© 2015 Nature America, Inc. All rights reserved. T C 3 1 that protein partner a proteins, ofMEP50, family WD40 the of ber mem a complexesis multimeric these componentcoreofficity. A with a number of binding (H3R8) partners that influence its Arg8 substrate speci residue H3 and (H4R3) Arg3 substratesnuclearand cytoplasmic of variety a of methylation the through processes cellular diverse (the other is PRMT9) dimethylationresiduesarginine responsibleofsymmetric is for the that PRMT II type predominant the is PRMT5donor. methyl the using residues arginine of chains or two methyl groups to the nitrogen atoms of the guanidinium side types three into classified are and far so identified been havePRMTs mammalian metrical forming residues, arginine transduction or by some other mechanism unknown. is still signal by promoterbinding), or binding factor transcriptionation, methyl histone through example, (for expression gene regulating growth and proliferation postulated to have roles in cell death, cell-cycle progression and cell is enzyme the but unclear, is PRMT5 of capabilities transforming lines cell MCL in knockdown PRMT5 afterantiproliferative by samples,butalso observed effects in MCL, as evidenced not only by upregulation of PRMT5 in patient and colorectal cancer study ofPRMT5 biologyandargininemethylation incancer andotherdiseases. dependent antitumor activity in multiple MCL xenograft models. EPZ015666 represents a validated chemical probe for further of SmD3 methylation and cell death, with IC inhibition to EPZ015666led with lines cell methyltransferases.TreatmentMCL histone of other of panel a against selectivity (IC concentration inhibitory half-maximal a with assays biochemical in activity enzymatic PRMT5 of both in effects antiproliferative with PRMT5 of inhibitor selective and potent a of characterization and identification the describe we Here (MCL). lymphoma cell mantle particularly lymphomas, fromderived samples patient primary and lines cell overexpressionin observedits is and Protein arginine methyltransferase-5 (PRMT5) is reported to have a role in diverse cellular processes, including tumorigenesis, Mikel Melissa Margaret Kip L E in vitro A nature CH 9 7 D Agile D T ollegeville, layne Chan- hese authors contributed equally to thiswork. *e-mail: epartments of epartments iscovery D RT ctlzs h tase o u t to ehl rus to groups methyl two to up of transfer the catalyzes PRMT5 anielle Johnston selective inhibitor of A nancies, including lymphomasincludingnancies, several reports. PRMT5 is upregulated in in several highlighted humanis tumorigenesis malig in PRMT5 of importance he B iostructure Solutions, West P E ω C Moyer MIC P ore P N-iehl riie n rti substrates protein on arginine -NG-dimethyl ennsylvania, appalardi P A T B L BIOLOGY orter orter 1 echnologies and 1 , iology andMolecular 0 . Each type is defined by its ability to transfer onetransfer to abilityits by defined is type Each . T P potency inMCLmodels rupti Lingaraj enebre 8 , 6 1 . In addition, PRMT5 is reported to have a role 1 R S . PRMT5 is reported to participate in several U

obert obert | Adv 8 cott . Whether PRMT5 drives tumorigenesis by SA. 5 C 1 , , ω ambridge, Massachusetts, T a 6 N 1 -NG-monomethyl arginine and sym and arginine -NG-monomethyl D , 1– nce online public 4 9 hau FHo C epartment of epartment , athalie , Kristy GKuplast 3 , apabilities, GlaxoSmithKline, A 7 N . The mechanism behind the cell- the behind mechanism The . S Copeland igel JWaters 8 in vitro in -adenosylmethionine (SAM) as (SAM) -adenosylmethionine D , including histones H4 residue H4 histonesincluding , 1– iscovery, 1 3 , Kimberly , lung cancer lung , R 6 and ioux B , Kelvin iological Reagents andAssay E 1 a , pizyme, 3 , tion | 7 50 PM5 interacts PRMT5 . 1 in vivo in , 1 values in the nanomolar range. Oral dosing with EPZ015666 demonstrated dose- , MichaelJMunchhof R [email protected] 4 U , breast cancerbreast , ichard Chesworth www.nature.com/naturechemicalbiology 1 S , SA. I N nc., tickland R 1 models of MCL. EPZ015666 (GSK3235025) is an orally available inhibitor available orally an is (GSK3235025)EPZ015666 MCL. of models , 9 urse oy M 4 , Christina Genentech, SanFrancisco, C C ambridge, Massachusetts, ollegeville, 9 Nine . 6 PR , Khyati P 1 ollock - - - - ­ , 5

S P cott ennsylvania, oet n oal bovial ihbtr f RT wt anti with PRMT5 both in effects proliferative of inhibitor bioavailable orally and potent validate PRMT5 as aclinicallyrelevant target. further potentiallyexploreand to efforts in tool powerful a as used out to identify a potent and selective PRMT5 inhibitor that could be mark.Wemethyl enzyme-specific anof levels reductionin thusset the ability produce a phenotypic response that can be correlated to a compoundsdemonstrated hasrecent these advances,noneof these IC molar inhibitors of con (IC centrations enzyme-inhibition half-maximal biochemical with pounds PRMTs chemical activity of PRMT5 (refs. bio cell the track to used be can which SmD3, is which ofone ing, of methylateproteinsspecifically,can RNAinvolved PRMT5splic in knockdown that shown modulatesmethylationPRMT5 the statusproteins. ofseveral have More antibodies arginine ­dimethyl enzymes their and substrates containing arginine– methylated of biology the probe to used are antibodies arginine Pan-dimethyl activity. enzymatic PRMT5 for required is of symmetrically dimethylated PRMT5 substrates in the excised the in substrates PRMT5 dimethylated symmetrically of levels decreased Corresponding models. xenograft MCL several in activity antitumor dose-dependent demonstrated EPZ015666 of dosing manner.concentration-dependent Oral and time- a in di symmetric of inhibition with well correlatedinhibition Biochemical M D R evelopment, GlaxoSmithKline, pu ­methylationarginine-containingof substrates proliferationand ee e ecie ht s o u kolde h frt cell- first the knowledge our to is what describe we Here A number of groups have discussed small-molecule inhibitors of Majer 2 P , Jesse J bli A T Oza 1 &Kenneth W 17–

s R 1 h 50 , Lei Jin 2 5 with ibich ed 8 inhibition of a specific methyl mark in cells in mark methyl specific a ofinhibition . Although the majority of these reports describe com describe reports these of majority the Although . C U 6 2 alifornia, 22 SA. U

, , Kathleen o , 2 SA. P 4 n 50 with nanomolar biochemical IC nanomolarbiochemical with S 8 li

1 ) in the micromolar range, there are a limited set set limited a are there range, micromolar the in ) Raze A , 2 mith ne: 27 apr Warp A 3 nn Boriack- , U lejandra S T SA. herapeutics, uzanne LJacques D 1 , OlenaBarbash rive 5 C D T ancer in vivo il uncan C in vitro in B Gallagher 2015 | ollegeville, io, R C E 14– pigenetics C ambridge, Massachusetts, S aimondi ambridge, Massachusetts,

jodin d and and 1 , 1 9 o 6 * i P ). :

1 50 ennsylvania, 0 in vivo in ) of 22 nM and broad and nM 22 of ) 12 1 . 7 1 DPU , , , article 0 and 1 T 3 1 R 3 Suis ih pan- with Studies . 5 , 1 8 im JWigle , , yan Kruger , GlaxoSmithKline,

/ 50

models of MCL. of models n values or micro or values c h U e SA. m 26 , 2 b 8

i . Despite . U o U SA. . 1 SA. 2 8 , 1 5 0 ,

------1

© 2015 Nature America, Inc. All rights reserved. article to free enzymeand fit to competitive anduncompetitive forms ofthe EP of PRMT5. Figure 1|Identification,characterization andoptimization ofdiversity high-throughput screening (HTS) hitto apotent andselective inhibitor IC cal biochemi cell and biochemical the between observed were tions assay in Z-138 cells over 5 d of continuouscell- treatment.a correlaGood (3) and d, 4 over cells Z-138 in substrates arginine-containing of dimethylation symmetric of inhibition ing IC biochemical mentioned previously the (1) assays: three of nation combi a using tracked were SAR Potencypublication. future a subject of the be will EPZ015666 toward series this of optimization ADME The properties. (ADME) excretion and metabolism tion, distribu absorption, in and potency in improvements significant yieldingtolerated, well weregroup tetrahydroisoquinoline (THIQ) ships (SAR) emerging. Analogs with structural changes distal to the 0.4–7 from ( ogy, biophysical methods and X-ray crystallography. EPZ007345 ( members were further validated as inhibitors of PRMT5 by enzymol whose series chemical prioritized a ofidentification the in resulted that inhibited the enzyme in an intractable manner. These activities on a FlashPlate capturedthatwasmethylhistone group peptide a toH4 fromSAM orthogonal PRMT5:MEP50 activity an assay that included followed the screens transfer of these a tritiated hits; of subset a on formed per were wellscompound contaminants in compoundspresentor and artifacts HTRF forfollow-up.Counterscreens for selected was compounds 800 of subset a substructures, frequent-hitter known (PAINS)structures interferencepan-assay taining con compounds of removal the after and re-testing, and picking cherry approxiupon confirmed were hits the was of half Roughly rate0.7%. mately hit the wells, compound in inhibition percent 1 Table Supplementary ( molecules small 370,000 containing library diversity a screen to it used and PRMT5:MEP50 by peptide tions condi balanced under assay (HTRF) homogeneous fluorescence a time-resolved developed we PRMT5, of inhibitors identify To Tool compound discovery RES direct consequence of PRMT5 inhibition. strongly tumors 2 show that for Fig. 1 Fig. a O

Z019896 ( 50 n O assay, (2) a cell biochemical IC biochemical cell a assay,(2) =1).( U 2 9 50 to monitor the monomethylation of H4R3 on a histone H4 histone a on H4R3 monomethylationof the monitor to LTS N H a N H aus wt a aeae hf bten h to sas of assays two the between shift average an with values, ) was part of a 17-member series with IC with series 17-member a of part was ) N H NN EP d ( HTS hitEPZ007345 ) a NN Z015666 isaselective andpotent inhibitor of n μ L , b =2for eachcompound shown). ( igand-affinity mapsof EPZ019896 EPZ015666 M with early evidence of structure-activity relation structure-activity of evidence early with M IC IC ) Structures ( IC 3 50 50 1 O 50 and a redox assay =326nM =>10 =22nM α ugs ta te nirlfrtv efcs ee a were effects antiproliferative the that ­suggest O H N O K i H N represents thebindingconstant oftheinhibitor to theenzyme-SAM complex (experiments performed with µ (3) (2) OH OH M ). With a cutoff of 3 s.d. from the average the from s.d. 3 of cutoff a With ). (1) OH a ) andrepresentative N N N EP 3 2 Z015666 across thefamily trees of humanarginine methyltransferases andlysine methyltransferase enzymes to identify reactive compounds 50 in-cell western assay follow assay western in-cell Supplementary Results Supplementary b Inhibition (%) 100 c 40 80 60 20 0 ) C IC EP heng- 01 50 Z015666 isaSAM-uncompetitive, peptide-competitive inhibitor of plot( proliferation IC ­proliferation 50 3 P 0 values ranging values and additional and rusoff equation( P RM log (nM) b nature 2 EPZ019896 EPZ015666 EPZ007345 ) ofinitialH T 5. 34 ch and and e mic 1 Na 50 T ------) O S-hit

5 a nline Methods), inwhich l t

with crystallographic data for the ternary PRMT5:MEP50–SAM– ternary the for data crystallographic consistentwith inhibition), of mode uncompetitive an purposes, tical prac all for (i.e., binding SAM by augmented greatly was enzyme tor had some modest affinity for the free enzyme, its affinity for the ( inhibitoranconstant yielded saturatingatinhibition model [SAM] ( concentration SAM IC the of dependence curvilinear descending, the by demonstrated clearly as SAM, to respect with uncompetitive was yielded a tion ( IC the of dependence linear ascending, an by demonstrated respect as substrate, peptide with the to inhibition competitive of pattern unambiguous an consistently ( was turnover 93% of enzyme inhibition maximal a in resulting residual observed, of amount small a Note Supplementary identified with a biochemical IC of result direct a were cells PRMT5 inhibition. Z-138 in effects antiproliferative high-throughput-proliferationIC and methylation cellular between ~10× ( no inhibition up to the maximum tested concentration of 50 of concentration tested maximum the to up inhibition no showingmethyltransferases,protein other 20 of panel a against ity selectiv exquisite demonstrated EPZ015666 substrate. accepting group–methyl the beforebinds SAM which formationcomplexin indicatepreferredmight a forbinding productive sequence ternary uncompetitive nature of EPZ015666 inhibition with respect to SAM binding substrate of order random a follow to reported been has PRMT5 below). complex(described EPZ015666 ( both for tool appropriatebiological an kg mg 10 administrationof kg mg 2 at dosing min ml 30 of clearance plasma with mice, in profile pharmacokinetic against PRMT9. The compound shownwas also to have a favorable ( biology α 1 Fig. Supplementary Fig. 2 1 Fig. d PRMT1 c EP u PRMT8 K 50 fe a ubr f trtv dsg cce, P056 ( EPZ015666 cycles, design iterative of number a After PRMT3 Legend: Z007345, tool compound re K values ( values i −1 ) of 20 i (M) Fig. IC50 (nM) kg Supplementary Fig. 1a d b 40 80 60 20

PRMT6 | Adv ), the cause of which remains unclear. EPZ015666 showed unclear.EPZ015666 remains which of cause the ), ). At the time of this writing we had not evaluated activity evaluated not had we writing this of time the At ). 0 PRMT7 chemic −1 K

CARM1 1 05 10 , a volume of distribution of 1.7 l kg l 1.7 of distribution of volume a , i ± c value of 5 –9 ); fitting of these data to a competitive inhibition model Supplementary Fig. 1b Fig. Supplementary a 0.9 nM. These results indicate that although the inhibi nce online public > 10 PRMT5 [Peptide]/ –5 −1 , and oral bioavailability of 69% following oral following 69% of bioavailability oral and , a K ± Fig. 1 Fig. ). At saturating concentrations of EPZ015666, i represents thebinding constant oftheinhibitor 50 l 0.3 nM. Inhibition of PRMT5 by EPZ015666 10 K ). value on the peptide substrate concentra substrate peptide the on value M b EP iolog c −1 ); fitting the data to an uncompetitive an to data the fitting ); . EPZ015666 was therefore selected as therefore selected was EPZ015666 . Z015666 andinactive analog a 15 ). A similar relationship was observed DOT1L tion | 50 of 22 SMYD3 ), suggesting that the observed observed the that suggesting ), www.nature.com/naturechemicalbiology IC (nM) 50 y P SMYD2 200 300 100 RM

± d 0 in vitro in 14 nM ( oi 01 T 5:M : 10.1038/n SETD7 SETD2 n EP EZH1 3 =2;datashown and and −1 3 [SAM]/ . Nevertheless, the the Nevertheless, . 50. n after intravenous after = 12; EZH2 WHSC1 WHSC1L1 NSD1 23 IC in vivo in ± 50 ch K 50 3% ( 3% value on the the on value M datawere

Fig. 1 e mbio SETDB1 studies n EHMT2 SUV39H1

EHMT1 2 = 12) = b was ) 4

.181 and and μ

M

0 - - - -

© 2015 Nature America, Inc. All rights reserved. Na a group capable of maintaining a favorable quadrupole moment quadrupole favorable a maintaining of capable group a the THIQ phenyl ring of EPZ015666 were consistent with requiring related but inactive analog, closely EPZ019896 ( a produced THIQ the of ring phenyl the of Removal type. which to our knowledge is the first example of an interaction of this cation- a in involvedinteraction with clearly the partial positively was charged THIQmethyl group the of SAM, of ring phenyl The ( moiety THIQ bulky the accommodate to backbone the and chain side the both at changeconformational significant went had a role in directing symmetric arginine methylation a groupformed nitrogen THIQofsystem.THIQ ringThe the tertiary the tionwith enzyme catalysis, Glu435, was engaged in a water-mediated interac chainsside of Glu444. Another residue thoughtimportant tobe for methyl transfer. These included the backbone NH of Phe580 and the dues that are postulated to be involved in the catalytic mechanism of directly with many of chain the side residues involved arginine in substrate peptide the binding or by resi to bind in the peptide-binding site, including in the pocket occupied found was compound the data, enzymological the with Consistent ( SAM and EPZ015666 with for this compound, we obtained a crystal structure of PRMT5:MEP50 To understand further the mechanism of inhibition and SAR trends Characterization ofuniquecation- EP SAM- orsinefungin-bound had modestaffinity for SAH-bound bound ( studies of to thebindingmodeofligand withdifferent nucleotides.( SFG (magenta; structures of site and (gray; ( density for theligand isshown at1.0 complex (green) inthepresence ofSAM (yellow; surface plasmonresonance. Figure 2|Characterization ofEPZ015666 bindingmodeusingX-ray crystallography and a nature CH the in EPZ015666 and PRMT5:MEP50 of structures co-crystal To confirm further the feasibility of this interaction, we determined d g b Response units ) sinefungin-bound ) Superpositionof Z015666 andSAM contributed >3kcal mol 10 0 Phe580 5 Glu444 t PDB P u RM 0 P no binding re he327 changes conformation significantlyto accommodate theinhibitor. ( Time (s) EP accession E Leu437 Apo, T MIC 100 Z015666 bindingto ( 5:M EP

Glu435 chemic PDB A Z015666 boundto H L BIOLOGY 200 EP 2 O π 50, confirming theSAM-uncompetitive mechanismofinhibition. accession - EP π 4GQ P stacking interaction with Phe327. This residueThis Phe327. interactionwith stacking Phe577 Phe327 Z015666-SAM (green andcyan, respectively) andH4peptide–SFG RM SAM e B

T | Adv P Response units ) complexes reveals that 10 5:M a RM 0 ( 5 a 4X6 l ) T a EP Fig. 2 Fig. b C 5:M nce online public 0 d K SAH-bound bc rystal structure of 50. 0 P D ) apo- Time (s) P iolog =171nM σ RM ) andSAH (cyan; RM EP 100 . Selectinteractions are shown by dashedlines. EP Phe580 a T 50 ( and and T Z015666 bindingoccurred onlywithaminonucleoside- 5:M P 3 5:M Glu444 200 4 RM Te opud interacted compound The . p K 3 EP D −1 EP ). In addition, SAR around bindingmode T Supplementary Table 2 Table Supplementary <1nM),indicatingthatthecation- y ofbindingenergy. 5:M 50 complex inthepresence ofSAM (green), 50 ( H

PDB d 2 Glu435 O oi a f EP K EP tion |

EP Response units 10 accession : 10.1038/n D PDB 50 and( 0 5 = 171 nM)andhighaffinity =171 for Z015666 bindsinthepeptide-binding Z015666 (cyan) bound to Phe327 Phe577 accession www.nature.com/naturechemicalbiology 0 SAM-bound K 3 Time (s) d D 5 and under <1nM – e 100 g ) SAH-, ( 4X6 ) Surface plasmonresonance Fig. 2 Fig. ch 200 1 e 4X6 ). mbio T b f 3 he 2 3 ). ). π ) SAM- and 6 - - - . ) show nochange

.181 g

F Response units o has been reported in lymphomacomparedcells linesnaivein B reportedto cell been has dependent decrease in the the in decrease concentration-dependent a to led treatment EPZ015666 SDMA. using noblot ( cells Z-138 in dimethylationarginine symmetric cellular on treatment EPZ015666 of effects The enzyme. this on dependentare that lines cell upregulatedin is activity PRMT5 cancer samples most of the published literature shows PRMT5 upregulation in primary lines ( sistentlyupregulated MCLincelllines compared otherto cancer cell body symmetric dimethyl arginine (SDMA) were inhibitors.not shown to be con PRMT5 with antiarginine Interestingly, symmetric pan-dimethyl treatment the and PRMT5 upon effects proliferation and levels methylation cellular in changes assess Granta-519 to used Mino, was Maver-1,Jeko-1) and (Z-138, lines cell MCL five of panel A Characterization ofcell methylation andproliferation were agreement ingood ( techniquesindicatingtwo that method, the single-kinetics the with min 130 and method tracer the with min 94 be to determined was single-cycle kinetics. The half-life of EPZ015666 on PRMT5:MEP50 hit (HTS) ( compound screening high-throughput fast-on/fast-off the using measured was PRMT5:MEP50 from EPZ015666 of rate sociation taneouslywith ( SAM running buffer; therefore EPZ015666 must dissociate first or simul 10 - 0 5 0 F c P electron π RM Sinefungin-bound interaction of c ) EP 0

Supplementary Figs. 6 K

C

T Time (s) Z015666 D rystal 5:M <1nM 100

EP

1 200

) 50 4– as a tracer molecule to probe the complex and SPR and complex the probe to molecule tracer a as 6 . More work is required for an understanding of how srkn efc o EZ166 idn on binding EPZ015666 on effect striking a was stable upon withdrawal of SAM from the the from SAM of withdrawal upon stable was complex PRMT5:MEP50–SAM–EPZ015666 the that showed studies SPR Further assay. SPR mol cation- SFG-boundPRMT5:MEP50 indicated that the or SAM- versus SAH- for EPZ015666 of ties and slowly. dissociated very Comparing affini EPZ015666 with very high affinity ( andSAM- SFG-bound PRMT5:MEP50bound ( EPZ015666 for affinity SAH-bound modest a had PRMT5 EPZ015666. bind showed to ability Apo-PRMT5:MEP50 no analog. side nucleo bound the of identity the of basis the ( well superimposed EPZ015666 and structures protein PRMT5 three The group. methyl the and mimic, SAM a (SFG), sinefungin of ­presence of the SPR sensorgrams in Examination surfaces. PRMT5:MEP50 bound SFG- and apo- SAM- against SAH-, and examined PRMT5:MEP50 was EPZ015666 of cation- the of contribution the characterize to it used ( PRMT5:MEP50 for assay (SPR) resonance plasmon surface a due to cation- the likely most were complexes SFG or SAM and SAH between seen potency in differences any seen as in the protein SAM and the SFG structures. with Therefore, interactions same the all ing ofmode the compound, as EPZ015666 has SAH structure did not change the overall bind the in groupcharged positively the of absence moiety.chargedpositivelyThe the from Å 3.8 3.6– oriented was THIQ of ring aryl the SFG, K i. 2 Fig. SupplementaryFig. 4 D To test this hypothesis further, we developed = 171 nM) and dissociated rapidly, whereas −1 S Supplementary Fig. 5 f idn eeg i te reductionist the in energy binding of aeoyhmcsen (A) without (SAH), -adenosylhomocysteine π π c and nest o mlil bns including bands, multiple of ­intensity . o te tutrs ih A and SAM with structures the For ). interaction contributed at least 3 kcal interactioncontributed3 leastat interaction to binding affinity. Binding 7 ). Although PRMT5 over Fig. 3 Fig. π upeetr Fg 3 Fig. Supplementary interaction. a ). Additionally,). dis the ) were tested by immu by tested were ) Figure 2d ). article – K ­expression g D revealed < 1 nM) and ) 1 , 2 3 ------,

© 2015 Nature America, Inc. All rights reserved. article EPZ015666 for 4 d did not show in any significant decreases in in decreases significant any in show not did d 4 for EPZ015666 treatedwith cells Z-138 H3R8me2s, and H4R3me2s recognizing ies antibod custom-made and commercial both using experiments In histones. acid-extracted of analysis blot western by evaluated were cating binding specific of active the compound to PRMT5 incells. of presence the in PRMT5 EPZ015666, but not ofof curve melting the in shift °C 5.9 a in resulted characteristics) culture favorable their of because in-house (CETSA) assay with a recently described technique known as the cellular thermal shift Figs. 9 SmD3 were calculated to determine the IC total to SmD3me2s of ratios densitometry,and by quantified were blots western the from SmD3me2s of Levels tested. lines cell all antibody.in SDMA the observed usingwere SmD3me2s in blotting decreases Concentration-dependent western by assessed and 4 day on harvested were EPZ015666 of titration dose a with treated similar controla structurally ( ( knockdown PRMT5 by dimin ished were cells EPZ015666-treated in seen bands substrate The same knockdown. protein >60% achieved and lines cell knockdown PRMT5- Z-138 stable generate to (shRNA) RNA hairpin short used we substrates, PRMT5-dependent cellular confirm To further SmD3. substrate PRMT5 reported previously the with colocalized that one Supplementary Figure 17 temperature; error bars denote point plotted in the s.e.m. Alldatawere analyzed usinga presence oftheinactive compound ( cell lysates. showed stabilization of this specificband.( that intheuncropped S T 50% reduction inSm a dosetitration of0.0003–5 12-d shR including Sm ( target inhibitionasdetermined by SMD Figure ofEPZ015666 3|Effects andcontrol compound 4 sensitive however,status; methylation H2AR3me2 investigatedWe histonemethylation ( global levels c a bc a he Sm

) ) 20 kDa Percentage of unheated 30 kDa 15 kDa Further confirmation of target engagement target of confirmation Further lines cell MCL of panel the from lysates whole-cell Therefore, The effects of PRMT5 inhibition on cellular histonemethylationcellularinhibitionon PRMT5 of effects The N C control oncentration-dependent inhibitionofcellular SM o shift inmeltingtemperatureso shift was observed for 100 120 40 80 60 20 0 D and N 0 cellular thermalshiftassay 3me2s blotwas cropped andtheintensity decreased relative to 40 A knockdown of 40 PRMT5 meltingcurve T Temperature ( D 10 D he meltingtemperature for 0.0003 3, after 4doftreatment3, after with 45 and b 3

and 0.001 7 50 EP . Assays with pretreated A375 cells (routinely used used (routinely cells A375 pretreated with Assays .

b 0.005 Z015666 ) A375 cells treated for 18hwith1 D Supplementary Table 3 55 c

° 0.02 3me2s signalwhennormalized to theSm C) represents themeanofthree replicates for each D P 60 RM 3

MA blotto more clearlydistinguishchanges in 0.08 . (

P 65 0.31 Fig. 3b RM T μ EPZ015666 DMSO

5 incellularanalysis thermalshift inwhole- 1.25 M compound. ± T Fig. 3

s.e.m. Full Sm 5 5 inZ-138 cells.

Fig. 3 Fig. 0.0003 , 3 c , asany changes observed were within and and 0.001 Supplementary Figs. 12 Figs.Supplementary a

and and Percentage of unheated 0.005 a A P B ), but not by treatment with treatment by not but ),

RM control oltzmann sigmoidalfit. Supplementary Fig. 11 western blotandCETS

100 0.02 120 3 40 80 60 20 EP 0 T

Supplementary Fig. 8 0.08 T

he 12-d knockdown ledto a 0 D Z015666 or cellular thermalshiftassay 50 5 was by shifted 5.9 ° 40 0.31 3 blotscanbefound in ). values ( 40 PRMT5 meltingcurve C Temperature ( 1.25 ells were treated with

in vitro in 45 5 D P shRNA +– μ –– A substrates, RM 50 3 M Supplementary Supplementary oncellular 55 3 T EP SmD3me2s (SDMA) ° compound ( Doxycycline SDMA, fullblot was achieved achieved was SmD3 total compared to PRMT5 5 inthe C) nature

Z015666 60 D SmD3me2s 3 total. E 65 and A ach DMSO 3 ), indi . µ C ch

M) ). . 13 e mic Na 3 ). ). - - - , a l t

f ilgcl ehnss rvn y RT-eitd arginine PRMT5-mediated methylation incancer and other indications. by driven mechanisms biological of evaluation biological chemical the in watershed a represent could compound this of identification The models. tumor xenograft in demonstrated both has that enzyme methyltransferase arginine an of inhibitor described first the also is ToEPZ015666 knowledge,identified. our been now has A cancers. multiplecell-potent of and drivers orally are bioavailable methyltransferases inhibitor these of that PRMT5, ing EPZ015666, demonstrat in successful been has compounds tool selective and potent of identification the which for family enzyme yltransferase (refs. EZH2 DOT1L clinic. the in patients benefit will that strategies ing defin in assist to also but inhibition, methyltransferaseprotein of effects biological the investigate to only not necessary are probes oncogenesis.molecular High-qualityin roles their andtransferases criti methyl arginine about are known is that less development, cancer patterns for cal expression gene regulate to have shown and been studied widely are methyltransferases lysine Although cancers. human of driver potential a as importance gaining is tion biological role. In particular, the misregulation of significant arginine methyla a have to recognized increasingly is substrates histone non and histone both on methylation arginine and lysine Protein DISC respectively ( dose, highest and dose lowest the at achieved mark methyl the of tumors at day 21; >66% and >95% for Granta-519 dose-dependent tumors at day 18) showed 21 daychanges of >40% and >95% inhibition on (>48% and >87% for Maver-1 collected tumors xenograft Z-138 ELISA, SDMA the In blot. western SDMA the complement to and throughput higher for allow to ELISA SDMA quantitative group and no other observations clinical ( n egt vlm ad uo got cmae t vehicle-treated to compared growth tumor and volume weight, in groups measured on day 21 showed statistically significant differences ( models MCL both in mark pharmacodynamics and tumor-growth inhibition (TGI). tissues were analyzed to determine the relationship between methyl- 21 d of continuous dosing, animals were euthanized, and blood and 25, 50, 100 and 200 mg per kilogram of body weight (mg kg xenografts, with twice-daily (BID) oral dosing on four groups: dose Maver-1and Z-138 subcutaneous bearing mice (SCID) deficiency immuno combined severe in studies efficacy 21-d We performed to amenable and bioavailable orally is EPZ015666 A Fig. 14 IC with lines, cell MCL additional in observed also were EPZ015666 with effects ( respectively Maver-1cells, and Z-138 IC with antiproliferative effects, concentration-dependent potent demonstrated EPZ015666 d. 12 over growth cell of measurement pro the for long-term allowing assay a liferation of development the necessitating days, several technologies for assessing arginine methylation remain challenging. and specific three models, with minimal bodyweight loss in the 200 mg kg mg 200 the in loss bodyweight minimal with models, three ( group and showed dose-dependent with efficacy 45% TGI in the 18 200 mg day kg on endpoint reached that model fast-growing a line, cell 519 TGI. Additionally, a third MCL xenograft was tested using the Granta- >70% showedMaver-1 whereascells d, 21 after TGI >93% with cells, kg mg 200 at Dosing tumors. biology u ntitumor effects inMCLxenograftntitumor effects models o measure To EPZ015666 showed dose-dependent exposure and TGI after 21 d d 21 after TGI and exposure dose-dependent showed EPZ015666 over manifested inhibitor the of effects antiproliferative The re U and Supplementary Fig. Supplementary

SSION | Adv chemic Supplementary Table 3 ­antibodies to this mark have been difficult to obtain, and a 11 Fig. 4e 50 nce online public values ranging from 61 to 904 nM ( nM 904 to 61 rangingfromvalues , 39 n vivo in , 4 , 0 a f ae eet xmls rm h lsn meth lysine the from examples recent are ) and l target inhibition, we developed a highly highly a developed we inhibition, target i. 4c Fig. b Supplementary Figs. 17 iolog

15 in vivo in −1 a ). EPZ015666). waswell tolerated allin tion | , BID induced tumor stasis in Z-138 Z-138 in stasis tumor induced BID d 50 ). Tumors in all EPZ015666 dose dose EPZ015666 all in Tumors ). values of 96 nM and 450 nM for nM 450 and nM 96 of values target engagement and efficacy efficacy engagementandtarget ). www.nature.com/naturechemicalbiology y

Fig. 4a Fig. d Supplementary Fig. 16 oi : 10.1038/n , b ). Antiproliferative). – Supplementary Supplementary in vivo in 22 ch ). e mbio −1 studies. ). After −1 3 8 dose dose and and .181 ). −1 0 ------

© 2015 Nature America, Inc. All rights reserved. Na to use because of the low-throughput method of investigating multiple and in PRMT5 of role the investigateto technologiesinterference explored can further be ogy and validated. Previous studies RNA used need for potent and selective inhibitors of PRMT5 so that its pathobiol cell-cycle death, andeffects RNA processing, an is area this still of active investigation. cell including oncogenesis, driving in PRMT5 for cancers different cancers, including lymphoma plastic cells. PRMT5 has been shown to be upregulatedneo in a andnumber of normal both in PRMT5 of roles physiological potential of in both the cytoplasm and the nucleus has provided an understandingfamily of PRMTs. The variety of reported PRMT5 substrates that exist substratesamongthe of collections largest the of one with mammals, as apositive control. **** group). Z-138 T represents the ratio of S and ( (data shown asmean administration was stopped onday 21,andtumors were harvested for pharmacodynamic analysis in water) for 21dattheindicated dosesfor ( activity induced by and 8. compound (see key). Reagent Assay) over 12dinculture. ( cell linesandxenografts inSCID mice. Figure 4|EPZ015666 on effects nature CH lossofprotein incells. We have shown inincompletethis studyoften the that and even smalla effects off-target as well as lines, cell tumor e a c b he horizontal linesrepresent group meanvalues Percentage of control Tumor volume –1 ) Maver-1 cells by 3 Viable cells ml The multitude of reports implicating PRMT5 in cancer reflects the multitudeThethe implicatingofreports reflects cancer in PRMT5 in methyltransferase arginine symmetric major the is PRMT5 (vehicle avg) 10 10 10 10 10 10 (mm ) 10 in vivo in t f 100 120 2,000 ) Maver-1 xenograft tumor tissue collected from mice euthanized on day 21. 2,500 4 8 6 9 5 7 3 1,000 40 1,500 80 60 20 E u 0 500 ach pointrepresents themeanfor three replicates ateachconcentration. ( 0 6 with EPZ015666orcontrol Z-138 . Although many groups have reported various mechanisms various reported have groups many Although . re Z-138 cellproliferatio 0 12 Z-138 xenografttumor E MIC models of cancer. This type of system has proven difficult provendifficult has system of cancer.type of This models

Vehicle after treatment 3456 0 ELI –1 Treatment period(d) 25 mg kg BID chemic A Time (d) SA includedsamplesfrom theZ-138 cell linetreated 41 L BIOLOGY –1 200 mgkg 100 mgkg 50 mgkg Vehicle, 0.5%MCBID 50 mg kg BID 25 mgkg BID 71 EP –1 78 C

± 100 mg kg BID Z015666 administration of ells were counted and replated at the original seeding densities on days 4 s.e.m. for ten animalspergroup). (

D –1 1 –1 –1

P 200 mg kg BID 91 –1 MA to total Sm BID BID –1 <0.0001 versus vehicle, one-way analysis ofvariance witha BID n BID 01 41

| Adv Z-138 DMSO s 11 a 8

Z-138 5 µM 2 l in vitro 21 a EPZ015666 in vitro b nce online public **** **** **** **** C 100 mgkg 25 mgkg EPZ015666 Z-138 5 Z-138 DMSO 200 mgkg 50 mgkg Vehicle iolog 0.3125 1.25 5 DMSO 0.0000763 0.000305 0.001221 0.004883 0.019531 0.078125 ells were treated withadosetitration of0.0007–5 µ (measured by cell viability as determined by Guava ( M µ a cellular proliferation and D EP M , µ µ b 3 normalized to the vehicle control, as measured by –1 –1 1– M M Z015666 or vehicle (0.5% methyl-cellulose (M –1 BID ) µ BID –1 µ c µ 3 BID µ µ M BID M ) Z-138 and( M I , breast , M µ M nhibition ofproliferation of( M y ±

s.d. for two replicates per sample (ten mice per d f b d oi a 5 –1

, lung Percentage of control Tumor volume tion | 3 Viable cells ml : 10.1038/n 10 10 10 10 (vehicle avg) (mm ) 10 e 100 4,000 2,000 120 3,000 8 6 9 5 7 d 1,000 Maver-1 , 40 80 60 20 f ) Maver-1 xenografts. 0 ) 0 with EPZ015666orcontrol 4 www.nature.com/naturechemicalbiology Maver-1 cellproliferation and colorectal P 0 12 Maver-1 xenografttumors RM 05 after treatment

Vehicle 3456 T **** in vivo 5 target inhibitionin( Time (d) ch –1 Treatment period(d) in vitro in in vitro 200 mgkg Vehicle, 0.5%MCBID 100 mgkg 25 mgkg 25 mg kg BID 50 mgkg e **** mbio 10 –1 78 antitumor activity in MCL

a 50 mg kg BID ) Z-138 and **** with - - –1 –1 91

–1 BID BID –1

–1 15 BID .181 BID

100 mg kg BID 01 **** 11 rf mdl, ih er 5 TI bevd fe 2 d of d 21 after observed TGI 95% near with models, graft xeno MCL multiple in activity antitumor dose-dependent strated demon EPZ015666 of dosing Oral CETSA. byshown was PRMT5 Further for evidence cellular target engagement of EPZ015666 with concentration-dependentmanner.and time- a proliferationin and substratesarginine-containing of dimethylation symmetric inhibi of tion with well correlated inhibition Biochemical far. so tested enzymes methyltransferaseprotein other all against EPZ015666 of active enzyme site. SAM-dependent We believe a that this interaction withinmay contribute an to type the of selectivity example this first of the interaction knowledge, our to is, SAM cofactor and known cation- a for potential The enzyme. methyltransferaseproteinany in previously observed been not has a unique binding mode within the substrate channel of PRMT5 that has PRMT5, exemplifiedbeen and characterized. X-ray crystallography revealed of inhibitor bioavailable orally and cell-potent first C EP E c

–1 20 0 ompound 2 ach point ,

d 200 mg kg BID Z015666 for 4 d In summary, the action of EPZ015666, to our knowledge the the knowledge our to EPZ015666, of action the summary, In ) Antitumor **** **** **** **** 25 T

200 mgkg Vehicle 100 mgkg 25 mgkg 50 mgkg ukey test. μ 4 e 0.0000763 0.000305 0.001221 0.004883 0.019531 0.078125 0.3125 1.25 5 DMSO M 2 ) Z-138 µ C ; however, the key cation- V M ) µ

ia M ELI –1 µ –1 C –1 M BID BID –1

µ ount µ BID µ BID µ µ M M SA. M M µ M M of stable knockdown cell lines and cells treated cells and lines cell knockdown stable of ment of methylation at this site remain. The use assess the to challenges technical and obtain, to difficult been have antibodies H2AR3me2s arginine ( dimethyl asymmetric monomethyl and arginine marks, methyl contaminating through rigorous testing against two of the most that were highly specific and sensitive to SDMA result, we generated our own custom antibodies for a As nonspecific. as identified were H4R3me2s available were that H3R8me2s those and available antibodies, commercially no were histone antibodies. Early on in our studies there tones, with both commercial and custom-made his acid-extracted of analysis blotting western by and methylation histone of molecules knockdown shRNA small both using tested inhibition were PRMT5 of effects The H4R3. and H3R8 methylationH2AR3, of the through tion notypes and thus confounding interpretation. sub phe detectable no or partial relevant in resulting strates, physiologically on methylation amount of remaining enzyme can lead to residual r utm. hs eut a osre despite observed was result This custom). or with blotting (commercial reagents western antibody specific highly by detected as levels H3R8me2s or H4R3me2s global in decreases with EPZ015666 did not result in any significant tion of PRMT5 through histone methylation. gationintotranscriptional the regulatory func PRMT5 inhibitors will allow for further investi reports few a by suggested as level, global cannot a on that detected be promoters gene specific at tion methyla histone of modulation potential the out rule not do results Our reagents. antibody specific highly with even possible notmightbe abundance low in already is that population a loss of one or two methyl groups on arginine in the of detection Therefore,methylation. lysine to comparedhistones of on methylation arginine abundance low the is cells in methylation to the lack of detectable histoneglobal arginine contributing Also antibody). SDMA by sured (mea substrates arginine dimethylated tiple complete reduction of the methyl mark on mul Supplementary Fig. 23 RT i rpre t mdlt transcrip modulate to reported is PRMT5 1 π , 3 interaction between EPZ015666 , 7 π , 4 1 interaction involving SAM is SAM involvinginteraction . The existence of cell-potent of existence The . ). Sensitive and specific article ­dosing. 5 ------© 2015 Nature America, Inc. All rights reserved. article 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. R 4X6 codes accession under deposited codes. Accession version of the in available are references associated any and Methods M published online27 R across multiple cancer indications. strategy therapeutic a defining in assist potentially and PRMT5 of roles biological the about more understand to used be could that compound probe powerful a is EPZ015666 We believe inhibition. PRMT5 of consequence direct a were effects antiproliferative that the suggested strongly tumors excised dimethylated the in symmetrically substrates PRMT5 of levels decreased Corresponding 6

eceived 7December 2014; accepted 1

eferences

ethods

methyltransferase 1 (CARM1). 1 methyltransferase (2009). 2924–2927 (CARM1). 1 MethyltransferaseArginine (2011). 7814–7821 CARM1. and PRMT1 N-methyltransferases arginine methyltransferases. activity.cellular and selectivity enzyme inhibitors: 1 methyltransferase argininecoactivator-associated pICln. factor assembly snRNP U putative the (2001). 8289–8300 proteins. Sm dimethylarginine-modified produces pICln, ribonucleoproteins.Sm-class of biogenesis PRMTs.other by scavenging substrate causes complexes.protein arginine-methylated SAP145. factor splicing Sci. Life humans. in role physiological the and perspectives new function, activity. methyltransferaseprotein contains and kinases Jak with interacts Hsl7p Sci. Biochem. development. and control growth in methylation PRMT5-induced of Biol. genes.suppressor tumor NM23 and ST7 of expressionregulates negatively and 8 arginine H3 histone methylates PRMT5 SWI/SNF-associated J. EMBO 71 4. death cell programmedsuppressor tumor the of methylation arginine by growth tumor accelerates 5 methyltransferase arginine cascade. signaling 3-kinase/AKT phosphoinositide the and kinases cyclins/cyclin-dependent G1 upregulatesthat lymphoma. cell mantle in methylation H4R3 cells. lymphoma and leukemia suppressorsin tumor of family RB the of transcription silencing. (PRC2) 2 complexrepressor polycomb and pathwaysuppressortumor retinoblastoma the of reactivation through death cell lymphoma induces Purandare, A.V.Purandare, T.Huynh, Dowden, J. Dowden, D. Cheng, D. Cheng, Meister,G. W.J.Friesen, G.B. Gonsalvez, Dhar,S. of analysis proteomic A S. Richard, & Boulanger,M.-C. J.,F.-M., Côté, Boisvert, Yang,Y. about update an family: methyltransferase arginine protein The Wolf,S.S. B.P.Pollack, VersatilityS. Sif, & A.N. Imbalzano,V.,Karkhanis,Y.-J., Hu,R.A., Baiocchi, Human Tempst,S. Erdjument-Bromage,P.Vishwanath,Sif,H., S.N., S., & Pal, E.C. Cho, Protein K.S. Ullman, & Welm,A.L. Factor, Fay,R.E., M.M., M.A., Powers, Wei,T.-Y.W. S. Pal, the suppresses 5 methyltransferase arginine Protein S. Sif, & S. Pal,Wang, L., J. Chung, 3 , 5579–5587 (2011). 5579–5587 , for SAH.

24 et al. et , 9630–9645 (2004). 9630–9645 ,

J. Biol. Chem. Biol. J. the pape the 66 et al. et et al. et

31 et al. et J. Biol. Chem. Biol. J. et al. et et al. et et al. et al. et , 2109–2121 (2009). 2109–2121 , et al. et Low levels of miR-92b/96 induce PRMT5 translation and H3R8/ and translation PRMT5 induce miR-92b/96 of levels Low et al. et , 1785–1797 (2012). 1785–1797 , et al. et et al. et

et al. et Loss of the major Type I arginine methyltransferase PRMT1 methyltransferase arginine I Typemajor the of Loss PRMT9 is a Type II methyltransferase that methylates the the methylates that methyltransferase II Type a is PRMT9 36 Protein arginine methyltransferase 5 (PRMT5) inhibition (PRMT5) 5 methyltransferase arginine Protein Arginine methylation controls growth regulation by E2F1. by regulation growth controlsmethylation Arginine Methylation of Sm proteins by a complex containing PRMT5 and and PRMT5 containingcomplex a by proteins Sm ofMethylation Optimization of pyrazole inhibitors of Coactivator Associated Coactivator of inhibitors pyrazole of Optimization Small molecule regulators of protein arginine protein of regulators molecule Small 3,5-Bis(bromohydroxybenzylidene)piperidin-4-onesNovelas et al. et , 633–641 (2011). 633–641 , et al. et Small molecule inhibitors that discriminate between protein between discriminate that inhibitors molecule Small Mol. Cell. Biol. Cell. Mol. Protein arginine methyltransferase potentiala is 5 oncoprotein Protein Data Bank (PDB): Structures have been been have Structures (PDB): Bank Data Protein The human homologue of the yeast proteins Skb1 and Skb1 proteins yeast the of homologue human The The methylosome, a 20S complex containing JBP1 and JBP1 containing complex 20S a methylosome, The r J. Biol. Chem. Biol. J. . Pyrazoleinhibitors coactivatorof associated arginine Two distinct arginine methyltransferases are required for required are methyltransferases arginine Twodistinct A

274 pril 2015

Nat. Commun.Nat. 288 , 31531–31542 (1999). 31531–31542 , , 35534–35547 (2013). 35534–35547 , Bioorg. Med. Chem. Med.Bioorg. J. Med. Chem. Med. J.

Cancer Sci. Cancer 28

279 , 6262–6277 (2008). 6262–6277 , 4X6 , 23892–23899 (2004). 23892–23899 , Mol. Cell. ProteomicsCell. Mol.

doi:10.1038/ncomms742 Bioorg. Med. Chem. Lett. Chem. Med.Bioorg. 1 J. Cell Biol. Cell J.

103 for SAM, for Curr.Biol. A

EMBO J. EMBO Sci. Rep. Sci. 54 , 1640–1650 (2012). 1640–1650 , pril 2015; , 4928–4932 (2011). 4928–4932 , Lett.

Org. Biomol. Chem. Biomol. Org. 178 11

3 26 18 , 1990–1994 (2001). 1990–1994 , , 1311 (2013). 1311 , 4X6 , 733–740 (2007). 733–740 ,

, 3558–3569 (2007). 3558–3569 , Mol. Cell. Biol. Cell. Mol. 2 , 4438–4441 (2008). 4438–4441 , , 1319–1330 (2003). 1319–1330 , 0 nature for SFG andSFG for 8 Cancer Res. Cancer Mol. Cell. Mol. (2015).

Cell. Mol. Cell. 19 , Trends online ch

21 9 e , mic

, Na a l t

33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 23. 22. 42. 41. 40. 39. 38. 37. 36. 35. 34. Correspondence and requests for materials should addressed to be K.W.D. information is available online at information is available inthe Supplementary information, chemical compound information and chemical probe A ver The authors declare competing interests: financial details are available inthe Competing financialinterests and interpreted results. K.W.D., E.C.-P., K.G.K.,T.J.W. and P.A.B.-S. wrote paper. the M.P.M., O.B., R.A.C., N.J.W., R.K., K.S.,J.J.S., N.R., studies designed and S.A.R. A.R. R.C., C.R.M. and T.J.W. ran biochemical and SPR studies. K.W.D., E.C.-P., K.G.K., S.L.J., M.P.S.,pharmacokinetics studies. E.C.-P., K.G.K.,R.M.P. and K.A.W. ran methyl mark and proliferation studies. and N.J.W. N.R. ADME performed protein initial the for biochemistry. E.C.-P., K.G.K.,T.L. and L.D.J. performed crystallography and produced X-ray protein. M.P., T.F.H., K.N., K.P.O. and K.T.G. made K.W.D., M.J.M. compounds. designed and R.C. L.J. and P.A.B.-S. X-ray performed A K.N., K.P.O., K.T.G. for and R.K.) contributions their to manuscript. this R.M.P., J.J.S., M.P.M., and K.W.D.) R.C. R.A.C., and GlaxoSmithKline (O.B., M.P., T.F.H., T.J.W., L.D.J., M.J.M., N.R., L.J., S.L.J., K.A.W., T.L., M.P.S., A.R., K.S.,S.A.R., N.J.W., We acknowledge team members from Epizyme, Inc. (E.C.-P., P.A.B.-S., K.G.K.,C.R.M., A biology u dditional information uthor contributions cknowledgments

sion of pape the

kinetic mechanism of protein arginine methyltransferase 5. methyltransferase arginine protein of mechanism kinetic Screen. Biomol.J. lymphomas. B-cell human in (H3K27) H3 histone on 27 lysine of hypertrimethylationtumor-associated bioassays. in exclusion their for and libraries screening (PAINS)fromcompounds interference Pharmacologistsand MedicinalChemists doi: (PRMT3). 3 methyltransferase arginine protein doi: transformation. B-cell of maintenance and initiation blocks Lett. Chem. ChemBioChem and synthesis, design, 1: methyltransferase inhibitors. selective Lett. Chem. studies. Lead to (CARM1)—Hit 1 MethyltransferaseArginine (2009). 6725–6732 (CARM1). 1 methyltransferase arginine polarizability in catalysis. in polarizability of role The interactions.cation-.pi. through reactions SN2 of catalysis methyltransferase. PRMT5 the of activation via growth neoplastic triggers and cells. lymphomamutant kills and Ther. lymphoma.non-Hodgkin EZH2-mutant in activity antitumor inhibitor. DOT1L small-molecule assay.shift thermal cellular the using tissues PRMT5. by complex. (2013). 5430–5440 Wang, M., Xu, R.-M. & Thompson, Thompson, specificity, processivity,Substrate and & P.R. R.-M. Xu,Wang, M., L.A. Lor, Sneeringer,C.J. assay pan of removal for filters substructure NewHolloway, G.A. & J.B. Baell, R.A. Copeland, H.Ü.Kaniskan, L. Alinari, D. Smil, Obianyo,O. F.Liu, Wan,H. E. Therrien, McCurdy, A., Jimenez, L., Stauffer, D.A. & Dougherty, D.A. Biomimetic Dougherty, D.A. Stauffer, & L., D.A. Jimenez,McCurdy, A., P. Aggarwal, S.K. Knutson, S.K. Knutson, S.R. Daigle, D.Molina, Martinez interaction. cation-p The D.A.Dougherty, L. Sun, Antonysamy,S. re 10.1002/anie.20141215 10.1182/blood-2014-1

13 | Adv chemic et al. et et al. et , 842–854 (2014). 842–854 , et al. et et al. et et al. et Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc. et al. et a Exploiting an allosteric binding site of PRMT3 yields potent and potent yields PRMT3 of site binding allosteric an Exploiting Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc. doi:10.102 19 Structural insights into protein arginine symmetric dimethylation symmetric arginine protein into insights Structural et al. et et al. et et al. et nce online public et al. et Discovery of a dual PRMT5–PRMT7 inhibitor.PRMT5–PRMT7 dual a of Discovery r Benzo[d]imidazole inhibitors of Coactivator Associated Coactivator of inhibitors Benzo[d]imidazole A simple assay for detection of small-molecule redox activity.redox small-molecule of detection for assay simple A . et al. et al. et , 5063–5066 (2009). 5063–5066 ,

et al. et 11 EvaluationEnzymeof Inhibitors DruginDiscovery:Guide A for Selective inhibition of protein arginine methyltransferase 5 methyltransferase arginine protein of inhibition Selective et al. et et al. et

Selective killing of mixed lineage leukemia cells by a potent a by cells leukemia lineage mixed of killing Selective 1,2-Diamines as inhibitors of co-activator associated co-activator of inhibitors as 1,2-Diamines A chloroacetamidine-based inactivator of protein arginine protein of inactivator chloroacetamidine-based A 12 , 1219–1223 (2010). 1219–1223 , Nuclear cyclin D1/CDK4 kinase regulates CUL4 expression CUL4 regulates kinase D1/CDK4 cyclin Nuclear Cancer Cell Cancer A selective inhibitor of EZH2 blocks H3K27 methylation H3K27 blocks EZH2 of inhibitor selective A potent to leads EPZ-6438 by EZH2 of inhibition Selective Coordinated activities of wild-type plus mutant EZH2 drive drive EZH2 mutantplus wild-type of activities Coordinated J. Med. Chem. Med. J. , 881–890 (2007). 881–890 , A potent, selective and cell-active allosteric inhibitor of inhibitor allosteric cell-active and selective potent, A Crystal structure of the human PRMT5:MEP50 human the of structure Crystal et al. et a 1/ml500467 J. Med. Chem. Med. J. l on 2-61978 Proc. Natl. Acad. Sci. USA Sci. Acad.Natl. Proc. J. Am. Chem. Soc. Chem. Am. J. Monitoring drug target engagement in cells and cells in engagement target Monitoringdrug b 4 line version of the http://www.nat (2015). iolog

18 a , 329–340 (2010). 329–340 , 3 tion | Nat. Chem. Biol. Chem. Nat. h Cancer Cell Cancer 56 (2015). (2015).

109 , 2110–2124 (2013). 2110–2124 ,

53 108 2nd edn. (John Wiley & Sons, 2013). Sons, & Wiley (John edn. 2nd , 17960–17965 (2012). 17960–17965 , , 2719–2740 (2010). 2719–2740 , Bioorg. Med. Chem. Lett. Chem. Med.Bioorg. www.nature.com/naturechemicalbiology ure.com/reprints/index.him y Acc. Chem. Res. Chem. Acc. , 20538–20543 (2011). 20538–20543 , in vitro in pape

114 d Science

20 oi Angew. Chem. Int. Ed. Engl. Ed. Int.Angew.Chem. r , 10314–10321 (1992). 10314–10321 , , 53–65 (2011). 53–65 , . Reprints and permissions : 10.1038/n

and and

8 107

, 890–896 (2012). 890–896 , 341 , 20980–20985 (2010). 20980–20985 , in vivo in , 84–87 (2013). 84–87 , in vivo

46 Biochemistry Blood , 885–893 (2013). 885–893 , ch ACS Med.ACS evaluation. Mol. Cancer Mol. Bioorg. Med.Bioorg. studies.

e

19 mbio l online . in vitro ,

.181 52

, 0 © 2015 Nature America, Inc. All rights reserved. collected at synchrotron sources (Advanced Photon Source beamlines 22-ID beamlines Source werePhoton (Advanced sources sets synchrotron at data collected All nitrogen. liquid in frozen being before glycerol 20% and liquor mother 80% containingsolution final a to fashion stepwise a in tected cryoprowere Crystals week. 1 after size full to grew and d 1 appearedwithin to the drops to facilitate growth.crystal Trays were incubated at 18 °C. Crystals wt/vol PEG400; 10% microseeds of previously6.1, grown PRMT5:MEP50 pH complex citrate,were added Na M 0.1 acetate, Na M 0.2 containing solution Typically,1 crystallization. for used were reservoir 0.5-mL a with trays drop hangingh. 1 using for Vapor-diffusion methods ice on incubated were samples which after each, mM 1.3 of tration concen final complexa PRMT5:MEP50DMSO,to to in wereadded mM 100 Crystallography. Tris-HCl, 250 mMNaCl, mM1TCEP, pH8.0. 50 in stored and chromatography FLAG by was purified complex further PRMT5:MEP50 biotinylated The °C. 18 at h 4 for incubation ATPmM 100 andandbiotin mM 5 BirA, mg/mL 2 ofaddition nylated the by MgCl mM buffer 7.5 Tris, biotinylation mM into (50 dialyzed was complex the affinity, nickel by ment enrich crystallography.After for protein the as manner similar a in purified (SPR). purification Biotin-PRMT5:MEP50: was concentrated to 32–38mg/mL and for flash-frozen storage at −80°C. containing 50 mM Tris-HCl, 250 mM NaCl, 1 mM TCEP,buffer a pH 8.0. This proteininto exchange final before 7.8, pH glycerol, 5% NaCl, mM 150 Tris, Protein(Sigma). elutedwas buffercontaining with 200 glycerol,5% andpH 8.0,onto loaded columna containing FLAG resin affinity Protein wasinto then dialyzed a buffer containing 20 mM Tris, 150 mM NaCl, imidazole. mM TCEP,0–250 mM 8.0, 1 pH NaCl, Tris-HCl,mM mM 250 50 purified by Ni-NTA (GE Healthcare) chromatographywas usingsupernatant buffers containing clarified the centrifugation, After sonication. by performed was lysis cell and inhibitors (Roche), proteaseTCEP, with mM 8.0, 1 pH Arg, mM 100 Glu, mM 100 NaCl, mM Tris-HCl,500 mM 50 containing buffer a (crystallography). purification PRMT5:MEP50 recovered protein was 87%. of purity buffer.The same the in imidazole mM 300 with eluted was MEP50 to minimize °C, the adsorption 4 of tubulin at impurity (TCEP) to tris(2-carboxyethyl)phosphine the resin. mM FLAG-PRMT5–6His- 1 and 8.0, NaCl, pH mM Tris-HCl, 25 mM 50 containing buffer with resin 5-h the of a equilibration after chromatography affinity agarose (Ni-NTA) acid nitrilotriacetic PRMT5–6His-MEP50 protein complex was frompurified cell paste by nickel– (assay). purification PRMT5:MEP50 °C −80 for purification.at stored and centrifugation by harvested were cells and h, 72 or 48 either for °C 27 at out carried were Infections virus. each for 1:200 of ratios infection at viruses P2 FLAG-Avi-PRMT5His-MEP50 andor FLAG-PRMT5 dilution of BIIC stock or through infection of Sf9 cells at 1.2 × 10 Spodoptera ref. and over Technologies)Protein (Life the instructions to according Kit generated Bac-to-Bac were (BIICs) cells expression. insect ­baculovirus-infected protein PRMT5:MEP50 FLAG-Avi-PRMT5 was made pDEST inthe vector. and system, vector pFastbac1 the using made were His-MEP50 and expression vector (Life Technologies). Additional constructs of FLAG-PRMT5 Gateway by ferred trans subsequently and Technologies) (Life pENTR/D/TEV into subcloned were genes amplified The MEP50. of Arg2 to directly fused (MHHHHHH) 5 a incorporating library cDNA testis PRMT5. human of a from amplified was clone Ala2 (NM_024102) MEP50 human Full-length to directly fused (MDYKDDDDK) tag FLAG a encoding 5 flanking a incorporating library, brain (cDNA) DNA fetal complementary a from biology. amplified was clone 1 variant transcript (NM_006109.3) molecular PRMT5:MEP50 ONLINE METHODS doi:10.1038/nchembio.1810 XDS either using performed wereing (SAM, SAH) or 21-ID-G (SFG)) at 1.000 Å at −180 °C. Data reduction and scal ­frugiperda expression was accomplished by infecting exponentially growing exponentially infecting by accomplished was ­expression A, A o SG ad P056, ah ouiie at solubilized each EPZ015666, and SFG, or SAH SAM, att (Sf9) cell culture at 1.2 × 10 × 1.2 at culture cell (Sf9) × L att 2 , pH 7.8). The Avi tag was enzymatically bioti enzymatically was tag Avi The 7.8). pH , R recombination to the pDEST8 baculovirus baculovirus pDEST8 the to recombination R 4 ′ 4 xrse fl-egh ua FLAG- human full-length Expressed sequence encoding a six-histidine tag tag six-histidine a encoding sequence and AIMLESS and eobnn bclvrs and baculovirus Recombinant ullnt hmn PRMT5 human Full-length μ L protein was added to 1 to added was protein L LGAiPM5MP0 was FLAG-Avi-PRMT5:MEP50 el wr rssedd in resuspended were Cells 6 cells/ml with a 5,000-fold a with cells/ml 4 5 μ or HKL2000 (ref. HKL2000 or g/ml peptide, 20 mM 20 peptide, g/ml 4 3 respectively. , 6 cells/ml with ′ sequence μ L well L 4 6 ). ------

0.05% Tween-20, 1 mM TCEP, 2% DMSO, 50 NaCl, mM 100 7.6, pH Bicine, mM (20 2% TCEP, buffer running mM SAM-bound 1 DMSO), Tween-20, 0.05% NaCl, mM 100 7.6, pH Bicine, mM (20 of SAMat and start the end of eachexperiment. PRMT5:MEP50 surface was validated by the injection of a dose-response curve injection of 1 mM PEG-biotin (Sigma-Aldrich). The activity of the biotinylated byand(FC2) BicineFC1 were2 mM 7.6). FC2 injecting20 (pH blocked by an streptavidin-coated cell chip.biosensorWeflow in reference surface createda the capturedwerebiotinylated1 on PRMT5:MEP50 the of unitsresponse 2,500 of rate flow a using 7.6) (pH Bicine mM 20 with equilibrated was that Healthcare) (GE T200 Biacore a in Healthcare) (GE SA Chip Sensor S Series a of (FC1) 1 cell flow into injected and 7.6) (pH Bicine 25 °C. Biotinylated PRMT5:MEP50 complex was diluted to 1.15 studies. resonance plasmon Surface SAH, SAM, codes: accession following the with Bank Data shown are statistics refinement in and collection the of Data regions allowed plot. or preferredRamachandran in were residues all of 99% than more REFMAC5 using building model (ref. and refinement of cycles iterative using and ligand fitting was performed manually. Structure refinement was performed ProDrg using generated were tionaries dic Ligand maps.density difference of inspection visual and PRMT5:MEP50 of structures solved previously using performed was determination Structure the abilitysaturating the ofa amount(2 tracer of the assessing by PRMT5:MEP50 from EPZ015666 of dissociation the measured the tracer and EPZ015666 compete for the same binding site in PRMT5, we creating a long-lived complex achieved, ofwas PRMT5:MEP50-SAM-EPZ015666. Because PRMT5:MEP50 the of saturation until buffer running apo in all remove to washed tracer and SAM. Then, extensively 20 was surface the which after surface, chip SPR the on active and folded properly was protein the that validate to SAM tracer the of binding the molecule by acquiring a full dose-response curve in characterized the presencewe of and 20 above, described as bilized immo was PRMT5:MEP50 ‘tracer’). (the series chemical same the from ( compound,fast-on/fast-offEPZ007345 a with EPZ015666 PRMT5:MEP50-SAM- of complex pre-established a probing involved dissociationthe for 3min. (0.5 EPZ015666 (20 SAM of amount saturating a injecting either by complex PRMT5:MEP50 nylated bioti same the on complex PRMT5:MEP50 the of dissociation of order the studies. determination half-life resonance plasmon Surface using the following parameters: Tween-20,NaCl,TCEP,0.05% mM mM 100 1 7.6, DMSO,2% 50 DMSO,2% 50 TCEP, mM 1 Tween-20, 0.05% NaCl, mM 100 7.6, pH Bicine, mM (20 buffer dissociation constant the in kinetics single-cycle of Biacore T200 technique (ref.In the 6.0. used Prism we GraphPad method in second model the decay exponential one-site a to the fit run the and to of start the at SAM or comparison tracer the for measured through signal determined response-unit percentage was the and and PRMT5:MEP50 tracer period, The 12-h blocked a of time. during of period repeatedly long injected a were over SAM bind to ability the regain to SPR compound screening was performed at 25 °C in apo running buffer buffer running apo in °C 25 at performed was screening compound SPR The half-life of EPZ015666 was measured in two ways. The first method method first The ways. two in measured was EPZ015666 of half-life The For a simple 1:1 interaction under steady state conditions, the equilibrium upeetr Tbe 2 Table Supplementary 4 4X6 9 ad COOT and ) 3 μ . M) or coinjecting saturating amounts of both SAM (20 SAM both of amounts saturating coinjecting or M) μ μ M SFG) or SAH-bound running buffer (20 mM Bicine, pHBicine, mM (20 buffer running SAH-bound or SFG) M M) for 60 s against apo-PRMT5:MEP50 and then following then and apo-PRMT5:MEP50against s 60 for M) 5 1 5 0 K ). rsetvl. nlss f h srcue soe that showed structures the of Analysis respectively. , D is calculated using the following formula: Disassociatio μ Associatio Flow Srcue hv be dpstd n h Protein the in deposited been have Structures . M SAM and 20 R rate = KA RA P imblzto ws efre at performed was immobilization SPR =µ nt ma D nt 4 7 80 within the CCP4 software package software CCP4 the within im + x ime [] [] e6 L/mi μ = μ ≥ M EPZ015666 were coinjected coinjected were M EPZ015666 M SAM), SFG-bound running 120 0s n nature CH s μ μ M) and SAM (20 andSAM M) 4X6 L/min. ApproximatelyL/min. 1 ; SFG, ; We determined E MIC μ K M in 20 mM d A = 70 nM), nM), 70 = 4X6 μ L BIOLOGY μ M SAH) M M) and M) 0 ; and ; μ μ M) M) M 4 8 - - - ,

© 2015 Nature America, Inc. All rights reserved. assay concentration). the by 10 ofquenched addition and min 60 for incubated were Reactions both). for tions concentraassay (final peptide nM 40 and enzyme nM 4 ofaddition the by top a with were initiated series Reactions of assay concentration). 700 nM concentration (final dilution seven-point a for buffer assay in twofold diluted ted into a 384-well polypropylene V-bottom microplate. 3H-SAM was serially lowing exceptions. IC the for those to similar were format 384-well conditions Experimental for competitionsSAM the 50- a in format.FlashPlate 384-well radioactive in Mechanism-of-inhibitionstudies minute.per counts in substrate,reported peptide the intoincorporated tritium amountof the measure to TopCount(PerkinElmer) a with on washedread then was andTween-20 0.1% plate the h, 1 of time incubation an After (PerkinElmer). FlashPlate 384-well streptavidin-coated a to transferred was mix reaction the 60 concentrationin assay (final buffer assay in SAM 10 with quenchedtemperature androom at 50 mix comprising assay buffer with 75 nM 3H-SAM (final assay concentration in 10 of total A TCEP). mM 1 and gelatin, skin bovine in 50 concentrationassay (final 1–15 residues H4 histone humanrepresenting tide concentration50 assay in (final PRMT5:MEP50 nM 4 of 40 with min 30 for incubated was Compound SAH. inhibitor uct 100% inhibition control consisted of a 100 The plate.microtiter 384-well a in spotted was series dilutioninhibitor the of 10 compoundwasof threefold dilutions in DMSO, beginning at 0.5 mM (the final top concentration format. FlashPlate IC enzyme-inhibition of Determination EnVision. PerkinElmer a on read were plates HTS Abcam. from obtained was antibody monomethylR3 histoneH4 Cisbio, andfromobtained were(IgG)-cryptate G Streptavidin-D2anti-rabbit andScientific). (ThermoCombi immunoglobulin Multidrop by added were cocktails Reagent Scientific). (Thermo PlateMate Matrix Scientific Thermo Freedom a using plates a assay into spotted (Tecan) onand EVO performed were reader dilutions microplate TopCount serial Compound a (PerkinElmer). on read were FlashPlates 384-well Tween. 0.1% obtained with ELx-406 were Biotek in SAH washed were and FlashPlates Sigma-Aldrich. SAM from Unlabeled a Ci/mmol. with 80 Chemicals of activity Radiolabeled specific American from obtained was (3H-SAM) 3H-labeled and PerkinElmer, from purchased were Century Biochemicals and HPLC-purified to >95% purity. 384-well FlashPlates methods. Biochemical are occupied, and Where: k are occupied, Where: nature seven-point a for buffer assay in twofold diluted serially was Peptide plate. 1,000 to 0.051 nM and spotted into a 384-well polypropylene V-bottom micro d are calculated by fitting to a 1:1 interaction model. For the peptide competition, EPZ015666 was diluted serially threefold from EPZ015666 was serially diluted threefold from 1,000 to 0.051 nM and spot R R [A] = concentration of injected analyte A, dt dR The kinetic association rate constant R [A] = concentration of injected analyte A, and R μ L) was added to initiate the reaction. Reactions were incubated for 120 min max max = response units elicited by analyte A. = response units elicited by analyte A. = change in time, μ = change in response unit, = when all response binding observed sites on the protein immobilized = when all response binding observed sites on the protein immobilized L) in 1× assay buffer (20 mM Bicine, pH 7.6, 0.002% Tween-20, 0.005% ch e mic μ a L per well of 600 of well per L l

biology Ten-point curves of EPZ015666 were made using serial serial using made were EPZ015666 of curves Ten-point μ Biotinylated21stby weresynthesized histone peptides M, and the fraction of DMSO was 2%). A 1- A 2%). was DMSOof fraction the and M, dR dt =− kR aa [] AA μ ma M unlabeled SAM in assay buffer (final (final buffer assay in SAM unlabeled M x k ([ a μ kk 50 and the dissociation rate constant M final concentration of the prod aus n aiatv 384-well radioactive in values μ L per well of unlabeled 600 unlabeled of well per L ]) + 50 experiments, with the fol the with experiments, d μ R μ L). A 50- A L). L per well of substrate of well per L S -adenosylmethionine μ L) and 40 nM pep nM 40 and L) μ L totalL volume in μ L volume of volume L μ μ L per well per L L aliquot L μ M ------

4 in concentrationassay (final SAM nM 200 with buffer assay comprising mix 1 of total A NaCl). mM 25 andDTT, mM 2 gelatin, assayTween-20,1× Bicine,0.010% mM 7.6, buffer(20 pH bovineskin 0.005% 1,536-well-format senting human histone H4 residues 1–15 assay(final concentration in 4 in HTS 4 concentrationassayin (final PRMT5:MEP50 for inhibition HTRF. percent of Determination Where: unlabeled SAM in assay buffer (final assay concentration). and the reactions were quenched by the addition of 10 min, 60 for incubated were Reactions concentrations both). assayfor (final by of were initiated the addition 4 and nM Reactions 75 enzyme nM 3H-SAM dilution series with a top concentration of 480 nM (final assay concentration). antibody(goatanti-rabbit Invitrogen,IR700, anti-mousedonkey and A21076, blocking buffer and water with 0.1% Tween-20) at 4 °C overnight and or HPA001170-100UL; Sigma, SmD3, 13222s; CST,(SDMA, antibody primary with incubated then temperatureand room at (Licor,927-40010) blocked were (Invitrogen).Blots 10–15 with run analysis. blotWestern supernatant was assayed for protein concentration (Pierce, by BCA 23225). (Roche,04693124001) and sonicated onicebefore being spun at°C.Clarified4 buffer(Millipore, 20-188) with0.1% SDS and Protease Inhibitor Cocktail tablet Whole-cell lysate protocol. line. assays All were out carried for 12d. cell each for characteristics growth on depending densities, seeding initial to all MCL lines using the method previously described In vitro ice dry on frozen being before processing.pending further PBS with once rinsed were pellets cell and rpm), 1,200 min, (5 centrifugation by harvested were cells period, treatment 0.2%. Cells were allowed to grow for 96 h undisturbed. At the conclusion of each in DMSO and added to each culture vessel with a final DMSO concentration of diluted was Compound period. growth the of end the atrequired yield the on 10 × 2 of density seeding a to split Invitro A549 (CCL-185). Granta-519 (ACC 342)cells were purchased from DSMZ. (CRL-1469), Panc-1 MDA-MB-453 (CRL-1420), MDA-MB-468(HTB-131), MCF-7(HTP-22), (HTB-132), and MP-2 (CRL-3002), JVM-2 (CRL-3006), Jeko-1 (CRL-3000), Mino from (CRL-3008), purchased Maver-1 were (CRL-3001), lines Z-138 ATCC: cell following The banks. cell respective the by specified conditions the to accordingcultured were and sources various from Tissue culture and cell lines. procedures as previously described in listed enzymes methyltransferase Methyltransferasepanel.cross-screening incubation of time plate 30min,the was read on an EnVision reader. an After buffer). assay of uL 4 in concentrations final (all fluoride potassium 3 nM anti-rabbit IgG-cryptate, 1× anti-histone H4 monomethyl R3, and 200 temperatureroom1 quenchedwith andmM μ α K K [ K L) was added to initiate the reaction. Reactions were incubated for 90 min at S K i i M = inhibitor constant for binding to enzyme, and and ] = substrate concentration, = Michaelis constant, i = inhibitor constant for binding to enzyme-substrate complex. Compounds were incubated for 30 min with 2 with min 30 for incubated were Compounds proliferation assay. compoundtreatment. α K i were calculated using the following formulas: μ g protein per lane and transferred to nitrocellulose via iBlot via nitrocellulose to transferred and lane per protein g 4–12% Bis-Tris gels (Invitrogen, WG1402BOX) were WG1402BOX) (Invitrogen, gels Bis-Tris 4–12% β -actin, CST, 3700S; all prepared in a 1:3 dilution of dilution 1:3 a in prepared all CST,3700S; -actin, Cells or powdered tumor tissue were lysed in 1× RIPA Long-term proliferation assays were performed on IC Cell lines used in these experiments were obtained IC 50 Cultured cells in linear/log-phase growth weregrowthlinear/log-phase Culturedin cells 50 =+ =+ 5 4 cells/mL in 2–20 mL of media, depending media, of mL 2–20 in cells/mL a 0 . K Figure 1 Figure K i i       1 μ 1 Cross-screening against the proteinCross-screeningagainst the L per well of 3 nM Streptavidin-D2,nM 3 ofwell per L K [] K S [] c M S M was done according to general to according done was μ       L) and 50 nM peptide repre peptide nM 50 and L) doi:10.1038/nchembio.1810 3 8 , with slight adjustments μ L per well of substrate of well per L μ μ L per well of 600 L per well of 8 nM 8 of well per L secondary ­secondary μ L) in μ M -

© 2015 Nature America, Inc. All rights reserved. penicillin-streptomycin) and cultured at 37 °C under 5% CO units/mL 100 and serum horse heat-inactivated vol/vol 10% with plemented Electron Microscopy (Hatfield, Sciences PA, USA). USA). from NE, purchased was paraformaldehyde 16% USA). (Lincoln, MA, (Billerica, Millipore Biosciences EMD from purchased was Licor (SYM11) antibody arginine dimethyl from Symmetric purchased Infrared Odyssey were Licor a Scanner and (H+L), IgG anti-rabbit goat 800CW buffer, blocking Odyssey USA). NY, Island, (Grand Technologies Life from chased pur were D-PBS and serum, horse heat-inactivated penicillin-streptomycin, cells. Z-138 in assay western In-cell sigmoidal fit. Boltzmann a using Prism GraphPad in plotted were curves Melt condition. of control was calculated on the basis of the unheated control samples for each lane. Bandswereper reaction mix quantified by densitometry. percentageThe or ab12151) (Abcam, PRMT5 either to antibodies with probingabove, described as performed was blotting 1 with described previously method the using cells A375 on assay. shift thermal Cellular GraphPad Prism. IC vehicle). or (DMSO controls to normalized compound-treatedsample,and sampleseach werefor protein calculated were total and methylated between Ratios densitometry. by quantified were band SmD3 the in changesmethylation Odyssey, and Licor a using performed was Imaging water. and buffer blocking of dilution 1:3 a in prepared 92632212) Licor,IR800, anti-mousedonkeyInvitrogen, anti-rabbit(goatA21076; IR700, 0.1% with water andTween-20 and then bufferfor 45 min at room blockingtemperature with antibodiessecondary of dilution 1:3 a in prepared custom) Biochemicals, Century 21st H3R8me2s, custom; Biochemicals, Century 21st H4R4me2s, custom; CST, H4R3me2s, ab31830; Abcam, H4, Total ab10799; Abcam, temperature (Total H3, antibodies primary room with overnight °C at 4 at incubated and 927-40010) (Licor, blocked were Blots (Invitrogen). 1 with run were Histone western blot analysis. method described analysis. extraction Histone Individual sample data were plotted then inGraphPad Prism. sample ratios from each group to the average ratio of the vehicle-treatedindividual group.comparing by values control of percentages calculated Weplates. methylationSDMA the in plates decreases compared proteintotalto SmD3 in EnVision reader (PerkinElmer) scanning at 450 nM. Ratios were calculated for H 1N with stopped were Reactions temperature.room at dark the in min 8 to up for develop to allowed and well with PBST, and TMB solution (SurModics, TMBS-1000-01) was added to each washed were plates again, Oncetemperature. room at min 60 for dark the in ish peroxidase conjugate, CST, 7074S,diluted in1×PBST) and were incubated horserad IgG (anti-rabbit added was antibody secondary before PBST with day,second the overnight.plateswashedwereOn °C 4 atPBST) 1× in diluted with PBST was followed by incubation with primary antibody (SDMA or SmD washes of round second A h. 2 temperaturefor room at PBS in BSA 5% with blocked were wells washer), plate (Biotek PBS–Tween20 with washing After PlatesAP12451a). were incubated at room temperature forminimum h. a of2 Abgent, SmD3, 13222S; CST,(SDMA, tested be to antibody and sample the on depending duplicate, in (ThermoFisher,3855) plate titer 96-well a of well bicarbonate buffer (Sigma, C3041), and 62.5, 125, or 250 ng was added to each protocol. ELISA or vehicle). IC (DMSOcontrols to normalized were compound-treatedsamples and sample, tometry.methylated proteinbetween andtotal Ratios for wereeach calculated Odyssey, and methylation changes in the SmD3 band were quantified by densi Licor a using performed Imagingwas temperaturemin. roomwater)at 45 for and buffer blocking of dilution 1:3 a in prepared all 92632212; Licor, IR800, doi:10.1038/nchembio.1810 Z-138 cells were in seeded assay medium at a concentration of 50,000 cells/mL Z-138 suspension cells weresup(IMDMmaintainedsuspensiongrowthmediumcells Z-138 in Methods. μ M compound for 18 h before the assay on whole-cell lysates.Westernwhole-cell onassay the before h compound18 forM For detection of symmetric dimethyl arginine and DNA content, arginine dimethyl of symmetric For detection 50 values were using calculated GraphPad Prism. μ hl-el yae wr dltd n × B carbonate- PBS 1× in diluted were lysates Whole-cell g histone per lane and transferred to nitrocellulose via iBlot via nitrocellulose totransferred and lane histoneper g 3 8 . Cellular thermal shift assays were performed performed were assays shift thermal Cellular itns ee xrce uig previously a using extracted were Histones 4–12% Bis-Tris gels (Invitrogen, WG1402BOX) β atn CT 30) n laig 20 loading and 3700) (CST, -actin 2 SO

Materials. 4 before plates were analyzed using an using analyzed were plates before 50 values were calculated using calculated were values MMGuaa Medium, IMDM/Glutamax 2 9 . Cells were pretreated were Cells . 2. μ of L - - - -

(RPMI 1640 supplemented with 10% vol/vol heat-inactivated FBS and 100 100 and units/mL penicillin-streptomycin)FBS at 37 °C under 5% CO heat-inactivated vol/vol 10% with supplemented 1640 (RPMI under 5% CO supplementedvol/vol°C10% heat-inactivatedculturedandat 37 with FBS) from from Molecular (Sunnyvale, Devices CA,USA). purchased was Glo purchased was readerplate M5 SpectraMax A USA). PromegaWI, (Madison, Cell-Titer USA). MA, (Waltham, from PerkinElmer purchased were plates opaque white 384-well Cell-culture USA). NC, (Monroe, Bio-One Greiner from purchased were poly plates V-bottom 384-well USA). propylene NY, Island, (Grand Technologies Life from pur chased were serum bovine fetal heat-inactivated and penicillin-streptomycin, assay. proliferation High-throughput nels were both scanned. intensity at 700-nm and 800-nm wavelengths. The 700-nm and 800-nm chan integrated measures which machine, Odyssey Licor on the imaged were then 100 were washed five times with 100 platestemperature.The room at h 1 for incubated and (vol/vol))Tween 20 0.1% with buffer Odyssey in limited) (Biostatus DRAQ5 1:1,000 (H+L), IgG 20 4 °C. Plates were washed five times with 100 with 0.1% Tween 20 (vol/vol)) and plates were incubated overnight (16 h) at well of primary antibody was added (SYM11 diluted 1:100 in Odyssey buffer temperature.removed,roomatwas 20 h buffer Blockingfor1 bated 30 Next (vol/vol)). X-100 Triton 0.1% with PBS (1× buffer wash of well per were Plates 100 min. with times five washed and platewasher Biotek30 405 a transferredto for incubated and plate each to added was PBS) in 8% paraformaldehydeof8% well paraformaldahyde(16% PBS in diluted was to for 30 min and then at 37 °C, 5% CO temperature room at incubated were Plates 356697). Biosciences, (BD plates culture 384-well Poly-D-Lysine–coated to added was plates incubated from CO 5% °C, 37 atincubated source 384-well plates was to added directly the cell 384-well plate. Plates were in a 384-well cell-culture plate with 50 relative humidity > 90%. tion of the compounds, assay plates were incubated for 5 d at 37 °C, 5% CO 0%-inhibitionaddi controlthe AfterDMSO-treatedconsisted and ofcells. consisted of cells treated with a 200 nM final concentration of staurosporine, control 100%-inhibition The plate. cell the in well respective its to added was fraction of DMSO was 0.2%). A 100-nL aliquot from the compound stock plate 20 was assay the in compoundconcentration of top final (the of at 10 mM in DMSO, beginning dilutions volume serial threefold nine-point triplicate final a in cells/mL 10,000 of 50 density a at plates opaque white tion of the Z-138 cell line, exponentially growing cells were plated in 384-well werecurves generated using triplicate wells per concentration of compound. trations, beginning at 3 control was serially diluted threefold in DMSO for a total of nine test concen for the inhibition percent each test to well in determine the plate. The positive signal in the in-cell western assay without antiproliferative effects. positive control was a compound that gave maximum inhibition of the SYM11 3 with treated inhibition maximum for wells control 14 as well as inhibition), (minimum treatment DMSO-only of wells control 14 included plate Each 100 Percent inhibition μ Z-138 suspension cells were maintained in growth medium (RPMI 1640 (RPMI medium growth in maintainedwere cells suspension Z-138 Calculations. Methods. The average of the ratio values for each control type was calculated and used μ μ μ M of the positive control compound EPZ011273 (background wells). The L per well of secondary antibody was added (1:200 800CW goat anti-rabbit L of assay medium. To prepare the compound source plate, we performed μ L per L wellper of blockingOdyssey buffer was added to each plate and incu − L water per well. Plates were allowed to dry at room temperatureandroom at dry to allowed werePlates well. per water L       (Individua (Minimum For the assessment of the effect ofcompounds Forproliferaassessment effect onthe the ofthe 2 . Under assay conditions, cells were incubated . in assay were medium Under cells incubated assay conditions,    First, the ratio for each well was determined as follows: Symme = lt inhibition es μ tric ts M. The percent inhibition was determined and IC ampl DRAQ5 2 dimethyl for 96 h. After 4 d of incubation, 40 incubation,of d 4 After h. 96 for er ratio) μ atio L wash buffer per well and then once with with once then and well per buffer wash L 700-nm 2 for 5 h. After the incubation, 40 arginine − μ −

Materials. ( L per well. Compound (100 nL) from (100 L Compound well. per (u Background Backgr valu μ L per well of wash buffer. Next Next buffer. wash of well per L 800 o e un PIGuaa Medium, RPMI/Glutamax nature CH nm da aver valu verage 2 a . e gge    E ratio) MIC ratio) μ A M, and the the and M, μ L BIOLOGY    L of cells cells of L × μ μ 100 L per per L L per L per μ    50 L 2 ------,

© 2015 Nature America, Inc. All rights reserved. Phoenix WinNonlin 6.2.1. internal-standardorcorresponding each drug ratio. usingwereanalyzedData for equation calibration-curve linear the solving by sample unknown each in (3.0–2,400 ng/mL EPZ015666). analysisWe the determined in the ng/mL included concentration also were 1.0–3,000 of control con compoundquality and of levels standard aliquots Four EPZ015666. internal plasma an control as labetalol of ng/mL series 100 taining a analyzing by curves calibration before protein precipitation−70 and atLC-MS/MS analysis. Westored constructedwere standard samples Plasma collection. sample after min 30 on wet ice before centrifugation at 4 °C (3,000 (70% anesthesia under CO were animals the while puncture cardiac via lected samplescolwereh), (24 point time last Forpoints). the time (seven intervals fromanimals by submandibular or retro-orbital bleeding at pre-specifiedtime Approximately30 Health. of Institutes National the and International) (AAALAC Care Animal Laboratory of Accreditation and accordance with the guidelines and standards of the Association for Assessment in performed was study The dosing. of day the onadministration dose before N-N- 20% in formulated doses both with administration, gavage oral by mg/kg 10 and injection intravenoustail-vein by mg/kg 2 at EPZ015666 of dose single a Laboratory Animal Technology; mice. in study Pharmacokinetic AGGATCTCTGTGCCTACTGCCTCGG. GATTGACAACTAGTGAAGCCACAGATGTAGTTGTCAATCAT TCGAGAAGGTATATTGCTGTTGACAGTGAGCGAAGAGATCCTAT struct(Open Biosystems) used toknock down PRMT5 inthese experiments was shRNA construct. cells were for harvested western blotting. (1 doxycycline with induced was knockdown puromycin with begun (1 was selection before h 96 for grow to allowed were Cells media. fresh with replaced was media the and removed was virus h, 18 8 usingsupplemental) in (sequence with shRNA (TRIPZ Inducible Lentivirus, Open Biosystems) targeting PRMT5 Generation of stable inducible cell line.knockdown four-parametric fit of the normalized dose-response curves. tration of compound inhibiting cell viability by 50% was determined using a Luminescence was read in the SpectraMax M5 microplate reader. The concen 35 ofaddition the withtures, nature Cell Cell viability was measured by quantitation of ATP present in the cell cul μ 2 :30% O :30% /L n ei) Pos ee loe t poaae o 12 ek before weeks 1–2 for propagate to allowed were Pools media). in g/mL dimethylacetamide in water.dimethylacetamidein wereovernightfastedAnimals andweighed ch e 2 mic ). Blood samples Blood were). transferred into K a l The sequence of the TRIPZ inducible lentiviral shRNA con

biology μ L of Cell Titer Glo reagent to the cell plates.cell the reagenttoTiter Glo Cell of L n = 6, with 3 per time point) were treated with ae D1 ie 2–0 ; ia River Vital g; (25–40 mice CD-1 Male μ g/mL polybrene in culture media. After media. culture in polybrene g/mL g , 15 min) to obtain plasma within μ g/mL in media) for 12 d and d 12 for media) in g/mL Z-138 cells were infected 2 -EDTAandtubes placed μ L of blood were taken taken were blood of L ± 10 °C 10 - - - - -

44. 43. tively, at and blood time which tissues were for collected analysis. respec Granta-519,Maver-1, or Z-138, for 18 or 22 21, day on dose final the the and volumewasexpressed caliper,cubicin millimeters. Animalswere euthanized afterh 3 a using dimensions two in weekly twice measured was size day for the first week, then twice weekly for the remainder of the study. Tumor every measuredwere weights Body d). 18 for dosed was (Granta-519 d 21 for mL/kg 10 volumeof dose a at BID orallyadministered water)was in cellulose intogroups using a randomized block EPZ015666 ordesign. vehicle (0.5% methyl assigned were Mice inoculation). after d (10 study efficacy Granta-519 mm 155.2 or inoculation), after d (13 study efficacy Maver-1 the for mm 141.98 reachedtumor size mean the development. treatmentswhen The were started tumor for 1:1) RPMI:Matrigel, or (IMDM:Matrigel Matrigel and media base 10 × (5 cells tumor 519 Granta- orMaver-1 Z-138, with flank right the at subcutaneously inoculated where the work was performed. For the institution the at process review ethical the to according or GlaxoSmithKline at IACUC Welfare the by Care, reviewed were the and on Animals Laboratory Policy of Treatment and GSK the with accordance in conducted were studies ShanghaiofAAALAC. All followingthe ofChempartnerguidance the linesapproved by Institutional the CareAnimal and Use Committee (IACUC) dling, care and treatment in this study were performed according to the guide studies. xenograft efficacy 21-d 51. 50. 49. 48. 47. 46. 45.

Journal (2006). biosensors. affinity using series titration kinetic Coot. of Crystallogr. method. maximum-likelihood the by structures Crystallogr.Biol. Crystallogr.D Acta Crystallogr.Biol. complexes.protein-ligand of crystallography throughput 1997). A, Part In mode. oscillation resolution? Kabsch, W.Kabsch, XDS. scale-up. and preservation Wasilko,infected-cells TiterlessD. Karlsson, R., Katsamba, P.S., Nordin, H., Pol, E. & Myszka, D.G. Analyzing a Analyzing D.G.Myszka, & E. Pol,P.S.,Katsamba, H., Nordin, R., Karlsson, development andFeatures K. W.G.Cowtan, Emsley,P.,Scott, & B., Lohkamp, macromolecular of Refinement E.J. Dodson, & Murshudov,Vagin,A.A. G.N., M.D.Winn, high- for tool D.M.F.Aalten,a PRODRG:Schüttelkopf,A.W.van & in collected data diffraction X-rayMinor, W.of & Processing Z. Otwinowski, the is what and data my are good Murshudov,P.R.HowEvans, & G.N. Vol. 276 (eds Carter, C.W. Jr. & Sweet, R.) Ch. 19 (Academic Press, (Academic 19 Ch. R.) C.W.Carter,Sweet, Jr. (eds & Vol. 276

5 3 Acta Crystallogr. D Biol. Crystallogr.Biol. Crystallogr.D Acta for the Z-138 efficacy study (12 d after inoculation), 120.02 mm 120.02 inoculation), after d (12 study efficacy Z-138 the for , 29–32 (2006). 29–32 ,

Acta Crystallogr. D Biol. Crystallogr.Biol. Crystallogr.D Acta 53 et al. et , 240–255 (1997). 240–255 ,

60 Overview of the CCP4 suite and current developments.current and suite CCP4 the of Overview Acta Crystallogr. D Biol. Crystallogr.Biol. Crystallogr.D Acta , 1355–1363 (2004). 1355–1363 , Methods in Enzymology: MacromolecularCrystallography, Enzymology: in Methods 6 cells/mouse, 50% Matrigel) in 0.2 mL of a mixture ofmixture a of mL 0.2 Matrigel)in 50% cells/mouse, All of the procedures related to animal han animal to relatedprocedures the of All

67 in vivo , 235–242 (2011). 235–242 , efficacy studies, each mouse was

66

, 486–501 (2010). 486–501 , 69 Anal. Biochem.Anal. Acta Crystallogr. D Biol. Crystallogr.D Acta doi:10.1038/nchembio.1810 , 1204–1214 (2013). 1204–1214 ,

66 , 125–132 (2010). 125–132 , Acta Crystallogr.D Acta BioProcessing BioProcessing

349 , 136–147 , 3 for the the for - - - - 3

Supplementary Information

A Selective Inhibitor of PRMT5 with In Vivo and In Vitro Potency in MCL Models

Elayne Chan-Penebre1†, Kristy G Kuplast1†, Christina R Majer2, P Ann Boriack-Sjodin1,

Tim J Wigle2, L Danielle Johnston1, Nathalie Rioux1, Michael J Munchhof1, Lei Jin3,

Suzanne L Jacques1, Kip A West1, Trupti Lingaraj1, Kimberly Stickland1, Scott A Ribich1,

Alejandra Raimondi1, Margaret Porter Scott4, Nigel J Waters1, Roy M Pollock2, Jesse J

Smith1, Olena Barbash5, Melissa Pappalardi5, Thau F Ho6, Kelvin Nurse6, Khyati P

Oza6, Kathleen T Gallagher7, Ryan Kruger5, Mikel P Moyer8, Robert A Copeland1,

Richard Chesworth1, Kenneth W Duncan1*†

1Epizyme, Inc., Departments of Biology and Molecular Discovery, Cambridge,

Massachusetts, USA. 2Warp Drive Bio, Cambridge, Massachusetts, USA. 3Agile

Biostructure Solutions, Cambridge, Massachusetts, USA. 4Genentech, San Francisco,

California, USA. 5Cancer Epigenetics DPU, GlaxoSmithKline, Collegeville,

Pennsylvania, USA. 6Department of Biological Reagents and Assay Development,

GlaxoSmithKline, Collegeville, Pennsylvania, USA. 7Discovery Core Technologies and

Capabilities, GlaxoSmithKline, Collegeville, Pennsylvania, USA. 8Raze Therapeutics,

Cambridge, Massachusetts, USA.

[†]These authors contributed equally.

[*]Corresponding Author email: [email protected]

1

Nature Chemical Biology: doi:10.1038/nchembio.1810 Supplementary Results

Supplementary Figures

Supplementary Figure 1. Correlation plots of high throughput assay data from

lead series. (a) Correlation of biochemical IC50 from PRMT5:MEP50 radioactive

Flashplate assay against cell biochemical IC50 with a high throughput (HT) In-Cell

Western format (ICW) assay following symmetric methylation of SmD3 with SMY11

antibody in Z-138 cells over 4 days. (b) Correlation of HT ICW assay IC50 against HT

cell proliferation IC50 using a 96 well format in Z-138 cells over a 5 day continuous

treatment. All data points were determined using a minimum 8 point dose response

curve with n≥2.

2

Nature Chemical Biology: doi:10.1038/nchembio.1810 a

EPZ015666 Parameter IV Bolus PO Dose (mg/kg) 2 10 C (ng/mL) max 3500 (1133) t (h) max 0.333 (0.144) AUC (ng.h/mL) 0-t 1110 (91.7) 3847 (1014) AUC (ng.h/mL) 0-inf 1113 (90.7) 3850 (1010) t (h) 1/2 1.38 (0.445) 1.62 (0.396) MRT (h) 0.928 (0.082) 1.35 (0.181) 0-inf VD (L/kg) 1.67 (0.210) ss CL (mL/min/kg) 30.0 (2.37)

F (%) 69.2 (18.1)

Supplementary Figure 2. Preclinical pharmacokinetics in CD-1 mouse. (a) Table of

EPZ015666 pharmacokinetic (PK) parameters as determined in mouse. All values

3

Nature Chemical Biology: doi:10.1038/nchembio.1810 reported as mean ± standard deviation (SD), n=3. PK data analysis was performed

using noncompartmental analysis and WinNonlin Phoenix 6.2.1 software. Calculated PK

parameters show low clearance (CL) and high oral bioavailability (%F) for EPZ015666.

Volume of distribution at steady state (VDss) was greater than total body water of 0.7

L/kg. Mean terminal half-life (t1/2) and residence time (MRT) ranged from 0.9 to 1.6

hours. Cmax, the maximum plasma concentration, was determined at time tmax. AUC0-t

and AUC0-inf are the areas under the curve to the last measurable data point and

extrapolated to infinity, respectively. (b) EPZ015666 data are shown graphically as

concentration vs. time profile of mean ± SD (n=3) plasma concentrations following i.v.

bolus (2 mg/kg) or oral gavage (po; 10 mg/kg) administration to CD-1 mouse

(formulated in 20% N-N-dimethylacetamide in water).

4

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 3. Assessment of SAM, SAH and Sinefungin binding using

a PRMT5:MEP50 SPR assay. Biotinylated PRMT5:MEP50 complex was immobilized

in a Biacore T200 and assay buffer, flow-rate and temperature were optimized to detect

binding of small molecules to PRMT5. SAM, SAH and Sinefugin (SFG) binding was

then measured.

5

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 4. Complex of PRMT5:MEP50-SAM-EPZ015666 is stable

upon withdrawal of SAM from SPR running buffer indicating that EPZ015666 must

dissociate first or simultaneously with SAM. Injections of a saturating amount of

SAM (20 µM) (blue) or co-injections of saturating SAM (20 µM) + saturating EPZ015666

(0.5 µM) (green) were performed against apo PRMT5:MEP50 for 60s then dissociation

rates were monitored. SAM underwent rapid and complete dissociation from

PRMT5:MEP50, while the co-injected sample of SAM and EPZ015666 demonstrated

very slow dissociation from PRMT5:MEP50.

6

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 5. Surface plasmon resonance analysis of half-life of

EPZ015666 for PRMT5:MEP50 complex measured using a fast-on/fast-off tracer

molecule by SPR and by single-cycle kinetics. The tracer EPZ007345 (2 µM) was

injected with SAM (20 µM) to measure the dissociation of EPZ015666 and SAM. (a)

The tracer method gave a t1/2 of 94 min, while (b) the single-cycle kinetic method gave a

t1/2 of 130 min.

7

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary figure 6. PRMT5 levels in cancer cell lines. Western blot analysis of

whole cell lysates from MCL cell lines and cancer cell lines from other indications.

PRMT5, SDMA and alpha-tubulin (loading control) levels were assessed as shown. Cell

lines “453” and “468” refer to MDA-MB-453 and MDA-MB-468 respectively. Uncut

western blots for PRMT5 and Tubulin can be seen in Supplementary Figure 7.

8

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 7. Uncut western blots from Supplementary Figure 6.

9

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 8. Uncut western blots from Figure 3a.

10

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 9. Effects of EPZ015666 on cellular symmetric dimethyl

arginine substrate SmD3 in MCL cell lines. Concentration-dependent inhibition of

SmD3me2s after four days of treatment with a dose-titration from 0.0003 to 5µM of

EPZ015666 in MCL cell lines Granta-519, Maver-1, Mino, and Jeko-1. SmD3me2s

panel is cropped and the intensity decreased from the uncropped SDMA panel above to

more clearly distinguish changes in this specific band. Uncut western blots for SmD3

can be seen in Supplementary Figure 10. 11

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 10. Uncut western blots from Supplementary Figure 9.

12

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 11. Effects of EPZ015666 and control compound 3 on

cellular control protein using CETSA. A375 cells treated for 18 hours with either (a)

1uM EPZ015666 or (b) the inactive compound 3 in cellular thermal shift analysis of

whole cell lysates. No shift in melting temperatures was observed for β-Actin in the

presence of either compound as any changes observed are within SEM. All data

analyzed using a Boltzmann Sigmoidal fit. Each point represents the mean of three

replicates for each temperature ± SEM.

13

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 12. Lack of global histone methylation changes upon

compound treatment and shRNA KD in Z-138 cells. Acid-extracted histones from 4-

day compound treatment of Z-138 cells with EPZ015666 or the paired inactive

compound 3 compared to 12 day shRNA KD of PRMT5. Cells were treated with a dose-

titration of 0.0003 to 5µM EPZ015666 or compound 3. No observed global histone

methylation changes with multiple antibodies to several histone marks. Uncut western

blots for all marks shown can be seen in Supplementary Figure 13.

14

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 13. Uncut western blots from Supplementary Figure 12.

15

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 14. Effects of EPZ015666 on cell proliferation. Inhibition of

proliferation of Jeko-1, Granta-519, and Mino cells by EPZ015666 in vitro (measured by

Guava Viacount Reagent assay) over 12 days in culture. Cells were counted and

replated at the original seeding densities on days 4 and 8. Each point represents the

mean for three replicates at each concentration.

16

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 15. Anti-tumor activity of EPZ015666 in Granta-519

xenografts in SCID mice. (a) Anti-tumor activity induced by twice daily (BID)

administration of EPZ015666 for 18 days at the indicated doses. Compound

administration was stopped on day 18, and tumors were harvested for PD analysis

(data shown as mean values ± SEM, n=10 mice per group). (b) PRMT5 target inhibition

in Granta-519 xenograft tumor tissue collected from mice euthanized on day 18. Each

point represents the ratio of SDMA to total SmD3 normalized to the vehicle control,

measured by ELISA. The horizontal lines represent group mean values ± SD for 2

replicates per sample (10 mice per group). **** P < 0.0001, versus vehicle, 1-way

ANOVA with a Tukey Test.

17

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 16. Bodyweight change (%) of mice in EPZ015666-Treated

(a) Z-138 Xenograft Mice and (b) Maver-1 xenograft mice in 21-Day and (c) Granta-

519 xenograft mice in 18-day Efficacy Studies. Mean body weight changes induced

by twice daily (BID) administration of EPZ015666 for 21 or 18 days at the indicated

doses. Compound administration was stopped on day 21 (or 18), and tumors were

harvested for PD analysis (data shown as mean values ± SEM, n=10 mice per group).

All doses were well tolerated, with no group experiencing greater than 8.3% body

weight loss over the course of these studies.

18

Nature Chemical Biology: doi:10.1038/nchembio.1810

19

Nature Chemical Biology: doi:10.1038/nchembio.1810 Supplementary Figure 17. EPZ015666 decreases cellular methylation of SmD3 in

tumors of Z-138 xenograft SCID mice collected on day 21. (a) Western blots

performed on whole cell lysates of tumors from 6 representative animals for each group.

SmD3me2s panel is cropped and the intensity decreased from the uncropped SDMA

panel above to more clearly distinguish changes in this specific band.

(b) Quantification performed by comparing SmD3me2s to total SmD3 signal for each

individual tumor and normalizing to vehicle average. The horizontal lines represent

group mean values ± SD for 6 mice per group. Uncut western blots for SmD3 can be

seen in Supplementary Figure 18.

20

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 18. Uncut western blots from Supplementary Figure 17a.

21

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 19. EPZ015666 decreases cellular methylation of SmD3 in

tumors of Maver-1 xenograft SCID mice collected on day 22. (a) Western blots 22

Nature Chemical Biology: doi:10.1038/nchembio.1810 performed on whole cell lysates of tumors from 6 representative animals for each group.

SmD3me2s panel is cropped and the intensity decreased from the uncropped SDMA

panel above to more clearly distinguish changes in this specific band.

(b) Quantification performed by comparing SmD3me2s to total SmD3 signal for each

individual tumor and normalizing to vehicle average. The horizontal lines represent

group mean values ± SD for 6 mice per group. Uncut western blots for SmD3 can be

seen in Supplementary Figure 20.

23

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 20. Uncut western blots from Supplementary Figure 19a.

24

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 21. EPZ015666 decreases cellular methylation of SmD3 in

tumors of Granta-519 xenograft SCID mice collected on day 18. (a) Western blots

25

Nature Chemical Biology: doi:10.1038/nchembio.1810 performed on whole cell lysates of tumors from 6 representative animals for each group.

SmD3me2s panel is cropped and the intensity decreased from the uncropped SDMA

panel above to more clearly distinguish changes in this specific band.

(b) Quantification performed by comparing SmD3me2s to total SmD3 signal for each

individual tumor and normalizing to vehicle average. The horizontal lines represent

group mean values ± SD for 6 mice per group. Uncut western blots for SmD3 can seen

in Supplementary Figure 22.

26

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 22. Uncut western blots from Supplementary Figure 21a.

27

Nature Chemical Biology: doi:10.1038/nchembio.1810

Supplementary Figure 23. Specificity of custom H3R8me2s antibody against full-

length synthetic histones with alternative modifications. Western blot of full-length

single-modification synthetic histones (1µg per lane loaded) probed with H3R8me2s

affinity-purified antibody (1:5000 dilution).

28

Nature Chemical Biology: doi:10.1038/nchembio.1810 Supplementary Tables

Supplementary Table 1: Summary of high throughput screening data

Category Parameter Description Assay Type of assay In vitro, Homogeneous Time Resolved Fluorescence (HTRF) assay Target PRMT5:MEP50 Complex Primary measurement Detection of time resolved fluorescence Key reagents PRMT5:MEP50 enzyme complex, peptide, Streptavidin-D2, Anti-Rabbit IgG-Cryptate, Anti- Histone H3 mono-methyl R3 antibody Assay protocol Compound was incubated for 30 min with 2 µL per well of 8nM PRMT5/MEP50 (final assay concentration in 4 μL) and 50nM of peptide representing human histone H4 residues 1-15 (final assay concentration in 4 μL) in 1X assay buffer (20 mM Bicine [pH 7.6], 0.010% Tween-20, 0.005% Bovine Skin Gelatin, and 2 mM DTT, 25mM NaCl). A total of 1 µL per well of substrate mix comprised of assay buffer with 200nM SAM (final assay concentration in 4 μL) was added to initiate the reaction. Reactions were incubated for 90 min at room temperature and quenched with 1 µL per well of 3nM Streptavidin-D2, 3nM Anti-Rabbit IgG- Cryptate, 1x Anti-Histone H4 mono-methyl R3 antibody, and 200 mM potassium flouride (all final concentrations in 4ul of assay buffer). After an incubation time of 30 minutes, the plate was read on an Envision. Additional comments N/A Library Library size 370,000 Library composition 350,000 lead-like compounds & 20,000 fragments Source Confidential Additional comments N/A Screen Format 1536 well plates Concentration(s) tested 10 uM, 1% DMSO

Plate controls DMSO for 0% Inhibition, SAH at IC50 for 50% Inhibition, and SAH at 100X IC50 for 100% Inhibition Reagent/ compound dispensing system Multiflo peristaltic pump Detection instrument and software PerkinElmer, Envision Assay validation/QC 50% Inhibition between 30%-70%, Z’ > 0.5 Correction factors N/A Normalization N/A Additional comments N/A Post-HTS analysis Hit criteria 30% Inhibition and above Hit rate 0.7% Additional assay(s) After removal of compounds containing pan-assay interference structures (PAINS) and additional known frequent hitter substructures, a subset of 800 compounds were selected for follow-up activity confirmation in enzyme based flashplate assay and a redox assay to identify reactive compounds that inhibit the enzyme in an intractable manner. Confirmation of hit purity and structure Compounds were repurchased, re-synthesized and verified by LC/MS, and potency was confirmed at every step. Additional comments N/A

29

Nature Chemical Biology: doi:10.1038/nchembio.1810 Supplementary Table 2: Data collection and refinement statistics for EPZ015666 complexes in PRMT5-MEP50

SAM SFG SAH Data collection Space group I222 I222 I222 Cell dimensions a, b, c (Å) 102.3, 138.2, 178.0 103.7, 138.0, 178.0 102.4, 138.1, 178.3 α, β, γ (°) 90.0, 90.0, 90.0 90.0, 90.0, 90.0 90.0, 90.0, 90.0 Resolution (Å) 50.00-2.85 44.75-2.35 50.00-3.05 (2.95-2.85) (2.41-2.35) (3.16-3.05) Rsym or Rmerge 0.117 (0.576) 0.045 (0.646) 0.148 (0.653) I / σI 13.8 (2.2) 21.0 (2.5) 11.3 (2.2) Completeness (%) 96.5 (78.0) 99.6 (99.4) 95.1 (75.8) Redundancy 5.9 (4.9) 5.0 (5.0) 5.8 (5.3)

Refinement Resolution (Å) 50.00-2.85 44.75-2.35 50.00-3.05 No. reflections 27160 48418 21785 Rwork / Rfree 0.206/0.260 0.202/0.254 0.214/0.274 No. atoms Protein 7358 7412 7402 EPZ015666/Cofactor/Glycerol 28/27/6 28/27/18 28/26/0 Water 61 140 1 B-factors Protein 65.8 63.3 83.7 EPZ015666/Cofactor/Glycerol 49.3/50.8/82.8 46.2/42.6/76.3 87.0/66.8/- Water 45.0 51.0 36.2 R.m.s. deviations Bond lengths (Å) 0.005 0.008 0.004 Bond angles (°) 0.972 1.242 0.927 1 crystal was used for each structure. *Values in parentheses are for highest-resolution shell.

30

Nature Chemical Biology: doi:10.1038/nchembio.1810

EPZ015666

LTP IC LTP IC SDMA Western Blot Cell Line 50 90 (nM) (nM) IC50 (nM)

Z-138 96 208 44

Granta-519 61 243 4

Maver-1 450 3060 42

Mino 103 2080 78

Jeko-1 904 3430 347

Supplementary Table 3. Long term proliferation IC50/IC90 values and SmD3me2s (SDMA) western IC50 values in MCL cell lines dosed with EPZ015666. A panel of 5 MCL cell lines were treated with EPZ015666 for 12 days in the long-term proliferation

assay. IC50s and IC90s were calculated in GraphPad Prism (non-linear regression analysis, top and bottom of the curves were fixed to 100 and 0%, respectively) for each

line using split-adjusted cell counts at day 12. IC50s and IC90s ranged from 4-347nM across all types of MCL cell lines tested (n=1 for all cell lines). SDMA western blot IC50s for 4-day EPZ015666 treatment are shown for the MCL cell line panel. Western blot images for this data are available in Supplementary fig. 7.

31

Nature Chemical Biology: doi:10.1038/nchembio.1810 Supplementary Note

Many of the intermediates have previously been described in WO2014100719.

Unless otherwise noted, intermediates were characterized by LC-MS to confirm the

mass matched the structure and carried on to the next step without further purification.

Compound 1, EPZ007345, 1-(3-((cyclopentylamino)methyl)phenoxy)-3-(3,4-

dihydroisoquinolin-2(1H)-yl)propan-2-ol was purchased from ChemBridge, Catalog

#39852262, 98% HPLC purity.

Compound 2, EPZ015666, (S)-N-(3-(3,4-dihydroisoquinolin-2(1H)-yl)-2-hydroxypropyl)-

6-(oxetan-3-ylamino)pyrimidine-4-carboxamide.

Step 1: (R)-2-(oxiran-2-ylmethyl)-1,2,3,4-tetrahydroisoquinoline

N O

To a solution of 1,2,3,4-tetrahydroisoquinoline (400g, 6mol) in tetrahydrofuran (THF)

(4000mL) was added potassium fluoride (KF) (880g, 9mol) and (S)-oxiran-2-ylmethyl 3-

nitrobenzenesulfonate (856g, 6.8mol) at 0°C. After the addition was complete, the

resulting mixture was stirred at 20°C for 16 h then filtered. The filtrate was concentrated

in vacuum to give the desired product (400g, crude) which was used for next step

without the further purification. LCMS (m/z): 190.1 (M+1).

Step 2: (S)-1-amino-3-(3,4-dihydroisoquinolin-2(1H)-yl)propan-2-ol

H2N N OH

32

Nature Chemical Biology: doi:10.1038/nchembio.1810 A solution of (R)-2-(oxiran-2-ylmethyl)-1,2,3,4-tetrahydroisoquinoline (80g, 0.42mol) in

NH3/EtOH (10L) was sealed and stirred at 80°C for 3 h. After completion, the reaction

mixture was concentrated under vacuum. The residue was purified by column

chromatography separation to afford desired product (48g, Yield 55%) which was used

for the next step without further purification. LCMS (m/z): 207.1 (M+1).

Step 3: (S)-6-chloro-N-(3-(3,4-dihydroisoquinolin-2(1H)-yl)-2-hydroxypropyl)pyrimidine-

4-carboxamide

O N N N H N OH

Cl

To a stirred and cooled (0 oC) solution of (S)-1-amino-3-(3,4-dihydroisoquinolin- 2(1H)-

yl) propan-2-ol (7.15 g, 34.7 mmol) and triethylamine (Et3N) (14.0 g, 138.8 mmol) in

dichloromethane (DCM) (100 mL) was added 6-chloropyrimidine-4-carbonyl chloride

(5.5 g, 34.7 mmol). After addition, the resulting mixture was stirred at 25 oC for 16 h, at

which time LCMS showed the completion of the reaction. The solvent was evaporated

and the residue purified by flash chromatography to give the (S)-6-chloro-N- (3-(3,4-

dihydroisoquinolin-2(1H)-yl)-2-hydroxypropyl)pyrimidine-4-carboxamide (7.2 g, yield:

60 %). LCMS (m/z): 347.0 [M+H]+

Step 4: (S)-N-(3-(3,4-dihydroisoquinolin-2(1H)-yl)-2-hydroxypropyl)-6-(oxetan-3-

ylamino)pyrimidine-4-carboxamide

O N N N H N OH

NH O

33

Nature Chemical Biology: doi:10.1038/nchembio.1810 To a solution of (S)-6-chloro-N-(3-(3,4-dihydroisoquinolin-2(1H)-yl)-2-hydroxy

propyl)pyrimidine-4-carboxamide (347 mg, 1 mmol) in iso-propylamine (i-PrOH) (5 mL)

was added oxetan-3-amine (73.1 mg, 1 mmol) and diisopropyl ethylamine (DIPEA) (129

mg, 1 mmol). The resulting mixture was stirred at 110 ºC for 16 hours, at which time

LCMS showed the completion of the reaction. After evaporation of the solvent, the

residue was purified by preparative HPLC to give the target compound (S)-N-(3-(3,4-

dihydroisoquinolin-2(1H)-yl)-2-hydroxypropyl)-6-(oxetan-3-ylamino)pyrimidine-4-

1 carboxamide (62.5 mg, yield: 16.3 %). H NMR (400MHz, MeOD-d4) δ 8.24 (s, 1H), 7.15

- 7.05 (m, 4H), 7.02 - 6.98 (m, 1H), 5.09 (s, 1H), 4.95 (t, J=6.8 Hz, 2H), 4.59 (t, J=6.3

Hz, 2H), 4.10 - 4.03 (m, 1H), 3.72 (s, 2H), 3.56 - 3.46 (m, 2H), 2.96 - 2.91 (m, 2H), 2.87

13 - 2.80 (m, 2H), 2.65 (d, J=6.3 Hz, 2H); C NMR (101 MHz, DMSO-d6) δ ppm 29.7, 45.7,

47.4, 52.8, 57.6, 63.7, 68.1, 79.4, 104.9, 126.8, 127.4, 127.6, 129.6, 135.2, 135.5, 155.

+ 8, 158.8, 164.1, 165.9 HRMS; HRMS (m/z): [M+H] Calcd. for C20H26N5O3. 384.2036;

found 384.2027.

Compound 3, EPZ019896, (S)-N-(2-hydroxy-3-(piperidin-1-yl)propyl)-6-(oxetan-3-

ylamino)pyrimidine-4-carboxamide

Step 1: (R)-1-(oxiran-2-ylmethyl)piperidine

N O

A solution of (S)-oxiran-2-ylmethyl 3-nitrobenzenesulfonate (18.3g, 70.6mmol),

piperidine (5g, 58.8mmol) and potassium fluoride (6.7g, 117.6mmol) was combined in

THF (50mL) and stirred at 20oC. After 24 hrs, the solid was filtered off and filtrate

34

Nature Chemical Biology: doi:10.1038/nchembio.1810 concentrated to provide the crude desired product (7g, 104% yield) which was used in

the next step without further purification.

Step 2: (S)-1-amino-3-(piperidin-1-yl)propan-2-ol

H2N N OH

A solution of (R)-1-(oxiran-2-ylmethyl)piperidine (7g, 49.6mmol) in NH3/EtOH (200mL)

was heated to 80oC in a sealed tube for 4 hrs. After cooling to 25oC, the solvent was

evaporated to yield the desired crude product (8g, 102% yield) which was used in the

next step without further purification.

Step 3: (S)-6-chloro-N-(2-hydroxy-3-(piperidin-1-yl)propyl)pyrimidine-4-carboxamide

O N N N H N OH

Cl

To a solution of (S)-1-amino-3-(piperidin-1-yl)propan-2-ol (0.93g, 5.8mmol) and Et3N

(11.8g, 11.7mmol) in DCM (100mL) at 0oC, 6-chloropyrimidine-4-carbonyl chloride

(1.03g, 5.8mmol) was slowly added. Once the addition was complete, the mixture was

warmed to 20oC and stirred for a further 4hrs. The mixture was washed with aqueous

NaHCO3 (2x50mL) then dried over anhydrous sodium sulfate and the solvent removed

under reduced pressure. The crude product was purified by column chromatography to

give the desired product (800mg, 47% yield). LCMS (m/z): 299.2 [M+H]+

Step 4: (S)-N-(2-hydroxy-3-(piperidin-1-yl)propyl)-6-(oxetan-3-ylamino)pyrimidine-4-

carboxamide

35

Nature Chemical Biology: doi:10.1038/nchembio.1810 O N N N H N OH

NH O

To a solution of (S)-6-chloro-N-(2-hydroxy-3-(piperidin-1-yl)propyl)pyrimidine-4-

carboxamide (300mg, 1.004mmol) in isopropanol (15mL) was added oxetan-3-amine

(73.4mg, 1.004mmol) and DIPEA (254mg, 2.008mmol) and the reaction mixture was

stirred and heated at 80oC for 18 hrs. The reaction mixture was concentrated under

reduced pressure and purified by preparative HPLC to yield the desired compound

1 (10mg, 0.03 mmol, 3% yield). H NMR (400MHz, MeOD-d4) δ 8.45 (s, 1H), 7.14 (s, 1H),

5.11 (m, 1H), 4.96 (t, 2H, J=6.4 Hz), 4.61 (t, 2H, J=6.4Hz), 3.94 (m, 1H), 3.47 (dd, 1H,

J=5.2, 5.2Hz), 3.41 (dd, 1H, J=6.8, 6.8Hz), 2.47 (m , 4H), 2.40 (d, 2H, J=6.4Hz), 1.59

13 (m, 4H), 1.47 (m, 2H); C NMR (101 MHz, DMSO-d6) δ ppm:25.3, 26.8, 45.6, 47.4,

56.3, 64.7, 68.0, 79.4, 104.9, 155.8, 158.9, 164.2, 165.9; HRMS (m/z): [M+H]+ calcd.

for C16H26N5O3, 336.2036; found 336.2040.

36

Nature Chemical Biology: doi:10.1038/nchembio.1810