy or AP-infected shoots. Each shoot was placed in a glass tube (3 per 16 cm), inserted into a green sponge soaked with MS nutritive solution (Murashige and Skoog, 1962), and kept in a growth chamber with a controlled temperature and photoperiod (20°C, 16L:8D). Ten C. melanoneura couples were used for each treatment. Insects were gently transferred to a new shoots every two to three days using a thin paint brush. We recorded data on adult survival, the number of eggs laid and the hatching rate. To evaluate survival to adulthood, second instar nymphs produced by females that had fed on diseased or healthy shoots were moved onto potted apple plants. The nymphs were confined within cylindrical Plexiglass vessels (27 per 10.5 cm) and kept under the conditions described above until adult emergence.

151 Data analysis Data on the survival of the female insects were analyzed using a pair-wise Wilcoxon χ2 test ( α = 0.05). Oviposition data were analyzed by fitting the cumulative number of eggs laid during the experiment to a generalized linear model with a Poisson distribution and a log-link function. Data on egg hatching (number of immature insects/number of eggs) and survival to adulthood (number of adults/number of eggs) were analyzed by applying a binomial model with a logit-link function. The Wald chi-square test ( α = 0.05) was used to evaluate the effects of AP infection on oviposition and egg hatching.

Results and discussion No significant differences were observed between the survival of C. melanoneura adults reared on AP-infected shoots and those reared on healthy shoots (Wilcoxon χ2 = 0.012; df = 1; P = 0.998). The mean life spans were 10.6 and 9.5 days on healthy and AP-infected shoots, respectively. More eggs were laid on the healthy shoots (12.74 eggs/day/female) than on the AP-infected shoots (7.7 eggs/day/female; χ2 = 4.67; df = 1; p = 0.03). The rate of egg hatching was significantly higher on healthy shoots (93%) than on AP-infected shoots (64%; χ2 = 18.32; df = 1; p < 0.001). In contrast, the survival of nymphs and their development to adulthood were similar in both treatments ( χ2 = 0.08; df = 1; p = 0.78). This is the first study to investigate the effect of ‘ Ca . P. mali’ on C. melanoneura . Our findings suggest that exposure of C. melanoneura to ‘ Ca . Phytoplasma mali’ reduces its fecundity and egg hatching rate, thus diminishing the fitness of the vector. Nevertheless, the phytoplasma does not influence the longevity of overwintering adults or the development of their offspring. Similar effects of AP phytoplasma on the number of eggs laid by overwintering females were observed in a previous study (Malagnini et al., 2006). These data indicate a deleterious relation between AP phytoplasma and C. melanoneura , which may be an effect of recent co-evolution (Purcell, 1982). Reduced fitness has been previously described in other vector- phytoplasma associations. For instance, Flavescence dorée phytoplasma (‘ Ca . P. vitis’) was shown to decrease the fitness of its specific leafhopper vector Scaphoideus titanus Ball, as well as that of Euscelidius variegatus Kirschbaum, an experimental vector (Bressan et al., 2005a, b).

152 It is difficult to separate the effects of the phytoplasma on the food quality of the plant host from its direct effects on the insect vector (Christensen et al ., 2005; Weintraub and Beanland, 2006). It has been reported that the presence of phytoplasmas may increase the attractiveness of plants to vectors (Todd et al., 1990). Mayer et al. (2008) conducted studies concerning the attractiveness of AP-infected and uninfected apple plants to C. picta (Förster), the other reported psyllid vector of this disease (Frisinghelli et al., 2000). These studies found that AP phytoplasma affects both the odor of infected plants and the behavior of vector insects in ways that promote its own propagation. We suggest that the reduced fitness of C. melanoneura on AP-infected apple shoots is due to a direct effect of the phytoplasma. The longevity of overwintering adults on infected plants (9.5 days on average) is sufficient for the acquisition of ‘ Ca. P. mali’ (Pedrazzoli et al., 2007). After a four-day acquisition period, more than 90% of insects tested positive for AP phytoplasma (Pedrazzoli, unpublished data).

Acknowledgements The authors thank Dr. A. M. Ciccotti, I. Battocletti and M. Deromedi for the micropropagated plant material and L. Mattedi for suggestions regarding the insects. This research was financed by the Province of Trento.

References Beanland, L., Hoy, C.W., Miller, S.A., Nault, L.R., 2000. Influence of aster yellows phytoplasma on the fitness of the aster leafhopper (Homoptera: Cicadellidae). Ann. Entomol. Soc. Am. 93, 271-276. Bressan, A. Clair, D., Sémétey, O., Boudon-Padieu, É., 2005a. Effect of two strains of Flavescence dorée phytoplasma on the survival and fecundity of the experimental leafhopper vector Euscelidius variegatus Kirschbaum. J. Invertebr. Pathol. 89, 144-149.

153 Bressan, A., Girolami, V., Boudon-Padieu, É., 2005b. Reduced fitness of the leafhopper vector Scaphoideus titanus exposed to Flavescence dorée phytoplasma. Entomol. Exp. Appl. 115, 283-290. Cainelli, C., 2007. Population dynamics of apple proliferation in Trentino. Ph.D. Thesis, Università degli Studi di Verona (Italy), p. 171. Christensen, N.M., Axelsen, K.B., Nicolaisen, M., Schulz, A., 2005. Phytoplasmas and their interactions with hosts. Trends Plant Sci. 10, 526-535. Ciccotti, A.M., Gatto, P., Vindimian, M.E., 2003. Differente comportamento in vitro ed ex vitro di due cultivar di melo micropropagate infettate con fitoplasma AP (Apple Proliferation). Petria 13(3), 165-172. Ebbert, M.A., Nault, L.R., 2001. Survival in Dalbulus leafhopper vectors improves after exposure to maize stunting pathogens. Entomol. Exp. Appl. 100, 311-324. Frisinghelli, C., Delaiti, L., Grando, M.S., Forti, D., Vindimian, M.E., 2000. Cacopsylla costalis (Flor 1861), as a vector of apple proliferation in Trentino. J. Phytopathol. 148, 425-431. Garcia-Salazar, C., Whalon, M.E., Rahardja, U., 1991. Temperature-dependent pathogenicity of the X-Disease mycoplasma-like organism to its vector: Paraphlepsius irroratus (Homoptera: Cicadellidae). Environ. Entomol. 20, 179-184. Jensen, D.D., 1959. A plant virus lethal to its insect vector. Virology 8, 249-260. Madden, L.V., Nault, L.R., 1983. Differential pathogenicity of corn stunting mollicutes to leafhopper vectors in Dalbulus and Baldulus species. Phytopathology 73, 1608-1614. Malagnini, V., Cainelli, C., Pedrazzoli, F., Ioriatti, C., 2006. Population diversity within Cacopsylla melanoneura (Förster) based on ecological and molecular studies. In: Proceedings of the VIIIth European Congress of Entomology. 17-22 September 2006. Mayer, C.J., Vilcinskas, A., Gross J., 2008. Phytopathogen lures its insect vector by altering host plant odor. J. Chem. Ecol. 34, 1045-1049. Murashige, T., Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco culture. Physiol. Plant. 15, 473-497. Pedrazzoli, F., Gualandri, V., Forno, F., Mattedi, L., Malagnini, V., Salvadori, A., Stoppa, G., Ioriatti, C., 2007. Acquisition capacities of the overwintering adults of the psyllid vectors of ‘ Candidatus Phytoplasma mali’. Bull. Insectol. 60(2), 195-196.

154 Purcell, H.A., 1982. Insect vector relationships with prokaryotic plant pathogens. Annu. Rev. Phytopathol. 20, 397-417. Severin, H.H.P., 1946. Longevity, or life histories, of leafhopper species on virus-infected and on healthy plants. Hilgardia 17, 121-133. Tedeschi, R., Bosco, D., Alma, A., 2002. Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in northwestern Italy. J. Econ. Entomol. 95, 544-551. Todd, J.L., Harris, M.O., Nault, L.R., 1990: Importance of color stimuli in host-finding by Dalbulus leafhoppers. Ent. Exp. Appl. 54, 245-250. Weintraub, P.G., Beanland, L., 2006. Insect vectors of phytoplasmas. Annu. Rev. Entomol. 51: 91-111.

180 160

140 120 100

80 N° eggs 60 40 healthy apple 20 AP-infected apple 0 0 5 10 15 20 25 30 Days

Figure 1 - Mean cumulative numbers (untransformed data) of eggs laid by C. melanoneura on healthy and infected apple shoots.

155

1.2 * 1 * 0.8

0.6 Rate 0.4

0.2

0 healthy apple AP-infected apple healthy apple AP-infected apple Egg hatching Survival to adulthood

Figure 2 - Egg-hatching rates and survival rates for the larval instars of C. melanoneura on the two types of host plants (mean values ± SE). Asterisks indicate significant differences according to the Wald chi-square test ( α = 0.05).

156

Chapter 5

157

158

159

Chapter 6

Differences in populations of Cacopsylla melanoneura (Hemiptera, Psyllidae): insights from ecological and molecular studies

Manuscript for Molecular Ecology

Valeria Malagnini 1, Federico Pedrazzoli 1, Chiara Papetti 2, Christian Cainelli 1, Rosaly Zas- so 1, Valeria Gualandri 1, Alberto Pozzebon 3, Claudio Ioriatti 1

1FEM-IASMA Research Centre, Plant Protection Department, via E. Mach 1, 38010 San Michele all’Adige (TN), Italy 2Department of Biology, University of Padua, via U. Bassi 58/b, 35131 Padova, Italy 3Department of Environmental Agronomy and Crop Science, University of Padua, viale dell’Università, 35020 Legnaro (PD), Italy

Corresponding author: Valeria Malagnini FEM-IASMA Research Centre, Plant Protec- tion Department, via E. Mach, 1 – 38010 San Michele all’Adige (TN) – Italy; tel. 00390461615510; e-mail: [email protected]

Running title: Differences among C. melanoneura populations

161

Abstract: The psyllid Cacopsylla melanoneura (Förster) is one of the vectors of ‘ Candida- tus Phytoplasma mali’, the causal agent of apple proliferation disease. In Northern Italy, overwintering adults of C. melanoneura can be found on both apple and hawthorn from the end of January to mid-June. The present research aims to assess behavioural differences and/or genetic variation between populations of C. melanoneura collected from two different host plants ( Malus domestica , Crataegus monogyna ). This study found that the two examined populations of C. melanoneura both perform better on their primary host species, in terms of oviposition and the optimal development of their offspring. The genetic variability of the populations was studied using microsatellite primers developed for C. melanoneura and DNA sequences from the mitochondrial cytochrome oxidase subunit I. Data obtained from microsatellite analyses indicate a low, but statistically significant difference between the collected-from apple and collected-from hawthorn populations. Mitochondrial DNA diversity was low with no evidence for population differentiation among the above mentioned groups. Furthermore, a genetic boundary was found separating the Aosta Valley populations. Behavioural and genetic results indicate a differentiation among C. melanoneura populations linked to the host plants.

Keywords : apple proliferation disease; psyllid; microsatellites; mitochondrial sequences

162

Introduction The agronomic importance of the Hemiptera genus Cacopsylla is due to the role played by several species in the transmission of phytoplasma diseases belonging to the apple proliferation cluster, including ‘ Candidatus Phytoplasma mali’, ‘ Ca . Phytoplasma pyri’ and ‘Ca . Phytoplasma prunorum’ (Seemüller & Schneider 2004). Phytoplasmas, previously termed mycoplasma-like organisms (MLOs), have been associated with diseases in several hundreds of plant species (McCoy et al. 1989). These pathogens are non helical, wall-less bacteria that morphologically resemble mycoplasmas (Doi et al. 1967) and inhabit the phloem sieve elements of infected plants and specific districts (mainly gut, haemolymph and salivary glands) of sap-sucking insect vectors (Kirkpatrick 1991). ‘Candidatus Phytoplasma mali’ is the etiological agent of apple proliferation (AP) disease, which is a severe problem in Italian apple ( Malus domestica ) orchards. The most typical symptom of the disease is the formation of witches’ brooms at the ends of shoots. Moreover, unusually enlarged leaf stipules, early leaf reddening and smaller and flattened fruits, with longer peduncles, also indicate the infection. The economic impact of the disease is quite high. The disease causes a reduction in size (up to 50%), weight (by 63-74%) and, therefore, quality of fruits (EPPO/CABI 1996). Cacopsylla melanoneura (Förster), one of the most common psyllids in apple orchards of Northern Italy, is a vector of AP (Tedeschi et al. 2002). It is an univoltine species and its diffusion is linked to some Rosaceae Maloideae , such as Crataegus , Malus and Pyrus spp. In Italy, the biological cycle of this species was studied and described on apple by Mattedi et al. (2007) and Tedeschi et al. (2002). In Trentino overwintered adults reach the orchards by the end of January and reproduce, laying eggs between the beginning of March and the beginning of April. Neanids hatch at mid-March and complete their development at the end of April, when the new generation appears. The new adults leave the orchard around mid- June and reach alternative host plants. Conifers were reported as shelter plants for the hibernation of the new generation (Conci et al. 1992; Ossiannilsson 1992). Besides apple, the AP agent can also affect other plants, such as other rosaceous fruit trees and other woody plants, including hawthorn ( Crataegus monogyna ), on which causes yellowing and/or decline symptoms (Seemüller 2002). These plant species could, therefore, represent an alternative phytoplasma reservoir for the psyllids, if the insects were able to

163

move from these plants to apple trees. Moreover, according to recent observations carried out in Piedmont, Italy, also C. melanoneura collected from hawthorn can carry AP-group phytoplasmas (Tedeschi et al. 2005). In this study, we analyzed 10 populations of C. melanoneura collected from apple and from hawthorn plants to assess ecological and molecular differences between them and to verify possible exchanges between psyllids from hawthorn and from apple. In particular, from an ecological point of view, a host-switching experiment was performed to evaluate the effect of the different host plants on survival and reproductive performances of two insect populations collected on apple and on hawthorn plants, respectively. Furthermore, the genetic population structure of insect populations collected from apple and from hawthorn plants were analyzed from a molecular point of view, genotyping 10 microsatellite markers specifically developed for C. melanoneura (Malagnini et al. 2007). Our study could represent a new contribution in the epidemiology of the disease and provide information about the role of alternative inoculum sources. Moreover, as no cura- tive treatments for phytoplasma diseases exist and the control of vectors is an important preventive measure, the knowledge of the ecological behaviour of the different populations can represent a useful tool in the integrated pest management.

Materials and methods

Sampling Population samples analyzed in this study were collected in North Eastern and Western Italy and in Germany; sampling details are reported in Table 1. Sampled individuals were immediately frozen at -80°C, lyophilized and homogenized after collection. Samples were then stored at -80°C until the molecular analysis.

Genetic and statistical analyses DNA extraction and genotyping. Total genomic DNA was extracted from single adult specimens using the protocol described in Doyle & Doyle (1990). Each individual was genotyped for seven microsatellite loci following PCR procedure as described in Malagnini

164

et al. (2007). Genotypes were obtained by an ABI 3100 sequencer (GeneScan-500 ROX as internal standard; Applied Biosystems, Foster City, CA, USA). Allele sizing was performed using the softwares GENESCAN 3.1.2 and GENEMAPPER (both from Applied Biosystems,

Foster City, CA, USA) and binning was automated with the software FLEXIBIN version 2 (Amos et al. , 2007) in order to reduce human-related scoring errors especially when reference standards are not available or when analyzing new samples (Amos et al. 2007). The scoring was then manually checked by authors and loci were analyzed for null alleles presence with FREENA (Chapuis & Estoup 2007). Genetic diversity, Hardy-Weinberg Equilibrium, Linkage disequilibrium. Descriptive statistics such as allele size range (S R) in base pair (bp), number of alleles (N a) and allelic richness (A R) were calculated using FSTAT version 2.9.3.2 (Goudet 1995). The allelic richness was based on the smallest population sample size. Observed (H O) and expected (H E) heterozygosity were calculated with GENETIX version 4.05 (Belkhir et al. 2004). Genotypic linkage disequilibrium tests between pairs of loci in each population and global tests for conformity with Hardy-Weinberg equilibrium (HWE) were performed across loci and across populations using GENEPOP , online version (Raymond & Rousset 1995). Population structure. Differentiation tests between population samples were performed using CHIFISH version 1.3 (Ryman 2006). The software tests the hypothesis of no allele frequency difference among populations at each locus by means of Pearson’s traditional chi- square and Fisher’s exact test.

FSTAT version 2.9.3.2 (Goudet 1995) was used to compute the overall and population pair-wise F ST values and the inbreeding coefficients (FIS ,) . The estimation of the probability of F ST was determined using 1000 permutations and bootstrap replicates for all comparisons. The 95% confidence intervals were estimated by 1000 bootstrap replicates over loci and probability values were determined by 1000 permutations. For all tests implying multiple comparisons, statistical significance level was adjusted, against type I errors, using standard Bonferroni correction (Rice 1989). The nominal significance level was set at 0.05. Population structure at geographic level was investigated by a landscape genetic approach using BARRIER version 2.2 (Manni et al. 2004) to find the largest breaks in genetic structure of our populations collected at different locations. The analysis was based both on

165

the genetic distances (i.e. FST ) and on the geographical distances between population samples upon geographic coordinates. As a parallel approach to graphical representation of genetic barriers we tested for the presence of correlation between geographic and genetic distance performing a Mantel’s test using the procedure of Smouse et al. (1986) implemented in GEN ALEX version 6.1 (Peakall & Smouse 2006). Statistical significance of the values was obtained via 1000 random permutations.

Mean value of A R, H E and F IS estimates for all loci were compared according to the host plants using the Mann-Whitney U test (Sokal & Rohlf 1995).

A three-level hierarchical analysis of molecular variance ( AMOVA ) was also performed using the software ARLEQUIN version 3.11 (Excoffier et al. 2005) to verify the role of host plant sample origin (collected from apple or hawthorn) on differentiation.

The program BOTTLENECK version 1.2.02 (Cornuet & Luikart 1996; Luikart & Cornuet 1998) was used to test the population samples for recent bottlenecks. Statistical tests implemented in BOTTLENECK version 1.2.02 check for departure from drift–mutation equilibrium due to a transient excess of expected heterozygotes resulting from a bottleneck. The expected heterozygosity in case of mutation–drift equilibrium was estimated using a TPM model (the two-phase model, DiRienzo et al. 1994). Significance of an excess of heterozygosity was assessed by Wilcoxon sign-rank test, carried out with 5000 iterations. Mitochondrial DNA sequencing. A fragment of approximately 500 pb of the cytochrome oxidase subunit I ( COXI ) gene was amplified from ten psyllids for each population, using the primers CI-J-1718 (5' GGAGGATTTGGAAATTGATTAGTTCC 3') and C1-N-2191 (5' CCCGGTAAAATTAAAATATAAACTTC 3') (Simon et al. 1994). Amplification was carried out in a 30 µl reaction volume containing 2 µl of psyllid

DNA, 0.3 µM of each primer, 3.00 mM of MgCl 2 (Promega, Madison, WI, USA), 400 ng/ml BSA (Bovine Serum Albumin, New England BioLabs, Inc., Beverly, MA, USA) and the 2x Go Taq® Green Master Mix (Promega, Madison, WI, USA). The amplifications were performed in a Gene Amp® PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The PCR parameters were as follows: 2 min at 94°C, followed by 35 cycles of 30 sec at 94°C, 30 sec at 50°C and 45 sec at 72°C, and an extension at 72°C for 5 min. PCR products were sequenced on an ABI 3130 xl automated DNA sequencer, using ABI PRISM BigDye Terminator Sequence Kit (Applied Biosystems, Foster City, CA, USA) according

166

to the manufacturer’s instructions but diluted 16 times. Sequences were manually checked using BIOEDIT (Hall 1999) and then aligned with CLUSTAL W (Thompson et al . 1994). Phy- logenetic and molecular evolutionary analyses were performed with MEGA version 4 (Ta- mura et al. 2007).

ARLEQUIN (Schneider et al . 2000) was used for the molecular variance analysis

(AMOVA ), to test for significant population structure by host plant or by location.

Host-switching experiments The effect of different host plant on two populations of C. melanoneura (one collected on apple and one on hawthorn plants – in North-Western Italy) was evaluated on survival and reproductive performances. In two bi-factorial laboratory experiments the native host plants (apple and hawthorn) and potential host plants (respectively: hawthorn and apple) were considered as experimental factors. The initial experiment involves thirty overwintering females and males collected at the end of March 2007 on apple orchard and on hawthorn plants located in Trentino. Survival and oviposition on different host plants were compared isolating one overwintering adult female and one male on apple and hawthorn shoots under controlled conditions (T=20°C; 16:8). New shoots were replaced every two days and C. melanoneura females were gently transferred using a thin paintbrush. Ten replications for each combination of population and potential host plant were performed. Ob- servations were carried out every two-three days recording survival time of adult females, number of laid eggs and hatching rate. To evaluate survival to adulthood, six recently emerged larvae obtained from eggs laid in the previous experiments were isolated on small plants of different host with a fine paintbrush under controlled conditions (T=20°C; 16:8) . Host-switching data analysis. Data on the survival of females belonging to the two populations and observed on different host plants were analyzed applying a survival analysis with the LIFEREG procedure of SAS (SAS Institute 1999) and fitting a Weibull model to survival time. Median lethal time of different population-host plant combinations was also estimated. The differences related to population, host plant and their interactions were compared applying a Wald chi-square test ( α = 0.05) (Allison, 1995). Data on oviposition of females of the two populations observed on different host plants were analyzed fitting the cumulative number of eggs laid during the experiments to a generalized linear Poisson model with log-link function, using the GENMOD procedure of SAS (SAS Institute 1999)

167

and estimating the least-squares means. The Likelihood ratio chi-square test G2 ( α = 0.05) was applied to compare the differences related to population, potential host plant and their interactions, while the differences among the least-squares means were evaluated with a Wald chi-square test ( α = 0.05). Data on eggs hatching (number of immatures/number of eggs) and survival to adulthood (number of adults / number of initial eggs) were analyzed applying a Binomial model with logit-link function using the GENMOD procedure of SAS (SAS Institute 1999). The Likelihood ratio chi-square test G2 ( α = 0.05) was performed to compare the differences related to population, potential host plant and their interactions, while the differences among the least-squares means were evaluated with a Wald chi- square test ( α = 0.05).

Results

Genetic and statistical analyses. Genetic diversity, Hardy-Weinberg Equilibrium, Linkage disequilibrium. A total 356 individuals from 10 populations were genotyped for 7 microsatellite loci. All loci proved to be polymorphic. The null alleles mean frequency for populations was lower than 0.2 (data not reported). The number of alleles (N a) detected at each locus ranged from 3 (Co14 and Co18) to 44 (Co14, Table 2).

Allelic richness (A R) arranged from a minimum value of 2.95 for locus Co18 (HaRU) to a maximum of 18.7 for locus Co14 (ApAO) (Table 2). The average Ho ranged from 0.125 to 0.982 for the collected-from-apple populations and from 0.432 to 0.954 for the collected- from-hawthorn population. The average He ranged from 0.544 to 0.952 and 0.518 to 0.946 for the collected-from-apple and collected-from-hawthorn populations, respectively. There were no significant differences between the host plants for mean allelic richness (U=12, P > 0.05) and mean Nei’s gene diversity index (U=12.5, P > 0.05). A significant deviation from Hardy-Weinberg equilibrium was observed for most of the analyzed loci and populations (Table 2). Departures from HWE were due to a deficiency of heterozygotes in all loci but loci Co13 and Co18 in HaCL population and Co18 in HaRU population, where an excess of heterozygotes was detected. The mean F IS coefficient per populations was significantly lower in the collected-from-hawthorn population (F IS =0.183)

168

than in the collected-from-apple population (F IS = 0.456; U = 1, P = 0.0159). Moreover, loci where found not to be in linkage disequilibrium (P > 0.05). Population structure. Pearson’s traditional chi-square and Fisher’s exact test for population differentiation showed highly significant differences among populations at each locus (P < 0.001).

Overall F ST value was highly significant (F ST = 0.035, 95% Confidence Interval

C.I.=0.014-0.065; P<0.001) and pair-wise F ST revealed significant values for most of the comparisons (36 out of 45) after Bonferroni correction (Table 3). No differences among collected-from-hawthorn populations of North-Eastern Italy were found (HaCL, HaMP, HaRU, Table 3), and similarly among collected-from-apple populations of North-Eastern Italy (ApOL, ApSM, ApVE). Significant differences (P < 0.0001) emerged from the pair- wise comparison between German apple population and all the other populations (Table 3). Similar results were obtained with German hawthorn population (P < 0.0001 in all the pair- wise comparisons; Table 3). Few pair-wise comparisons between populations from Tren- tino and Aosta Valley resulted to be significant (HaMP/HaCH F ST = 0.0206, P = 0.026;

ApAO/ApOL F ST = 0.0361, P = 0.0156; ApAO/ApVE F ST = 0.0270, P = 0.022) (Table 3).

The AMOVA analysis of populations collected from the two host plants revealed that most of the variability was due to the subdivision into the two groups of collected-from-apple and collected-from-hawthorn populations (percentage of variation 0.85%, F CT = 0.0085, P = 0.023) (Table 4). Moreover, variation among populations within groups and variation among individuals within populations were highly significant (variation percentage respectively of 3.69% and 95.46%; F SC = 0.0373 and F ST = 0.0454; both P < 0.001) (Table 4). No significant differences were found between populations grouped on the base of geographical origin (F TC = 0.00144, P = 0.328). Mantel test revealed a significant relationship between geographical and genetic distance (P < 0.01). In particular the program Barrier revealed a main genetic barrier isolating Aosta Valley populations (Fig. 3). The bottleneck tests did not detect signatures of recent bottlenecks in any population sample (Table 5). Mitochondrial DNA. The COXI sequences used in this study were 472 bp long. Se- quence variation was generally low; with 22 variable sites, and 4 parsimony informative

169

sites. Across the entire dataset of 100 individuals, nine haplotypes were found; their name, accession numbers and the frequencies are reported in Table 6. Haplotype 1 was shared among all populations, haplotype 2 was present in 8% of the individuals, while haplotype 3 and 4 were present only in few individuals and the other five haplotypes were unique.

AMOVA analysis detected significant structuring neither by host plant (F TC = -0.00031, P =

0.52) nor by geographical location (F TC =0.00049, P = 0.402).

Ecological experiments and data analysis. Survival analysis evidenced a significant variation between C. melanoneura reared on the different host plants (Wald χ2 = 9.51; df = 1; p = 0.002), while no differences were observed between the two populations (Wald χ2 = 0.96; df = 1; p = 0.326). The analysis evidenced a significant “Population * Host plant” interaction (Wald χ2 = 11.78; df = 1; p < 0.005). The survival of the apple population of C. melanoneura was higher on apple shoots compared to hawthorn shoots (Wald χ2 = 11.78; df = 1; p < 0.005; Table 7), whereas no differences between the host plant effect were observed for the hawthorn population (Wald χ2 = 0.04; df = 1; p = 0.841; Table 7). No differences on the number of eggs laid during the experiments emerged between the two C. melanoneura populations ( G2 = 0.86; df = 1; p = 0.353, Figure 1) and between host plants ( G2 = 0.91; df = 1; p = 0.339, Figure 1). However, significant interaction indicates that the differences in oviposition of the two populations are related to the host plant ( G2 = 16.95; df = 1; p < 0.001, Figure 1). The apple population laid more eggs on apple shoots (12.74 eggs/day/female) than on hawthorn shoots (0.03 eggs/day/female; Wald χ2 = 50.96; df = 1; p < 0.001). On the other hand, the hawthorn population of C. melanoneura laid more eggs on hawthorn shoots (14 eggs/day/female) than on apple shoots (0.8 eggs/day/female; Wald χ2 = 21.87; df = 1; p < 0.001). No effect of population ( G2 = 1.03; df = 1; p = 0.31) and host plant ( G2 = 0.03; df = 1; p = 0.85) was observed on eggs hatching rate, while a significant “Population * Host plants” interaction resulted in the analysis ( G2 = 13.49; df = 1; p < 0.001). No eggs of the apple population of C. melanoneura hatched on hawthorn shoots while 93% of the laid eggs hatched on apple shoots. Regarding the hawthorn population, no eggs hatched on apple shoots, while on hawthorn the egg hatching rate was 80.2% (Figure 2). The survival to adults resulted similar in the two populations on their native host plant ( G2 = 0.65; df = 1; p = 0.4207).

170

Discussion The present work seeks to integrate for the first time both biological and genetic data about C. melanoneura populations collected from different host plants and geographic areas. Cacopsylla melanoneura is considered as widely oligophagous on Crataegus spp., even though in some European regions populations live on, and cause damage to, apple trees ( Malus spp.) and, occasionally, also pear trees ( Pyrus spp.) or Mespilus germanica (Lauterer 1999). In Moravia and Central Europe, C melanoneura populations were observed only on Crataegus spp. (Lauterer 1999). In contrast, Lazarev (1972a, b) studied and described the form taurica , which has no taxonomic value but refers to C. melanoneura populations living on apple trees (Gegechkori & Loginova 1990). In Northern Italy this species occurs on both apple and hawthorn trees (Pedrazzoli et al. 2005; Mattedi et al. 2007; Tedeschi et al. 2008). Field observations of C. melanoneura populations naturally occurring in apple orchards and hawthorn hedgerows (unpublished data) and preliminary laboratory experiments (Malagnini et al. 2006) revealed ecological differences between the apple and hawthorn populations. Ex- periments performed to measure the survival and reproductive performance of the two populations revealed a significant interaction between C. melanoneura and potential host plant. This result indicated that the insects’ ecological fitness is higher on their own host plant. The offspring reached adulthood on their primary host plant while died on the alternative host plant. Data obtained in this work are consistent with those already reported by Lazarev (1974). In Crimean populations, Lazarev (1974) observed that members of the population which lives on apple trees will not develop if transferred to hawthorn and die within several days. Host-switch experiments with different populations carried out in Germany confirmed that the hawthorn and apple populations laid eggs and developed preferentially on their native host plants (Jarausch et al. , unpublished data). The behavior of the apple and hawthorn populations was studied also in North-Western Italy. Observations carried out in Piedmont indicate that C. melanoneura collected from apple can survive and reproduce also on hawthorn, while the population collected from hawthorn seems to be more selective (R. Tedeschi, personal communication). These data suggested the existence of different populations within C. melanoneura that are linked to the host plant. The ecological advantage gained by host-associated populations by feeding and reproducing on their own host plant species, with a differentiation of host races, is widespread in insects (Guldemond 1990a, b; Craig et al. 1993; Feder et al. 1994; Filchak et al. 2000; Via et al. 2001).

171

As defined by Dres & Mallet (2002), host races are genetically differentiated, sympatric populations of parasites that use different hosts, and between which there is appreciable gene flow. In this work we cannot define the populations collected on apple and on hawthorn as host races, because all the criteria required were not experimentally verified. Even if the females showed a host-associated tradeoff in fitness, we could not assess whether the host preference results in assortative mating. Nevertheless, ecological differences are supported by genetic data: AMOVA analysis of microsatellite dataset indicated low but significant genetic differences between the collected-from-apple and collected-from-hawthorn populations

(F TC = 0.0085; P = 0.023). The mitochondrial marker ( COXI ) dataset analysis did not supported this finding (FTC = -0.0031; P = 0.606). The nonconformity of the two results may indicate that population differentiation took place recently. According to the ecological results, we also revealed a geographic differentiation, at the microsatellite dataset level, and a genetic barrier was found separating the Aosta Valley population samples. Genetic differences could reflect the different role of this species in the transmission of ‘Ca. P. mali’. In fact, North-Western Italy, C. melanoneura is known to be the main vector of apple proliferation phytoplasma (Tedeschi et al. 2002; Tedeschi & Alma 2004). On the other hand, a very low transmission efficiency was found in Trentino (Mattedi et al. 2008). The marked deficiency of heterozygotes observed in these populations may provide some insights. Heterozygote deficits can be caused by null alleles (Callen et al. 1993); but they can be ruled out from our dataset or considered as not pervasive among the individuals analyzed because the C. melanoneura populations considered showed high allelic richness values and high inbreeding coefficients that exclude this hypothesis. A possible factor determining high inbreeding rates could be the Wahlund effect. This occurs when populations are subdi- vided unequally with regard to allele frequencies so that random mating only involves a por- tion of the population. The deficiency becomes apparent when the various subpopulations are sampled as a single unit. Cacopsylla melanoneura is not a very motile insect and, even if it overwinters on conifers at high altitudes, its transport is not active but caused by the wind (Clark 1962; Hodkinson 1974). The Wahlund effect could explain our results, in that some individuals could therefore form small groups with few genotypes that migrate as a single unit taking preferential directions. In the same manner psyllids may be brought back to the native areas by winds blowing in the opposite directions (Conci et al. 1995). Furthermore,

172

Mattedi et al. 2007 provided evidence that some specimens could also overwinter in apple orchards and in this case it can be hypothesized that the mating choice is reduced to few individuals. These evidences with the fact that apparently fertilization only takes place after hibernation between March and May (Lauterer 1999), could shape the subdivision of the population and generate the excess of homozygosities. Finally, the high inbreeding rate was suggested to be also influenced by the host life history, as reported for Bemisia tabaci (Gennadius), another hemipteran (De Barro 2005). In fact, B. tabaci is a colonizer of short-lived hosts and if relatively few genotypes colonize any given crop, the chances of inbreeding are high and would lead to the heterozygosity deficiencies (De Barro 2005). Nevertheless, this explanation does not fit with biological characteristics of C. melanoneura, which is an univoltine species linked to ar- borous plants. The epidemic spread of apple proliferation, which is vehiculated by the psyllids C. melanoneura and C. picta , increased the insecticide pressure against these insects at the beginning of the 2000s. The phytosanitary measure applied in Northern Italy caused a dramatic decrease of the populations from 2000 to 2006 (Mattedi et al. 2007). The population decrease was not detected by BOTTLENECK analysis, indicating that the human insecticide pressure, due to the incidence of the disease in the last years, did not affect the genetic variability of the species. In conclusion, our results indicate that genetically divergent populations of C. melanoneura are linked to the host plant. However, future studies involving measurements of the genetic variation between and within populations of C. melanoneura , host association and fidelity will be carried out to confirm these preliminary results. Further investigation is needed to better understand the whole life cycle of C. melanoneura and to verify if genetically different populations belong to host races.

Acknowledgements The authors thank R. Tedeschi (University of Turin, Italy), W. Jarausch and B. Jarausch- Wehrheim (AlPlanta-Institute for Plant Research, Neustadt a.d. Weinstrasse, Germany) for the insects and the scientific support. This research was financed by DEMARCATE projects, funded by Provincia Autonoma di Trento (Italy).

173

References Allison PD (1995) Survival analysis using the SAS system: a practical guide , 2 nd ed. SAS Institute, Cary, NC. Amos W, Hoffman JI, Frodsham A, Zhang L, Best S, Hill AVS (2007) Automated binning of microsatellite alleles: problems and solutions. Molecular Ecology Notes , 7, 10-14. Belkhir K, Borsa P, Raufaste N, Bonhomme F (2004) GENETIX v. 4.05 logiciel sous Win- dowsTM pour la génétique des populations. Laboratoire Génome, Populations, interactions CNRS UMR 5171, Université de Montpellier II, Montpellier, France. Bohonak AJ (2002) IBD (Isolation By Distance): A program for analyses of isolation by distance. Journal of Heredity , 93 , 153-154. Callen DF, Thompson AD, Shen Y, Phillips HA, Richards RI, Mulley JC, Sutherland GR (1993). Incidence and origin of 'null' alleles in the (AC)n microsatellite markers. American Journal of Human Genetics , 52 , 922-927. Chapuis M, Estoup A (2007) Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution , 24 , 621–631. Clark LR (1962) The general biology of Cardiaspina albitextura (Psyllidae) and its abundance in relation to weather and parasitism. Australian Journal of Zoology , 10 , 537- 586. Conci C, Rapisarda C, Tamanini L (1992) Annotated catalogue of the Italian Psylloidea. First part (Insecta Homoptera) - Atti Acc. Rov. Agiati, ser. VII, vol. II, B: 33-135. Conci C, Rapisarda C, Tamanini L (1995) Annotated catalogue of the Italian Psylloidea . Second part (Insecta Homoptera) - Atti Acc. Rov. Agiati, ser. VII, vol. V, B: 5-207. Cornuet JM, Luikart G (1996) Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics , 144 , 2001-2014. Craig TP, Itami JK, Horner JD, Abrahamson WG (1993) Behavioral evidence for host-race formation in Eurosta solidaginis . Evolution , 47 , 1696-1710. De Barro PJ (2005) Genetic structure of the whitefly Bemisia tabaci in the Asia-Pacific region revealed using microsatellite markers. Molecular Ecology , 14 , 3695-3718. DiRienzo A, Peterson AC, Garza JC, Valdes AM, Slatkin M, Freimer MB (1994) Muta- tional process of simple-sequence repeat loci in human populations. Proceedings of the National Academy of Science USA , 91 , 3166-3170. Doi Y, Terenaka M, Yora K, Asuyama H (1967) Mycoplasma of PTL group-like microor-

174

ganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches’ broom, aster yellows, or Pawlonia witches’ broom. Annals of The Phytopa- thological Society of Japan , 33 , 259-266. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus , 12 , 13-15. Dres M, Mallet J (2002) Host races in plant-feeding insects and their importance in sympatric speciation. Philosophical Transactions of the Royal Society B-Biological Sciences , 357 , 471-492. EPPO/CABI (1996) Apple proliferation phytoplasma. In: Quarantine Pests for Europe , pp. 959-962, 2 nd ed. CAB International, Wallingford, GB. Excoffier L, Laval G, Schneider S (2005) ARLEQUIN ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online , 1, 47-50. Feder JL, Opp SB, Wlazlo B, Reynolds K, Go W, Spisak S (1994) Host fidelity is an effective premating barrier between sympatric races of the apple maggot fly. Proceedings of the National Academy of Sciences USA , 91 , 7990-7994. Filchak KE, Roethele JB, Feder JL (2000) Natural selection and sympatric divergence in the apple maggot Rhagoletis pomonella . Nature , 407 , 739-742. Gegechkori AM, Loginova MM (1990) Psyllids (Homoptera , Psylloidea) of the USSR (an An- notated List) (Metsniereba, Tbilisi, 1990) [in Russian]. Goudet J (1995) FSTAT (ver. 1.2): a computer program to calculate F-statistics. Journal of Heredity , 86 , 485-486. Guldemond JA (1990a) Choise of host plant as a factor in reproductive isolation of the aphids genus Cryptomyzus. Ecological Entomology , 15 , 43-51. Guldemond JA (1990b) Evolutionary genetics of the aphid Cryptomyzus , with a preliminary analysis of host plant preference, reproductive performance and host-alternation. Entomologia Experimentalis et Applicata , 57 , 65-76. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis . http://www.mbio.ncsu.edu/BioEdit/bioedit.html Hodkinson ID (1974) The biology of the Psylloidea (Homoptera): a review. Bulletin of En- tomological Research , 64 , 325-339.

175

Kirkpatrick BC (1991) Mycoplasma-like organisms: plant and invertebrate pathogens. In: The Prokaryotes , pp. 4050-4067. A. Balows, H.G. Trüper, M. Dworkin, W. Harder and K.H. Schliefer (eds.). Springer-Verlag Press, New York (USA). Lauterer P (1999) Results of investigations on Hemiptera in Moravia, made by Moravian Mu- seum (Psylloidea 2). Acta Musei Moraviae , Scientae Biologicae (Brno), 84 , 71-151. Lazarev MA (1972a) Psylla melanoneura Frst. taurica forma nov. (Homoptera: Psylloidea ). Entomologicheskoe Obozrenie USSR (Ent. Oboz.) , 51 , 37-41 (in Russian). Lazarev MA (1972b) Psylla melanoneura Frst. taurica forma nov. (Homoptera: Psyllidae). An apple tree pest in the Crimea. Proceedings of the All-union V. I. Lenin Academy of Agri- cultural Sciences , The State Nikita Botanical Gardens, Yalta, Ukraine, 61 , 101-122. Lazarev MA (1974) Leaf-bugs (Homoptera: Psyllidae) of the apple and pear in the orchards of the Crimea. (Morphology , biology , control). Published degree dissertation. Academy of Sciences of the Moldavian SSR, Kishinyov. (in Russian). Luikart G, Cornuet JM (1998) Empirical evaluation of a test for identifying recently bottle- necked populations from alleles frequencies data. Conservation Biology , 12 , 228-237. Malagnini V, Cainelli C, Pedrazzoli F, Ioriatti C (2006) Population diversity within Cacop- sylla melanoneura (Förster) based on ecological and molecular studies (Abstract). Proceedings of VIII European Congress of Entomology, September 17-22, 2006. Iz- mir, Turkey. Malagnini V, Pedrazzoli F, Forno F, Komjanc M, Ioriatti C (2007) Characterization of microsatellite loci in Cacopsylla melanoneura Föster (Homoptera: Psyllidae). Molecular Ecology Notes , 7, 495-497. (DOI:101111/j.471-8286.2006.01632.x.). Manni F, Guérard E, Heyer E (2004) Geographic patterns of (genetic, morphologic, linguis- tic) variation: how barriers can be detected by “Monmonier’s algorithm”. Human Bio- logy , 76 , 173-190. Mattedi L, Forno F, Varner M (2007) Scopazzi del melo. Conoscenze ed osservazioni di campo , 144 pp. Arti Grafiche La Commerciale-Borgogno, Bolzano (Italy). McCoy RE, Caudwell A, Chang CJ, Chen TA, Chiykowski LN, Cousin MT, Dale De Le- euw GTN, Golino DA, Hackett KJ, Kirkpatrick BC, Marwitz R, Petzolt H, Sinha RH, Sugiura M, Whitcomb RF, Yang IL, Zhu BM, Seemuller E (1989) Plant diseases asso-

176

ciated with mycoplasmalike organisms. In The Mycoplasmas , 5, 545-640. R.F. Whitcomb, J.G. Tully (eds.). Academic Press, New York (USA). Ossiannilsson F (1992) The Psylloidea (Homoptera) of Fennoscandia and Denmark , vol. 26. Fauna Entomologica Scandinavica, Brill E. J., Leiden, The Netherlands. Otha T, Kimura M (1973) A model of mutation appropriate to estimate the number of elec- trophoretically detectable alleles in a Wnite population. Genetics Research , 22 , 201- 204. Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes , 6, 288-295. Pedrazzoli F, Forno F, Malagnini V, Mattedi L (2005) Indagini bioecologiche su Cacop- sylla melanoneura (Förster) (Homoptera: Psyllidae). XX Congresso Nazionale Italiano di Entomologia . 13-18 Giugno 2005, p. 251. Raymond M, Rousset F (1995) GENEPOP (version 1.2), population genetics software for exact tests and ecumenicism. Journal of Heredity , 86 , 248-249. Rice WR (1989) Analyzing tables of statistical tests. Evolution , 43 , 223-225. Ryman N (2006) CHIFISH: a computer program testing for genetic heterogeneity at multiple loci using chi-square and Fisher’s exact test. Molecular Ecology Notes , 6, 285-287. SAS Institute (1999) SAS/STAT User’s Guide , version 8 th ed. SAS Institute, Cary, NC. Schneider S, Roessli D, Excoffier L (2000) ARLEQUIN: A software for population genetics data analysis. Ver 2.000. Genetics and Biometry Lab, Dept. of Anthropology, Uni- versity of Geneva. Seemüller E. (2002) Apple proliferation: etiology, epidemiology and detection. ATTI Gior- nate Fitopatologiche , 1, 3-6. Seemüller E, Schneider B (2004) ‘ Candidatus Phytoplasma mali’, ‘ Candidatus Phyto- plasma pyri’ and ‘ Candidatus Phytoplasma prunorum’, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. International Journal of Systematic and Evolutionary Microbiology, 54 , 1217-1226. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America , 87, 651–701.

177

Smouse PE, Long JC, Sokal RR (1986) Multiple Regression and Correlation Extensions of the Mantel test of matrix correspondence. Systematic Zoology , 35 , 627-632. Sokal RR, Rohlf FJ (1995) Biometry . Freeman and Company, New York. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution , 24 , 1596- 1599. Tedeschi R, Bosco D, Alma A (2002) Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae), a vector of apple proliferation phytoplasma in northwestern Italy. Journal of Economic Entomolgy , 95 , 544-551. Tedeschi R, Bertignolo L, Alma A (2005) Role of the hawthorn psyllid fauna in relation to the apple proliferation disease. In Proceedings, Workshop: 3 rd National Meeting on Phytoplasma Disease. Petria , 15 , 47-49. Tedeschi R., Lauterer P., Brusetti L., Tota F., Alma A Composition, abundance and phytoplasma infection in the hawthorn psyllid fauna of northwestern Italy. European Jour- nal of Plant Pathology , On-line first: 2 September 2008. DOI: 10.1007/s10658-008- 9367-1. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Research , 22 , 4673- 4680. Via S (2001) Sympatric speciation in animals: the ugly duckling grows up. Trends in Ecol- ogy & Evolution , 16 , 381-390.

178

Table 1 - Geographical locations, acronym and sample size of Cacopsylla melanoneura populations.

Host plant Locality Acronym Location (lat. and log.) Sample size (N) Cles (TN-Italy) HaCL 46°21'N 11°02'E 22 Maso Parti (TN-Italy) Ha MP 46°11'N 11°06'E 25 Hawthorn Rumo (TN-Italy) HaRU 46°26'N 11°01'E 44 Chambave (AO-Italy) HaCH 45°44'N 07°33'E 47 Neustadt (Germany) HaNE 49°21'N 08°08'E 48

Oltrecastello (TN-Italy) ApOL 46°04'N 11°09'E 16 San Michele (TN-Italy) ApSM 46°11'N 11°08'E 41 Apple Vervò (TN-Italy) ApVR 46°18'N 11°07'E 28 Aosta (AO-Italy) ApAO 45°44'N 07°18'E 36 Meckenheim (Germany) ApME 49°24’N 08°14’E 49

179

Table 2 - Genetic variability at seven microsatellite loci in for each of the population of Cacopsylla melanoneura plus the overall data set; SR size range; Na, number of alleles; A R: Allelic Richness per locus and population based on smallest population sample size;

He, expected heterozygosity; Ho, observed heterozygosity; Fis , inbreeding coefficient; P HW , probability of Hardy-Weinberg equilibrium.

Locus Population ApOL ApSM ApVE ApAO ApME HaCL HaMP HaRU HaCH HaNE Co03 SR 126-238 126-217 118-244 122-230 120-193 127-195 126-216 125-195 120-298 102-194 Na 18 31 23 29 27 18 25 30 29 33 A R 14.811 14.454 15.668 15.812 14.376 12.675 17.244 16.043 15.165 13.788 Ho 0.8125 0.6000 0.2308 0.6765 0.7021 0.8182 0.7600 0.8837 0.6739 0.8889 He 0.9617 0.9763 0.9683 0.9548 0.9456 0.9271 0.9641 0.9477 0.9501 0.9653 Fis 0.159 0.389 0.765 0.295 0.260 0.120 0.215 0.068 0.293 0.080 PHW 0.0421 <0.001 <0.001 <0.001 <0.001 0.0995 0.0083 0.3019 <0.001 0.0085 Co04 SR 86-148 70-130 80-146 74-126 74-166 77-167 72-170 72-166 70-166 72-170 Na 10 25 18 17 16 14 27 29 29 34 A R 10.000 13.734 14.427 10.537 10.355 9.918 17.086 12.369 12.388 15.516 Ho 0.2727 0.3684 0.3158 0.6111 0.5918 0.4545 0.9000 0.6364 0.4468 0.5682 He 0.8788 0.9340 0.9602 0.9018 0.8834 0.8467 0.9705 0.8966 0.8696 0.9600 Fis 0.700 0.609 0.677 0.325 0.332 0.469 0.074 0.293 0.489 0.411 PHW <0.001 0.0040 <0.001 <0.001 <0.001 <0.001 0.0122 <0.001 0.0003 <0.001 Co11 SR 162-206 134-291 139-211 134-200 136-206 138-168 137-211 136-202 134-146 130-200 Na 13 21 19 20 26 18 22 30 27 28 A R 11.392 12.450 12.958 12.130 13.483 13.531 14.076 15.705 14.341 11.162 Ho 0.5333 0.6579 0.5926 0.5000 0.4348 0.6667 0.8000 0.8974 0.4318 0.5778 He 0.9153 0.9372 0.9406 0.9187 0.9446 0.9270 0.9469 0.9654 0.9514 0.8162 Fis 0.431 0.301 0.374 0.460 0.542 0.284 0.158 0.071 0.549 0.294 PHW <0.0001 0.0124 <0.0001 0.0128 <0.0001 <0.0001 0.0914 <0.0001 <0.0001 0.0007 Co12 SR 135-247 121-249 135-270 121-243 122-200 126-166 137-216 120-200 122-296 121-231 Na 15 37 24 33 33 16 26 34 39 36 A R 13.237 16.506 15.966 16.956 14.984 11.677 15.727 16.188 16.159 16.428 Ho 0.4000 0.6098 0.5000 0.6857 0.6531 0.7619 0.8000 0.7674 0.7447 0.8000 He 0.9517 0.9681 0.9690 0.9731 0.9508 0.9268 0.9616 0.9669 0.9595 0.9698 Fis 0.588 0.373 0.489 0.298 0.315 0.182 0.171 0.208 0.226 0.177

180

PHW <0.001 0.0124 <0.001 0.0128 <0.001 <0.001 0.0914 <0.001 <0.001 0.0007 Co13 SR 129-187 121-201 130-213 123-191 123-217 137-151 135-147 123-205 121-203 136-200 Na 13 26 21 28 33 14 24 25 31 37 A R 11.402 15.280 14.610 15.262 16.335 10.280 15.761 11.633 15.411 15.771 Ho 0.1875 0.4359 0.2609 0.5152 0.6122 0.9545 0.9200 0.9318 0.7333 0.9333 He 0.9173 0.9627 0.9546 0.9594 0.9703 0.9006 0.9682 0.9018 0.9630 0.9630 Fis 0.801 0.550 0.731 0.467 0.371 -0.061 0.051 0.034 0.241 0.031 PHW <0.001 <0.001 <0.001 <0.001 0.0147 0.0024 0.0295 <0.001 0.0036 0.0098 Co14 SR 168-290 156-292 115-282 152-292 152-282 151-267 140-264 150-244 150-298 151-229 Na 24 33 22 41 39 21 27 3 44 34 A R 18.119 17.157 14.891 18.701 16.061 13.558 17.086 13.027 17.523 14.656 Ho 0.6875 0.5333 0.1250 0.6667 0.5714 0.6364 0.7826 0.8409 0.7174 0.5217 He 0.9819 0.9746 0.9495 0.9847 0.9634 0.8932 0.9758 0.8973 0.9761 0.9436 Fis 0.307 0.457 0.871 0.326 0.409 0.292 0.202 0.064 0.267 0.450 PHW 0.0123 0.0367 <0.001 <0.001 <0.001 <0.001 <0.001 0.1461 0.0281 0.0117 Co18 SR 79-127 64-198 80-198 93-145 75-157 75-101 75-133 73-103 69-145 75-89 Na 8 16 11 14 12 4 12 3 17 16 A R 7.791 8.989 9.310 7.327 7.811 3.754 8.538 2.953 9.927 10.396 Ho 0.1538 0.5610 0.1304 0.6389 0.9184 0.7727 0.7083 0.9318 0.7391 0.7292 He 0.8769 0.7371 0.8918 0.6451 0.8336 0.6776 0.8520 0.6001 0.8569 0.9042 Fis 0.830 0.241 0.857 0.010 -0.103 -0.144 0.172 -0.563 0.139 0.195 PHW <0.001 <0.001 <0.001 0.6829 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 All SR 79-290 64-292 80-282 74-292 74-282 75-267 72-264 72-244 69-298 72-229 Na 14.429 27 19.743 26 26.571 15 23.286 25.429 30.857 31.143 A R 12.393 14.480 13.983 13.725 13.260 10.770 14.849 12.322 14.315 14.249 Ho 0.4353 0.5380 0.3079 0.6134 0.6405 0.7236 0.8101 0.8414 0.6410 0.7170 He 0.9275 0.9271 0.9477 0.9054 0.9274 0.8708 0.9484 0.8822 0.9324 0.9317 Fis 0.540 0.423 0.680 0.326 0.312 0.173 0.149 0.047 0.315 0.232

181

Table 3 - Pairwise genetic differentiation (F ST ) between Cacopsylla melanoneura popu-

lations (below diagonal) and F ST P values (above diagonal). Significant P values are in bold, asterisk (*) indicate significant P-values after Bonferroni correction ( α = 0.01).

ApOL ApSM ApVE ApAO ApME HaCL HaMP HaRU HaCH HaNE ApOL - 0.0433 0.6244 0.0156 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* ApSM 0.0238 - 0.0044 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* ApVE -0.0028 0.0154 - 0.0022 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* ApAO 0.0361 0.0063 0.0270 - 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* ApME 0.0330 0.0185 0.0294 0.0256 - 0.00111* 0.00111* 0.00111* 0.00111* 0.00111* HaCL 0.0651 0.0692 0.0616 0.0833 0.0339 - 0.0014 0.9988 0.00111* 0.00111* HaMP 0.0267 0.0304 0.0186 0.0398 0.0155 0.0266 - 0.0044 0.0256 0.00111* HaRU 0.0704 0.0694 0.0633 0.0830 0.0348 -0.0061 0.0262 - 0.00111* 0.00111* HaCH 0.0331 0.0085 0.0255 0.0143 0.0215 0.0538 0.0206 0.0522 - 0.00111* HaNE 0.0377 0.0335 0.0329 0.0382 0.0258 0.0555 0.0247 0.0508 0.0304 -

Table 4 - Results of AMOVA performed for C. melanoneura on ten populations grouped in two groups of host plants. Asterisk (*) indicate significant P values ( α < 0.05).

Source of varia- Variance com- df ss % variation F statistcs tion ponents

Among group 1 23.129 0.02866 0.85102 FTC = 0.0085* Among popula-

tion within 8 94.770 0.12437 3.69338 FSC = 0.0373* groups Within popula- 702 2256.527 3.21443 95.45561 FST = 0.0454* tions

182

Table 5 - Sign tests and Wilcoxon sign-rank tests for heterozygosity excess for the whole sample.

Bottleneck test (probabilities)

SIGN TEST WILCOXON TEST Under the TMP Population Under the TPM for H excess HaCL 0.09818 0.96094 ApOL 0.16525 0.01953 ApVE 0.17666 0.00781 HaMP 0.25734 0.65625 ApSM 0.49938 0.40625 HaCH 0.22725 0.85156 ApAO 0.07494 0.94531 HaNE 0.21824 0.85156 ApME 0.01388 0.94531 HaRU 0.23493 0.94531

183

Table 6 - Haplotypes of cytochrome oxidase subunit units and relative frequencies found among C. melanoneura populations.

GenBank Population Haplotype Acces. N.* ApOL ApSM ApVE ApAO ApME HaCL HaMP HaRU HaCH HaNE 1 b1176482 0.909 0.8 0.667 1 0.769 0.818 1 0.667 0.769 1 2 b1176486 0.091 0.2 0.167 0 0.077 0.091 0 0.111 0.077 0 3 b1176487 0 0 0.167 0 0 0 0 0 0 0 4 b1176490 0 0 0 0 0.154 0 0 0 0 0 5 b1176491 0 0 0 0 0 0.091 0 0 0 0 6 b1176493 0 0 0 0 0 0 0 0.111 0 0 7 b1176495 0 0 0 0 0 0 0 0.111 0 0 8 b1176499 0 0 0 0 0 0 0 0 0.077 0 9 b1176500 0 0 0 0 0 0 0 0 0.077 0 The accession numbers reported are provisory.

184

Table 7 - Survival of C. melanoneura females of the two populations on the potential host plants. LT 50 indicate median lethal time. Different letters within a population indicate significant differences according to the Wald chi-square test ( α = 0.05).

Population Potential host plant LT 50 ± std.err. Apple Apple 9.109 ± 2.266 a

Hawthorn 1.897 ± 0.450 b

Hawthorn Apple 4.002 ± 0.971 a Hawthorn 4.303 ± 1.026 a

180 160 140

120 100 80 N° eggs N° 60

40 20 0 0 5 10 15 20 25 30 days

apple/ apple apple/ hawthorm hawthorm/ hawthorm hawthorn/ apple

Figure 1 - Mean cumulative numbers (untransformed data) of eggs laid by the two populations of C. melanoneura on different host plants.

185

1.2 a 1 b 0.8

0.6

0.4

egg-hatching rate 0.2 c c 0 apple hawthorn apple hawthorn

apple apple hawthorn hawthorn Potential host-insect subpopulaion

Figure 2 - Egg-hatching rates of the two populations of C. melanoneura on the different host plants. Different letters indicate significant differences according to the Wald chi- square test ( α = 0.05).

186

Fig. 3 - Genetic boundary obtained with Monmonier’s algorithm, implemented in BAR-

RIER version 2.2, is indicated by full thick red line (Barrier a). The green lines represent De- launey triangulation and the blue ones Voronöi tessellation, red point inside Delauney triangulation indicate population samples analyzed.

187

Conclusions

To summarise the results obtained during these researches, it is possible to draw the following considerations: • Acquisition capacity of the overwintered adults. The study of the acquisition by overwintered adults of the two species revealed that short acquisition periods (less than four days) are sufficient for the insects to acquire the pathogen from infected plants. Moreover, at least in some individuals a multiplication of the pathogen took place after the acquisition. Nevertheless, the phytoplasma titres reached by the overwintered adults are probably not sufficient to render them infective. • Acquisition capacity in the springtime generation. The juvenile instars and the new generation adults of both species, when individuals were born and developed on infected plants, showed high titres of phytoplasma. In particular C. picta showed higher percentages of individuals in the higher phytoplasma concentration classes compared to C. melanoneura , which is consistent with the results of the transmission trials. On the basis of these results it is possible to infer that the presence of a certain number of individuals with phytoplasma levels above a threshold value is necessary to have a successful transmission of the disease. • Role of the two species in the transmission of apple proliferation. C. picta is the most efficient vector of apple proliferation in Trentino. The overwintered generation of this psyllid did not succeed in transmitting the disease under the experimental conditions adopted, while both nymphal instars and springtime adults could infect the apple test plants. C. melanoneura was not able to transmit ‘ Ca . Phytoplasma mali’ in any of the trials conducted. • Natural infection of C. melanoneura collected from different host plants. Different infection levels were detected among the different populations of C. melanoneura collected in apple orchards of Trentino, Veneto and Aosta Valley. A positive correlation was found between the percentage of infected individuals and the mean infection level of the orchards. Moreover, some infected insects were collected also on conifers, con- firming that C. melanoneura retain the infection during the winter period. C.

189

melanoneura captured on hawthorn, an alternative host plant of this species, had much lower percentages of phytoplasma infection than those captured on apple. • Influence of ‘ Ca. P. mali’ on the fitness of C. melanoneura . Exposure to diseased apple shoots has a detrimental effect on the fitness of C. melanoneura which may reflect a recent co-evolution between the psyllid and the phytoplasma. Even though the presence of the phytoplasma in the plant did not affect the life span of the adult psyllids, females laid significantly less eggs on infected shoots. Furthermore, a reduced number of the eggs that were laid on the diseased plants hatched. On the other hand, the survival of nymphs and their development to adulthood was similar among the treatments. • Ecological differences between C. melanoneura collected from apple and from hawthorn. The bioassays conducted with two populations of C. melanoneura , one collected from apple and one from hawthorn, an alternative host plant, revealed that the two populations are linked to their native host for their reproduction. The fitness of the two groups of insects was found to be higher on the plants from which they were collected and therefore the existence of host associated populations could be hypothesised. • Genetic differences between different populations of C. melanoneura. The ecological differences detected in the previous experiments were confirmed also by the study of the genetic structures of the two groups of psyllids: even though the analysis of the COXI sequences yielded no discriminating variability between the insects, the microsatellite markers developed for this species revealed significant differences between the populations associated to apple and those associated to hawthorn.

190

Aknowledgements

These researches were conducted within two projects funded by the Provincia Autonoma di Trento: • SMAPII (Scopazzi del Melo - Apple Proliferation), whose scientific coordinator was Wolfgang Jarausch. The project tackled the problem of Apple Proliferation disease with an interdisciplinary approach (study of the epidemiology of the disease, development of effective control strategies against the vectors and development of resistant plant material of agronomic value). Partners of the project were the Istituto Agrario di San Michele all’Adige (IASMA - San Michele all’Adige - Italy), the RLP AgroScience GmbH (Neustadt - Germany), the AlPlanta Institute for Plant Research (IPR - Neustadt - Germany) and the Biolo- gische Bundesanstalt (BBA - Dossenheim - Germany). • DEMARCATE (Development of molecular taxonomic markers for the psyllids of agronomic interest), whose scientific coordinator was Claudio Ioriatti. The project aimed the development of specific primers for the identification of psyllid species and microsatellite markers for the study of the population genetics and the ecology of Cacopsylla melanoneura Förster, a vector of ‘Candidatus Phytoplasma mali’.

I would like to thank all the people that, in different ways, helped me during these years. First of all, I am grateful to the University of Padua, and especially to Prof. Vincenzo Girolami, for giving me the opportunity of this adventure and supporting me. Then, many thanks go to all the colleagues and friends which were involved in my work and I had the opportunity to collaborate with: • Luisa Mattedi, Valeria Malagnini, Flavia Forno and Nicola Ormas for their precious suggestions and the supervision in the experiments with insects, • Valeria Gualandri, Rosaly Zasso, Paola Bragagna, Elisa Bozza, Christian Cainelli, Gessica Tolotti, Erika Di Marino, Federica Savazzini, Federica Fiamingo and Silvia Zangrando for the support in the laboratory analyses, • Anna Maria Ciccotti, Ivana Battocletti and Pier Luigi Bianchedi for the micropropagation of the plant material,

191

• Marco Deromedi and Mauro Filippi for taking care of the plants before and after the experiments, • Wolfgang Jarausch and Barbara Jarausch-Wehrheim for the huge help in writing and the critical revision of the work, • Antonella Salvadori and Gabriele Stoppa for the statistical elaborations of the data, • Pavel Lauterer for the willingness to share his knowledge in the psyllid classification, • Mauro Varner for the all the photographic material, • Matteo Komjanc and his group for the help in the molecular analyses, • Stella Passerotti and Manuela Malavolta for the technical suggestions, • Alberto Pozzebon, Chiara Papetti, Nicola Mori and Becky Bierman for the collabo- ration in writing the papers, • Andrea Frizzi for solving my troubles with informatics, • Claudio Ioriatti for the scientific supervision, • the staff of the library of FEM-IASMA for the kindness and the support, • all the colleagues and friends belonging to FEM-IASMA for sharing the good and bad moments.

I also thank Koninklijke Brill NV for the permission to include in this thesis drawings from the book The Psylloidea (Homoptera) of Fennoscandia and Denmark by F. Ossian- nilsson F. (1992), 346 pp., Fauna Entomologica Scandinavica, 26, E.J. Brill, Leiden (The Netherlands) ISBN 9789004096103.

Finally, I can not get out of thanking my whole family and my friends, that were always present and very patient during this demanding but also stimulating experience.

192