Helicobacter Suis Infections: Host Response and Different Vaccination Strategies

Home , MALT lymphoma

Helicobacter suis infections: host response and different vaccination strategies

Iris Bosschem

Dissertation submitted in fulfillment of the requirements for the degree of Doctor in Veterinary Sciences (PhD), 2017

Promoters:

Prof. dr. F. Haesebrouck

Prof. dr. R. Ducatelle

Dr. B. Flahou

Ghent University, Faculty of Veterinary Sciences

Department of Bacteriology, Pathology, and Avian Diseases

This research was funded by the Research Fund of Ghent University, Belgium (GOA 01G00408).

Table of contents

ABBREVIATION KEY ...... 5

GENERAL INTRODUCTION ...... 9 1 The genus Helicobacter ...... 11 2 Gastric non-Helicobacter pylori helicobacters in pigs and humans ...... 12 2.1 Nomenclature of gastric non-Helicobacter pylori helicobacters ...... 12 2.2 Helicobacter suis infections in pigs ...... 13 Morphology, isolation and cultivation of Helicobacter suis ...... 13 Prevalence and transmission of Helicobacter suis in pigs ...... 14 Role of Helicobacter suis in the development of porcine gastric pathologies 15 2.3 Gastric non-H. pylori Helicobacter infections in humans with particular emphasis on Helicobacter suis ...... 17 3 The inflammatory and immune response to gastric Helicobacter infection ...... 19 3.1 Virulence mechanisms of Helicobacter pylori and other gastric helicobacters .... 19 Virulence mechanisms involved in colonization and adherence ...... 20 Major virulence factors involved in lesion development ...... 22 3.2 Immune response to Helicobacter pylori ...... 25 The innate immune response to Helicobacter pylori infection ...... 26 The adaptive immune response to Helicobacter pylori infection...... 29 3.3 Animal models used for the study of the inflammatory and immune response following gastric Helicobacter infections ...... 32 4 Control of gastric Helicobacter infections ...... 36 4.1 Antimicrobial therapy ...... 36 4.2 Vaccination against gastric Helicobacter infections ...... 37 Current status in Helicobacter pylori vaccination ...... 37 Vaccination against gastric non-Helicobacter pylori helicobacters ...... 43

SCIENTIFIC AIMS ...... 69

EXPERIMENTAL STUDIES ...... 73 Chapter 1: Species-specific immunity to Helicobacter suis ...... 75 Chapter 2: Host response to in vitro-cultured primate- and pig-associated Helicobacter suis strains in a BALB/c mouse and a Mongolian gerbil model ...... 109 Chapter 3: Effect of different adjuvants on protection and side-effects induced by Helicobacter suis whole-cell lysate vaccination ...... 139

GENERAL DISCUSSION ...... 175

SUMMARY ...... 199

SAMENVATTING ...... 205

CURRICULUM VITAE ...... 213

BIBLIOGRAPHY ...... 217

DANKWOORD ...... 221

Abbreviation key

Abbreviation key µm micrometer µg/ml microgram per milliliter ACTB actin beta AlpA/B adherence-associated lipoproteins A/B APC antigen presenting cell APC allophycocyanin ASCT2 alanine serine cysteine transporter 2 ATPase adenosine triphosphatase BabA blood group antigen-binding adhesin BMDC bone marrow-derived dendritic cell bp basepair cagA cytotoxin-associated gene A CagA cytotoxin-associated protein A cagPaI cytotoxin-associated gene pathogenicity island CAMP cationic antimicrobial peptides CCR4 CC chemokine receptor 4 CD cluster of differentiation cDNA copy DNA CpG unmethylated cytosine guanine dinucleotides CT cholera toxin Ct treshold cycle values CTLA-4 cytotoxic T-lymphocyte-associated protein 4 CXCL chemokine (C-X-C motif) ligand CXCR CXC chemokine receptors DC dendritic cell dmLT double mutant form of heat-labile toxin from enterotoxigenic E. coli DNA deoxyribonucleic acid dupA duodenal ulcer promoting gene A E. coli Escherichia coli ELISA enzyme-linked immunosorbent assay EPIYA Glu-Pro-Ile-Tyr-Ala ERK extracellular signal-related kinase

Abbreviation key

FA complete Freund's adjuvant FCS fetal calf serum FISH fluorescent in situ hybridization FITC fluorescein isothiocyanate Fla flagellin FoxP3 transcription factor Forkhead-box P3 g gravitational acceleration GADPH glyceraldehyde-3-phosphate dehydrogenase GGT gamma-glutamyl transpeptidase GITR glucocorticoid-induced TNFR-related protein GM-CSF granulocyte macrophage colony-stimulating factor Grb2 growth factor receptor-bound protein 2 GSH reduced glutathione h hour H. Helicobacter HBSS Hank's balanced salt solution HCl hydrochloric acid HE haematoxylin-eosin Hop Helicobacter outer membrane porins Hor Hop-related subgroups HpaA H. pylori adhesin A HP-NAP H. pylori neutrophil-activating protein HPRT(1) hypoxanthine guanine phosphoribosyltransferase 1 HRP horseradish peroxidase IFA incomplete Freund's adjuvant IFN interferon Ig immunoglobulin IL interleukin KC keratinocyte chemoattractant kDa kilodalton kHz kilohertz Leb Lewis b blood group antigens LEL lympho-epithelial lesion

Abbreviation key

Lex sialyl-dimeric-Lewis x glycosphingolipid LFA-1 lymphocyte function-associated antigen 1 LIX LPS-induced CXC chemokine LPS lipopolysaccharide mAb monoclonal antibody MACS magnetic-activated cell sorting MALT mucosa-associated lymphoid tissue MAPK mitogen-activated protein kinase MDC macrophage-derived chemokine MHC major histocompatibility complex MIC minimal inhibitory concentration MIP-2 macrophage inflammatory protein 2 MLST multilocus sequence typing MoDC monocyte-derived dendritic cells MOI multiplicity of infection mRNA messenger RNA NFAT nuclear factor of activated T-cells NF-κB nuclear factor κB NHPH non-Helicobacter pylori helicobacters NOD nucleotide-binding oligomerization domain ODN oligodeoxynucleotides OipA outer inflammatory protein A OMP outer membrane protein PAMP pathogen-associated molecular pattern PAS periodic acid-Schiff PBMC peripheral blood mononuclear cell PBS phosphate-buffered saline PD1 programmed cell death protein 1 PE phycoerythrin pH measure of acidity or basicity PI propidium iodide PPI proton pump inhibitor PRR pathogen recognition receptor

Abbreviation key qPCR quantitative real-time polymerase chain reaction r recombinant RNA ribonucleic acid ROR RAR-related orphan receptor ROS reactive oxygen species rRNA ribosomal RNA RT room temperature s.l. sensu lato s.s. sensu stricto SabA sialic acid-binding adhesin A SD standard deviation SHP-2 SH2-containing tyrosine phosphatase siRNA small interfering RNA SPEM spasmolytic polypeptide-expressing metaplasia SPF specific pathogen free STAT signal transducer and activator of transcription T4SS type IV secretion system TARC thymus and activation-regulated chemokine TEM transmission electron microscopy TGF transforming growth factor Th T helper TLR toll-like receptor TNF tumor necrosis factor Treg regulatory T-cell U Unit UreA/B/E/F/G/H/I urease subunit A/B/E/F/G/H/I v/v volume per volume VacA vacuolating cytotoxin A WT wild type ZO-I zonula occludens-1

General Introduction

1 The genus Helicobacter For a long time, the gastric environment was believed to be sterile. In 1984, Barry Marshall and Robin Warren reported for the first time that a bacterium, residing in the stomach, plays a role in gastric ulcer disease in humans. This bacterium was later named Helicobacter (H.) pylori (Marshall and Warren, 1984; Goodwin et al., 1989). Since the description of H. pylori, a large number of non-Helicobacter pylori helicobacters (NHPH) have been described in a wide variety of animals and humans. To date, the genus Helicobacter contains 45 identified species with validly published names. The Helicobacter bacteria can be divided into two major groups, gastric and enterohepatic species. The enterohepatic species live on the mucosal surfaces of the intestinal tract and/or in the liver (Sterzenbach et al., 2007). Gastric helicobacters are able to survive in the acidic environment of the stomach, mainly by expressing urease (Labigne et al., 1991). Most of the gastric NHPH are animal-associated bacteria, but some of them have zoonotic potential, as shown in Table I.

Table I: Gastric Helicobacter spp. and their hosts (adapted from Flahou et al., 2016)

Taxon Hosts Zoonotic potential ‘Candidatus H. bovis’ cattle Yes ‘Candidatus H. homininae’ chimpanzee, gorilla Unknown H. acinonychis cheetah, tiger, lion Unknown H. ailurogastricus cat Unknown H. baculiformis cat Unknown H. bizzozeronii cat, dog Yes H. cetorum whale, dolphin Unknown H. cynogastricus dog Unknown H. felis dog, cat, cheetah Yes new Guinea wild dog rabbit H. heilmannii dog, cat, cheetah Yes bobcat, tiger, lynx leopard, puma H. mustelae ferret Unknown H. pylori human / H. salomonis cat, dog, rabbit Yes H. suis pig, mandrill monkey Yes rhesus macaque crabeating macaque

General Introduction

2 Gastric non-Helicobacter pylori helicobacters in pigs and humans

2.1 Nomenclature of gastric non-Helicobacter pylori helicobacters

In the early years of H. pylori research, spiral-shaped bacteria, different in morphology from H. pylori were reported colonizing the human stomach (McNulty et al., 1989). They were originally referred to as ‘Gastrospirillum hominis’, but later renamed H. heilmanii, after the German pathologist Konrad Heilmann, who first studied the pathologies associated with these bacteria (Heilmann and Borchard, 1991). Analysis of the 16S ribosomal RNA (rRNA) gene of these uncultivated organisms resulted in their classification in the genus Helicobacter. Sequence analysis of the 16S and 23S rRNA gene enabled further subdivision in ‘H. heilmannii’ type 1 and ‘H. heilmannii’ type 2 bacteria (Haesebrouck et al., 2009). At that time, ‘H. heilmannii’ was not formally recognized as a valid species name.

‘H. heilmannii’ type 1 is both morphologically and genetically identical to a bacterium colonizing the stomachs of pigs (De Groote et al., 1999; O’Rourke et al., 2004a) that was first designated ‘Gastrospirillum suis’ (Mendes et al., 1990). Almost 10 years later, sequencing of the 16S rRNA gene, fluorescent in situ hybridization (FISH) and electron microscopy showed that these organisms belong to the genus Helicobacter and are sufficiently different from all existing species to constitute a new taxon. Because at that time this species could not be fully characterized due to the lack of pure in vitro isolates, the organism was described as ‘Candidatus Helicobacter suis’ (De Groote et al., 1999). In 2008, pure in vitro cultures were obtained using a new biphasic culture method, resulting in the official description of H. suis as a species (Baele et al., 2008). Besides pigs, this species also colonizes the stomach of humans and non-human primates, such as mandrills, macaques and baboons (O’Rourke et al., 2004b).

‘H. heilmannii’ type 2 does not represent a single species, but a group of different Helicobacter species. These species, including H. felis, H. bizzozeronii, H. salomonis, H. baculiformis and H. cynogastricus, mainly colonize the stomach of dogs and cats (Haesebrouck et al., 2009). This group also comprises H. heilmannii (also referred to as H. heilmannii sensu stricto or s.s.), which was isolated from the stomach of cats and characterized in 2013 (Smet et al., 2013). In an attempt to avoid further confusion in nomenclature, the term Helicobacter heilmannii sensu lato (H. heilmannii s.l.) was introduced to refer to the group of non-H. pylori Helicobacter species detected in the stomachs of humans or animals if only histopathological, electron microscopy, or crude taxonomic data are available. Helicobacter heilmannii sensu stricto (H. heilmannii s.s.) or the other species 12

General Introduction names should be used if definite identification at the species level is achieved (Haesebrouck et al., 2009).

During the last couple of years, several new Helicobacter species have been described including a feline gastric species, H. ailurogastricus, which is closely related to H. heilmannii (Joosten et al., 2015), and a putative Helicobacter species in wild gorillas and chimpanzees, for which the name ‘Candidatus H. homininae’ has been proposed (Flahou et al., 2014).

In table II the most important characteristics of the main gastric helicobacters associated with human gastric disease are presented. Although differences in morphology have been described, microscopic investigation of biopsy samples is not an accurate method for species identification.

Table II: The most important characteristics of the main gastric helicobacters associated with human gastric disease (adapted from Haesebrouck et al., 2009)

Characteristics H. pylori H. suis H. heilmannii H. felis H. bizzozeronnii H. salomonis Length (µm) 2.5-5 2.3-6.7 5-10 5-7.5 5-10 5-7 Cell width (µm) 0.5-1 0.9-1.2 0.5-0.6 0.4 0.3 0.8-1.2 Urease + + + (+) (+) + GGT + + + + + + Nitrate reduction - - ND + + + Periplasmatic fibril - - - + - - # Flagella 4-8 4-10 10-20 10-20 10-20 10-23 Distribution of flagella MP BP BP BP BP BP

All taxa produce catalase and possess sheathed flagella. +, 100% of strains positive; −, 0% of strains positive; (+), 80 to 94% of strains positive; ND, not determined; BP, bipolar; MP, monopolar; GGT, gamma-glutamyl transpeptidase.

2.2 Helicobacter suis infections in pigs

Morphology, isolation and cultivation of Helicobacter suis

H. suis is a spiral-shaped, Gram-negative bacterium (Figure 1). This bacterium is on average 2.3-6.7 µm in length and 0.9-1.2 µm in width. H. suis is highly motile because of flagella which can be found in groups of 4 to 10 on each side of the cell (Baele et al., 2008). Differentiation of H. suis from the other gastric NHPH species mentioned above can be done

General Introduction by molecular methods, for instance by sequencing of the 16S and 23S rRNA encoding genes (Baele et al., 2008).

Figure 1. TEM image of a cell of H. suis strain HS1 showing bipolar flagellae (Baele et al., 2008).

H. suis is very fastidious. This bacterium has been cultivated for the first time in 2008 (Baele et al., 2008). Primary isolation and cultivation require specific growth conditions. Briefly, for primary isolation the pig stomach is rinsed and subjected to acid treatment to prevent bacterial overgrowth (submersion in a 1% HCl bath for 1 hour). After this, the mucus is scraped off using a glass slide and collected in a sterile tube. The mucus is slightly liquefied with Brucella broth supplemented with fetal calf serum and inoculated on Brucella agar containing fetal calf serum, amphotericin B, Campylobacter-selective supplement, Vitox supplement, activated charcoal and HCl (min. 37 %) to obtain a pH of 5. Plates are incubated at 37 °C under humidified microaerobic conditions (85% N2, 10% CO2, 5% O2) (Baele et al., 2008). Light microscopic examination of the broth reveals the presence of spiral-shaped motile cells. For cultivation, H. suis is grown on the same Brucella agar plates used for primary isolation but without the supplementation of activated charcoal. In addition, Brucella broth with a pH of 5 is added on top of the agar to obtain biphasic culture conditions. Recently, a method has been developed to acquire pure cultures by growing the bacteria as individual colonies on 1% Brucella agar plates, after which they are purified and enriched by conventional biphasic subculture as described above (Liang et al., 2015).

Prevalence and transmission of Helicobacter suis in pigs

The prevalence of H. suis infection in pigs is low before weaning. Hereafter, when the maternal immunity disappears, the prevalence gradually increases to 60% or even more, depending on the study, in European, Asian and American pigs at slaughter age (Barbosa et al., 1995; Grasso et al., 1996; Cantet et al., 1999; Park et al., 2004; Hellemans et al., 2007b). The regrouping of animals at the time of weaning most probably favors the spread of the 14

General Introduction micro-organisms from the few piglets infected before weaning to non-infected animals. Transmission most likely occurs via the oral-oral route through saliva or via the gastric-oral route through vomiting or regurgitation.

Role of Helicobacter suis in the development of porcine gastric pathologies

The involvement of H. suis in different gastric pathologies in pigs will be discussed below. A schematic overview of the different regions of the porcine stomach is depicted in Figure 2.

Figure 2. Schematic overview of the different regions of the porcine stomach. The porcine stomach has four distinct areas which include the oesophageal, cardiac, fundic and pyloric (also referred to as the antral region) regions. The oesophageal region is located at the entrance of the stomach and does not secrete digestive enzymes. In the cardiac region of the stomach, mucus is secreted and mixed with the digested food. In the fundic region gastric glands secrete hydrochloric acid, resulting in a low pH. Other secretions in this region are present in the form of digestive enzymes, specifically pepsinogen. Pepsinogen is broken down by the hydrochloric acid to form pepsin, which is involved in the breakdown of proteins. Finally, the digesta moves to the pyloric region. This region is responsible for secreting mucus to line the digestive membranes to prevent damage from the low pH digesta as it passes through the small intestine (Karali et al., 1995).

H. suis has been shown to cause gastritis in pigs, both after experimental (Hellemans et al., 2007a; De Bruyne et al., 2012) and after natural (Grasso et al., 1996; Hellemans et al., 2007b) infection. This gastritis is characterized by a diffuse lymphocytic/plasmacytic infiltration as well as lymphocytic aggregates and lymphoid follicles, occasionally accompanied with neutrophilic infiltrates (Hellemans et al., 2007a; De Bruyne et al., 2012). In young pigs and

General Introduction pigs at slaughter age, the highest H. suis colonization densities can often be found in the antrum. In adult boars and sows, higher colonization rates have been described in the fundic region (Hellemans et al., 2007b). Several studies also attribute a role to this pathogen in the development of hyperkeratosis and ulceration of the non-glandular stratified squamous epithelium of the pars oesophagea of the porcine stomach, although H. suis does not colonize this region (Queiroz et al., 1996; Roosendaal et al., 2000; De Bruyne at al., 2012). Others did not find this association (Grasso et al., 1996; Melnichouk et al., 1999; Park et al., 2004). Hence, the exact role of H. suis in the development of these lesions remains to be elucidated. Recently, it was found that a novel Fusobacterium sp., named F. gastrosuis, was abundantly present in the gastric microbiota of pigs and higher numbers were present in H. suis-infected animals. F. gastrosuis might also play a role in the development of gastric pathologies, since most Fusobacterium spp. are opportunistic pathogens that can aggravate necrosis when tissue damage is initiated by other micro-organisms or environmental factors (De Witte et al., 2017). In any case, the development of gastric ulcer disease is most likely multifactorial and in general, all conditions increasing the fluidity of the stomach content may cause a breakdown of the pH gradient between the proximal and distal parts of the stomach. This breakdown causes increased contact of gastric acid with the pars oesophagea, ultimately leading to ulcer formation. Several factors such as fine particle size of the feed, pelleting of the feed, presence of highly fermentable carbohydrates and short chain fatty acids in the diet, interruption in feed intake, overcrowding, stress and respiratory disease could also play a role in the development of gastric ulcers (De Bruyne et al., 2012). It has been demonstrated that H. suis infection in pigs results in an increased number of gastrin-producing cells and a decreased number of somatostatin-producing cells in the antrum (Sapierzynski et al., 2007). Since gastrin stimulates and somatostatin inhibits acid secretion by parietal cells, this may influence gastric acid production. Acid secretion may also be altered due to the tropism of this bacterium for parietal cells (Hellemans et al., 2007a; Flahou et al., 2010). This altered acid secretion could in turn be involved in the development of ulceration of the pars oesophagea. Ulceration may result in decreased feed intake, decreased daily weight gain and even sudden death due to fatal hemorrhage. Besides the substantial economic losses caused by H. suis infections, there is no doubt that this disease causes pain and discomfort for the animal.

General Introduction

2.3 Gastric non-H. pylori Helicobacter infections in humans with particular emphasis on Helicobacter suis

NHPH have been demonstrated in 0.2–6 % of human patients with gastric complaints undergoing a gastric biopsy, which is probably an underestimation of their true prevalence (Haesebrouck et al., 2009). The pig-associated bacterium H. suis comprises 13.9% to 78.5% of human NHPH infections, which makes this species the most prevalent gastric NHPH in humans (Trebesius et al., 2001; Van den Bulck et al., 2005; Haesebrouck et al., 2009). Interestingly, a study by Blaecher et al. (2013) demonstrated a high prevalence (27%) of H. suis DNA in gastric biopsies from human patients with idiopathic parkinsonism. The putative significance of this bacterium in Parkinson’s disease requires further investigation. Clinical symptoms associated with NHPH in humans can be characterized by atypical complaints such as acute or chronic epigastric pain and nausea. Other aspecific symptoms include hematemesis, recurrent dyspepsia, irregular defecation frequency and variable stool consistency, vomiting, heartburn, and dysphagia, often accompanied by a decreased appetite. Some people infected with non-H. pylori helicobacters remain asymptomatic (Haesebrouck et al., 2009). It is not exactly known how NHPH are transmitted to humans, but most likely it occurs through contact with animals. Living in close proximity to animals such as dogs, cats, and especially swine (pig farmers, the staff of slaughterhouses and veterinarians) has indeed been identified as a significant risk factor for these infections (Holck et al., 1997; Svec et al., 2000). Joosten et al. (2013) described a H. suis infection in a human patient having regular contact with pigs and provided clear evidence for an association between H. suis and dyspepsia. It is remarkable that H. suis is the most prevalent gastric NHPH species in humans. This might indicate that the infectivity for humans of cat- or dog-related NHPH is less than that of H. suis (Haesebrouck et al., 2009). Despite numerous attempts, H. suis could not be detected in feces of infected pigs, which may indicate that fecal-oral spread between pigs and from pigs to humans is limited. Apart from the stomach of pigs and humans, H. suis has also been found in the stomach of mandrill monkeys (Papio sphinx), cynomolgus monkeys (Macaca fasicularis) and rhesus macaques (Macaca mulatta). Although it is clear that non-human primates may be infected with different types of gastric helicobacters, little information on these bacteria and their interaction with these hosts is available (Haesebrouck et al., 2009; Flahou et al., 2014). It is unknown whether these non-human primates constitute a source of infection for humans.

General Introduction

Additional possible transmission routes that require further investigation include consumption of water (Azevedo et al., 2008) and consumption of raw or undercooked contaminated pork (De Cooman et al., 2013). Since rodent models are easily colonized with most NHPH, the role of wild mice as vector might also be considered (Haesebrouck et al., 2009). Due to the fastidious nature of gastric NHPH, isolation is not an option for routine diagnoses. The urea breath test, which is frequently used to diagnose infection with H. pylori, is often negative in patients infected with NHPH (Matsumotu et al., 2014). This can be explained by the fact that infections with these bacteria are more often focal and predominantly found in the antrum of the stomach (Stolte et al., 1997). Therefore, analysis of gastric biopsies by molecular microbiological methods and histology is so far the only way to determine infections with these bacteria. In patients undergoing an endoscopy, a variety of lesions can be observed, ranging from a normal to slightly hyperemic mucosa to mucosal edema and to multiple erosions and ulcerations in the antrum or in the duodenum (Sykora et al., 2003; Haesebrouck et al., 2009). Histologically, the inflammation induced by NHPH in the gastric tissue is generally characterized by lymphocytic exudation into gastric foveolae, sometimes mixed with plasma cells. In some cases, lymphocytes are organized into lymphoid aggregates. The epithelial mucus layer is occasionally depleted (Haesebrouck et al., 2009). NHPH-associated gastritis is often less severe compared to H. pylori-associated gastritis (Stolte et al., 1997). Recently, a multilocus sequence typing (MLST) technique was developed to demonstrate genetic variation between different H. suis strains. This technique uses the following genes/gene clusters to distinguish different H. suis strains: atpA, efp, mutY, ppa, trpC, yphC and ureAB. The use of this technique should allow to investigate whether H. suis infection in human patients is a consequence of direct or indirect contact with pigs (Liang et al., 2013).

General Introduction

3 The inflammatory and immune response to gastric Helicobacter infection

3.1 Virulence mechanisms of Helicobacter pylori and other gastric helicobacters

Gastric helicobacters have developed a unique set of virulence factors, actively supporting their successful survival and persistence in their natural hostile ecological niche, the stomach. Abundant information is available on virulence factors of H. pylori, whereas little is known about the virulence factors of other gastric helicobacters. Therefore, this paragraph focusses on the major H. pylori virulence factors and their effects, which are presented in figure 3. The potential impact of these virulence factors on the host immune response will be addressed where appropriate.

Figure 3. The major H. pylori virulence factors and their effects. The cagPaI (red) encodes a type IV secretion system (T4SS) which is the main stimulus to epithelial cell pro-inflammatory cytokine production and subsequent inflammation. CagA (green), which is translocated through the T4SS has other effects, but also contributes to inflammation. BabA (purple) encodes an adhesin which allows close contact and enhances virulence factor delivery and hence inflammation. The functions of the 19

General Introduction products of oipA (orange) and dupA (yellow) are not known, but they have been shown to upregulate cytokine expression and inflammation. VacA (blue) has many effects on cells and increases disease risk, but has not been shown to increase inflammation. The ggt gene (black) encodes gamma-glutamyl transpeptidase which probably plays a role in damaging gastric epithelial cells (Adapted from Robinson et al., 2007).

Virulence mechanisms involved in colonization and adherence

Urease Gastric helicobacters must survive the extremely acidic environment of the stomach lumen and penetrate the outer mucous gel layer of the stomach to reach their ideal niche, which has an external pH of approximately 5-6. All gastric Helicobacter sp. are able to increase the pH of their immediate surroundings as well as their cytosol and periplasm by producing urease. This enzyme consists of two subunits, UreA and UreB (Labigne et al., 1991), which are assembled into catalytically active, nickel-containing dodecamer via the actions of the accessory proteins UreE, UreF, UreG and UreH (Mobley et al., 1995). Urease activity is upregulated under acidic conditions by a proton-gated urea channel formed by the inner membrane protein UreI, allowing rapid entry of urea into the bacteria (Skouloubris et al., 1998; Weeks et al., 2000). Urea is hydrolyzed into ammonia, which neutralizes the hydrochloric acid creating a neutral microenvironment around the bacterium, and carbon dioxide. Urease localizes mainly in the cytoplasm, but also associates with the surface of the viable bacteria after autolysis of surrounding bacteria (Haesebrouck et al. 2009). H. pylori mutants lacking either urease activity (through disruption of ureB) or a functional UreI were shown to be defective for colonization in animal models of infection (Eaton et al., 1994; Skouloubris et al., 1998; Eaton et al., 2002), thus demonstrating the essential role of urease in H. pylori pathogenesis.

Motility Motility is essential for stomach colonization by all gastric helicobacters, allowing them to move towards the gastric mucosal surface. Next, the bacteria have to overcome the viscous mucous gel covering the gastric epithelium. The spiral shape of H. pylori is believed to enhance its ability to penetrate the mucus. Mutants lacking a helical twist show diminished colonization (Sycuro et al., 2012). H. pylori possesses 2-5 unipolar flagella, whereas H. suis possesses 4-10 flagella per cell, which are distributed bipolar (Haesebrouck et al., 2009). The flagella consist of a body, hook and flagellar filament. The filament is composed of two

General Introduction flagellin subunits, the predominant FlaA and the minor FlaB (Suerbaum et al., 1993). It works as a propeller and is covered by a sheath which is suspected to play a role in acid protection, masking of antigens and probably adhesion. The basal body of the flagellum is embedded in the bacterial cell wall and contains proteins required for rotation and chemotaxis. The hook links the body and the filament (Haesebrouck et al., 2009). Mutants lacking flagella are unable to colonize in a gnotobiotic piglet model of infection (Eaton et al., 1996).

Chemotaxis Several studies have shown that not only motility but also chemotaxis is an important factor for successful colonization of the stomach (Eaton et al., 1996; Foynes et al., 2000; Otteman and Lowenthal et al., 2002; Terry et al., 2005; Howitt et al., 2011; Rolig et al., 2012). H. pylori uses four methyl-accepting chemoreceptor proteins (TlpA, TlpB, TLpC and TlpD) to sense external stimuli and repellent ligands. Chemotaxis is used to colonize injured epithelium, which may possess high amounts of favorable nutrients (Aihara et al., 2014), and to respond to auto-inducer 2, a small signaling molecule involved in quorum sensing by which bacteria monitor the amount of bacteria in close proximity (Bassler et al., 1999; Surette et al., 1999). Living in close proximity could lead to limiting resources and therefore spreading out might be more favorable than staying together.

Outer membrane proteins In addition to motility and chemotaxis, adherence to the gastric epithelium is important because this facilitates colonization and persistence, by preventing the bacteria from being washed out from the stomach by mucus turnover and gastric peristalsis, by evasion from the immune system and by efficient injection of bacterial effector proteins into the gastric cell (Oleastro and Ménard, 2013). The outer membrane protein (OMP) profile of H. pylori strains differs significantly from that of other Gram-negative species as no major OMPs predominate, but rather multiple lower-abundance OMPs are observed (Alm et al., 2000). Approximately 4% of the H. pylori genome encodes an extraordinary large set of OMPs (~64 OMPs) divided into five paralogous gene families. This unusual set of OMPs may reflect the adaptation of H. pylori to its unique environmental niche. The known H. pylori adhesins all belong to the major OMP Family 1, comprised of the Hop (for H. pylori OMP, 21 members) and Hor (for Hop related, 12 members) proteins (Oleastro and Ménard, 2013). The best characterized adhesins are the blood group antigen-binding (BabA) and sialic acid-binding (SabA) proteins,

General Introduction the outer inflammatory protein A (OipA) and the adherence-associated lipoproteins AlpA and AlpB. BabA mediates the binding of H. pylori to fucosylated Lewis b blood group antigens (Leb) on blood group O (H antigens), A and B antigens, that are expressed on mucins and gastric epithelial cells (Aspholm-Hurtig et al., 2004). SabA mediates the binding to sialyl- dimeric-Lewis x glycosphingolipid (Lex), which is upregulated on the inflamed gastric tissue after H. pylori infection (Mahdavi et al., 2002). Both lipoproteins AlpA and AlpB have been shown to contribute to host laminin binding and to influence gastric inflammation (Senkovich et al., 2011). OipA is involved in the adherence of H. pylori to gastric cell lines (Dossumbekova et al. 2006), but its host receptor remains to be identiﬁed. Families 2 and 3 comprise the Hof (for Helicobacter OMP, 8 members) and Hom (for Helicobacter outer membrane, 4 members) proteins, respectively. Families 4 and 5 are composed of iron- regulated OMPs (6 members) and efflux pump OMPs (3 members), respectively (Oleastro and Ménard, 2013).

Before the start of this research, information about the OMPs from gastric NHPH species was limited. In addition, it was also unknown which OMPs are involved in adhesion to and colonization of the gastric mucosa. The genomes of H. bizzozeronii (Schott et al., 2011), H. felis (Arnold et al., 2011), H. heilmannii (Smet et al., 2013), H. suis (Vermoote et al., 2011a), H. acinonychis (Eppinger et al., 2006), H. cetorum (Kersulyte et al., 2013) and H. mustelae (O’Toole et al., 2010) have recently been published. Similar to H. pylori, they also harbor a large repertoire of OMP-encoding genes. Remarkably, all canine, feline and porcine helicobacters seem to lack the well-characterized and important H. pylori Hop and Hom adhesins, suggesting that other OMPs may be used by these species for adhesion to the gastric mucosa. H. suis also contains some similar members of the major OMP families described for H. pylori. These include the gastric epithelial cell adhesin HorB and the surface lipoprotein, H. pylori adhesin A (HpaA). HpaA, also annotated as neuraminyllactose-binding hemagglutinin, is found exclusively in Helicobacter species and binds to sialic acid-rich macromolecules present on the gastric epithelium.

Major virulence factors involved in lesion development

Cytotoxin-associated gene (cag) pathogenicity island (PaI) Probably the most important and definitely the best-characterized H. pylori virulence factor is the cytotoxin-associated gene (cag) pathogenicity island (PaI), whose presence in a

General Introduction functional form is associated with increased risk of developing peptic ulcer disease and gastric adenocarcinoma (Blaser et al., 1995; Nomura et al., 2002). It has, however, not been reported to be present in any other Helicobacter species. The cagPaI contains about 31 genes and encodes a bacterial type IV secretion system (T4SS) and its only known effector protein, CagA, which is injected into the gastric epithelial cells of the host. This T4SS represents a pilus-like structure (T4SS pilus), induced upon host cell contact and protruding from the bacterial membrane (Odenbreit et al., 2000). The presence of the T4SS itself is the major stimulus of epithelial cell pro-inflammatory cytokine/chemokine expression, including interleukin-8 (IL-8) (Peek et al., 1995). Translocation of CagA into the host epithelial cytosol results in profound cellular changes, benefiting the bacterium. The ‘injected’ CagA is recognized by epithelial cells as a signaling molecule and activated by phosphorylation on tyrosine residues by host src kinases (Selbach et al., 2002; Stein et al., 2002). It interacts with SHP-2 and induces MAP kinase signaling, resulting in abnormal proliferation and cytoskeletal changes (Higashi et al., 2002; Rieder et al., 2005). Phosphorylated CagA can also bind to Crk proteins, leading to the disruption of epithelial cell tight junctions and tissue damage (Suzuki et al., 2005). Non-phosphorylated CagA can interact with other cellular receptors such as Grb2 and ZO-I to induce other morphological cellular changes and proliferation (Mimuro et al., 2002; Amieva et al., 2003). CagA represents a prime example of tyrosine phosphorylatable effector proteins of bacteria. Site-directed mutagenesis and mass spectrometry has revealed numerous phosphorylation sites in CagA known as the Glu-Pro- Ile-Tyr-Ala (EPIYA) motifs A, B, C and/or D (Hatakeyama, 2003; Yamaoka et al., 2010). The motif present in East Asian strains of H. pylori (D type) is a more potent activator of SHP-2 than the corresponding (C type) motif found in Western strains (Hatakeyama, 2004). Several studies have shown that strains possessing CagA with more phosphorylation motifs are more closely associated with the development of atrophy and gastric carcinoma than strains possessing CagA with fewer motifs (Argent et al., 2004). The actions by which CagA increases cancer risk remain unclear. It could be due to increased IL-8 secretion, however contradicting results exist (Ando et al., 2002; Backert et al., 2004).

Vacuolating cytotoxin A (VacA) Vacuolating cytotoxin A (VacA) is the second most extensively studied H. pylori virulence factor. The VacA toxin binds to host cells after secretion through a type V autotransporter secretion system. In addition to vacuolation, VacA can induce multiple activities in the host

General Introduction cell, including membrane-channel formation, cytochrome c release from mitochrondria leading to apoptosis, and binding to cell membrane receptors followed by initiation of a pro- inflammatory response (Kusters et al., 2006). VacA can also specifically inhibit T-cell activation and proliferation (Boncristiano et al., 2003). The coding gene vacA is present in nearly all H. pylori strains, although not all strains induce vacuolation of epithelial cells in vitro. The vacA gene possesses several polymorphic sites, namely the signal (s) region, the midregion (m) and the intermediate (i) region. Type s1/m1 strains have been shown to produce higher levels of cytotoxins in vitro compared to s1/m2 strains, whereas s2 genotypes are inactive in vacuolating cytotoxicity assays (Atherton et al., 1995). Strains carrying s1/m1 vacA alleles are associated with increased bacterial load and neutrophil infiltration (Atherton et al., 1997). However, the i-region has been reported to be a more reliable predictor of severe gastric disease than the s- or m-regions of vacA (Rhead et al., 2007). Vermoote et al. (2011a) demonstrated that a vacA homolog was absent in H. suis strain 5, whereas a vacA paralog was present in H. suis strain 1. Sequence analysis, however, suggested that no functional toxin is produced (Vermoote et al., 2011a).

Gamma-glutamyl transpeptidase (GGT) The enzyme gamma-glutamyl transpeptidase (GGT) is well conserved in the genus Helicobacter and has been shown to play an important role during the metabolism of extracellular L-glutamine (L-Gln) and reduced glutathione (GSH) (Flahou et al., 2011). The Helicobacter GGT is very efficient in using both glutamine and gluthatione from epithelial cells as a source of glutamate (Shibayama et al., 2003; Flahou et al., 2011). It is probably involved in gastric epithelial cell damage as glutamine is an important nutrient for host cells and gluthatione a crucial antioxidant. They thus both play a role in maintaining healthy gastric tissue. In addition, degradation of reduced glutatione by H. suis GGT results in more extracellular oxygen radicals, further increasing oxidative damage of epithelial cells (Flahou et al., 2011). GGT also inhibits T-cell proliferation, indicating its role in immune evasion (Zhang et al., 2013).

General Introduction

3.2 Immune response to Helicobacter pylori

Despite induction of innate and adaptive immune responses in the H. pylori infected individual, the host is unable to clear the bacteria, leading to chronic inflammation. One widely accepted hallmark of H. pylori is that it successfully evades host defense mechanisms. In the next paragraphs, the innate and adaptive immune responses to H. pylori and the different mechanisms by which H. pylori evades immune-mediated clearance will be discussed. A simplified presentation of the host immune response following H. pylori infection is depicted in figure 4.

Figure 4. Simplified presentation of the host immune response following Helicobacter pylori infection. H. pylori T4SS is induced by contact with the host cell and forms a pilus-like structure that protrudes from the bacterial surface. T4SS delivers the effector protein of the cagPAI, CagA, and H. pylori cell wall peptidoglycan into the host cell. The latter is recognized by the cytoplasmic pathogen recognition molecule NOD1. This triggers a pro-inflammatory signaling cascade in epithelial cells, characterized by the translocation of NF-κB to the nucleus and activation of mitogen-activated protein kinases (MAPKs), p38 and extracellular signal regulated kinase (ERK), leading to the production of pro-inflammatory cytokines/chemokines including IL-8, by which innate immune cells (including neutrophils, macrophages and dendritic cells) are attracted. The subsequent expression of cytokines by these cells leads to skewing of naive CD4+ cells into T helper (Th) 1, 2, 17 or regulatory T-cells.

General Introduction

The innate immune response to Helicobacter pylori infection

Innate immune recognition of H. pylori H. pylori is mainly considered as an extracellular pathogen (Amieva et al., 2003). Before attaching to the gastric epithelium, H. pylori has to cross the thick mucus layer covering the mucosal surface. As described above, the unipolar sheathed flagella allow H. pylori to quickly move from the inhospitable low pH of the gastric lumen to the epithelial surface where the pH is higher and favorable for successful colonization (Khatoon et al., 2016). Colonization of the gastric mucosa triggers innate host defense mechanisms, thus stimulating the expression of pro-inflammatory and anti-bacterial factors by gastric epithelial cells (Jung et al., 1997; George et al., 2003). Toll-like receptors (TLR’s) are important pathogen recognition receptors (PRR) expressed by epithelial cells and cells of the innate immune system, including dendritic cells and macrophages (Kaparakis et al., 2010). They are involved in pathogen-associated molecular pattern (PAMP) recognition. TLR1, TLR2, TLR4, TLR5 and TLR6 bind to their ligands on the cell surface and recognize microbial membrane components. TLR3, TLR7, TLR8, TLR9 are found in intracellular vesicles and are mainly involved in the recognition of microbial nucleic acids (Smith et al., 2014). Various in vitro experiments have shown that H. pylori can stimulate pro-inflammatory gene expression via TLR2, TLR4, TLR5 and TLR9. However, some of these results are conflicting and the role of TLR4 in particular remains controversial (Robinson et al., 2007). It has been shown that H. pylori lipopolysaccharide (LPS) initiates inflammatory signaling in human epithelial cells via TLR2, rather than the more classical sensor of Gram-negative LPS, TLR4 (Yokota et al., 2007; Smith et al., 2011).

NOD1 is a member of the nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) family and an intracellular PRR. It is responsible for the recognition of H. pylori peptidoglycan, delivered by the CagA type IV secretion system (Viala et al., 2004). This results in the induction of NF-κB activation and subsequent production of pro-inflammatory cytokines/chemokines, including IL-8 (Viala et al., 2004). H. pylori is known to elude recognition by PRRs by multiple methods, including avoidance of recognition by TLR’s and inhibition of C-type lectin receptor (DC-SIGN)-mediated signaling. To avoid recognition by TLR’s the bacterium modulates its surface molecules (including LPS and flagellin) (Lina et al., 2014). LPS is a glycolipid found on the outer membrane of Gram-negative bacteria (Cullen et al., 2011) and consists of lipid A, a core polysaccharide of five sugars and the O- antigen (Appelmelk and Vandenbroucke-Grauls, 2001). As determined by serological techniques, the O-antigen of LPS of more than 80% of H. pylori strains tested worldwide

General Introduction express Lewis blood group antigens (Appelmelk and Vandenbroucke-Grauls, 2001). Lewis antigens, which are composed of carbohydrates, resemble human blood group antigens (Wang et al., 2000). By exploiting this form of molecular mimicry, the bacterium is able to evade TLR’s because the normally detectable O-antigens are recognized as a “self” molecule by this type of PRR. The bacterium also modifies the lipid A portion of the LPS molecule. Modification of this unit is achieved through several pathways, resulting in an alteration of the net charge of the microbial surface, which leads to an inability of cationic antimicrobial peptides (CAMP’s) to bind to typically negatively charged structures like lipid A. This reduced binding of LPS to TLR4 results in a decreased activation of monocytes and macrophages (Lina et al., 2014). In addition, several studies showed that the major H. pylori flagellin, FlaA, was not recognized by TLR5 and thus failed to induce NF-κB activation (Andersen-Nissen et al., 2005).

The role of infiltrating leukocytes Cytokines and chemokines secreted by gastric epithelial cells stimulate the migration of granulocytes, monocytes and lymphocytes into the inflamed mucosa. High densities of infiltrating cells are associated with more severe inflammatory pathologies (Ernst et al., 2000). A major H. pylori pro-inflammatory factor involved in the enhancement of early immune responses is the H. pylori neutrophil activating protein (HP-NAP). A homologue of the coding gene is found in the H. suis genome (Vermoote et al., 2011a). HP-NAP promotes the adherence of neutrophils to the endothelium, their transendothelial migration, chemotaxis of leukocytes and the release of reactive oxygen species (ROS) by neutrophils and monocytes (Polenghi et al., 2007). H. pylori produces catalase and superoxide dismutase to detoxify ROS. H. pylori can also downregulate CXCR1 and CXCR2 expression in human neutrophils, which act as receptors for the neutrophil recruiting chemokine, IL-8, thus resulting in an inhibitory effect on neutrophil migration and reduced bacterial killing (Lina et al., 2014).

Professional antigen-presenting cells (APC), represented by macrophages, dendritic cells (DCs) and B cells, internalize antigen by phagocytosis or endocytosis, process the antigens and present them to CD4+ T-cells via MHC class II molecules. This leads to the initiation of antigen specific T-cell responses. Phagocytosis is an important anti-bacterial innate immune mechanism, but H. pylori seems to partially evade phagocyte-mediated killing. A large proportion of engulfed bacteria appear to survive inside phagosomes which fuse to become ‘megasomes’ and may provide a protected intracellular niche contributing to the persistence

General Introduction of infection. Urease and possibly the cagPaI are involved in megasome formation and H. pylori survival (Allen et al., 2000).

The role of DCs in H. pylori pathogenesis is complex. There is a growing consensus that DCs may play an important role in promoting tolerance (Shiu and Blanchard, 2013). H. pylori uses several mechanisms to interrupt antigen presentation by DCs, in which the virulence factors VacA and CagA possibly play a role (Lina et al., 2014). Kaebisch and colleagues (2014) infected DCs with H. pylori strains deficient for one of the following virulence factors: CagA, BabA, UreA/B, GGT or VacA. The expression of CD86/CD83 double positive cells was significantly higher when DCs were infected with CagA deficient bacteria, whereas deletion of the other factors did not influence the phenotypical maturation of DCs. In addition, comparable results were observed when DCs were infected with the SS1 strain, which has a non-functional CagY and does not translocate CagA into the host cells, indicating that CagA translocation is mainly responsible for the H. pylori-induced incomplete DC maturation. In the same study, it was shown that CagA impairs DC maturation and function through IL-10- mediated activation of STAT3, favoring a Treg response (Kaebisch et al., 2014). Similar studies have been carried out in mouse models, confirming that CagA suppresses DC maturation and function (Tanaka et al., 2010), however conflicting results exist. In a study by Oertli et al. (2013), VacA and GGT were pointed out as the main virulence factors involved in murine DC tolerization. Kim et al. (2011) demonstrated that VacA inhibits DC maturation via restoration of E2F1, an important regulator of DC maturation, since transfection of murine DCs with E2F1 siRNA showed recovery of maturation inhibition caused by VacA. In addition, H. pylori is also known to cause an impaired antigen presentation by murine DCs by inhibiting export of MHCII molecules to the cell surface (Wang et al., 2010). Several studies demonstrated that depletion of DCs improved clearance of H. pylori and induced protective immunity upon infection (Hitzler et al., 2011; Oertli et al., 2012). These results suggest that DCs are most likely dispensable for immunity to H. pylori and instead are an essential element of immuno-regulation, preventing control of the infection.

In addition, mast cells have been reported to be present at higher frequencies in the infected human gastric mucosa, declining after H. pylori eradication therapy (Bamba et al., 2002). The role of these cells during infection has not been widely studied. They may be involved in tissue repair and/or increased inflammatory responses (Yakabi et al., 2002).

General Introduction

The adaptive immune response to H. pylori infection

Effector T-cell responses Naive CD4+ T helper cells can be induced to differentiate towards effector T helper 1, Th2, Th17 and regulatory T-cell (Treg) cells depending on the cytokine milieu (Larussa at al., 2015). The Th1 phenotype is defined by differentiation in the presence of IL-12 and IFN-γ and secretion of IL-2 and IFN-γ. The number of IFN-γ secreting cells in the human gastric mucosa correlates with severity of the gastritis (Larussa et al., 2015). Th2 cells secrete IL-4, IL-5, IL-6 and are responsible for B-cell activation and differentiation. In general, most intracellular bacteria induce Th1 responses, whereas extracellular pathogens stimulate Th2 responses (Larussa at al., 2015). Th17 cells produce IL-17A, IL-17F, IL-21 and IL-22. They are involved in host defense mechanisms to extracellular bacteria and fungi, but also in the pathogenesis of auto-immune diseases (Larussa at al., 2015). IL-17 has been shown to be involved in neutrophil infiltration during H. pylori infection (Shiomi et al., 2008). Mice infected with H. pylori have been shown to develop a mixed Th17/Th1 response, with the Th17/IL-17 pathway preceding and modulating the Th1 response (Shi et al., 2010).

Given the critical role of effector T-cells (Th1 and Th17 subsets) in controlling H. pylori, it is no surprise that these bacteria have developed elaborate mechanisms to suppress human T- cell activity, proliferation and clonal expansion. Several virulence factors play a role in interfering with T-cell responses including VacA, GGT and arginase (Lina et al., 2014). All H. pylori strains express the secreted virulence factors VacA and GGT. Hexameric VacA binds to the β2 integrin subunit of the heterodimeric transmembrane receptor LFA-1. The receptor complex is internalized upon protein kinase C-mediated serine/threonine phosphorylation of the β2 integrin cytoplasmic tail. Cytoplasmic VacA prevents nuclear translocation of NFAT by inhibiting its dephosphorylation by the Ca2+/calmodulin-dependent phosphatase calcineurin and thereby blocks IL-2 production and subsequent T-cell activation and proliferation. Interestingly, murine T-cells are resistant to VacA, because they do not express this receptor (Algood et al., 2007; Sewald et al., 2008); rather, it appears that VacA promotes persistence in mice through a mechanism involving its interaction with DCs (Oertli et al., 2013). The inhibitory effect of GGT on T-cell proliferation could be linked to a cell cycle arrest in the G1 phase and to its enzymatic activity (Schmees et al., 2007). Another virulence factor that impairs T-cell function is arginase, which hydrolyzes L-arginine, an amino-acid required for T-cell activation and function, into urea and ornithine (Zabaleta et al., 2004).

General Introduction

Regulatory T-cell responses There is increasing evidence that H. pylori may elicit Treg responses to suppress immune and inflammatory responses and thus maintain chronic colonization in order to limit tissue injury. Tregs can be divided into several subsets according to how they are derived and the markers they express. ‘Inducible’ Tregs develop in the periphery upon stimulation of T-cells in the presence of IL-2 and TGF-β, whereas ‘natural’ Tregs are thymus derived. They express FoxP3, which is a member of the forkhead/winged-helix family of transcriptional regulators. They also express high levels of the surface marker CD25 and an array of secreted and surface exposed regulatory molecules including IL-10, TGF-β, CTLA-4, PD1 and GITR (Bollrath and Powrie, 2013). FoxP3-expressing CD4+CD25high regulatory T-cells have previously been demonstrated in the gastric mucosa of H. pylori infected humans (Lundgren et al., 2005). Multiple in vivo and in vitro studies have shown that H. pylori specifically targets DCs to promote their tolerogenic properties, as described above. H. pylori stimulated DCs fail to mature, as shown by the impaired expression of MHCII and co-stimulatory markers including CD80, CD86 and CD40 (Oertli et al., 2012; Kaebisch et al., 2014). However, these semi-mature DC are excellent inducers of Treg differentiation in vitro and in vivo (Kao et al., 2010; Oertli et al., 2012). Induction of Treg cells appears to depend on the age at which the host acquired the infection, since H. pylori infected children have increased levels of FoxP3-expressing cells and reduced gastric pathology compared to adults (Harris et al., 2008). H. pylori may utilize several yet unknown mechanisms to induce Treg responses, while maintaining a suboptimal level of Th17 cells in the host, which helps to establish a chronic infection (Lina et al., 2014).

Humoral immunity The majority of people infected with H. pylori develop a specific antibody response, which is not sufficient to clear an existing infection. In a study of mice lacking B-cells, the animals were protected against H. pylori challenge suggesting that the humoral response might be dispensable. To further support this, another B-cell knockout study showed that with an H. pylori urease vaccine, mice deficient in B-cells had equal protection as wild type mice and stomach CD4+ T-cells were equal in both mouse strains (Ermak et al., 1998). It was also demonstrated that differences in this specific antibody response occur. Infected individuals who develop gastritis or duodenal ulcers were shown to have a greater IgG response than those who develop gastric cancer. In contrast, patients with gastric cancer mount a more

General Introduction distinct IgA response compared to those with gastritis and duodenal ulcers (Manojlovic et al., 2004). Interestingly, a study showed that H. pylori evades antibody-mediated recognition through lack of surface binding of host elicited antibodies (Darwin et al., 1996).

In conclusion, the immune response to H. pylori includes both innate effectors and a complex mix of Th1, Th17, and Treg adaptive immune responses. The clinical outcome of infection may well depend to a large extent on the relative balance of these responses.

General Introduction

3.3 Animal models used for the study of the inflammatory and immune response following gastric Helicobacter infections

In order to study the pathogenic outcome and immune responses evoked by gastric Helicobacter infections, animal experiments remain fundamental. Current studies most commonly use mice, Mongolian gerbils or non-human primates. Because of cost, ease of manipulation, availability of reagents and genetic tools, the laboratory mouse is often the model of choice. However, the function of the H. pylori type IV secretion system is commonly lost during colonization of mice. This occurs less frequently in Mongolian gerbils. However, for the latter less genetic tools and reagents are available.

After the discovery of H. pylori, attempts were made to infect mice and rats, but remained unsuccessful. For 10 years, animal experiments were predominantly performed using H. felis in mice and H. mustelae in ferrets. H. felis causes lesions that are similar to those caused by H. pylori, but the lesions are more severe and rapidly progressive (Court et al., 2002). The mouse model was not frequently used until 1997 when strain SS1 was introduced (Lee et al., 1997). SS1 is an H. pylori isolate from a human patient that was adapted to mouse colonization by several in vivo passages. SS1 colonizes mice well, persists indefinitely in most mouse strains, causes histological gastritis and is genetically tractable. This strain became the international standard for animal experimentation with H. pylori (Lee et al., 1997).

Progression and severity of gastric lesions in gastric Helicobacter-infected mice are enhanced by adoptive transfer of CD4+ T-cells or by absence or suppression of T-cell regulatory cytokines such as IL-10 (Eaton et al., 2001) or Treg subsets (Gray et al., 2013), as described above. Gastritis and secondary epithelial lesions are enhanced by Th1 and Th17 cytokines, IFN-γ in particular, which appears to be the principal inducer of gastritis and metaplasia in murine models (Sayi et al., 2009). This could explain the less severe lesions in H. suis infected BALB/c mice, in which a Th1 response is mostly absent. However, conﬂicting reports have been published regarding the immune response underlying H. suis-induced gastritis. Several authors have described the inﬂammation to be driven mainly by a Th1 response (Cinque et al., 2006; Mimura et al., 2011). Others have described a mixed Th1/Th2 response (Park et al., 2008). However, these studies used gastric mucosal homogenate or gastric mucus from H. suis infected mice to inoculate the animals. Studies using pure in vitro isolated H. suis strains revealed that experimental H. suis infection in mice causes an upregulation of IL-17, IL-10, and IL-4 expression, in the absence of IFN-γ upregulation

General Introduction

(Flahou et al., 2012), which also clearly contrasts to the immune response elicited by H. pylori in this same animal model. Other pro-inflammatory cytokines, such as TNF-α (Thalmaier et al., 2002) and IL-1β (Huang et al., 2013) have also been associated with gastric disease in mouse models.

The inflammatory infiltrate in both H. pylori infected mice and humans, consists of a mixture of neutrophils and mononuclear inflammatory cells that are rarely specifically identified, but probably are a mixture of lymphocytes, plasma cells, macrophages and dendritic cells. In humans, chronic infection is sometimes associated with loss of gastric glands and fibrosis (atrophic gastritis) and replacement of gastric-type glandular epithelium with intestinal type epithelium, complete with absorptive and goblet cells (intestinal metaplasia). Gastric cancer is thought to develop as a result of intestinal metaplasia progressing to dysplasia and neoplasia. In contrast, mice do not develop atrophy or intestinal metaplasia, but chronic colonization rather leads to epithelial hyperplasia and a type of metaplasia known as spasmolytic polypeptide-expressing metaplasia (SPEM) (Weis and Goldenring, 2009). Experimental H. suis infection in mice evokes inflammation in the glandular part of the stomach, epithelial cell hyperproliferation and necrosis of parietal cells. The loss of parietal cells might be involved in the development of several gastric pathologies, such as gastric erosion and ulcer formation (Flahou et al., 2010). Lesion severity associated with H. suis is often less than described for H. pylori (Stolte et al., 1997). In the case of H. suis more MALT lymphoma-like lesions are observed (Nakamura et al., 2007; Yang et al., 2014).

Interestingly, a Th2 response, rather than a Th1-predominant response, has been shown to play a role in the development of low-grade B-cell MALT lymphoma (Flahou et al., 2012). In BALB/c mice experimentally infected with different H. heilmannii sensu lato bacteria, ‘isolated’ in vivo in mice and originating both from humans and animals, gastric MALT lymphoma has been shown to start developing from 6 months post infection (O’Rourke et al., 2004b). In this study, the most severe pathological changes were seen in mice infected with in vivo ‘isolates’ from a human patient, a bobcat, a crab-eating macaque, and mandrill monkeys. Except for the strain from the bobcat, these strains were in fact shown to be H. suis. Similar lesions were observed in C57BL/6 mice infected for at least 6 months with an in vivo ‘isolate’ of ‘Candidatus H. heilmannii’, which later was also shown to be H. suis (Nakamura et al., 2007; Haesebrouck et al., 2009), as well as in Mongolian gerbils infected with an in vitro isolated strain of H. suis (Figure 5) (Flahou et al., 2010). These histopathological changes

General Introduction resemble inﬂammation-related changes in the stomach of humans infected with NHPH, including H. suis.

Figure 5. H&E staining of the fundus of a H. suis-infected BALB/c mouse. In this animal, infected for 8 months, two large lymphoid aggregates can be seen in the lamina propria mucosae, accompanied by loss of normal mucosal architecture. Original magnification: 200× (Flahou et al., 2010).

The first published description of the gerbil model appeared in 1991 (Yokota et al., 1991). In 1998, it was demonstrated that long term infection of Mongolian gerbils with H. pylori led to gastric adenocarcinoma in approximately one-third of infected animals, without the co- administration of carcinogens, which was subsequently confirmed by others (Watanabe et al., 1998; Ogura et al., 2000). This closely resembled the development of gastric adenocarcinomas in H. pylori-infected humans. H. pylori colonizes deep within the gastric mucus gel layer near the epithelia, similar in topography to where the bacteria are found in human gastric specimens (Schreiber et al., 2004). Similar observations were made in Mongolian gerbils infected with H. suis, where inflammation is limited to the antrum and a narrow zone at the forestomach-stomach transition, which also resembles more closely the human situation (Figure 6). Therefore, the Mongolian gerbil might be a more suitable model for human gastric disease compared to mice. Several authors describe the increased expression of IL-17 and IFN-γ mRNA in H. suis-infected gerbils, which indicates a

General Introduction predominant Th17/Th1 response in this animal model (Liang et al., 2015, Zhang et al., 2015). IL-1β, a cytokine that inhibits acid secretion, is also increased within the gastric mucosa of both H. pylori and H. suis infected gerbils. In addition, in this animal model also increased serum levels of gastrin are observed, which can promote cell growth and is directly related to gastric epithelial cell proliferation (Peek et al., 2000; Joosten et al., 2013). In Mongolian gerbils infected with H. suis, generally more severe inflammation is observed, evolving to a pathology that resembles gastric MALT lymphoma.

Figure 6. Immunohistochemical Helicobacter staining of a gerbil stomach, showing H. suis colonization. H. suis bacteria (brown) are seen (A) in the glands of the antrum and (B) at the forestomach/stomach transition zone, accompanied by a focal infiltrate of mononuclear cells. Original magnification: 200× (Flahou et al., 2010).

General Introduction

4 Control of gastric Helicobacter infections

4.1 Antimicrobial therapy

Eradication of H. pylori infection provides symptomatic benefits for many dyspepsia patients, heals and prevents recurrence of peptic ulcer disease, reduces the risk of development of gastric cancer and can be a curative therapy for gastric MALT lymphoma (Molina-Infante and Graham, 2016). Over the last 20 years, the most recommended first-line treatment for eradication of H. pylori by all international guidelines has been the standard triple therapy, consisting of a proton pump inhibitor (PPI) and the combination of two antibiotics (clarithromycin and amoxicillin or metronidazole) (Chey and Wong, 2007; Fock et al., 2009; Malfertheiner et al., 2012). However, the effectiveness of triple therapy has dramatically declined due to the increased resistance to clarithromycin (Graham and Fischbach et al., 2010), which reaches up to 40% in adults in southern and central European countries (Megraud et al., 2013). Global guidelines recommend that first-line therapies for H. pylori infection should have a minimum of 90% eradication success rate. This eradication rate is frequently not achieved with the standard PPI-based triple therapies. Novel empiric therapeutic schemes have been explored to overcome acquired antibiotic resistance. The choice of therapy may depend on the patient’s previous antibiotic treatment, local patterns of antimicrobial resistance and drug availability. Optimization of all eradication regimes (including duration, PPI/ antibiotic doses and dosing intervals) is key to maximize efficiency. Currently, the most effective first-line eradication regimens are 14-day bismuth and non- bismuth concomitant quadruple therapies. These regimens consist of bismuth salicylate, metronidazole, tetracycline, and PPI. No trial has compared the efﬁcacy of both regimens yet (Graham et al., 2014; Molina-Infante and Gisbert et al., 2014).

In human patients presenting severe pathology and clinical symptoms associated with the presence of NHPH, treatment is warranted, although the efficacy of such treatment is not always easy to determine due to the lack of randomized trials. In general, treatment regimens identical to those used for H. pylori have been prescribed and may be effective (Haesebrouck et al., 2009). Because of the low number of in vitro isolates available, very little data exist on the antimicrobial susceptibility and acquired resistance of gastric NHPH species. Determination of minimal inhibitory concentrations (MICs) of various antimicrobials against in vitro isolates indicates that acquired resistance to metronidazole may occur in H. bizzozeronii and H. felis strains of animal origin (Van den Bulck et al., 2005). Experimental H. felis infections in mice showed that several therapies using only one

General Introduction antimicrobial were effective in only 25 to 70% of the animals tested, while triple therapy using metronidazole, tetracycline, and bismuth subcitrate eradicated H. felis from all the animals (Dick-Hegedus et al., 1991). In a BALB/c mouse model it was shown that treatment with ampicillin/omeprazole resulted in the suppression of H. suis. Differences in sensitivity were seen between different H. suis isolates, which might indicate acquired antimicrobial resistance (Hellemans et al., 2005). Vermoote et al. (2011b) developed a combined agar and broth dilution method to analyze the activity of antimicrobial agents against H. suis isolates. MICs were determined by software-assisted calculation of bacterial growth. Results of this study showed that acquired resistance to fluoroquinolones may occur in H. suis field isolates. As the results of this study are based on a small number of strains, additional tests are needed to determine if these results reflect the susceptibility of the H. suis population.

4.2 Vaccination against gastric Helicobacter infections

Current status in Helicobacter pylori vaccination

Although antibiotic treatment combined with proton pomp inhibitors may lead to eradication of infection, several difficulties including side-effects and the development of antibiotic resistance may occur. Epidemiological studies have reported a reinfection rate of 20-30%/year after antibiotic treatment in low- and middle-income countries, which is accompanied by the return of peptic ulcer disease and the risk of gastric cancer (Parsonnet et al., 2003). Therefore, large scale control of H. pylori infections is probably best achieved through vaccination strategies (Robinson et al., 2007). However, due to the complex pathogenicity and large variability, vaccine development remains a major challenge. Efforts to develop a Helicobacter pylori-specific vaccine began in the early 1990s with the recognition that infection with this bacterium is the main cause of peptic ulcer disease and is a strong risk factor for gastric cancer in humans. Vaccination protocols with a wide range of different antigens, adjuvants and delivery routes can significantly reduce H. pylori colonization in rodent models and humans, however, sterilizing immunity is rarely achieved (Müller and Solnick, 2011).

Protective immune mechanisms for eradication of Helicobacter pylori For the development of an effective vaccine, the protective immune mechanisms that will lead to bacterial eradication need to be identified. As this is an extracellular bacterium, it was originally presumed that a secretory IgA response would be sufficient to prevent infection.

General Introduction

However, early studies in mice clearly showed that CD4+ T helper cells, but not CD8+ T-cells or antibodies were crucial for vaccine-induced protection (Ermak et al., 1998; Blanchard et al., 1999; Pappo et al., 1999). Several studies attributed a major role for Th17 responses in vaccine-induced protection against H. pylori in mice, possibly through IL-17-mediated induction of neutrophil chemo-attractants (DeLyria et al., 2009; Velin et al., 2009). The importance of a Th1 response for protection was shown by several research groups (Akhiani et al., 2002; Sayi et al., 2009), but contradicted by others (Sawai et al., 1999; Garhart et al., 2002; Flach et al., 2011). In any case, CD4+ T helper cells with the ability to migrate to gastric mucosal effector sites and secrete either Th1 or Th17 cytokines, or both, are crucial for vaccine-induced protection. Garhart et al. (2003) demonstrated, by using gene knockout studies, that IL-4 is dispensable for the induction of protective immunity.

Choice of antigens A number of vaccine antigens have been tested over the years including whole-cell lysates (Sutton et al., 2000; Kotloff et al., 2001) and single or combined purified or recombinant proteins (subunit vaccines).

Whole-cell lysate vaccines consist of bacteria that have been inactivated by physical or chemical processes. The advantage of such preparations is that they contain all the known immunodominant and protective antigens (Raghavan, unpublished results). The lysate also contains a high concentration of pathogen-associated molecular patterns such as LPS, flagellin and unmethylated cytosine, guanine oligonucleotides (CpG DNA), that potentially trigger an inflammatory reaction when given together with a strong mucosal adjuvant. Drawbacks are batch-to-batch variation and lack of thorough characterization of the preparation. However, in several studies both after prophylactic (Garhart et al., 2002; Raghavan et al., 2010) and therapeutic immunization (Raghavan et al., 2002, Nÿstrom et al., 2006), a strong reduction in H. pylori colonization was observed when using whole-cell lysates.

Subunit vaccines may have the disadvantage of sometimes being less immunogenic, but have an excellent safety profile. This is due to their high purity which limits the risk of adverse reactions (Gerdts, 2015). The important H. pylori virulence factors CagA (Rossi et al., 2004) and VacA (Marchetti et al., 1998) have been used as antigens for immunization. However, VacA has been shown to inhibit T-cell activation and proliferation and CagA is not secreted by all H. pylori strains and not by NHPH species, which could make these antigens less

General Introduction suitable for vaccination (Blanchard and Nedrud, 2010). Several other antigens have also been used including, urease (Kleanthous et al., 1998; Weltzin et al., 2000), HP-NAP (Satin et al., 2000), catalase (Radcliff et al., 1997), heat shock proteins (Kamiya et al., 2002) and lipopolysaccharide (Taylor et al., 2008). The use of bacterial vectors for the delivery of antigens has also been investigated. Attenuated Salmonella Typhi, Lactobacillus ssp. and polio virus all have been used as vectors for urease (Corthesy et al., 2005; Smythies et al., 2005; Aebischer et al., 2008). The advantage of this approach is that there is less need for an adjuvant.

Another alternative is DNA vaccination by which DNA encoding an antigen is inserted into a bacterial plasmid. Since this type of vaccines induces host cells to newly synthezise foreign antigens, they are effective in inducing both cellular and humoral responses. Mucosal administration of an ureB DNA vaccine was shown to induce both innate and cellular adaptive immunity in the gastric mucosa of mice and to significantly reduce H. pylori colonization densities after challenge infection (Hatzifoti et al., 2006).

Choice of adjuvants The mucosal route of immunization requires the use of a strong adjuvant because proteins are poor mucosal immunogens. Most adjuvants are used with inactivated whole-cell or subunit vaccines. Live-attenuated vaccines rarely require adjuvants due to a different mode of action, resulting in a higher immunogenicity (Gerdts, 2015). Adjuvants are required to assist vaccines to induce potent and persistent immune responses, with the additional benefits that the dose and dosing schedule of the antigen(s) can be decreased and modulated, which reduces the cost and logistical complexity of administering vaccines (Davies et al., 2009). Mineral salts, such as alum-based vaccines and oil-water emulsions (either water-in-oil or oil-in-water) have been successfully used since the early 1940s in both humans and animals, and are still being used today.

The strongest and most frequently used mucosal adjuvants in prophylactic H. pylori vaccination studies are cholera toxin (CT) and the heat-labile toxin from Escherichia (E.) coli (LT). CT is the virulence factor of Vibrio cholerae and consists of an A and B subunit (Giuliani et al., 1998). The pentameric B subunit binds to receptors on the plasma membrane and delivers the A subunit into the cytoplasma to exert its enzymatic activities and hence toxicity. CT is known to elicit strong T-cell as well as B-cell responses to vaccine components. However, both CT and LT cause severe diarrhea, limiting their use in humans.

General Introduction

In addition, in 2000, an intranasal vaccine (NasalFlu) was introduced in Switzerland that contained LT as an adjuvant. The vaccine was withdrawn after being associated with an increased risk of a form of transient facial paralysis called Bell´s palsy (Mutsch et al., 2004). The LT adjuvant shares 80% homology with CT, which is also a potent adjuvant, but can be toxic when used intranasally (Pizza et al., 2001). Although the adverse reactions induced by CT and LT prevent their use as a vaccine component, it remain excellent research tools. Their strong immune enhancing properties warrant their use as a reference in experimental studies dealing with the efficacy of other adjuvants.

For half a century, incomplete (IFA) and complete Freund’s adjuvant (FA) have also been commonly used for experimental work (Billiau and Matthys, 2001). Freund’s adjuvant is a solution of antigen emulsified in mineral oil. The complete form is composed of inactivated mycobacteria (usually M. tuberculosis) whereas the incomplete form (IFA) lacks the mycobacterial components. FA is designed to provide continuous release of antigens, necessary for stimulating a strong, persistent immune response. The main disadvantage is that it can cause granulomas and inflammation at the inoculation site, therefore it should be injected subcutaneously or intraperitoneally. Intravenous injections can cause lungembolism. The mycobacteria in Freund’s complete attract macrophages and other cells to the injection site which enhances the immune response. Mostly, FA is used for the initial injections and IFA is used for the boosts, to minimize the side-effects. Due to its toxicity, the use in human patients is forbidden. Research on transgenic mice that were injected intraperitoneally with H. pylori lysate and FA showed a clear decrease in the number of colonizing bacteria by Th1- mediated immune response. The combined use of FA and IFA induced a mix of Th1 and Th2 responses (Eisenberg et al., 2003).

Other, less frequently used adjuvants are CpG-DNA and Curdlan. Synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs trigger cells that express TLR9 (including human plasmacytoid dendritic cells and B-cells) to mount an innate immune response characterized by the production of Th1 and proinflammatory cytokines. When used as vaccine adjuvants, CpG ODNs improve the function of professional antigen-presenting cells and boost the generation of humoral and cellular vaccine-specific immune responses. The adjuvant properties of CpG ODNs are observed when administered either systemically or mucosally, and persist in immunocompromised hosts. Preclinical studies indicate that CpG ODNs improve the activity of vaccines targeting infectious diseases and cancer. Clinical trials demonstrate that CpG ODNs have a good safety profile and increase the immunogenicity of

General Introduction co-administered vaccines (Bode, 2011). Cox et al. (2006) also describe CpG-ODN motifs with immunostimulatory properties for several domestic animals, including pigs, making them a potentially interesting adjuvant.

Curdlan is a β-(1,3)-glucan, produced by the bacterium Alcaligenes faecalis. It is a PAMP recognized by several receptors including dectin-1, which is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages (Taylor et al., 2002). Activation of dectin-1 promotes signaling, ultimately resulting in the production of pro- inflammatory cytokines, thus inducing inflammation. Curdlan, when used as an adjuvant, is known to elicit a predominant Th17 response and can be administered intranasally as well as subcutaneously.

Vaccination routes In addition to different antigens and adjuvants, the choice of the administration route also plays an important role in the development of a vaccine. In general, Helicobacter vaccination strategies have been designed to generate an optimal immune response at the mucosal surface, in line with strategies designed for other mucosal bacterial infections (Blanchard and Nedrud, 2010). Alternatives to the intragastric route have been investigated, due to additional challenges on the stability of the antigen and adjuvants used. The intranasal and sublingual route of immunization have consistently proved to induce a stronger protection against H. pylori infection compared to the intragastric route. However, intranasal immunization is associated with a risk of translocation of GM1-binding adjuvants like CT to the olfactory bulb of the brain, restricting its applicability in humans (Van Ginkel et al., 2000). The sublingual route has been reported to be safe in mice and particularly suitable when using antigens or adjuvants that might be sensitive to the harsh environment of the stomach (Czerkinsky et al., 2011). However, mucosal immunization alone often requires two or three boosters for an effective immune response leading to reduction in the bacterial load in the stomach of mice (Sutton et al., 2000).

Since H. pylori also recruits inflammatory cells from the circulation (Blanchard and Nedrud, 2010), protective immunity may also be achieved through parenteral vaccination. A certain degree of protection has been described using prophylactic and therapeutic vaccination via several parenteral administration routes, mostly accompanied by adjuvants, such as Freund’s complete and incomplete adjuvant (Eisenberg et al., 2003; Morihara et al., 2007) and aluminum hydroxide (Ermak et al., 1998; Gottwein et al., 2001; Nyström et al., 2006).

General Introduction

Complete protection was however rarely observed and culture techniques were used to assess protection, which might not be the most sensitive evaluation method.

Obstacles for successful vaccination The role of Tregs in H. pylori vaccination was first described in the mouse model where it was shown to dampen the H. pylori induced-immunopathology by reducing the activation of CD4+ IFN-γ producing cells (Raghavan et al., 2003; Kaparakis et al., 2006; Rad et al., 2006; Sayi et al., 2009). Vaccination combined with Treg depletion has been suggested as strategy to enhance the protective effect of the vaccine. However, further investigation is required since blocking Treg activity might evoke auto-immune manifestations (Bayry et al., 2014).

Several studies have characterized the immune cell infiltration in the stomach of immunized mice compared to immunized infected mice, reporting enhanced infiltration of CD4+ T-cells, B-cells, neutrophils, M1 macrophages, DCs, mast cells, eosinophils and chemokine and cytokine response post challenge (Ermak et al., 1998; Quiding-Jabrink et al., 2010; Flach et al., 2011; Hitzler et al., 2011; Flach et al., 2012). This is referred to as post-immunization gastritis. It is often associated with the degree of protection against colonization as shown by a clear correlation between the severity of post-immunization gastritis and reduction of the bacterial load (Goto et al., 1999; Garhart et al., 2002; Morihara et al., 2007). Post- immunization gastritis may be transient, challenge strain dependent, and may or may not occur in different animal models (Robinson et al., 2007). For example, protection in the Mongolian gerbil model is not accompanied by post-immunization gastritis (Jeremy et al., 2006). Further studies are warranted for the future development of vaccines based on the induction of appropriate immune responses with minimal post-immunization gastritis.

In conclusion, combating H. pylori infections remains a major challenge for developing countries, where relatively high prevalence rates exist. As mentioned above, antibiotic therapy is a non-sustainable and sometimes inadequate strategy in the battle against H. pylori due to increased antimicrobial resistance. Therefore, the development of new vaccination strategies should be one of the main foci of future research. Certain progress has been made in the development of vaccines against H. pylori infection. However, unresolved issues for vaccine production include the complicated host immune response evoked by this pathogen, and the high genetic diversity in H. pylori. In addition, given the importance of adjuvants to, not only gastric Helicobacter vaccines, but vaccines in general, we can conclude that further research is required to better understand adjuvant action and how this might relate to adjuvant toxicity.

General Introduction

New adjuvants are needed that are potent enhancers of a specific type of immune response, as required for induction of protective immunity without compromising safety for humans and animals.

Vaccination against gastric non-Helicobacter pylori helicobacters

Apart from H. felis, only a limited number of studies investigated immunization strategies against other gastric NHPH (Table III). Dieterich et al. (1999) performed immunization with ‘Helicobacter heilmannii’ urease B administered intranasally together with CT as adjuvant in a BALB/c mouse model. Protection was achieved however, these results should be interpreted with caution since gastric tissue of ‘H. heilmannii’-infected mice was used for the challenge and the exact species of this strain was unknown. Urease, which is a highly conserved protein among Helicobacter species had already been used in different vaccination studies against H. pylori (Kleanthous et al., 1998; Marchetti et al., 1998) or H. felis infections (Michetti et al., 1994). Given the high degree of amino-acid conservation between H. pylori and H. felis urease enzyme, this protein most probably plays a role in the induction of cross-protection (Ferrero et al., 1994). In an immunization experiment by Hellemans et al. (2006) it was shown that both mucosal (with CT) and systemic immunization (with a saponin-based adjuvant) with heterologous whole bacterial cell lysate of H. pylori or H. felis and challenge with ‘Candidatus H. suis’, which was at that time unculturable, caused a decrease in faecal excretion of ’Candidatus H. suis’ DNA in mice. However, as shown by conventional PCR on the stomach samples, complete clearance was not achieved.

As previously mentioned, H. suis was successfully cultivated in vitro in 2008, which paved the way for new immunization studies with this bacterium (Baele et al., 2008). Prophylactic subcutaneous immunization of mice with whole bacterial cell lysates of H. suis, H. cynogastricus and H. bizzozeronnii was not protective against H. suis challenge (Flahou et al., 2009). Prophylactic intranasal immunization using a homologous (H. suis) or heterologous (H. cynogastricus and H. bizozeronnii) whole-cell lysate induced a protective response against H. suis, resulting in a minority of animals being H. suis negative, as shown by conventional PCR and urease activity test. However, increased mortality rates were observed in these vaccinated and challenged animals (Flahou et al., 2009).

An effective subunit vaccine might be a useful alternative for whole-cell lysates to control gastric NHPH infections. Vermoote and colleagues evaluated the protective efficacy of several subunit vaccine candidates, which was compared with that of whole-cell lysate in a

General Introduction mouse model. A subunit vaccine based on H. suis UreB, which was recombinantly expressed in E. coli (rUreB) was developed. Intranasal immunization with rUreB and cholera toxin (CT) resulted in a significant decrease of the bacterial load in the gastric mucosa, but could not prevent Helicobacter colonization. Immunization with whole-cell lysate, however, induced higher levels of protection compared to immunization with rUreB (Vermoote et al., 2012). Therefore, the efficacy of rUreB in combination with another H. suis protein was investigated (Vermoote et al., 2013). Simultaneous and consecutive immunization with the recombinant H. suis GGT (rGGT) and rUreB induced better protection against a subsequent H. suis challenge compared to immunization with single proteins. A complete clearance was observed in approximately 50% of the mice which is similar to the protection induced by a whole-cell lysate. This suggests that multiple antigens may be necessary for the development of a truly protective vaccine against H. suis. However, again, increased mortality rates were observed which might be due to the intranasal use of CT as adjuvant, which might have caused swelling of the nasal cavity mucosae, resulting in oxygen deficiency.

Although these studies show promising results, it is still unclear how to promote the development of immunity with the final goal of a successful vaccine. Further research should focus on a better understanding of the innate and adaptive immune responses towards a H. suis infection in animal models and pigs, with emphasis on the role of dendritic cells and the development of safe and efficient vaccine adjuvants.

General Introduction

Table III. Prophylactic vaccination studies against H. suis in mice

Antigen Adjuvant Route Conclusions Reference H. heilmanni s.s. UreB CT IN BALB/c mice protected against H. heilmannii infection (prophylactic) Dieterich et al. (1999) H. pylori urease Significantly reduces a pre-existing infection (therapeutic) Immunization aggravates gastric corpus atrophy CT/saponin-based Hellemans et al. H. pylori whole-cell lysate IN/SC Decrease in faecal excretion of “Candidatus H. suis” DNA adjuvant (2006) H. felis whole-cell lysate Complete clearance of challenge bacteria was not achieved CT/saponin-based H. suis whole-cell lysate IN/SC H. suis colonization suppressed Flahou et al. (2009) adjuvant H. bizzozeroni whole-cell lysate Complete protection only in a minority of animals following H. cynogastricus whole-cell lysate intranasal immunization H. suis whole-cell lysate CT IN UreB and lysate induced a significant decrease in H. suis colonization Vermoote et al. (2012) H. suis UreB NapA induced no significant decrease in H. suis colonization H. suis NapA H. suis whole-cell lysate CT IN All immunization protocols induced a significant reduction of H. suis Vermoote et al. (2013) H. suis UreB colonization which was least pronounced in groep with rUreB and H. suis GGT rGGT alone H. suis UreB+GGT Less gastric lesions in groups with combination of rUreB and rGGT

General Introduction

References

Aebischer T, Bumann D, Epple HJ, Metzger W, Schneider T, Cherepnev G, Walduck AK, Kunkel D, Moos V, Loddenkemper C, Jiadze I, Panasyuk M, Stolte M, Graham DY, Zeitz M, Meyer TF. 2008. Correlation of T-cell response and bacterial clearance in human volunteers challenged with Helicobacter pylori revealed by randomised controlled vaccination with Ty21a-based Salmonella vaccines. Gut. 57:1065–1072. Aihara E, Closson C, Matthis AL, Schumacher MA, Engevik AC, Zavros Y, Ottemann KM, Montrose MH. 2014. Motility and chemotaxis mediate the preferential colonization of gastric injury sites by Helicobacter pylori. PLoS Pathog. 10:e1004275. Akhiani AA, Pappo J, Kabok Z, Schon K, Gao W, Franzen LE, Lycke N. 2002. Protection against Helicobacter pylori infection following immunization is IL-12-dependent and mediated by Th1 cells. J Immunol. 169:6977–6984. Algood HM, Torres VJ, Unutmaz D, Cover TL. 2007. Resistance of primary murine CD4+ T cells to Helicobacter pylori vacuolating cytotoxin. Infect Immun. 75:334-41. Allen LA, Schlesinger LS, Kang B. 2000. Virulent strains of Helicobacter pylori demonstrate delayed phagocytosis and stimulate homotypic phagosome fusion in macrophages. J Exp Med. 191:115–128. Alm RA, Bina J, Andrews BM, Doig P, Hancock REW, Trust TJ. 2000. Comparative genomics of Helicobacter pylori: Analysis of the outer membrane protein families. Infect. Immun. 68:4155–4168. Amieva MR, Vogelmann R, Covacci A, Tompkins LS, Nelson WJ, Falkow S. 2003. Disruption of the epithelial apical-junctional complex by Helicobacter pylori CagA. Science. 300:1430–1434. Andersen-Nissen E, Smith KD, Strobe KL, Barrett SL, Cookson BT, Logan SM, Aderem A. 2005. Evasion of Toll-like receptor 5 by flagellated bacteria. Proc Natl Acad Sci USA. 102:9247–9252. Ando T, Peek RM Jr, Lee YC, Krishna U, Kusugami K, Blaser MJ. 2002. Host cell responses to genotypically similar Helicobacter pylori isolates from United States and Japan. Clin Diagn Lab Immunol. 9:167–175. Appelmelk BJ, Vandenbroucke-Grauls CMJE. Lipopolysaccharide Lewis Antigens. In: Mobley HLT, Mendz GL, Hazell SL, editors. Helicobacter pylori: Physiology and Genetics. Washington (DC): ASM Press; 2001. Chapter 35.

Argent RH, Kidd M, Owen RJ, Thomas RJ, Limb MC, Atherton JC. 2004. Determinants and consequences of different levels of CagA phosphorylation for clinical isolates of Helicobacter pylori. Gastroenterology. 127:514–523. Arnold IC, Zigova Z, Holden M, Lawley TD, Rad R, Dougan G, Falkow S, Bentley SD, Müller A. 2011. Comparative Whole Genome Sequence Analysis of the Carcinogenic Bacterial Model Pathogen Helicobacter felis. Genome Biology and Evolution. 3:302-308. Aspholm-Hurtig M, Dailide G, Lahmann M, Kalia A, Ilver D, Roche N, Vikstrom S, Sjostrom R, Linden S, Backstrom A, Lundberg C, Arnqvist A, Mahdavi J, Nilsson UJ, Velapatino B, Gilman RH, Gerhard M, Alarcon T, Lopez-Brea M, Nakazawa T, Fox JG, Correa P, Dominguez-Bello MG, Perez-Perez GI, Blaser MJ, Normark S, Carlstedt I, Oscarson S, Teneberg S, Berg DE, Boren T. 2004. Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science. 305:519– 522. Atherton JC, Cao P, Peek RM Jr, Tummuru MK, Blaser MJ, Cover TL. 1995. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific VacA types with cytotoxin production and peptic ulceration. J Biol Chem. 270:17771-7. Atherton JC, Peek RM Jr, Tham KT, Cover TL, Blaser MJ. 1997. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology. 112:92–99. Azevedo NF, Almeida C, Fernendes I, Cerqueira L, Dias S, Keevil CW, Vieira MJ. 2008. Survival of gastric and enterohepatic Helicobacter spp. in water: implications for transmission. Appl Environ Microbiol. 74:1805–1811. Backert S, Schwarz T, Miehlke S, Kirsch C, Sommer C, Kwok T, Gerhard M, Goebel UB, Lehn N, Koenig W, Meyer TF. 2004. Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer, and gastric cancer. Infect Immun. 72:1043–1056. Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A, Chiers K, Ducatelle R, Haesebrouck F. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. Int J Syst Evol Microbiol. 58:1350–1358. Bamba N, Nakajima S, Andoh A, Bamba M, Sugihara H, Bamba T, Hattori T. 2002. Stem cell factor expressed in human gastric mucosa in relation to mast cell increase in Helicobacter pylori-infected gastritis. Dig Dis Sci. 47:274–282.

Barbosa AJA, Silva JCP, Nogueira AMMF, Paulino E, Miranda CR. 1995. Higher incidence of Gastrospirillum sp. in swine with gastric ulcer of the pars oesophagea. Vet Pathol. 32:134–139. Bassler, BL. 1999 How bacteria talk to each other: regulation of gene expression by quorum sensing. Curr Opin Microbiol. 2:582–587. Bayry J, Tartour E, Tough DF. 2014. Targeting CCR4 as an emerging strategy for cancer therapy and vaccines. Trends Pharmacol Sci. 35:163-165. Billiau A, Matthys P. 2001. Modes of action of Freund's adjuvants in experimental models of autoimmune diseases. J Leukoc Biol. 70:849-60. Blaecher C, Smet A, Flahou B, Pasmans F, Ducatelle R, Taylor D, Weller C, Bjarnason I, Charlett A, Lawson AJ, Dobbs RJ, Dobbs SM, Haesebrouck F. 2013. Signiﬁcantly higher frequency of Helicobacter suis in patients with idiopathic parkinsonism than in control patients. Aliment Pharmacol Ther. 38:1347–1353. Blanchard TG, Czinn SJ, Redline RW, Sigmund N, Harriman G, Nedrud JG. 1999. Antibody independent protective mucosal immunity to gastric Helicobacter infection in mice. Cell Immunol. 191:74–80. Blanchard TG, Nedrud JG. 2010. Helicobacter pylori vaccines. In: Sutton P, Mitchell HM (eds.), Helicobacter pylori in the 21st century, CAB International, Oxfordshire, UK, pp. 167-189. Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, Stemmermann GN, Nomura A. 1995. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res. 55:2111–2115 Bode C, Zhao G, Steinhagen F, Kinjo T, Klinman DM. 2011. CpG DNA as a vaccine adjuvant. Expert Rev Vaccines. 10:499-511. Bollrath J, Powrie FM. 2013. Controlling the frontier: regulatory T-cells and intestinal homeostasis. Semin Immunol. 25:352–357. Boncristiano M, Paccani SR, Barone S, Ulivieri C, Patrussi L, Ilver D, Amedei A, D'Elios MM, Telford JL, Baldari CT. 2003. The Helicobacter pylori vacuolating toxin inhibits T-cell activation by two independent mechanisms. J Exp Med. 198:1887-97. Cantet F, Magras C, Marais A, Federighi M, Mégraud F. 1999. Helicobacter species colonizing pig stomach: molecular characterization and determination of prevalence. Appl Environ Microbiol. 65:4672–4676.

Chey WD, Wong BC. 2007. Practice Parameters Committee of the American College of Gastroenterology. American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol. 102:1808–1825. Cinque SMS, Rocha GA, Correa-Oliveira R, Soares TF, Moura SB, Rocha AMC, Nogueira AM, Cabral MM, Vieira LQ, Martins-Filho OA, Queiroz DM. 2006. The role of IFN-γ and IL-4 in gastric mucosa inﬂammation associated with Helicobacter heilmannii type 1 infection. Braz J Med Biol Res. 39:253–261. Corthesy B, Boris S, Isler P, Grangette C, Mercenier A. 2005. Oral immunization of mice with lactic acid bacteria producing Helicobacter pylori urease B subunit partially protects against challenge with Helicobacter felis. J Infect Dis. 192:1441–1449. Court M, Robinson PA, Dixon MF, Crabtree JE. 2002. Gastric Helicobacter species infection in murine and gerbil models: comparative analysis of effects of H. pylori and H. felis on gastric epithelial cell proliferation. J Infect Dis. 186:1348–1352. Cox E, Verdonck F, Vanrompay D, Goddeeris B. 2006. Adjuvants modulating mucosal immune responses or directing systemic responses towards the mucosa. Vet Res. 37:511-39. Cullen TW, Giles DK, Wolf LN, Ecobichon C, Boneca IG, Trent MS. 2011. Helicobacter pylori versus the host: remodeling of the bacterial outer membrane is required for survival in the gastric mucosa. PLoS Pathog. 7:e1002454. Czerkinsky C, Cuburu N, Kweon MN, Anjuere F, Holmgren J. 2011. Sublingual vaccination. Hum Vaccine. 7:110–114. Darwin PE, Sztein MB, Zheng QX, James SP, Fantry GT. 1996. Immune evasion by Helicobacter pylori: gastric spiral bacteria lack surface immunoglobulin deposition and reactivity with homologous antibodies. Helicobacter. 1:20–27. Davies MN, Bayry J, Tchilian EZ, Vani J, Shaila MS, Forbes EK, Draper SJ, Beverley PC, Tough DF, Flower DR. 2009. Toward the discovery of vaccine adjuvants: coupling in silico screening and in vitro analysis of antagonist binding to human and mouse CCR4 receptors. PLoS One. 4:e8084. De Bruyne E, Flahou B, Chiers K, Meyns T, Kumar S, Vermoote M, Pasmans F, Millet S, Dewulf J, Haesebrouck F, Ducatelle R. 2012. An experimental Helicobacter suis infection causes gastritis and reduced daily weight gain in pigs. Vet Microbiol. 160:449–454.

De Cooman L, Fahou B, Houf K, Smet A, Ducatelle R, Pasmans F, Haesebrouck F. 2013. Survival of Helicobacter suis bacteria in retail pig meat. Int J Food Microbiol. 166:164–167. De Groote D, van Doorn LJ, Ducatelle R, Verschuuren A, Haesebrouck F, Quint WG, Jalava K, Vandamme P. 1999. 'Candidatus Helicobacter suis', a gastric helicobacter from pigs, and its phylogenetic relatedness to other gastrospirilla. Int J Syst Bacteriol. 49:1769-77. De Witte C, Flahou B, Ducatelle R, Smet A, De Bruyne E, Cnockaert M, Taminiau, Daube G, Vandamme P, Haesebrouck F. 2017. Detection, isolation and characterization of Fusobacterium gastrosuis sp. nov. colonizing the stomach of pigs. Systematic and Applied Microbiology. 40:42-50. DeLyria ES, Redline RW, Blanchard TG. 2009. Vaccination of mice against Helicobacter pylori induces a strong Th-17 response and immunity that is neutrophil dependent. Gastroenterology. 136:247-56. Dick-Hegedus E and Lee A. 1991. Use of a mouse model to examine anti-Helicobacter pylori agents. Scand. J. Gastroenterol. 26:909-915. Dieterich C, Bouzourène H, Blum AL, Corthésy-Theulaz IE. 1999. Urease-based mucosal immunization against Helicobacter heilmannii infection induces corpus atrophy in mice. Infect Immun. 67:6206-9. Dossumbekova A, Prinz C, Mages J, Lang R, Kusters JG, Van Vliet AH, Reindl W, Backert S, Saur D, Schmid RM, Rad R. 2006. Helicobacter pylori HopH (OipA) and bacterial pathogenicity: genetic and functional genomic analysis of hopH gene polymorphisms. J Infect Dis. 194:1346–1355. Eaton KA, Krakowka S. 1994. Effect of gastric pH on urease-dependent colonization of gnotobiotic piglets by Helicobacter pylori. Infection and Immunity. 62:3604-3607. Eaton KA, Suerbaum S, Josenhans C, Krakowka S. 1996. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infection and Immunity. 64:2445-2448. Eaton KA, Mefford M, Thevenot T. 2001. The role of T-cell subsets and cytokines in the pathogenesis of Helicobacter pylori gastritis in mice. J Immunol. 166:7456–7461. Eaton KA, Gilbert JV, Joyce EA, Wanken AE, Thevenot T, Baker P, Plaut A, Wright A. 2002. In vivo complementation of ureB restores the ability of Helicobacter pylori to colonize. Infect Immun. 70:771–778.

Eisenberg JC, Czinn SJ, Garhart CA, Redline RW, Bartholomae WC, Gottwein JM, Nedrud JG, Emancipator SE, Boehm BB, Lehmann PV, Blanchard TG. 2003. Protective efficacy of anti-Helicobacter pylori immunity following systemic immunization of neonatal mice. Infect Immun. 71:1820-7. Eppinger M, Baar C, Linz B, Raddatz G, Lanz C, Keller H, Morelli G, Gressmann H, Achtman M, Schuster SC. 2006. Who Ate Whom? Adaptive Helicobacter Genomic Changes That Accompanied a Host Jump from Early Humans to Large Felines. Richardson PM, ed. PLoS Genetics. 2:e120. Ermak TH, Giannasca PJ, Nichols R, Myers GA, Nedrud J, Weltzin R, Lee CK, Kleanthous H, Monath TP. 1998. Immunization of mice with urease vaccine affords protection against Helicobacter pylori infection in the absence of antibodies and is mediated by MHC class II-restricted responses. J Exp Med. 188:2277–2288. Ernst PB and Gold BD. 2000. The disease spectrum of Helicobacter pylori: the immunopathogenesis of gastroduodenal ulcer and gastric cancer. Annu Rev Microbiol. 54:615–640.

Ferrero RL, Thiberge JM, Huerre M, Labigne A. 1994. Recombinant antigens prepared from the urease subunits of Helicobacter spp.: evidence of protection in a mouse model of gastric infection. Infect Immun. 62:4981-9.

Flach CF, Ostberg AK, Nilsson AT, Malefyt Rde W, Raghavan S. 2011. Proinﬂammatory cytokine gene expression in the stomach correlates with vaccine-induced protection against Helicobacter pylori infection in mice: an important role for interleukin-17 during the effector phase. Infect Immun. 79:879–886. Flach CF, Mozer M, Sundquist M, Holmgren J, Raghavan S. 2012. Mucosal vaccination increases local chemokine production attracting immune cells to the stomach mucosa of Helicobacter pylori infected mice. Vaccine. 30:1636–1643. Flahou B, Hellemans A, Meyns T, Duchateau L, Chiers K, Baele M, Pasmans F, Haesebrouck F, Ducatelle R. 2009. Protective immunization with homologous and heterologous antigens against Helicobacter suis challenge in a mouse model. Vaccine. 27:1416-21. Flahou B, Haesebrouck F, Pasmans F, D’Herde K, Driessen A, Van Deun K, Smet A, Duchateau L, Chiers K, Ducatelle R. 2010. Helicobacter suis causes severe gastric pathology in mouse and mongolian gerbil models of human gastric disease. PLoS ONE. 5:e14083.

Flahou B, Haesebrouck F, Chiers K, Van Deun K, De Smet L, Devreese B, Vandenberghe I, Favoreel H, Smet A, Pasmans F, D'Herde K, Ducatelle R. 2011. Gastric epithelial cell death caused by Helicobacter suis and Helicobacter pylori γ-glutamyl transpeptidase is mainly glutathione degradation-dependent. Cell Microbiol. 13:1933- 55. Flahou B, Van Deun K, Pasmans F, Smet A, Volf J, Rychlik I, Ducatelle R, Haesebrouck F. 2012. The local immune response of mice after Helicobacter suis infection: strain differences and distinction with Helicobacter pylori. Vet Res. 43:75. Flahou B, Modrý D, Pomajbíková K, Petrželková KJ, Smet A, Ducatelle R, Pasmans F, Sá RM, Todd A, Hashimoto C, Mulama M, Kiang J, Rossi M, Haesebrouck F. 2014. Diversity of zoonotic enterohepatic Helicobacter species and detection of a putative novel gastric Helicobacter species in wild and wild-born captive chimpanzees and western lowland gorillas. Vet Microbiol. 174:186–194. Flahou B, Haesebrouck F, Smet A. 2016. Significance of gastric and enterohepatic non- Helicobacter pylori Helicobacter infections in humans and animals. Book: Helicobacter pylori research: from bench to bedside, Springer Japan. Fock KM, Katelaris P, Sugano K, Ang TL, Hunt R, Talley NJ, Lam SK, Xiao SD, Tan HJ, Wu CY, Jung HC, Hoang BH, Kachintorn U, Goh KL, Chiba T, Rani AA; Second Asia-Pacific Conference. 2009. Second Asia-Paciﬁc Consensus guidelines for Helicobacter pylori infection. J Gastroenterol Hepatol. 24:1587–1600. Foynes S, Dorrell N, Ward SJ, Stabler RA, McColm AA, Rycroft AN, Wren BW. 2000. Helicobacter pylori possesses two CheY response regulators and a histidine kinase sensor, CheA, which are essential for chemotaxis and colonization of the gastric mucosa. Infect Immun. 68: 2016–2023. Garhart CA, Redline RW, Nedrud JG, Czinn SJ. 2002. Clearance of Helicobacter pylori infection and resolution of post-immunization gastritis in a kinetic study of prophylactically immunized mice. Infect Immun. 70:3529–3538. Garhart CA, Nedrud JG, Heinzel FP, Sigmund NE, Czinn SJ. 2003. Vaccine-induced protection against Helicobacter pylori in mice lacking both antibodies and interleukin- 4. Infect Immun. 71:3628-33. George JT, Boughan PK, Karageorgiou H, Bajaj-Elliott M. 2003. Host anti-microbial response to Helicobacter pylori infection. Mol Immunol. 40:451–456. Gerdts V. 2015. Adjuvants for veterinary vaccines-types and modes of action. Berl Munch Tierarztl Wochenschr. 128:456-63.

Giuliani MM, Del Giudice G, Giannelli V, Dougan G, Douce G, Rappuoli R, Pizza M. 1998. Mucosal adjuvanticity and immunogenicity of LTR72, a novel mutant of Escherichia coli heatlabile enterotoxin with partial knockout of ADP-ribosyltransferase activity. J Exp Med. 187:1123–1132. Goodwin CS, Armstrong JA, Chilvers T, Peters M, Colins MD, Sly L, McConnel W, Harper WES. 1989. Transfer of Campylobacter pylori and Campylobacter mustelae to Helicobacter gen. nov. as Helicobacter pylori comb. nov. and Helicobacter mustelae comb. nov., respectively. Int. J. Syst. Bacteriol. 39:397-405. Goto T, Nishizono A, Fujioka T, Ikewaki J, Mifune K, Nasu M. 1999. Local secretory immunoglobulin A and post-immunization gastritis correlate with protection against Helicobacter pylori infection after oral vaccination of mice. Infect Immun. 67: 2531- 2539. Gottwein JM, Blanchard TG, Targoni OS, Eisenberg JC, Zagorski BM, Redline RW, Nedrud JG, Tary-Lehmann M, Lehmann PV, Czinn SJ. 2001. Protective anti-Helicobacter immunity is induced with aluminum hydroxide or complete Freund's adjuvant by systemic immunization. J Infect Dis. 184: 308-314. Graham DY, Fischbach L. 2010. Helicobacter pylori treatment in the era of increasing antibiotic resistance. Gut. 59:1143–1153. Graham DY, Lee YC, Wu MS. 2014. Rational Helicobacter pylori therapy: evidence based medicine rather than medicine based evidence. Clin Gastroenterol Hepatol. 12:177– 186. Grasso GM, Ripabelli G, Sammarco ML, Ruberto A, Iannitto G. 1996. Prevalence of Helicobacter-like organisms in porcine gastric mucosa: a study of swine slaughtered in Italy. Comp Immunol Microbiol Infect Dis. 19:213–217. Gray BM, Fontaine CA, Poe SA, Eaton KA. 2013. Complex T-cell interactions contribute to Helicobacter pylori gastritis in mice. Infect Immun. 81:740–752. Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M, Meyns T, Decostere A, Ducatelle R. 2009. Gastric helicobacters in domestic animals and non-human primates and their significance for human health. Clin Microbiol Rev. 22:202-23. Harris PR, Wright SW, Serrano C, Riera F, Duarte I, Torres J, Peña A, Rollán A, Viviani P, Guiraldes E, Schmitz JM, Lorenz RG, Novak L, Smythies LE, Smith PD. 2008. Helicobacter pylori gastritis in children is associated with a regulatory T-cell response. Gastroenterology. 134:491–499.

Hatakeyama M. 2003. Helicobacter pylori CagA-a potential bacterial oncoprotein that functionally mimics the mammalian Gab family of adaptor proteins. Microbes Infect. 5:143–150. Hatakeyama M. 2004. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat Rev Cancer. 4:688–694. Hatzifoti C, Roussel Y, Harris AG, Wren BW, Morrow JW, Bajaj-Elliott M. 2006. Mucosal immunization with a urease B DNA vaccine induces innate and cellular immune responses against Helicobacter pylori. Helicobacter. 11:113–122. Heilmann KL, Borchard F. 1991. Gastritis due to spiral shaped bacteria other than Helicobacter pylori: clinical, histological, and ultrastructural findings. Gut. 32:137-40. Hellemans A, Decostere A, Haesebrouck F, Ducatelle R. 2005. Evaluation of antibiotic treatment against "Candidatus Helicobacter suis" in a mouse model. Antimicrob Agents Chemother. 49:4530-5. Hellemans A, Decostere A, Duchateau L, De Bock M, Haesebrouck F, Ducatelle R. 2006. Protective immunization against "Candidatus Helicobacter suis" with heterologous antigens of H. pylori and H. felis. Vaccine. 24:2469-76. Hellemans A, Chiers K, Decostere A, De Bock M, Haesebrouck F, Ducatelle R. 2007a. Experimental infection of pigs with “Candidatus Helicobacter suis”. Vet Res Commun. 31:385–395. Hellemans A, Chiers K, Maes D, De Bock M, Decostere A, Haesebrouck F, Ducatelle R. 2007b. Prevalence of “Candidatus Helicobacter suis” in pigs of different ages. Vet Rec. 161:189–192. Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M. 2002. SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 295:683–686. Hitzler I, Oertli M, Becher B, Agger EM, Müller A. 2011. Dendritic cells prevent rather than promote immunity conferred by a Helicobacter vaccine using a mycobacterial adjuvant. Gastroenterology. 141: 186-196. Holck S, Ingeholm P, Blom J, Nørgaard A, Elsborg L, Adamsen S, Andersen LP. 1997. The histopathology of human gastric mucosa inhabited by Helicobacter heilmannii-like (Gastrospirillum hominis) organisms, including the first culturable case. APMIS. 105:746-56.

Howitt MR, Lee JY, Lertsethtakarn P, Vogelmann R, Joubert LM, Ottemann KM, Amieva MR. 2011. ChePep controls Helicobacter pylori infection of the gastric glands and chemotaxis in the Epsilonproteobacteria. MBio 2: pii: e00098-11. Huang FY, Chan AO, Lo RC, Rashid A, Wong DK, Cho CH, Lai CL, Yuen MF. 2013. Characterization of interleukin-1beta in Helicobacter pylori-induced gastric inﬂammation and DNA methylation in interleukin-1 receptor type 1 knockout (IL- 1R1-/-) mice. Eur J Cancer. 49:2760–2770. Jeremy AH, Du Y, Dixon MF, Robinson PA, Crabtree JE. 2006. Protection against Helicobacter pylori infection in the Mongolian gerbil after prophylactic vaccination. Microbes Infect. 8:340-6. Joosten M, Flahou B, Meyns T, Smet A, Arts J, De Cooman L, Pasmans F, Ducatelle R, Haesebrouck F. 2013. Case report: Helicobacter suis infection in a pig veterinarian. Helicobacter. 18:392–396. Joosten M, Lindén S, Rossi M, Tay A, Skoog E, Padra M, Thirriot F, Perkins T, Vandamme P, Van Nieuwerburg F, Flahou B, Deforce D, Ducatelle R, Haesebrouck F, Smet A. 2015. Genomic divergence and differences in adhesion to the gastric mucosa between Helicobacter heilmannii and its closest relative Helicobacter ailurogastricus sp. nov. Infect Immun. 84:293–306. Jung HC, Kim JM, Song IS, Kim CY. 1997. Helicobacter pylori induces an array of pro- inflammatory cytokines in human gastric epithelial cells: quantification of mRNA for interleukin-8, -1 alpha/beta, granulocyte-macrophage colony-stimulating factor, monocyte chemoattractant protein-1 and tumour necrosis factor-alpha J Gastroenterol Hepatol. 12:473–480. Kaebisch R, Mejías-Luque R, Prinz C, Gerhard M. 2014. Helicobacter pylori cytotoxin- associated gene A impairs human dendritic cell maturation and function through IL- 10-mediated activation of STAT3. J Immunol. 192:316-23. Kamiya S, Osaki T, Taguchi H, Yamaguchi H. 2002. Immune response to heat shock protein of Helicobacter pylori--a candidate as a vaccine component. Keio J Med. 51:24-5. Kao JY, Zhang M, Miller MJ, Mills JC, Wang B, Liu M, Eaton KA, Zou W, Berndt BE, Cole TS, Takeuchi T, Owyang SY, Luther J. 2010. Helicobacter pylori immune escape is mediated by dendritic cell-induced Treg skewing and Th17 suppression in mice. Gastroenterology. 138:1046-54. Kaparakis M, Laurie KL, Wijburg O, Pedersen J, Pearse M, van Driel IR, Gleeson PA, Strugnell RA. 2006. CD4+ CD25+ regulatory T-cells modulate the T-cell and

antibody responses in helicobacter-infected BALB/c mice. Infect Immun. 74:3519– 3529. Kaparakis M, Turnbull L, Carneiro L, Firth S, Coleman HA, Parkington HC, Le Bourhis L, Karrar A, Viala J, Mak J, Hutton ML, Davies JK, Crack PJ, Hertzog PJ, Philpott DJ, Girardin SE, Whitchurch CB, Ferrero RL. 2010. Bacterial membrane vesicles deliver peptidoglycan to NOD1 in epithelial cells. Cell Microbiol. 12:372-85. Karali T. 1995. Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans and commonly used laboratory animals. Biopharmaceutics & Drug Disposition. 16:351-380. Kersulyte D, Rossi M, Berg DE. 2013. Sequence Divergence and Conservation in Genomes of Helicobacter cetorum Strains from a Dolphin and a Whale. Dobrindt U, ed. PLoS ONE. 8:e83177. Khatoon J, Rai RP, Prasad KN. 2016. Role of Helicobacter pylori in gastric cancer: Updates. World Journal of Gastrointestinal Oncology. 8:147-158. Kim JM, Kim JS, Yoo DY, Ko SH, Kim N, Kim H, Kim YJ. 2011. Stimulation of dendritic cells with Helicobacter pylori vacuolating cytotoxin negatively regulates their maturation via the restoration of E2F1.Clin Exp Immunol. 166:34–45. Kleanthous H, Myers GA, Georgakopoulos KM, Tibbitts TJ, Ingrassia JW, Gray HL, Ding R, Zhang ZZ, Lei W, Nichols R, Lee CK, Ermak TH, Monath TP. 1998. Rectal and intranasal immunizations with recombinant urease induce distinct local and serum immune responses in mice and protect against Helicobacter pylori infection. Infect Immun. 66:2879–2886. Kotloff KL, Sztein MB, Wasserman SS, Losonsky GA, DiLorenzo SC, Walker RI. 2001. Safety and immunogenicity of oral inactivated whole-cell Helicobacter pylori vaccine with adjuvant among volunteers with or without subclinical infection. Infect Immun. 69:3581–3590. Kusters JG, van Vliet AH, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. 2006. Clin Microbiol Rev. 19:449-90. Labigne A, Cussac V, Courcoux P. 1991. Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity. J Bacteriol 173:1920–1931 Larussa T, Leone I, Suraci E, Imeneo M, Luzza F. 2015. Helicobacter pylori and T Helper Cells: Mechanisms of Immune Escape and Tolerance. J Immunol Res. 2015:981328.

Lee A, O’Rourke J, De Ungria MC, Robertson B, Daskalopoulos G, Dixon MF. 1997. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology. 112:1386–1397. Liang J, Ducatelle R, Pasmans F, Smet A, Haesebrouck F, Flahou B. 2013. Multilocus sequence typing of the porcine and human gastric pathogen Helicobacter suis. J Clin Microbiol. 51:920-6. Liang J, De Bruyne E, Ducatelle R, Smet A, Haesebrouck F, Flahou B. 2015. Purification of Helicobacter suis strains from biphasic cultures by single colony isolation: influence on strain characteristics. Helicobacter. 20:206–216. Lina TT, Alzahrani S, Gonzalez J, Pinchuk IV, Beswick EJ, Reyes VE. 2014. Immune evasion strategies used by Helicobacter pylori. World J Gastroenterol. 20:12753-66. Lundgren A, Strömberg E, Sjöling A, Lindholm C, Enarsson K, Edebo A, Johnsson E, Suri- Payer E, Larsson P, Rudin A, Svennerholm AM, Lundin BS. 2005. Mucosal FOXP3- expressing CD4+ CD25high regulatory T-cells in Helicobacter pylori-infected patients. Infect Immun. 73:523–531. Mahdavi J, Sonden B, Hurtig M, Olfat FO, Forsberg L, Roche N, Angstrom J, Larsson T, Teneberg S, Karlsson KA, Altraja S, Wadstrom T, Kersulyte D, Berg DE, Dubois A, Petersson C, Magnusson KE, Norberg T, Lindh F, Lundskog BB, Arnqvist A, Hammarstrom L, Boren T. 2002. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science. 297:573–578. Malfertheiner P, Megraud F, O'Morain CA, Atherton J, Axon AT, Bazzoli F, Gensini GF, Gisbert JP, Graham DY, Rokkas T, El-Omar EM, Kuipers EJ. European Helicobacter Study Group. 2012. Management of Helicobacter pylori infection-the Maastricht IV/Florence Consensus report. Gut. 61:646–664. Manojlovic N, Nikolic L, Pilcevic D, Josifovski J, Babic D. 2004. Systemic humoral anti- Helicobacter pylori immune response in patients with gastric malignancies and benign gastroduodenal disease. Hepatogastroenterology. 51:282–284. Marchetti M, Rossi M, Giannelli V, Giuliani MM, Pizza M, Censini S, Covacci A, Massari P, Pagliaccia C, Manetti R, Telford JL, Douce G, Dougan G, Rappuoli R, Ghiara P. 1998. Protection against Helicobacter pylori infection in mice by intragastric vaccination with H. pylori antigens is achieved using a non-toxic mutant of E. coli heat-labile enterotoxin (LT) as adjuvant. Vaccine. 16:33-7. Marshall BJ and Warren JR. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet i:1311-1315.

McNulty CA, Dent JC, Curry A, Uff JS, Ford GA, Gear MW, Wilkinson SP. 1989. New spiral bacterium in gastric mucosa. J Clin Pathol. 42:585-91. Megraud F, Coenen S, Versporten A, Kist M, Lopez-Brea M, Hirschl AM, Andersen LP, Goossens H, Glupczynski Y, Study Group Participants. 2013. Helicobacter pylori resistance to antibiotics in Europe and its relationship to antibiotic consumption. Gut. 62:34-42. Melnichouk SI, Friendship RM, Dewey CE, Bildfell RJ, Smart NL. 1999. Helicobacter-like organisms in the stomach of pigs with and without gastric ulceration. Swine Health Prod. 7:201-205. Mendes EN, Queiroz DMM, Rocha GA, Moura SB, Leite VHR, Fonseca MEF. 1990. Ultrastructure of a spiral micro-organism from pig gastric mucosa (“Gastrospirillum suis”). J Med Microbiol. 33:61–66. Michetti P, Corthésy-Theulaz I, Davin C, Haas R, Vaney AC, Heitz M, Bille J, Kraehenbuhl JP, Saraga E, Blum AL. 1994. Immunization of BALB/c mice against Helicobacter felis infection with Helicobacter pylori urease. Gastroenterology. 107:1002-11. Mimura T, Yoshida M, Nishiumi S, Tanaka H, Nobutani K, Takenaka M, Suleiman YB, Yamamoto K, Ota H, Takahashi S, Matsui H, Nakamura M, Miki I, Azuma T. 2011. IFN-γ plays an essential role in the pathogenesis of gastric lymphoid follicles formation caused by Helicobacter suis infection. FEMS Immunol Med Microbiol. 63:25–34. Mimuro H, Suzuki T, Tanaka J, Asahi M, Haas R, Sasakawa C. 2002. Grb2 is a key mediator of Helicobacter pylori CagA protein activities. Mol Cell. 10:745–755. Mobley HL, Garner RM, Bauerfeind P. 1995. Helicobacter pylori nickel-transport gene nixA: synthesis of catalytically active urease in Escherichia coli independent of growth conditions. Mol Microbiol. 16:97–109. Molina-Infante J, Gisbert JP. 2014. Optimizing clarithromycin-containing therapy for Helicobacter pylori in the era of antibiotic resistance. World J Gastroenterol. 10:10338–10347. Molina-Infante Javier and David Y Graham. 2016. Helicobacter pylori therapy. Book: Helicobacter pylori research: from bench to bedside, Springer Japan. Morihara F, Fujii R, Hifumi E, Nishizono A, Uda T. 2007. Effects of vaccination by a recombinant antigen ureB138 (a segment of the β-subunit of urease) against Helicobacter pylori infection. J Med Microbiol. 56: 847-853.

Müller A, Solnick JV. 2011. Inflammation, immunity, and vaccine development for Helicobacter pylori. Helicobacter. 1:26-32. Mutsch M, Zhou W, Rhodes P, Bopp M, Chen RT, Linder T, Spyr C, Steffen R. 2004. Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland. N Engl J Med. 350:896-903. Nakamura M, Murayama SY, Serizawa H, Sekiya Y, Eguchi M, Takahashi S, Nishikawa K, Takahashi T, Matsumoto T, Yamada H, Hibi T, Tsuchimoto K, Matsui H. 2007. “Candidatus Helicobacter heilmannii” from a cynomolgus monkey induces gastric mucosa-associated lymphoid tissue lymphomas in C57BL/6 mice. Infect Immun. 75:1214–1222. Nomura AM, Pérez-Pérez GI, Lee J, Stemmermann G, Blaser MJ. 2002. Relation between Helicobacter pylori cagA status and risk of peptic ulcer disease. Am J Epidemiol. 155:1054–1059. Nÿstrom J, Raghavan S, Svennerholm AM. 2006. Mucosal immune responses are related to reduction of bacterial colonization in the stomach after therapeutic Helicobacter pylori immunization in mice. Microbes Infect/Inst Pasteur. 8:442–449. O’Rourke JL, Solnick JV, Neilan BA, Seidel K, Hayter R, Hansen LM, Lee A. 2004a. Description of 'Candidatus Helicobacter heilmannii' based on DNA sequence analysis of 16S rRNA and urease genes. Int J Syst Evol Microbiol. 54:2203-11. O’Rourke JL, Dixon MF, Jack A, Enno A, Lee A. 2004b. Gastric B-cell mucosa-associated lymphoid tissue (MALT) lymphoma in an animal model of ‘Helicobacter heilmannii’ infection. J Pathol. 203:896–903. O’Toole PW, Snelling WJ, Canchaya C, Forde BM, Hardie KR, Josenhans C, Graham RLj, McMullan G, Parkhill J, Belda E, Bentley SD. 2010. Comparative genomics and proteomics of Helicobacter mustelae, an ulcerogenic and carcinogenic gastric pathogen. BMC Genomics. 11:164. Odenbreit S, Püls J, Sedlmaier B, Gerland E, Fischer W, Haas R. 2000. Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science. 287:1497–1500. Oertli M, Sundquist M, Hitzler I, Engler DB, Arnold IC, Reuter S, Maxeiner J, Hansson M, Taube C, Quiding-Jarbrink M, Muller A. 2012. DC-derived IL-18 drives Treg differentiation, murine Helicobacter pylori-speciﬁc immune tolerance, and asthma protection. J Clin Invest. 122:1082-1096.

Oertli M, Noben M, Engler DB, Semper RP, Reuter S, Maxeiner J, Gerhard M, Taube C, Müller A. 2013. Helicobacter pylori γ-glutamyl transpeptidase and vacuolating cytotoxin promote gastric persistence and immune tolerance. Proc Natl Acad Sci USA. 110:3047-52. Ogura K, Maeda S, Nakao M, Watanabe T, Tada M, Kyutoku T, Yoshida H, Shiratori Y, Omata M. 2000. Virulence factors of Helicobacter pylori responsible for gastric diseases in Mongolian gerbil. J Exp Med. 192:1601-1610. Oleastro M, Ménard A. 2013. The Role of Helicobacter pylori Outer Membrane Proteins in Adherence and Pathogenesis. Biology. 2:1110-1134. Ottemann KM and Lowenthal AC. 2002. Helicobacter pylori uses motility for initial colonization and to attain robust infection. Infect Immun. 70: 1984-1990. Pappo J, Torrey D, Castriotta L, Savinainen A, Kabok Z, Ibraghimov A. 1999. Helicobacter pylori infection in immunized mice lacking major histocompatibility complex class I and class II functions. Infect Immun. 67:337-341. Park JH, Seok SH, Cho SA, Baek MW, Lee HY, Kim DJ, Park JH. 2004. The high prevalence of Helicobacter sp. in porcine pyloric mucosa and its histopathological and molecular characteristics. Vet Microbiol. 104:219-225. Park JH, Seok SH, Baek MW, Lee HY, Kim DJ, Park JH. 2008. Gastric lesions and immune responses caused by long-term infection with Helicobacter heilmannii in C57BL/6 mice. J Comp Pathol. 139:208-217. Parsonnet J. 2003. What is the Helicobacter pylori global reinfection rate? J Can Gastroenterol. 17:46B-48B. Peek RM Jr, Miller GG, Tham KT, Perez-Perez GI, Zhao X, Atherton JC, Blaser MJ. 1995. Heightened inflammatory response and cytokine expression in vivo to cagA+ Helicobacter pylori strains. Lab Invest. 73:760-770. Peek RM Jr, Wirth HP, Moss SF, Yang M, Abdalla AM, Tham KT, Zhang T, Tang LH, Modlin IM, Blaser MJ. 2000. Helicobacter pylori alters gastric epithelial cell cycle events and gastrin secretion in Mongolian gerbils. Gastroenterology. 118:48-59. Pizza M, Giuliani MM, Fontana MR, Monaci E, Douce G, Dougan G, Mills KH, Rappuoli R, Del Giudice G. 2001. Mucosal vaccines: non toxic derivates of LT and CT as mucosal adjuvants. Vaccine. 19:2534-41. Polenghi A, Bossi F, Fischetti F, Durigutto P, Cabrelle A, Tamassia N, Cassatella MA, Montecucco C, Tedesco F, de Bernard M. 2007. The neutrophil-activating protein of

Helicobacter pylori crosses endothelia to promote neutrophil adhesion in vivo. J Immunol. 178:1312-1320. Queiroz DMM, Rocha GA, Mendes EN, Moura SB, Rocha De Oliveira AM, Miranda D. 1996. Association between Helicobacter and gastric ulcer disease of the pars oesophagea in swine. Gastroenterology. 111:19-27. Quiding-Jarbrink M, Raghavan S, Sundquist M. 2010. Enhanced M1 macrophage polarization in human Helicobacter pylori-associated atrophic gastritis and in vaccinated mice. PLoS One 5: e15018. Rad R, Brenner L, Bauer S, Schwendy S, Layland L, da Costa CP, Reindl W, Dossumbekova A, Friedrich M, Saur D, Wagner H, Schmid RM, Prinz C. 2006. CD25+/Foxp3+ T- cells regulate gastric inﬂammation and Helicobacter pylori colonization in vivo. Gastroenterology. 131:525-537. Radcliff FJ, Hazell SL, Kolesnikow T, Doidge C, Lee A. 1997. Catalase, a novel antigen for Helicobacter pylori vaccination. Infect Immun. 65:4668-4674. Raghavan S, Svennerholm AM, Holmgren J. 2002. Effects of oral vaccination and immunomodulation by cholera toxin on experimental Helicobacter pylori infection, reinfection, and gastritis. Infect Immun. 70:4621-4627. Raghavan S, Nyström J, Frederiksson M, Holmgren J, Harandi AM. 2003. Orally administered CpG oligodeoxynucleotide induces production of CXC and CC chemokines in the gastric mucosa and suppresses bacterial colonization in a mouse model of Helicobacter pylori infection. Infection and Immunity. 71:7014-7022. Raghavan S, Ostberg AK, Flach CF, Ekman A, Blomquist M, Czerkinsky C, Holmgren J. 2010. Sublingual immunization protects against Helicobacter pylori infection and induces T and B cell responses in the stomach. Infect Immun. 78:4251-4260. Rhead JL, Letley DP, Mohammadi M, Hussein N, Mohagheghi MA, Eshagh Hosseini M, Atherton JC. 2007. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology. 133:926-936. Rieder G, Fischer W, Haas R. 2005. Interaction of Helicobacter pylori with host cells: function of secreted and translocated molecules. Curr Opin Microbiol. 8:67-73. Robinson K, Argent RH, Atherton JC. 2007. The inflammatory and immune response to Helicobacter pylori infection. Best Pract Res Clin Gastroenterol. 21:237-59. Rolig AS, Shanks J, Carter JE, Ottemann KM. 2012. Helicobacter pylori requires TlpD- driven chemotaxis to proliferate in the antrum. Infect Immun. 80: 3713-3720.

Roosendaal R, Vos JH, Roumen T, van Vugt R, Cattoli G, Bart A, Klaasen HL, Kuipers EJ, Vandenbroucke-Grauls CM, Kusters JG. 2000. Slaughter pigs are commonly infected by closely related but distinct gastric ulcerative lesion-inducing gastrospirilla. J Clin Microbiol. 38:2661-2664. Rossi G, Ruggiero P, Peppoloni S, Pancotto L, Fortuna D, Lauretti L, Gianfranco Volpini, Silvia Mancianti, Michele Corazza, Ennio Taccini, Francesco Di Pisa, Rino Rappuoli, Del Giudice, G. 2004. Therapeutic Vaccination against Helicobacter pylori in the Beagle Dog Experimental Model: Safety, Immunogenicity, and Efficacy. Infection and Immunity. 72:3252-3259. Sapierzyński R, Fabisiak M, Kizerwetter-Swida M, Cywińska A. 2007. Effect of Helicobacter sp. infection on the number of antral gastric endocrine cells in swine. Pol J Vet Sci. 10:65-70. Satin B, Del Giudice G, Della Bianca V, Dusi S, Laudanna C, Tonello F, Kelleher D, Rappuoli R, Montecucco C, Rossi F. 2000. The neutrophil-activating protein (HP- NAP) of Helicobacter pylori is a protective antigen and a major virulence factor. J Exp Med. 191: 1467-1476. Sawai N, Kita M, Kodama T, Tanahashi T, Yamaoka Y, Tagawa Y, Iwakura Y, Imanishi J. 1999. Role of gamma interferon in Helicobacter pylori-induced gastric inﬂammatory responses in a mouse model. Infect Immun. 67:279-285. Sayi A, Kohler E, Hitzler I, Arnold I, Schwendener R, Rehrauer H, Muller A. 2009. The CD4+ T cell-mediated IFN-gamma response to Helicobacter infection is essential for clearance and determines gastric cancer risk. J Immunol. 182:7085-7101. Schmees C, Prinz C, Treptau T, Rad R, Hengst L, Voland P, Bauer S, Brenner L, Schmid RM, Gerhard M. 2007. Inhibition of T-cell proliferation by Helicobacter pylori gamma-glutamyl transpeptidase. Gastroenterology. 132:1820-33. Schott T, Rossi M, Hänninen M-L. 2011. Genome Sequence of Helicobacter bizzozeronii Strain CIII-1, an Isolate from Human Gastric Mucosa. Journal of Bacteriology. 193:4565-4566. Schreiber S, Konradt M, Groll C, Scheid P, Hanauer G, Werling HO, Josenhans C, Suerbaum S. 2004. The spatial orientation of Helicobacter pylori in the gastric mucus. Proc Natl Acad Sci USA. 101:5024-5029. Selbach M, Moese S, Hauck CR, Meyer TF, Backert S. 2002. Src is the kinase of the Helicobacter pylori CagA protein in vitro and in vivo J Biol Chem. 277:6775- 6778.

Senkovich OA, Yin J, Ekshyyan V, Conant C, Traylor J, Adegboyega P, McGee DJ, Rhoads RE, Slepenkov S, Testerman TL. 2011. Helicobacter pylori AlpA and AlpB bind host laminin and inﬂuence gastric inﬂammation in gerbils. Infect Immun. 79:3106–3116. Sewald X, Gebert-Vogl B, Prassl S, Barwig I, Weiss E, Fabbri M, Osicka R, Schiemann M, Busch DH, Semmrich M, Holzmann B, Sebo P, Haas R. 2008. Integrin subunit CD18 Is the T-lymphocyte receptor for the Helicobacter pylori vacuolating cytotoxin. Cell Host Microbe. 3:20-9. Shi Y, Liu XF, Zhuang Y, Zhang JY, Liu T, Yin Z, Wu C, Mao XH, Jia KR, Wang FJ, Guo H, Flavell RA, Zhao Z, Liu KY, Xiao B, Guo Y, Zhang WJ, Zhou WY,Guo G, Zou QM. 2010. Helicobacter pylori-induced Th17 responses modulate Th1 cell responses, benefit bacterial growth, and contribute to pathology in mice. J Immunol. 184:5121-9. Shibayama K, Kamachi K, Nagata N, Yagi T, Nada T, Doi Y, Shibata N, Yokoyama K, Yamane K, Kato H, Iinuma Y, Arakawa Y. 2003. A novel apoptosis-inducing protein from Helicobacter pylori. Mol Microbiol. 47:443-51. Shiomi S, Toriie A, Imamura S, Konishi H, Mitsufuji S, Iwakura Y, Yamaoka Y, Ota H, Yamamoto T, Imanishi J, Kita M. 2008. IL-17 is involved in Helicobacter pylori- induced gastric inflammatory responses in a mouse model. Helicobacter. 13:518-24. Shiu J, Blanchard TG. 2013. Dendritic cell function in the host response to Helicobacter pylori infection of the gastric mucosa. Pathog Dis. 67:46-53. Skouloubris S, Thiberge JM, Labigne A, De Reuse H. 1998. The Helicobacter pylori UreI protein is not involved in urease activity but is essential for bacterial survival in vivo. Infect Immun. 66:4517-4521. Smet A, Van Nieuwerburgh F, Ledesma J, Flahou B, Deforce D, Ducatelle R, Haesebrouck F. 2013. Genome sequence of Helicobacter heilmannii Sensu Stricto ASB1 isolated from the gastric mucosa of a kitten with severe gastritis. Genome Announc. 1 pii:e00033- 12. Smith SM, Moran AP, Duggan SP, Ahmed SE, Mohamed AS, Windle HJ, O’Neill LA, Kelleher DP. 2011. Tribbles 3: a novel regulator of TLR2-mediated signaling in response to Helicobacter pylori lipopolysaccharide. J Immunol. 186:2462-2471. Smith SM. 2014. Role of Toll-like receptors in Helicobacter pylori infection and immunity. World Journal of Gastrointestinal Pathophysiology. 5:133-146. Smythies LE, Novak MJ, Waites KB, Lindsey JR, Morrow CD, Smith PD. 2005. Poliovirus replicons encoding the B subunit of Helicobacter pylori urease protect mice against H. pylori infection. Vaccine. 23:901-909.

Stein M, Bagnoli F, Halenbeck R, Rappuoli R, Fantl WJ, Covacci A. 2002. c-Src/Lyn kinases activate Helicobacter pylori CagA through tyrosine phosphorylation of the EPIYA motifs. Mol Microbiol. 43:971-980. Sterzenbach T, Lee SK, Brenneke B, von Goetz F, Schauer DB, Fox JG, Suerbaum S, Josenhans C. 2007. Inhibitory effect of enterohepatic Helicobacter hepaticus on innate immune responses of mouse intestinal epithelial cells. Infect Immun. 75:2717-2728. Stolte M, Kroger G, Meining A, Morgner A, Bayerdörffer E, Bethke B. 1997. A comparison of Helicobacter pylori and H. heilmannii gastritis. A matched control study involving 404 patients. Scand J Gastroenterol. 32:28-33. Suerbaum S, Josenhans C, Labigne A. 1993. Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae flaB flagellin genes and construction of H. pylori flaA- and flaB-negative mutants by electroporation-mediated allelic exchange. J Bacteriol. 175:3278-3288. Surette, MG, Miller MB, Bassler BL. 1999. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production. Proc Natl Acad Sci USA. 96:1639-1644. Sutton P, Wilson J, Lee A. 2000. Further development of the Helicobacter pylori mouse vaccination model. Vaccine. 18:2677-2685. Suzuki M, Mimuro H, Suzuki T, Park M, Yamamoto T, Sasakawa C. 2005. Interaction of CagA with Crk plays an important role in Helicobacter pylori-induced loss of gastric epithelial cell adhesion. J Exp Med. 202:1235-1247. Svec A, Kordas P, Pavlis Z, Novotný J. 2000. High prevalence of Helicobacter heilmannii- associated gastritis in a small, predominantly rural area: further evidence in support of a zoonosis? Scand J Gastroenterol. 35:925-8. Sycuro LK, Wyckoff TJ, Biboy J, Born P, Pincus Z, Vollmer W, Salama NR. 2012. Multiple Peptidoglycan Modification Networks Modulate Helicobacter pylori’s Cell Shape, Motility, and Colonization Potential. PLoS Pathogens. 8:e1002603. Sykora J, Hejda V, Varvarovska J, Stozicky F, Gottrand F, Siala K. 2003. Helicobacter heilmannii related gastric ulcer in childhood. J Pediatr Gastroenterol Nutr. 36:410-413. Tanaka H, Yoshida M, Nishiumi S, Ohnishi N, Kobayashi K, Yamamoto K, Fujita T, Hatakeyama M, Azuma T. 2010. The CagA protein of Helicobacter pylori suppresses the functions of dendritic cell in mice. Arch Biochem Biophys. 498:35-42. Taylor PR, Brown GD, Reid DM, Willment JA, Martinez-Pomares L, Gordon S, Wong, SY. 2002. The β-glucan receptor, dectin-1, is predominantly expressed on the surface of

cells of the monocyte/macrophage and neutrophil lineages. The Journal of Immunology. 169:3876-3882. Taylor JM, Ziman ME, Canfield DR, Vajdy M, Solnick JV. 2008. Effects of a Th1- versus a Th2-biased immune response in protection against Helicobacter pylori challenge in mice. Microb Pathog. 44:20-27. Terry K, Williams SM, Connolly L, Ottemann KM. 2005. Chemotaxis plays multiple roles during Helicobacter pylori animal infection. Infect Immun. 73: 803-811. Thalmaier U, Lehn N, Pfeffer K, Stolte M, Vieth M, Schneider-Brachert W. 2002. Role of tumor necrosis factor alpha in Helicobacter pylori gastritis in tumor necrosis factor receptor 1-deficient mice. Infect Immun. 70:3149-3155. Trebesius K, Adler K, Vieth M, Stolte M, Haas R. 2001. Specific detection and prevalence of Helicobacter heilmannii-like organisms in the human gastric mucosa by fluorescent in situ hybridization and partial 16S ribosomal DNA sequencing. J Clin Microbiol. 39:1510-1516. Van den Bulck K, Decostere A, Baele M, Driessen A, Debongnie JC, Burette A, Stolte M, Ducatelle R, Haesebrouck F. 2005. Identification of non-Helicobacter pylori spiral organisms in gastric samples from humans, dogs and cats. J Clin Microbiol. 43:2256- 2260. Van den Bulck K, Decostere A, Gruntar I, Baele M, Krt B, Ducatelle R, Haesebrouck F. 2005. In vitro antimicrobial susceptibility testing of Helicobacter felis, H. bizzozeronii, and H. salomonis. Antimicrob. Agents Chemother. 49:2297-3000. van Ginkel FW, Jackson RJ, Yuki Y, McGhee JR. 2000. Cutting edge: the mucosal adjuvant cholera toxin redirects vaccine proteins into olfactory tissues. J Immunol. 165:4778- 4782. Velin D, Favre L, Bernasconi E, Bachmann D, Pythoud C, Saiji E, Bouzourene H, Michetti P. 2009. Interleukin-17 is a critical mediator of vaccine-induced reduction of Helicobacter infection in the mouse model. Gastroenterology. 136:2237-2246. Vermoote M, Vandekerckhove TT, Flahou B, Pasmans F, Smet A, De Groote D, Van Criekinge W, Ducatelle R, Haesebrouck F. 2011a. Genome sequence of Helicobacter suis supports its role in gastric pathology. Veterinary Research. 42:51. Vermoote M, Pasmans F, Flahou B, Van Deun K, Ducatelle R, Haesebrouck F. 2011b. Antimicrobial susceptibility pattern of Helicobacter suis strains. Vet Microbiol. 153:339-42.

Vermoote M, Van Steendam K, Flahou B, Smet A, Pasmans F, Glibert P, Ducatelle R, Deforce D, Haesebrouck F. 2012. Immunization with the immunodominant Helicobacter suis urease subunit B induces partial protection against H. suis infection in a mouse model. Vet Res. 43:72. Vermoote M, Flahou B, Pasmans F, Ducatelle R, Haesebrouck F. 2013. Protective efficacy of vaccines based on the Helicobacter suis urease subunit B and γ-glutamyl transpeptidase. Vaccine. 31:3250-6. Viala J, Chaput C, Boneca IG, Cardona A, Girardin SE, Moran AP, Athman R, Mémet S, Huerre MR, Coyle AJ, DiStefano PS, Sansonetti PJ, Labigne A,Bertin J, Philpott DJ, Ferrero RL. 2004. Nod1 responds to peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island. Nat Immunol. 5:1166-74.

Wang G, Ge Z, Rasko DA, Taylor DE. 2000. Lewis antigens in Helicobacter pylori: biosynthesis and phase variation. Mol Microbiol. 36:1187-1196. Wang YH, Gorvel JP, Chu YT, Wu JJ, Lei HY. 2010. Helicobacter pylori impairs murine dendritic cell responses to infection. PLoS One. 5:e10844. Watanabe T, Tada M, Nagai H, Sasaki S, Nakao M. 1998. Helicobacter pylori infection induces gastric cancer in Mongolian gerbils. Gastroenterology. 115:642-648. Weeks DL, Eskandari S, Scott DR, Sachs G. 2000. A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonization. Science. 287:482-485. Weis VG, Goldenring JR. 2009. Current understanding of SPEM and its standing in the preneoplastic process. Gastric Cancer. 12:189-197. Weltzin R, Guy B, Thomas WD Jr, Giannasca PJ, Monath TP. 2000. Parenteral adjuvant activities of Escherichia coli heat-labile toxin and its B subunit for immunization of mice against gastric Helicobacter pylori infection. Infect Immun. 68:2775-2782. Yakabi K, Arimura T, Koyanagi M, Uehigashi Y, Ro S, Minagawa Y, Nakamura T. 2002. Effects of interleukin-8 and Helicobacter pylori on histamine release from isolated canine gastric mucosal mast cells J Gastroenterol. 37:10-16. Yamaoka Y. 2010. Mechanisms of disease: Helicobacter pylori virulence factors. Nat Rev Gastroenterol Hepatol. 7:629-641. Yang L, Yamamoto K, Nishiumi S, Nakamura M, Matsui H, Takahashi S, Dohi T, Okada T, Kakimoto K, Hoshi N, Yoshida M, Azuma T. 2015. Interferon-γ-producing B cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection. Mucosal Immunology. 8:279-295.

Yang L, Yamamoto K, Nishiumi S, Nakamura M, Matsui H, Takahashi S, Dohi T, Okada T, Kakimoto K, Hoshi N, Yoshida M, Azuma T. 2014. Interferon-γ-producing B cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection. Mucosal Immunol. 8:279-95. Yokota K, Kurebayashi Y, Takayama Y, Hayashi S, Isogai H, Isogai E, Imai K, Yabana T, Yachi A, Oguma K. 1991. Colonization of Helicobacter pylori in the gastric mucosa of Mongolian gerbils. Microbiol Immunol. 35:475-480. Yokota S, Ohnishi T, Muroi M, Tanamoto K, Fujii N, Amano K. 2007. Highly-puriﬁed Helicobacter pylori LPS preparations induce weak inﬂammatory reactions and utilize Toll-like receptor 2 complex but not Toll-like receptor 4 complex. FEMS Immunol Med Microbiol. 51:140-148. Zabaleta J, McGee DJ, Zea AH, Hernández CP, Rodriguez PC, Sierra RA, Correa P, Ochoa AC. 2004. Helicobacter pylori arginase inhibits T cell proliferation and reduces the expression of the TCR zeta-chain(CD3zeta). J Immunol. 173:586-93. Zhang G, Ducatelle R, Pasmans F, D’Herde K, Huang L, Smet A, Haesebrouck F, Flahou B. 2013. Effects of Helicobacter suis γ- Glutamyl Transpeptidase on Lymphocytes: Modulation by Glutamine and Glutathione Supplementation and Outer Membrane Vesicles as a Putative Delivery Route of the Enzyme. PLoS ONE. 8:e77966. Zhang G, Ducatelle R, De Bruyne E, Joosten M, Bosschem I, Smet A, Haesebrouck F, Flahou B. 2015. Role of γ-glutamyltranspeptidase in the pathogenesis of Helicobacter suis and Helicobacter pylori infections. Vet Res. 46:31.

Scientific aims

Helicobacter (H.) suis is a bacterium that predominantly colonizes the stomach of pigs and several non-human primates worldwide. In addition, this bacterium is the most prevalent non- Helicobacter pylori Helicobacter species present in humans suffering from gastric disease. In pigs, infection with H. suis causes chronic gastritis and a decrease in daily weight gain. Several studies attribute a role to this pathogen in the development of gastric ulcers. For a long time, the research on H. suis was hampered by the lack of pure in vitro cultures. The development of an isolation and cultivation protocol in 2008, paved the way for further research on pathogenesis, host immune response and possible strategies to control H. suis infections. The overall aim of this doctoral research was to develop new control strategies against H. suis infection, based on a better understanding of the mechanisms of a protective immune response. Unlike H. pylori, limited information is available about the immune response evoked by H. suis infections in its different hosts. A good knowledge about innate and adaptive immune responses is necessary for the future improvement of vaccination strategies against gastric Helicobacter infections. The first specific aim was to investigate immunity to H. suis, both after experimental infection of BALB/c mice, and in naturally infected pigs at slaughter age. H. suis isolates obtained from primates seem to be more virulent compared to porcine strains, since experimental H. suis infection of mice has previously been shown to lead to the development of gastric lymphoid follicles, which is not observed when using porcine strains. However, direct comparison between these H. suis strains was not straightforward in the past, since no pure in vitro isolated H. suis cultures from primates were available. Recently, we succeeded in cultivating H. suis strains in vitro from the stomach of cynomolgus monkeys, as well as rhesus monkeys. Differences in virulence might influence the host response against infection. Therefore, the second specific aim was to obtain insights into potential differences between pig- and primate-associated H. suis strains in terms of virulence and pathogenesis in a BALB/c mouse and Mongolian gerbil model. Antibiotic-based treatment to control gastric Helicobacter infections is not recommended due to the rise of antimicrobial resistance and as such, vaccination is considered to be a valuable approach to combat infections with this highly prevalent pathogen. Previously, only cholera toxin and a saponin-based adjuvant were used in H. suis vaccination studies. Therefore, the third specific aim was to investigate the efficacy and safety of several established and new vaccine adjuvants, along with H. suis whole-cell lysate, to protect against subsequent H. suis challenge in a BALB/c infection model.

Experimental Studies

Experimental Studies: Chapter 1

Chapter 1

Species-specific immunity to Helicobacter suis

Iris Bosschem1, Bram Flahou1, Kim Van Deun1, Stefaan De Koker3, Jiri Volf4, Annemieke

Smet1, Richard Ducatelle1, Bert Devriendt2,* and Freddy Haesebrouck1,*

1Department of Pathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University, Merelbeke, Belgium

2Department of Virology, Parasitology, Immunology, Faculty of Veterinary Medicine, Ghent

University, Salisburylaan 133, 9820 Merelbeke, Belgium

3Department of Biomedical molecular biology, Faculty of Sciences, Ghent University,

Ledeganckstraat 35, 9000 Gent, Belgium

4Veterinary Research Institute, Hudcova 70, 621 00 Brno, Czech Republic

*Bert Devriendt and Freddy Haesebrouck share senior authorship

Adapted from: Helicobacter (2016); DOI:10.1111/hel.12375

Experimental Studies: Chapter 1

ABSTRACT

Background: Helicobacter (H.) suis is mainly associated with pigs, but is also the most prevalent gastric non-H. pylori Helicobacter species found in humans. In the absence of proper treatment, both H. pylori and H. suis may cause persistent infection of the stomach. Several immune evasion mechanisms have been proposed for H. pylori, which focus to a great extent on the major H. pylori virulence factors, which are absent in H. suis.

Materials and methods: To gain more knowledge on immune evasion by H. suis, cytokine expression kinetics were monitored in the stomach of BALB/c mice after experimental H. suis infection. The cytokine expression profile in the stomach of naturally H. suis infected pigs was determined. Subsequently, the effect of H. suis on murine and porcine dendritic cell (DC) maturation and their ability to elicit T-cell effector responses was analyzed.

Results: Despite an Th17/Th2 response in the murine stomach, the inflammatory cell influx was unable to clear H. suis infection. H. suis-stimulated murine bone marrow-derived dendritic cells induced IL-17 secretion by CD4+ cells in vitro. Natural H. suis infection in pigs evoked increased expression levels of IL-17 mRNA in the antrum and IL-10 mRNA in the fundus. In contrast with mice, H. suis-stimulated porcine monocyte-derived dendritic cells were unable to express MHCII molecules on their cell surface. These semi-mature DCs induced proliferation of T-cells, which showed an increased expression of TGF-β and FoxP3 mRNA levels.

Conclusions: H. suis might evade host immune responses by skewing towards a Treg-biased response.

Experimental Studies: Chapter 1

Introduction

Helicobacter suis (H. suis) is a pathogen of pigs worldwide. It mainly colonizes the porcine stomach (Haesebrouck et al., 2009). Infections with this bacterium have been associated with ulceration of the gastric non-glandular mucosa, gastritis and a decreased daily weight gain in pigs (Haesebrouck et al., 2009; De Bruyne et al., 2012). A good knowledge about the immune responses that can protect against gastric Helicobacter infections or that can clear an existing infection is necessary for the potential development of vaccines. However, available literature focusses mainly on the immune response evoked by H. pylori infections. Limited information is available about the immune response evoked by H. suis infections. In addition, to our knowledge the immune response following H. suis infection in its natural host, the pig, has not been investigated. In BALB/c and C57BL/6 mice, experimental H. suis infection generally causes a predominant Th17 response in their stomach, accompanied by a mild Th2 response, mainly in BALB/c mice (Flahou et al., 2012; Zhang et al., 2015). The immune response induced by H. pylori infection on the other hand, is characterized by a Th17/Th1 response and the absence of a Th2 response in C57BL/6 and BALB/c mice (Shi et al., 2010). This different immune response could play a role in the development of different pathologies by Helicobacter species. Lesion severity associated with H. suis infection in humans is often less than with H. pylori infection (Stolte et al., 1997). Chronic H. suis infection in humans mainly causes the development of mucosa-associated lymphoid tissue (MALT) lymphoma-like lesions, whereas H. pylori causes predominantly metaplastic/dysplastic changes (Morgner et al., 2001; Nakamura et al., 2007; Yang et al., 2015). In addition, in humans H. pylori mainly colonizes the surface of the gastric epithelium, whereas H. suis is often found in the vicinity or in the canaliculi of parietal cells, which might also explain the differences in pathogenesis (Joo et al., 2007). Both H. pylori and H. suis may persist for life in the host in the absence of proper treatment. However, it remains largely unclear how they evade clearance in the presence of Helicobacter-specific immunity. Several immune evasion mechanisms have been proposed for H. pylori, which focus to a great extent on the CagA protein, encoded in the cag (cytotoxin-associated gene) pathogenicity island (cagPAI), and vacuolating toxin A (VacA) (Lina et al., 2014). VacA inhibits dendritic cell (DC) maturation and is known to impair antigen presentation by DCs (Wang et al., 2010; Kim et al., 2011). In addition, VacA may inhibit T-cell proliferation and signaling (Lina et al., 2014). CagA inhibits CD4+ T-cell differentiation towards Th1 effector cells (Tanaka et al., 2010). However, both CagA and VacA are absent in H. suis (Vermoote et

Experimental Studies: Chapter 1 al., 2011). Gamma-glutamyl transpeptidase (GGT), a well conserved virulence factor in the genus Helicobacter, is also involved in inhibition of T-cell proliferation. The inhibitory effect of GGT can be linked to cell cycle arrest in the G1 phase and to its enzymatic activity (Gerhard et al., 2005; Schmees et al., 2007; Zhang et al., 2015). In addition, high levels of CD4+CD25high regulatory T-cells, that efficiently block effector T-cell responses, have been detected in the gastric mucosa of H. pylori infected patients, which probably also contribute to bacterial persistence (Lundgren et al., 2005). The aim of the present study was to investigate the immunity to H. suis infection. Therefore, the dynamics of cytokine expression in the stomach of BALB/c mice after experimental H. suis infection were monitored as well as the gastric cytokine expression profile of naturally H. suis infected pigs. Subsequently, the effect of H. suis on murine and porcine DC maturation and their ability to stimulate T-cell proliferation in vitro was investigated. To assess the T helper response to which H. suis-stimulated DCs skew naive T-cells, the mRNA expression profile of key transcription factors and cytokines involved in T-cell polarization was determined.

Experimental Studies: Chapter 1

Materials and methods Experimental infection study in BALB/c mice Female SPF BALB/c mice of 4 weeks old were purchased from Harlan (Harlan NL, Horst, The Netherlands). The animals were housed on autoclaved wood shavings in filter top cages and were fed an autoclaved commercial diet (TEKLAD 2018 S, HARLAN). All animal procedures were approved by the Ethics committee of the Faculty of Veterinary Medicine, Ghent University (EC2009/87). Mice were inoculated once with 1.8 x 107 viable bacteria per inoculum (300 µl). The control mice received an equal volume of sterile bacterial growth medium. On days 1, 2, 3, 5, 7, 15, 28, 50, 70, 74 and 87 after inoculation, five mice from the infected group and five mice from the control group were euthanized and the stomachs were removed for further processing.

Sample collection from pigs Stomachs (n=107) from approximately six-month-old slaughter pigs from ten different herds were collected in a Belgian abattoir. Samples from the different regions of the stomach (pars oesophagea, cardia, antrum and fundus) were taken for DNA and RNA extraction and histopathological examination. Whole blood samples (n=12) were collected from pigs in EDTA-coated recipients in a Belgian abattoir.

H. suis strains H. suis strain HS5bLP, isolated from the stomach of a sow (Baele et al., 2008), was used for the inoculation of the mice, preparation of whole-cell lysate and heat-inactivation. Bacteria were cultured under microaerobic conditions (85% N2, 10% CO2, 5% O2; 37°C) on biphasic Brucella (Oxoid, Basingstoke, UK) culture plates supplemented with 20% fetal calf serum (HyClone, Logan, UT, USA), 5 mg/l amphotericin B (Bristol-Myers Squibb, Epernon, France), Campylobacter selective supplement (Skirrow, Oxoid; containing 10 mg/l vancomycin, 5 mg/l trimethoprim lactate and 2500 U/l polymyxin B) and Vitox supplement (Oxoid). In addition, the pH of the agar was adjusted to 5 by adding HCl to a final concentration of approximately 0.05%. Brucella broth (Oxoid) with a pH of 5 was added on top of the agar to obtain biphasic culture conditions. After 3 days of incubation, the Brucella broth, containing the bacteria, was harvested (Baele et al., 2008). For the preparation of the H. suis lysate, bacteria were washed, concentrated by centrifugation (5000g, 10 min, 4°C) and suspended in phosphate buffered saline (PBS). The bacterial suspension was sonicated 8

Experimental Studies: Chapter 1 times for 30 seconds, with a frequency of 20 kHz (Sonicator ultrasonic processor XL 2015; MISONIX, Farmingdale, USA), resulting in lysis of the bacteria. After centrifugation (13000g, 10 min, 4°C), the supernatant fluid was collected and stored at -70°C until further use. The protein concentration of the sonicate was determined using the Lowry assay (Flahou et al., 2009). For preparation of heat-inactivated H. suis, bacteria were washed, centrifuged and placed in a hot water bath at 95°C for 10 minutes.

Quantitative Real-Time PCR for the quantification of bacteria DNA was extracted from the murine and porcine stomach tissue using the DNeasy blood and tissue extraction kit (Qiagen, Venlo, The Netherlands). Quantitative Real-Time PCR (qPCR) was performed using the C1000TM Thermal cycler (CFX96TM Real-Time System, Bio-Rad, Hercules, CA, USA) for enumeration of colonizing bacteria. Each sample contained 5 µl of iQTM SYBR® Green Supermix (Bio-Rad), 0.25 µl of each primer, 3.5 µl of distilled water and 1 µl of template DNA. A fragment of the ureA gene of H. suis was amplified using the following primers: sense primer BF_HsuisF1: 5′-AAA ACA MAG GCG ATC GCC CTG TA-3′ and anti-sense primer BF_HsuisR1: 5′-TTT CTT CGC CAG GTT CAA AGC G-3′. For generating the standard, part of the ureAB gene cluster (1236 bp) from H. suis strain HS5 was amplified using primers U430F and U1735R as described previously (O’Rourke et al., 2004). The copy number concentration was calculated based on the length of the amplicon and the mass concentration. The standard consisted of 10-fold dilutions starting at 107 PCR amplicons for each 10 µl of reaction mixture. Data analysis was done using the Bio-Rad CFX Manager Version 3.0 software (Bio-Rad).

Quantitative Real-Time PCR for the analysis of cytokine/chemokine expression For RNA isolation, the murine and porcine stomach tissue and cell cultures were homogenized in Tri-reagent (MRC, Brunschwig Chemie, Amsterdam, The Netherlands) using a MagnaLyser (Roche Applied Science, Mannheim, Germany). Total RNA was extracted from the upper aqueous phase using the RNeasy mini kit (Qiagen). The mRNA (1 µg) was reverse transcribed into cDNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad). For the qPCR reaction, a C1000TM Thermal cycler was used. All reactions were performed in a final volume of 12 µl containing 5 pM of the sense and 5 pM of the antisense primers, 5 µl iQ SYBR mix and 2 µl cDNA. The reaction protocol consisted of an initial activation phase at 95°C for 15 minutes followed by 40 cycles of 95°C for 20 seconds, 60°C for 30 seconds and

Experimental Studies: Chapter 1

73°C for 30 seconds. A melting curve was included by increasing the temperature with 0.5°C every 5 seconds starting from 65°C until 95°C. In the mouse model, H2afz, PPIA and HPRT were chosen for normalization, since they were the most stable reference genes as determined using GeNorm version 3.4 (Vandesompele et al., 2002). For the porcine samples, the reference genes Cyc-5, ACTB and HPRT were shown to have a stable expression and were included as references. The sequences of all used primers are summarized in Additional files 1 and 2. The threshold cycle values (Ct) were first normalized to the geometric means of the reference genes and the normalized mRNA levels were calculated according to 2(-∆∆Ct) method for each individual animal (Livak and Schmittgen, 2001).

Histopathological evaluation of the gastric wall Samples of murine and porcine stomachs were formalin-fixed, paraffin wax embedded, cut at 5 µm and stained with hematoxylin and eosin according to standardized protocols. The presence of gastric follicles, lymphocyte and neutrophil infiltration in the mucosa and submucosa of the different parts of the stomach was scored using a scoring system adapted from the human updated Sydney System, but with some modifications: 0 = normal, 1 = mild, 2 = moderate, 3 = severe (Stolte et al., 2001).

Generation of murine bone marrow-derived dendritic cells Murine bone marrow-derived dendritic cells (BMDCs) were obtained from the femurs of 7-10 week old uninfected BALB/c mice. Bone marrow was passed through a 40 µm cell strainer (Becton Dickinson, Erembodegem, Belgium). Cells were cultured in complete RPMI medium containing 1 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 10% FCS, 50 µM β-mercaptoethanol and 20 ng/ml recombinant mouse (rm) granulocyte-macrophage colony-stimulating factor (GM-CSF) (Gibco, Merelbeke, Belgium). On day 3, the medium was replaced and on day 6, non-adherent differentiated BMDCs were harvested and cultured with medium supplemented with 10 ng/ml rm GM-CSF and 1 µg/ml lipopolysaccharide (LPS) from Escherichia coli (0111:B4; Sigma Aldrich, Bornem, Belgium) or 5 µg/ml H. suis lysate. Hank’s balanced salt solution (HBSS; Invitrogen, Paisley, United Kingdom) served as negative control. On day 7, BMDCs were harvested for flow cytometric analysis and supernatant was collected for enzyme-linked immunosorbent assay (ELISA).

Experimental Studies: Chapter 1

Generation of porcine monocyte-derived dendritic cells SIRPα+ cells, isolated from the peripheral blood mononuclear cell (PBMC) fraction from porcine whole blood samples were used to generate immature monocyte-derived dendritic cells (MoDCs). Peripheral blood mononuclear cells (PBMCs) were isolated from porcine whole blood samples by Ficoll Paque PLUS (GE Healthcare, Diegem, Belgium) density gradient centrifugation. Monocytes were enriched by immunomagnetic bead selection (MACS, Miltenyi Biotec, Bergisch Gladbach, Germany) to a purity of >95%, using an antibody against the pan-myeloid marker SIRPα and goat anti-mouse IgG Microbeads (Miltenyi biotec). The cell suspension was loaded onto an LS Column (Miltenyi Biotec) which was placed in the magnetic field of a MACS separator. Monocytes were cultured in 24- well plates (Cellstar, Greiner Bio one, Vilvoorde, Belgium) at a density of 5 x 105 cells/ml in Dulbecco’s modified Eagle’s Medium (Gibco) supplemented with 10% (v/v) FCS (Hyclone, GE Healthcare), 100U/ml penicillin (Sigma Aldrich), 100 µg/ml streptomycin (Sigma Aldrich), recombinant porcine (rp) granulocyte-macrophage colony stimulating factor (GM- CSF, R&D systems, Abingdon, United Kingdom) and rp IL-4 (R&D systems) and incubated at 37°C in a humified atmosphere at 5% CO2 to generate immature monocyte-derived dendritic cells (MoDCs). On day 3 of the culture period, fresh medium was added. On day 4 or 5 of the culture period, cells with long protrusions were present (Devriendt et al., 2013). MoDCs were stimulated with H. suis lysate (10 µg/ml) or heat-inactivated H. suis (MOI = 50) for 24 h at 37°C, 5% CO2 in a humified atmosphere. MoDCs stimulated with LPS (10 µg/ml) were used as positive control. MoDCs stimulated with HBSS served as negative control. After 24 h, the cells were harvested for flow cytometric analysis and qPCR.

Cell surface expression of DC markers To study the presence of cell surface markers on murine BMDC stimulated with H. suis, LPS or HBSS, cells were stained with CD11c-allophycocyanin (clone HL3; BD biosciences, Erembodegem, Belgium), MHCII-FITC (clone 14-4-4S; eBioscience, San Diego, United States), CD40-FITC (clone HM40-3; eBioscience), CD86 (B7-2)-FITC (clone GL1; eBioscience), CD80 (B7-1)-FITC (clone 16-10A1; eBioscience) or the isotype-matched controls for 1 hour at 4°C in the dark and subsequently washed with buffer. Propidium iodide (5 µg/ml) was added, the live CD11c+cells were gated, analyzed on a FACSCalibur (BD Pharmingen) and data were processed using CellQuest software. Likewise, to assess the cell surface expression of activation markers upon stimulation of porcine MoDCs by flow cytometry, the cells were stained for 20’ at 4°C with mAbs against

Experimental Studies: Chapter 1

MHCII (MSA3, Divbio science, Ulvenhout, The Netherlands), CD40 (clone G28.5; Imtec diagnostics, Antwerp, Belgium), CD25 (clone K231.3B2; AbD Serotec, Kidlington, UK) and a human CTLA-mulgG2a fusion protein (Enzo lifesciences, Antwerp, Belgium), which is able to bind to porcine CD80 and CD86 (Vaughan et al., 2000), followed by FITC conjugated isotype-specific anti-mouse secondary antibodies (Life technologies) for 20’ at 4°C. Cells stained with the isotype-matched controls were used to assess aspecific binding. Next, the cells were washed, propidium iodide (5 µg/ml) was added and data were acquired on a FACSCanto or Cytoflex. Data were processed using FacsDiva 6.1.3 software (BD biosciences) or CytExpert software (Analis, Sint-Denijs Westrem, Belgium).

Co-culture of murine BMDCs and CD4+ T cells CD4+ cells from murine lymph nodes were co-cultured with H. suis lysate-stimulated BMDCs. Negative controls consisted of CD4+ T helper cells co-cultured with untreated BMDCs. CD4+ T helper cells were isolated from gastric lymph nodes of infected mice by negative selection through magnetic bead depletion of unwanted cells (Stemcell Technologies, Grenoble, France) as described by the manufacturer. BMDCs pulsed with H. suis were co-cultured with CD4+ T helper cells (1:5) for 48 hours and the supernatant was stored at -70°C for ELISA.

Co-culture of porcine MoDCs and CD6+ T-cells The T-cell stimulatory capacity of porcine MoDCs was analyzed in an allogenic T-cell proliferation assay. T-cells were isolated from the PBMC fraction by enriching CD6+ cells to a purity of >95% by positive immunomagnetic selection with the α-CD6 mAb (IgG2a, clone MIL8, AbD Serotec) and goat anti-mouse IgG microbeads (Miltenyi Biotec). Stimulated MoDCs were co-cultured in duplicate at titrated numbers with 2.0 x 105 allogenic CD6+ T- cells in round-bottomed 96-well microtiter plates (Greiner Bio one, Vilvoorde, Belgium) for 5 days. Cell cultures were maintained in DMEM, 10% FCS, penicillin/streptomycin and 2- mercapto-ethanol (50 µM) at 37°C in a humified atmosphere at 5% CO2. After 5 days, the cells were pulsed labelled with 1 µCi/well (3H methyl-thymidine, Amersham ICN, Bucks, UK) for 18 h. Cells were harvested onto glass fiber filters (Perkin-Elmer, Life science, Brussels, Belgium) and the (3H) methyl-thymidine incorporation was measured using a β- scintillation counter (Perkin-Elmer). Cytokine expression was determined in the cell cultures after 5 days of co-incubation using qPCR.

Experimental Studies: Chapter 1

Staining of cytokine secreting murine cells The mouse IL-17 secretion assay is designed for the isolation, detection and analysis of viable IL-17A-secreting mouse leukocytes (Mouse IL-17 Secretion Assay - Cell Enrichment and Detection Kit (PE), Miltenyi Biotec). Gastric lymph node cells were co-cultured with H. suis pulsed BMDCs or unstimulated BMDCs for 48 hours. Subsequently, an IL-17-specific catch reagent was attached to the surface of all leukocytes. The cells were then incubated for 45 minutes at 37 °C to allow cytokine secretion. The secreted IL-17 binds to the IL-17 catch reagent on the positive secreting cells. Next, these cells were labelled with a second IL-17 specific antibody, the mouse IL-17 detection antibody conjugated to Biotin and Anti-Biotin- PE on ice. The IL-17-secreting cells were magnetically labeled with anti-PE Microbeads UltraPure and enriched over a MACS Column which was placed in the magnetic field of a MACS separator. Staining of the IL-17 secreting cells was performed using CD4-APC (clone GK1.5, Miltenyi Biotec). For optimal sensitivity, undesired non-T-cells such as B lymphocytes were stained with CD45R (B220)-VioBlue (clone RA3-6B2, Miltenyi Biotec). Dead cells were stained with propidium iodide (5 µg/ml). Data was analyzed using flow cytometry (FACSCalibur) and processed using CellQuest software.

Neutrophil chemotaxis assay The murine gastric epithelial cell line GSM06 was cultured in DMEM/F12 medium supplemented with 10% FCS, 1 ml ITS (Gibco), 100 U/ml penicillin, 100 µg/ml streptomycin and 2 ng/ml murine epidermal growth factor (mEGF; Sigma Aldrich). Cells were grown at the permissive temperature of 33°C and experiments were conducted at 37°C. For the neutrophil chemotaxis assay, 5 x 105 GSM06 cells were seeded in 24-well plates. After 24 hours, cells were incubated in cell medium supplemented with 100 ng/ml recombinant mouse IL-17 (recIL-17, eBioscience), live H. suis (MOI=100) or both for 24 h. HBSS-treated cells served as negative controls, while positive controls consisted of medium supplemented with 40 ng/ml recombinant mouse MIP-2 (recMIP-2, eBioscience). Optimal concentrations of IL-17 and MIP-2 were determined previously. Conditioned medium was centrifuged for 5 min at 14000xg and 500 µl was added to the basolateral chamber of transwell polyester membrane filters (6.5 mm diameter inserts, 3.0 µm pore size; Corning, New York, United States). Neutrophils were isolated out of bone marrow from femurs of 7-10 week old BALB/c mice on a Percoll gradient as described by Boxio and colleagues (2004). The purity was assessed by flow cytometry after staining with FITC conjugated rat anti-GR-1 antibody (eBioscience) and was > 94%. 6 x 105 neutrophils/ml were put in the apical chamber. After 45 minutes,

Experimental Studies: Chapter 1 transmigrated cells in the basolateral chamber were counted and normalized to the initial amount of cells in the apical chamber.

ELISA Murine cell culture supernatant was analyzed for the presence of IL-6, IL-23 and IL-17 using commercially available ELISA kits (eBioscience) according to the manufacturer’s instructions. Briefly, microtiter plates were coated overnight at room temperature with capture antibody (Ab), washed, blocked and samples and standards were added in duplicate and detected with the detection Ab and the avidin-HRP system. Optical densities were measured in an ELISA plate reader at 450nm. Standard curves were included on each plate to determine concentrations expressed as pg/ml ± standard error.

Statistical analysis. For statistical analysis, SPSS23 software was used. Statistical significance of DC marker expression, T-cell proliferation and cytokine secretion/expression was analyzed by non- parametric Mann-Whitney U test corrected with Bonferroni. P-values <0.05 were considered statistically significant.

Experimental Studies: Chapter 1

Results H. suis persistently colonizes BALB/c mice All mice were consistently colonized within one day after inoculation with H. suis strain HS5bLP. H. suis numbers increased progressively to reach a maximum on day 7 (1.6 x 106 ± 0.3 x 106 bacteria/mg), after which numbers of colonizing H. suis bacteria remained relatively stable (Figure 1). H. suis was never detected in the control mice.

Log10 H. suis 4 bacteria/mg

0 1 2 3 5 7 15 28 50

Days after inoculation

Figure 1. Kinetics of H. suis colonization after experimental infection of BALB/c mice. Colonization numbers of H. suis were assessed on day 1, 2, 3, 5, 7, 15, 28 and 50 after inoculation. The bacterial load is presented as log(10) of H. suis copies/mg stomach tissue at different time points (n=5 mice for each time point). The results are expressed as means ± standard error.

Th17 is the dominant adaptive immune response in H. suis infected BALB/c mice The transcript levels of several chemo- and cytokines were evaluated to assess the kinetics of the local pro-inflammatory gene expression profile associated with H. suis colonization in the stomach. Keratinocyte chemoattractant (KC or CXCL1), LPS-induced CXC chemokine (LIX) and macrophage inflammatory protein-2 (MIP-2 or CXCL2) were all detected during H. suis infection (Figure 2). Increased mRNA expression levels of KC and LIX were detected starting

Experimental Studies: Chapter 1 from day 5 post infection, while the MIP-2 mRNA expression level fluctuated more and increased expression was only significant on day 7 and day 50 post infection. The IL-17A mRNA expression level was upregulated in all infected mice 28 days post infection and continued to increase over time, while the mRNA expression level of the Th2 cytokine IL-4 was significantly increased at day 50 post infection (Figure 2). No significant increased mRNA expression levels of the Th1 marker INF-γ were observed. These results demonstrate that BALB/c mice elicit a Th17/Th2 response, which is not preceded by a dominant Th1 response in the initial phases after infection.

Experimental Studies: Chapter 1

Figure 2. Relative gene expression of cytokines and chemokines in the stomach of BALB/c mice. The relative gene expression of KC, IL-17A, LIX, IL-4, MIP-2 and IFN-γ on day 1, 2, 3, 5, 7, 15, 28 and 50 after infection is shown. Data are presented as the mean fold change ± standard error. An * indicates a value of P< 0.05 compared to the control group at the same time point. Squares represent the infected animals (n=5), while triangles represent the control animals (n=5).

Infection of BALB/c mice with H. suis results in a mixed neutrophil/mononuclear cell influx As H. suis colonization triggered increased expression of several CXC chemokines involved in attracting neutrophils and mononuclear cells, the inflammatory cell influx in the gastric mucosa and submucosa due to H. suis infection was assessed. Samples of the stomach were taken from long term infected mice for histopathological evaluation (70, 74 and 87 days post infection). Both neutrophils and mononuclear cells were present in the mucosa and submucosa at all time points (Figure 3). The neutrophil influx fluctuated more than that of the mononuclear cells, which remained stable over the entire sampling period. Histopathological evaluation of gastric samples of uninfected mice was consistent with normal gastric mucosa, except for 1 mouse for which neutrophil and mononuclear cell infiltration scores in the mucosa was 1 and in the submucosa 2 (data not shown).

Mucosa Submucosa 6

2 Mean inflammation Mean inflammation score 0 70 74 87 70 74 87

Days after infection

Figure 3. Infiltration of neutrophils and mononuclear cells in the gastric mucosa and submucosa after H. suis infection. Mice were infected with H. suis or sham-inoculated and euthanized 70, 74 and 87 days post infection (n=5). The influx of neutrophils (white bars) and mononuclear cells (filled bars) was scored for the mucosa and submucosa. Scores are presented as means + standard error. All uninfected mice had a score of 0, except for 1 mouse 74 days after infection, which had a score of 1 for neutrophil and mononuclear cell influx of the mucosa and 2 for the submucosa (data not shown).

Experimental Studies: Chapter 1

H. suis is unable to activate gastric epithelial cells to attract neutrophils in vitro We have established that H. suis infection leads to increased expression levels of IL-17A, KC, LIX and to a lesser degree, IL-4 and MIP-2 mRNA in gastric tissue and that their expression increased over time. To investigate if gastric epithelial cells exposed to H. suis could attract neutrophils, GSM06 cells were incubated with IL-17, H. suis or both for 24 hours. Using transwells, it was demonstrated that supernatant from H. suis-stimulated GSM06 cells did not significantly increase (P=0.145) the amount of attracted neutrophils as compared to supernatant from IL-17-stimulated cells (Figure 4). Moreover, H. suis did not amplify the IL- 17-mediated ability of gastric epithelial cells to attract neutrophils.

500000 * * * 400000

300000

200000

Neutrophils/ml 100000

HS IL-17 MIP-2

IL-17 + HS

Negative control

Figure 4. H. suis and IL-17 activate murine gastric epithelial cells to attract neutrophils. The transwell chemotaxis assay was used to evaluate the migration of neutrophils towards supernatant of H. suis-stimulated (HS) murine gastric epithelial cells (GSM06), IL-17-stimulated cells or both. MIP-2 was used as a positive control. Data are presented as the mean + standard deviation (n = 4). * P< 0.01.

H. suis matured murine BMDCs stimulate IL-17 production by CD4+ T lymphocytes Since DCs are important in the polarization of naive T-cells to a desired effector phenotype, the effect of H. suis on DC maturation and their ability to trigger Th17 effector cells was evaluated. As shown in figure 5, stimulation of murine BMDCs with H. suis significantly upregulated the cell surface expression of all investigated activation markers (MHCII, CD40,

Experimental Studies: Chapter 1

CD80 and CD86) as compared to the unstimulated BMDCs, indicating a phenotypical maturation.

800 ***

600 *** Relative expression to immature BMDC (%) 400 *** 200 *

0 MHCII CD80 CD86 CD40

Figure 5. H. suis lysate induces murine DC maturation. The expression of activation markers (CD40, CD80, CD86 and MHCII) on CD11c+ BMDCs stimulated with H. suis lysate was assessed by flow cytometry. BMDCs were exposed to H. suis lysate for 24 hours. Data are presented as mean percentage relative increase + standard deviation (n=4) compared to immature MoDCs. *: P <0.05 or ***: P<0.001.

Moreover, both LPS and H. suis-stimulated BMDCs secreted more IL-6 and IL-23 as compared to untreated BMDCs (Figure 6A and 6B). As these cytokines are key to the differentiation of Th17 effector cells, we next investigated if H. suis could trigger DCs to induce Th17 cells. To this end, BMDCs stimulated with H. suis were co-cultured with CD4+ lymphocytes isolated from gastric lymph nodes of H. suis infected mice. Interestingly, colonization caused a marked increase in the size of these lymph nodes located at the gastroduodenal junction, while it was nearly impossible to locate these in uninfected animals (data not shown). BMDCs, which had been exposed to H. suis, successfully stimulated CD4+ cells to produce elevated levels of IL-17 (Fig. 6C). Moreover, flow cytometric analysis showed an increased fraction of IL-17 secreting CD4+ lymph node cells after co-culture of whole lymphocyte preparations and H. suis treated BMDCs (Figure 6D and 6E).

Experimental Studies: Chapter 1

A B

1500 60 * * * *

1000 40

IL-6 pg/ml IL-6 500 20 IL-23 pg/ml IL-23

0 0

Control HS LPS Control HS LPS

C D 15 * 600 **

10 400

200

IL-17 pg/ml IL-17 % CD4 IL-17 cells IL-17 % CD4

0 0

Control BMDC HS Control HS

3.00.1% 13.00.3%

IL-17

CD4+

Experimental Studies: Chapter 1

Figure 6. H suis-activated murine BMDCs elicit IL-17 secreting CD4+ T cells. (A, B) Supernatant of BMDCs after 24 hours stimulation with H. suis lysate or LPS was analyzed for IL-6 and IL-23 using ELISA. Results are expressed as means ± standard error (n = 4). (C) Gastric CD4+ lymphocytes were isolated from H. suis infected mice and co-incubated with stimulated BMDCs. Supernatant was collected after 48 hours and IL-17 production was measured using ELISA. Results are expressed as means ± standard error (n = 4). (D, E) BMDCs pulsed with H. suis induced CD4+ gastric lymphocytes from H. suis infected mice to produce IL-17. Lymphocytes were isolated from the gastric lymph nodes of H. suis infected mice and cultured with H. suis pulsed BMDCs. After 48 hours, cells were stained for APC conjugated CD4+ and PE conjugated IL-17 as described in the materials and methods section. Results represent 4 independent experiments. * denotes P< 0.05, ** denotes P< 0.01 compared to unstimulated control cells.

H. suis infection is highly prevalent in Belgian slaughter pigs In this study, 76% (n = 82) out of 107 porcine stomach samples, collected from 10 different herds in a Belgian slaughterhouse, were H. suis positive as determined by qPCR. Higher colonization rates were found in the antrum compared to the fundus in infected animals, but this difference was not significant (data not shown). All H. suis infected animals showed distinct histopathological lesions which consisted of diffuse lymphocytic infiltration with multiple lymphocytic aggregates or lymphoid follicles, mainly in the antrum, compared to the H. suis negative animals.

CXC chemokine ligand 13 is highly expressed in the stomach mucosa of H. suis infected pigs Compared to H. suis negative pigs, IL-17 (p=0.032) and CXC chemokine ligand 13 (CXCL- 13) (p<0.01) expression was increased in the antrum of H. suis infected pigs (Figure 7). In the fundus of H. suis infected animals, CXCL-13 (p<0.001) and IL-10 (p=0.016) mRNA expression levels were significantly higher compared to the non-infected animals. IFN-γ, IL-4 and IL-8 mRNA expression levels were never significantly upregulated in both antrum and fundus.

Experimental Studies: Chapter 1

A B

20 20 ***

15 ** 15

10 * 10 *

5 5

Mean fold change fold Mean Mean fold change fold Mean

0 0   IL-4 IL-8 IL-4 IL-8 IL-10 IL-17 IFN- IL-10 IL-17 IFN- CXCL-13 CXCL-13 Antrum Fundus

Figure 7. H. suis induces CXCL-13 mRNA expression in porcine gastric tissues. The mRNA expression levels of IL-4, IL-8, IL-10, IL-17A, IFN-γ and CXCL-13 in A) antrum and B) fundus of the stomach of H. suis infected pigs are shown. H. suis positive (n=20) and H. suis negative stomachs (n=20) were compared for differences in cytokine mRNA expression in the gastric mucosa by qPCR. Data represent the mean fold change + standard deviation. *: P <0.05, **: P<0.01 or ***: P<0.001.

H. suis stimulation enhanced porcine dendritic cell activation marker expression To elucidate the effect of H. suis lysate and heat-inactivated H. suis bacteria on the phenotypical maturation of porcine MoDCs, the expression of co-stimulatory molecules (CD80/86, CD25, CD40) was determined 24h post stimulation of immature MoDCs using flow cytometry. Flow cytometry analysis revealed that both H. suis lysate and heat- inactivated H. suis bacteria were able to induce the expression of the DC activation markers CD25, CD80/86 and CD40, although this increase was not statistically significant compared to the HBSS treated (immature) MoDCs (Figure 8). Interestingly, a non-significant downregulation of MHCII expression was observed when compared to HBSS treated (immature) MoDCs.

Experimental Studies: Chapter 1

400 HS lysate 300 HS heat-inactivated

200

100

-100

Relativeexpression to immature MoDCs (%) CD40 CD80/86 CD25 MHCII

Figure 8. Relative expression (%) of dendritic cell activation markers (CD40, CD80/86, CD25 and MHCII) upon stimulation with H. suis lysate and heat-inactivated H. suis bacteria was analyzed using flowcytometry. Data are presented as mean percentage relative increase or decrease + standard deviation compared to immature MoDCs (n=6).

Dendritic cell cytokine secretion upon H. suis infection may promote the differentiation of regulatory T-cells T-cell activation by DCs requires, among other signals, cytokine secretion, which will influence the polarization of activated T-cells, and subsequently skews the immune response towards a Th1, Th2, Th17 or Treg response. mRNA expression levels of IL-8 and IL-1β were higher in MoDCs stimulated with H. suis lysate and heat-inactivated H. suis bacteria compared to immature MoDCs (Figure 9). An increased expression of IL-10 mRNA levels was also observed in H. suis lysate-stimulated MoDCs. Interleukin-23 (IL-23) is composed of subunits p40 (shared with IL-12) and p19 and is secreted by several types of immune cells, such as natural killer cells and dendritic cells (Li et al., 2016). IL-23p19 mRNA expression levels were significantly increased in H. suis lysate-stimulated MoDCs. However, no significant differences were observed for IL-12p40 mRNA expression levels.

H. suis-stimulated porcine MoDCs trigger the expansion of Tregs In order to determine the functional relevance of H. suis-stimulated DCs, co-culture experiments with allogenic CD6+ cells were carried out. Increased T-cell proliferation was observed when H. suis-stimulated MoDCs were co-incubated with CD6+ cells in comparison to control MoDCs. The highest proliferation counts were noted at the 1:10 and 1:30 ratio of H. suis lysate-stimulated MoDCs:T-cells (Figure 10A). Heat-inactivated H. suis-stimulated

Experimental Studies: Chapter 1

MoDCs also induced significantly increased T-cell proliferation compared to the control MoDCs at all ratios except for 1:270 (Figure 10B). Next, the T-cell differentiation was characterized by measuring the mRNA expression profile of several key genes involved in T- cell polarization. Increased mRNA expression levels of transforming growth factor beta 1 (TGF-β1) (P=0.006) and the transcription factor Forkhead-box P3 (FoxP3) (P=0.086), a Treg- specific marker, were observed in the co-culture of H. suis lysate-stimulated MoDCs and CD6+ cells. Increased mRNA expression levels of IL-17A were never observed (Figure 9D). No significant results were obtained in cytokine expression profile of heat-inactivated H. suis- stimulated MoDCs co-cultured with CD6+ cells (data not shown).

Experimental Studies: Chapter 1

Figure 9. H. suis induces pro-inflammatory cytokine production by porcine MoDCs. mRNA cytokine expression levels of LPS, H. suis lysate (A,B) and heat-inactivated (C) H. suis-stimulated MoDCs. Cytokine mRNA expression levels of IL-10, IL-1β, IL-12/23p40, IL-23p19 and IL-8 were examined by qPCR. Data are presented as the mean fold change with standard deviation (n=6). Significant differences in expression levels between infected groups and the negative control group are noted with an * (P<0.05) or ** (P<0.01). H suis-stimulated porcine DCs elicit increased TGF-β

Experimental Studies: Chapter 1 and FoxP3 mRNA expression. mRNA cytokine expression levels in the co-culture of LPS or H. suis lysate-stimulated MoDCs and CD6+ T-cells. mRNA expression levels of (D) IL-17A, IL-10, IL-4, IFN-γ, TGF-β and FoxP3 were examined by qPCR. Data are presented as the mean fold change with standard deviation (n=6). Significant differences in mRNA expression levels between infected groups and the negative control group are noted with an ** (P<0.01).

40000 MoDC * 1/10 30000 1/30 * 1/90

20000 1/270 cpm

10000

LPS LPS LPS LPS LPS HBSS HBSS HBSS HBSS HBSS

HS5 lysate HS5 lysate HS5 lysate HS5 lysate HS5 lysate

80000 * * MoDC 1/10 60000 * 1/30 ** ** 1/90

40000 1/270 cpm

20000

LPS LPS LPS LPS LPS HBSSHI HS5HBSSHI HS5HBSSHI HS5HBSSHI HS5HBSSHI HS5

Figure 10. The ability of A) H. suis lysate and B) heat-inactivated H. suis-stimulated porcine MoDCs to activate T-cells was analyzed in an allogenic T-cell proliferation assay. Allogenic CD6+ T-cells were co-cultured for 5 days with immature (HBSS), LPS, H. suis (HS5) lysate and heat-inactivated H. suis (HI HS5)-stimulated MoDCs. The data are presented as the mean counts per minute (cpm) + standard deviation (n=6). * (P<0.05) or ** (P<0.01) denote a significant difference between stimulated and immature MoDCs.

Experimental Studies: Chapter 1

Discussion The results of the present study are in line with previous H. suis infection studies in murine models, showing persistent colonization followed by a predominant Th17 response that is accompanied with elevated mRNA expression levels of IL-4, KC and LIX (Flahou et al., 2012; Zhang et al. 2015). The appearance of Th2 marker IL-4 during H. suis infection might originate from leakage of the genetic background of BALB/c mice, especially since this is less distinct in C57BL/6 mice (Flahou et al., 2012). Regardless the impact of the genetic background, increased INF-γ expression, as described during H. pylori infection, is not observed in H. suis infected BALB/c and C57BL/6 mice (Flahou et al., 2012). This could explain the difference in lesion severity following H. pylori and H. suis infection in human patients. Compared to H. pylori-associated gastritis, gastritis associated with NHPH is less active and less severe (Stolte et al., 1997), although a predominant acute neutrophilic infiltration has also been described (Yoshimura et al., 2002). In the present study, neutrophilic infiltration of the gastric mucosa and submucosa of BALB/c mice fluctuated over time and expression of KC, LIX and MIP-2 displayed different kinetics. LIX is known to be the most potent and abundant CXC chemokine (Wuyts et al., 1999) and was the highest expressed chemokine 50 days post infection which coincides with the increased presence of IL-17 mRNA transcripts. However, the presence of neutrophils in the gastric mucosa and submucosa did not resolve infection, leading to chronic inflammation. In pigs, the natural hosts of H. suis, prevalence of infection is very low before weaning, but increases rapidly hereafter and may reach up to 90%, depending on the study, in the adult boars and sows (Hellemans et al., 2007). Our results demonstrate that 76% of approximately six-month-old slaughter pigs in a Belgian abattoir were infected with H. suis. In line with observations made in previous experimental H. suis infection studies in mice (Flahou et al., 2012), increased mRNA expression levels of IL-17 and IL-10 were observed in the antral and fundic stomach mucosa respectively, of naturally H. suis infected pigs. On the other hand, upregulated expression of Th2 marker IL-4 and Th1 marker IFN-γ were not observed. Despite the clear immune response and infiltration of inflammatory cells in the porcine stomach, the infection is not cleared and prevalence rates remain very high. Interestingly, expression of CXCL-13, a chemokine attracting B-cells, was significantly upregulated in both antrum and fundus of H. suis infected pigs, compared to H. suis negative pigs. CXCL-13 is also known as a ligand for CXCR5, expressed by mature B-cells, Th17 cells and Tregs (Chevalier et al., 2011). Yamamoto et al. (2014) previously described that

Experimental Studies: Chapter 1

CXCL-13 is highly expressed in Helicobacter-infected mice and patients suffering from gastric MALT lymphoma. Histopathological evaluation of the stomach revealed that gastric lymphoid follicles were observed more often in the stomach of H. suis infected animals compared to the uninfected animals. These results are in line with a possible role of CXCL-13 in the development of gastric MALT lymphoma after infection with H. suis in humans. The pathways to activation of CXCL-13 and the formation of gastric MALT lymphoma remain to be investigated (Zhang et al., 2015). H. pylori utilizes several mechanisms to evade clearance by the host immune system which are attributed to a great extent to the virulence factors CagA and VacA. Since these virulence factors are absent in H. suis, it remains to be elucidated by which mechanisms these bacteria are able to persist in the absence of treatment. Dendritic cells are considered to be important mediators of the immune response during H. pylori infection and are observed in the gastric epithelium upon infection (Kao et al., 2010). Evidence is growing that DCs might play an important role in promoting tolerance (Shiu and Blanchard, 2013). Previous reports showed that DCs exposed to H. pylori fail to induce an effector T-cell response of the Th17 type in vivo and in vitro (Kao et al., 2010; Hitzler et al., 2011; Oertli et al., 2012). In the present study, the function of porcine and murine DCs after stimulation with H. suis lysate/heat- inactivated bacteria was investigated in vitro and revealed remarkable differences between both hosts. Exposure of murine BMDCs to H. suis lysate in vitro led to the secretion of IL-6 and IL-23, which are important players in Th17 development: IL-6 is necessary for Th17 differentiation, while IL-23 is required for survival and expansion of Th17 cells (Bettelli et al., 2007). Indeed, flow cytometric analysis showed an increased fraction of IL-17 secreting CD4+ T helper cells after co-culture of whole lymphocyte preparations and H. suis treated BMDCs. In addition, H. suis exposure of murine BMDCs resulted in DC maturation, characterized by an upregulation of CD40, CD80, CD86 and MHC class II molecules on its surface. These observations demonstrate that H. suis is able to circumvent the need for key H. pylori virulence factors CagA and VacA and that this absence does not compromise the major IL-17 polarized response in BALB/c mice. The role of Tregs was not investigated in this particular experiment. However, previous studies demonstrated increased expression of IL-10 mRNA levels after experimental H. suis infection in BALB/c mice and should therefore not be excluded as possible immune evasion mechanism (Flahou et al., 2012; Bosschem et al., 2015; Bosschem et al., 2016).

Experimental Studies: Chapter 1

In contrast with the mouse model, H. suis stimulation of porcine MoDCs resulted in a semi- mature phenotype, as shown by increased expression of CD25, CD80/86, CD40 and the impaired expression of MHC class II molecules on the cell surface of these cells. These results indicate that H. suis might be a weak activator of porcine MoDCs or possibly actively suppresses the DC response. The mechanisms by which H. suis manages to decrease MHCII presentation on porcine MoDCs remain to be elucidated. One possible hypothesis is that the observed reduction can be entirely attributed to the presence of the urease gene which is highly conserved between H. suis and H. pylori. It has been demonstrated that H. pylori urease binds to CD74, thus impairing correct folding and transport of MHCII molecules (Elliot et al., 1994; Beswick et al., 2006). These semi-mature porcine MoDCs were able to stimulate T-cell proliferation at different ratios. T-cell proliferation resulted in expression of several cytokines, including IL-8 and TGF-β but not IL-17, unlike in the BALB/c mouse model. FoxP3, a Treg-specific marker, was expressed in the co-culture of H. suis lysate-stimulated MoDCs and CD6+ cells. TGF-β is required for the differentiation of both Th17 and Treg cells by inducing their key transcription factors, RORγ/RORc and FoxP3, respectively (Li et al., 2008). Freire de Melo et al. (2012) described that a high concentration of TGF-β inhibits IL-23R expression, favoring Treg cell generation. Thus, like previously demonstrated for H. pylori, H. suis might induce a semi- maturation of porcine DCs conferring a tolerogenic phenotype that elicits the expansion of Tregs while maintaining a suboptimal level of Th17 cells, which helps to establish a chronic infection (Kao et al., 2010). The increased IL-10 mRNA expression levels which are observed in the fundic region of naturally H. suis infected pigs at slaughter age might also favor this hypothesis. In conclusion, it is clear that H. suis is able to evade the host immune response, both in a BALB/c mouse model and in pigs, by mechanisms which are independent of the H. pylori virulence factors CagA and VacA. Future studies are required to unravel the H. suis virulence factors and molecular mechanisms involved in the immune evasion and to elucidate the species-specific differences in DC maturation and T helper cell responses following H. suis infection. Since pigs are the natural host of H. suis, these results might be of greater importance compared to those obtained from the BALB/c mouse model.

100

Experimental Studies: Chapter 1

Acknowledgements

The authors thank Christian Puttevils, Delphine Ameye and Sarah Loomans for their excellent technical assistance.

Additional files

Additional file 1. List of genes and primers sequences used for quantitative RT-PCR in BALB/c mice.

Gene Primer Sequence (5'-3') Reference H2afz sense CGTATCACCCCTCGTCACTT Flahou et al. ( 2012) antisense TCAGCGATTTGTGGATGTGT PPIA sense AGCATACAGGTCCTGGCATC Flahou et al. ( 2012) antisense TTCACCTTCCCAAAGACCAC HPRT sense CAGGCCAGACTTTGTTGGAT Flahou et al. (2012) antisense TTGCGCTCATCTTAGGCTTT IL -4 sense ACTCTTTCGGGCTTTTCGAT Flahou et al. (2012) antisense AAAAATTCATAAGTTAAAGCATGGTG IFN-γ sense GCGTCATTGAATCACACCTG Flahou et al. (2012) antisense TGAGCTCATTGAATGCTTGG KC sense GCT GGG ATT CAC CTC AAG AA Flahou et al. (2012) antisense TCT CCG TTA CTT GGG GAC AC IL-17A sense TTTAACTCCCTTGGCGCAAAA Flahou et al. (2012) antisense CTTTCCCTCCGCATTGACAC MIP-2 sense AAA GTT TGC CTT GAC CCT GA Flahou et al. (2012) antisense TCC AGG TCA GTT AGC CTT GC LIX sense CCC TGC AGG TCC ACA GTG CC Flahou et al. (2012) antisense TGG CCG TTC TTT CCA CTG CGA

101

Experimental Studies: Chapter 1

Additional file 2. List of genes and primers sequences used for quantitative RT-PCR in pigs

Gene Primer Sequence (5'-3') Reference Cyc-5 sense CCTGAACATACGGGTCCTG Collado-Romero et al. (2010) antisense AACTGGGAACCGTTTGTGTTG ACTB sense CTCTTCCAGCCCTCCTTCCT Daudelin et al. (2011) antisense GCGTAGAGGTCCTTCTTCCTGATGT HPRT sense GTGATAGATCCATTCCTATGACTGTAGA Li et al. (2015) antisense TGAGAGATCATCTCCACCAATTACTT IL -17A sense CTCTCGTGAAGGCGGGAATC Yin et al. (2015) antisense GTAATCTGAGGGCCGTCTGG CXCL-13 sense GATCTTTCCCATCCAAGCAA This study antisense AACGCAAATGGTCAGTAGGG IL -10 sense GATATCAAGGAGCACGTGAACTC Daudelin et al. (2011) antisense GAGCTTGCTAAAGGCACTCTTC IL-4 sense GGTCTGCTTACTGGCATGTACC Daudelin et al. (2011) antisense CTCCATGCACGAGTTCTTTCTC IL -8 sense AGAACTGAGAAGCAACAACAACAG Daudelin et al. (2011) antisense CACAGGAATGAGGCATAGATGTAG IFN-γ sense AGGTTCCTAAATGGTAGCTCTGGG Daudelin et al. (2011) antisense AGTTCACTGATGGCTTTGCGCT TGF -β sense CGAGCCCTGGATACCAACT Bruun et al. (2013) antisense GCAGAAATTGGCATGGTAG FoxP3 sense TGCCATTCGCCACAACTT Luo et al. (2015) antisense GGTCCGTGAAGAGTTTATCTTTCT IL-12p40 sense CTTCATCAGGGACATCATCAAAC Daudelin et al. (2011) antisense AGCACGACCTCAATG IL-23p19 sense CCAAGAGAAGAGGGAGATGATGA Luo et al. (2015) antisense TGCAAGCAGGACTGACTGTTGT IL -1β sense CCAAAGGCCGCCAAGATATAA Frandoloso et al. (2013) antisense GGACCTCTGGGTATGGCTTTC

102

Experimental Studies: Chapter 1

References

Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A, Mast J, Chiers K, Ducatelle R, Haesebrouck F. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. Int J Syst Evol Microbiol. 58:1350-1358. Beswick EJ, Pinchuk IV, Minch K, Suarez G, Sierra JC, Yamaoka Y, Reyes VE. 2006. The Helicobacter pylori urease B subunit binds to CD74 on gastric epithelial cells and induces NF-kappa B activation and interleukin-8 production. Infect. Immun. 74:1148- 1155. Bettelli E, Korn T, Kuchroo VK. 2007. Th17: the third member of the effector T cell trilogy. Curr Opin Immunol. 19:652-657. Bosschem I, Flahou B, Bakker J, Heuvelman E, Langermans JA, De Bruyne E, Joosten M, Smet A, Ducatelle R, Haesebrouck F. 2016. Comparative virulence of in vitro-cultured primate- and pig-associated Helicobacter suis strains in a BALB/c mouse and a Mongolian gerbil model. Helicobacter. 22:e12349. Bosschem I, Bayry J, De Bruyne E, Van Deun K, Smet A, Vercauteren G, Ducatelle R, Haesebrouck F, Flahou B. 2015. Effect of Different Adjuvants on Protection and Side-Effects Induced by Helicobacter suis Whole-Cell Lysate Vaccination. PLoS One. 10:e0131364. Boxio R, Bossenmeyer-Pourié C, Steinckwich N, Dournon C, Nüsse O. 2004. Mouse bone marrow contains large numbers of functionally competent neutrophils. J Leukoc Biol. 75:604-611. Bruun CS, Jensen LK, Leifsson PS, Nielsen J, Cirera S, Jørgensen CB, Jensen E, Fredholm M. 2013. Functional characterization of porcine emphysema model. Lung. 191:669- 675. Chevalier N, Jarrossay D, Ho E, Avery DT, Ma CS, Yu D, Sallusto F, Tangye SG, Mackay CR. 2011. CXCR5 expressing human central memory CD4 T-cells and their relevance for humoral immune responses. J Immunol. 186:5556-5568. Collado-Romero M, Arce C, Ramírez-Boo M, Carvajal A, Garrido JJ. 2010. Quantitative analysis of the immune response upon Salmonella typhimurium infection along the porcine intestinal gut. Vet Res. 41:23. Daudelin J-F, Lessard M, Beaudoin F, Nadeau E, Bissonnette N, Boutin Y, Brousseau JP, Lauzon K, Fairbrother JM. 2011. Administration of probiotics influences F4

103

Experimental Studies: Chapter 1

(K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs. Vet Res. 42:69. De Bruyne E, Flahou B, Chiers K, Meyns T, Kumar S, Vermoote M, Pasmans F, Millet S, Dewulf J, Haesebrouck F, Ducatelle R. 2012. An experimental Helicobacter suis infection causes gastritis and reduced daily weight gain in pigs. Vet Microbiol. 160:449-454. Devriendt B, Baert K, Dierendonck M, Favoreel H, De Koker S, Remon JP, De Geest BG, Cox E. 2013. One-step spray-dried polyelectrolyte microparticles enhance the antigen cross-presentation capacity of porcine dendritic cells. Eur J Pharm Biopharm. 84:421-429. Elliott EA, Drake JR, Amigorena S, Elsemore J, Webster P, Mellman I, Flavell RA. 1994. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J. Exp. Med. 179:681-694. Flahou B, Van Deun K, Pasmans F, Smet A, Volf J, Rychlik I, Ducatelle R, Haesebrouck F. 2012. The local immune response of mice after Helicobacter suis infection: strain differences and distinction with Helicobacter pylori. Vet Res. 43:75. Frandoloso R, Martínez-Martínez S, Rodríguez-Ferri EF, Yubero S, Rodríguez-Lázaro D, Hernández M, Gutiérrez-Martín CB. 2013. Haemophilus parasuis subunit vaccines based on native proteins with affinity to porcine transferrin prevent the expression of proinflammatory chemokines and cytokines in pigs. Clin Dev Immunol. 2013:132432. Freire de Melo F, Rocha AMC, Rocha GA, Pedroso SHSP, de Assis BS, Fonseca de Castro LP, Carvalho SD, Bittencourt PF, de Oliveira CA, Corrêa-Oliveira R, Magalhães Queiroz DM. 2012. A regulatory instead of an IL-17 T response predominates in Helicobacter pylori-associated gastritis in children. Microbes Infect. 14:341-347. Gerhard M, Schmees C, Voland P, Endres N, Sander M, Reindl W, Rad R, Oelsner M, Decker T, Mempel M, Hengst L, Prinz C. 2005. A secreted low-molecular-weight protein from Helicobacter pylori induces cell-cycle arrest of T cells. Gastroenterology. 128:1327-1339 Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M, Meyns T, Decostere A, Ducatelle R. 2009. Gastric Helicobacters in Domestic Animals and Non-human Primates and Their Significance for Human Health. Clinical Microbiology Reviews. 22:202-223. Hellemans A, Chiers K, De Bock M, Decostere A, Haesebrouck F, Ducatelle R, Maes D. 2007. Prevalence of 'Candidatus Helicobacter suis' in pigs of different ages. Vet

104

Experimental Studies: Chapter 1

Rec. 161:189-192. Hitzler I, Oertli M, Becher B, Agger EM, Müller A. 2011. Dendritic cells prevent rather than promote immunity conferred by a Helicobacter vaccine using a mycobacterial adjuvant. Gastroenterology. 141: 186-196. Kao JY, Zhang M, Miller MJ, Mills JC, Wang B, Liu M, Eaton KA, Zou W, Berndt BE, Cole TS, Takeuchi T, Owyang SY, Luther J. 2010. Helicobacter pylori immune escape is mediated by dendritic cell-induced Treg skewing and Th17 suppression in mice. Gastroenterology. 138:1046-1054. Kim JM, Kim JS, Yoo DY, Ko SH, Kim N, Kim H, Kim YJ. 2011. Stimulation of dendritic cells with Helicobacter pylori vacuolating cytotoxin negatively regulates their maturation via the restoration of E2F1. Clin Exp Immunol. 166:34-45. Kim JM, Kim JS., Kim N, Kim SG, Jung HC, Song IS. 2006. Comparison of primary and secondary antimicrobial minimum inhibitory concentrations for Helicobacter pylori isolated from Korean patients. Int J Antimicrob Agents. 28:6-13. Li MO, Flavell RA. 2008. TGF-β: a master of all T cell trades. Cell. 134:392-404. Li X-Q, Zhu Y-H, Zhang H-F, Yue Y, Cai Z-X, Lu QP, Zhang L, Weng XG, Zhang FJ, Zhou D, Yang JC, Wang JF. 2012. Risks Associated with High-Dose Lactobacillus rhamnosus in an Escherichia coli Model of Piglet Diarrhoea: Intestinal Microbiota and Immune Imbalances. PLoS ONE. 7: e40666. Li Y, Wang H, Lu H, Hua S. 2016. Regulation of Memory T Cells by Interleukin-23. Int Arch Allergy Immunol. 169:157-162. Lina TT, Alzahrani S, Gonzalez J, Pinchuk IV, Beswick EJ, Reyes VE. 2014. Immune evasion strategies used by Helicobacter pylori. World J Gastroenterol. 20:12753- 12766. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402-408. Lundgren A, Strömberg E, Sjöling A, Lindholm C, Enarsson K, Edebo A, Johnsson E, Suri- Payer E, Larsson P, Rudin A, Svennerholm AM, Lundin BS. 2005. Mucosal FOXP3- expressing CD4+ CD25high regulatory T-cells in Helicobacter pylori-infected patients. Infect Immun. 73:523-31. Luo Y, Van Nguyen U, de la Fe Rodriguez PY, Devriendt B, Cox E. 2015. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response. Vet Res. 46:121.

105

Experimental Studies: Chapter 1

Lwai-Lume L, Ogutu EO, Amayo EO, Kariuki S. 2005. Drug susceptibility pattern of Helicobacter pylori in patients with dyspepsia at the Kenyatta National Hospital, Nairobi. East Afr Med J. 82:603-608. Morgner A, Bayerdorffer E, Neubauer A, Stolte M. 2001. Helicobacter pylori associated gastric B-cell MALT lymphoma: predictive factors for regression. Gut. 48:290-292. Nakamura M, Murayama SY, Serizawa H, Sekiya Y, Eguchi M, Takahashi S, Nishikawa K, Takahashi T, Matsumoto T, Yamada H, Hibi T, Tsuchimoto K, Matsui H. 2007. "Candidatus Helicobacter heilmannii" from a cynomolgus monkey induces gastric mucosa-associated lymphoid tissue lymphomas in C57BL/6 mice. Infect Immun. 75:1214-1222. Oertli M, Sundquist M, Hitzler I, Engler DB, Arnold IC, Reuter S, Maxeiner J, Hansson M, Taube C, Quiding-Järbrink M, Müller A. 2012. DC-derived IL-18 drives Treg differentiation, murine Helicobacter pylori-specific immune tolerance, and asthma protection. The Journal of clinical investigation. 122:1082-1096. O'Rourke JL, Solnick JV, Neilan BA, Seidel K, Hayter R, Hansen LM, Lee A. 2004. Description of 'Candidatus Helicobacter heilmannii' based on DNA sequence analysis of 16S rRNA and urease genes. Int J Syst Evol Microbiol. 54:2203-2211. Schmees C, Prinz C, Treptau T, Rad R, Hengst L, Voland P, Bauer S, Brenner L, Schmid RM, Gerhard M. 2007. Inhibition of T-cell proliferation by Helicobacter pylori gamma-glutamyl transpeptidase. Gastroenterology. 132:1820-1833 Shi Y, Liu XF, Zhuang Y, Zhang JY, Liu T, Yin Z, Wu C, Mao XH, Jia KR, Wang FJ, Guo H, Flavell RA, Zhao Z, Liu KY, Xiao B, Guo Y, Zhang WJ, Zhou WY, Guo G, Zou QM. 2010. Helicobacter pylori-induced Th17 responses modulate Th1 cell responses, benefit bacterial growth, and contribute to pathology in mice. J Immunol. 184:5121- 5129. Shiu J, Blanchard TG. 2013. Dendritic cell function in the host response to Helicobacter pylori infection of the gastric mucosa. Pathog Dis. 67:46-53. Stolte M, Kroher G, Meining A, Morgner A, Bayerdörffer E, Bethke B. 1997. A comparison of Helicobacter pylori and H. heilmannii gastritis. A matched control study involving 404 patients. Scand J Gastroenterol. 32:28-33. Stolte M, Meining A. 2001. The updated Sydney system: classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 15:591-598.

106

Experimental Studies: Chapter 1

Tanaka H, Yoshida M, Nishiumi S, Ohnishi N, Kobayashi K, Yamamoto K, Fujita T, Hatakeyama M, Azuma T. 2010. The CagA protein of Helicobacter pylori suppresses the functions of dendritic cell in mice. Arch Biochem Biophys. 498:35-42. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. research0034.1- research0034.11. Vaughan AN, Malde P, Rogers NJ, Jackson IM, Lechler RI, Dorling A. 2000. Porcine CTLA4-Ig lacks a MYPPPY motif, binds inefficiently to human B7 and specifically suppresses human CD4+ T-cell responses costimulated by pig but not human B7. J Immunol. 165:3175-3181. Vermoote M, Vandekerckhove TT, Flahou B, Pasmans F, Smet A, De Groote D, Van Criekinge W, Ducatelle R, Haesebrouck F. 2011. Genome sequence of Helicobacter suis supports its role in gastric pathology. Vet Res. 42:51. Wang YH, Gorvel JP, Chu YT, Wu JJ, Lei HY. 2010. Helicobacter pylori impairs murine dendritic cell responses to infection. PlosOne. 5:e10844. Wuyts A, Haelens A, Proost P, Lenaerts JP, Conings R, Opdenakker G, Van Damme J. 1996 Identification of mouse granulocyte chemotactic protein-2 from fibroblasts and epithelial cells. Functional comparison with natural KC and macrophage. J Immunol. 157:1736-43. Yamamoto K, Nishiumi S, Yang L, Klimatcheva E, Pandina T, Takahashi S, Matsui H, Nakamura M, Zauderer M, Yoshida M, Azuma T. 2014. Anti-CXCL13 antibody can inhibit the formation of gastric lymphoid follicles induced by Helicobacter infection. Mucosal Immunol. 7:1244-1254. Yang L, Yamamoto K, Nishiumi S, Nakamura M, Matsui H, Takahashi S, Dohi T, Okada T, Kakimoto K, Hoshi N, Yoshida M, Azuma T. 2015. Interferon-γ-producing B-cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection. Mucosal Immunology. 8:279-295. Yin J, Duan J, Cui Z, Ren W, Li T, Yin Y. 2015. Hydrogen peroxide-induced oxidative stress activates NF-κB and Nrf2/Keap1 signals and triggers autophagy in piglets. RSC Adv. 5:15479-15486. Yoshimura M, Isomoto H, Shikuwa S, Osabe M, Matsunaga K, Omagari K, Mizuta Y, Murase K, Murata I, Kohno S. 2002. A case of acute gastric mucosal lesions associated with Helicobacter heilmannii infection. Helicobacter. 7:322-326.

107

Experimental Studies: Chapter 1

Zhang G, Ducatelle R, De Bruyne E, Joosten M, Bosschem I, Smet A, Haeseboruck F, Flahou B. 2015. Role of γ-glutamyltranspeptidase in the pathogenesis of Helicobacter suis and Helicobacter pylori infections. Vet Res. 46:31.

108

Experimental Studies: Chapter 2

Chapter 2

Host response to in vitro-cultured primate- and pig- associated Helicobacter suis strains in a BALB/c

mouse and a Mongolian gerbil model

Iris Bosschem1, Bram Flahou1 , Jaco Bakker2, Edwin Heuvelman2, Jan A.M. Langermans2, 1 1 1 1,* Ellen De Bruyne , Myrthe Joosten , Annemieke Smet , Richard Ducatelle and Freddy Haesebrouck1,*

1 Department of Pathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University, Merelbeke, Belgium

2 Animal Science Department, Biomedical Primate Research Centre, Rijswijk, The Netherlands

*Richard Ducatelle and Freddy Haesebrouck share senior authorship

Adapted from: Helicobacter (2017); 22:e12349

109

Experimental Studies: Chapter 2

Abstract

Background: Helicobacter suis (H. suis) is the most prevalent gastric non-H. pylori Helicobacter species in humans. This bacterium mainly colonizes the stomach of pigs, but it has also been detected in the stomach of non-human primates. The aim of this study was to obtain better insights into potential differences between pig- and primate-associated H. suis strains in virulence and pathogenesis. Materials and Methods: In vitro isolated H. suis strains obtained from pigs, cynomolgus monkeys (Macaca fascicularis) and rhesus monkeys (Macaca mulatta) were used for intragastric inoculation of BALB/c mice and Mongolian gerbils. Nine weeks and 6 months later, samples of the stomach of inoculated and control animals were taken for PCR analysis and histopathological examination. Results: The cynomolgus monkey-associated H. suis strain only colonized the stomach of mice, but not of Mongolian gerbils. All other H. suis strains colonized the stomach in both rodent models. In all colonized animals, severe gastric inflammation was induced. Gastric lymphoid follicles and destruction of the antral epithelium were observed in infected gerbils, but not in mice. Infection with both pig- and primate-associated H. suis strains evoked a similar marked Th17 response in mice and gerbils, accompanied by increased CXCL-13 expression levels. Conclusions: Apart from the cynomolgus monkey-associated strain which was unable of colonizing the stomach of Mongolian gerbils, no substantial differences in virulence were found in rodent models between in vitro cultured pig-associated, cynomolgus monkey- associated and rhesus monkey-associated H. suis strains. The experimental host determines the outcome of the immune response against H. suis infection, rather than the original host where the strains were obtained from.

110

Experimental Studies: Chapter 2

Introduction

Helicobacter suis (H. suis) is a Gram-negative, spiral-shaped bacterium which mainly colonizes the stomach of pigs. It has also been detected in the stomach of several non-human primates, including rhesus monkeys (Macaca mulatta) and cynomolgus monkeys (Macaca fascicularis) (O’Rourke et al., 2004; Nakamura et al., 2007; Haesebrouck et al., 2009). In addition, H. suis is the most prevalent gastric non-H. pylori Helicobacter (NHPH) species in humans, in which infection is associated with gastritis, peptic ulcers and certain forms of gastric cancer (Baele et al., 2009). Unlike infections with H. pylori, infections with H. suis only rarely cause gastric adenocarcinoma. Instead, infections with H. suis, as well as with other gastric NHPH species, are associated with an increased risk of developing gastric mucosa-associated lymphoid tissue (MALT) lymphoma (Morgner et al., 2001; Nakamura et al., 2007; Yang et al., 2014). MALT lymphoma-like lesions are also observed in mice and Mongolian gerbils experimentally infected with H. suis, while they are less common in animals infected with H. pylori (O’Rourke et al., 2004; Wiedemann et al., 2009). The lesions in NHPH-infected animals exhibit the classical morphological features of MALT lymphomas in humans, including monomorphic centrocyte-like cells invading the gastric epithelium, forming lympho-epithelial lesions (LEL’s) in the presence of lymphoid tissue (O’Rourke et al., 2004; Flahou et al., 2010). These differences between H. pylori and H. suis infection, observed both in natural infections in humans and in experimental infections in rodent models, may be due to differences in the host immune response towards both Helicobacter species. This has been studied in several rodent models using pure in vitro isolated bacterial strains for experimental infection. In contrast to H. pylori, evoking a Th17/Th1 response, H. suis infection leads to a Th17/Th2 response, at least in mice, which could explain the association of NHPH infections with MALT lymphoma (Flahou et al., 2012). Indeed, higher expression levels of Th2 cytokines are observed in MALT lymphoma (Greiner et al., 1997; Yamasaki et al., 2004). In contrast, increased expression levels of interferon gamma (IFN-γ), a Th1 cytokine, and interleukin-17 (IL-17), the signature Th17 cytokine, are observed in H. suis-infected Mongolian gerbils with severe MALT lymphoma-like lesions, however in the absence of upregulated expression of Th2 cytokines, showing the complexity of gastric MALT lymphomagenesis in H. suis- infected animals (Zhang et al., 2015). Anyway, it is clear that there are differences in immunopathogenesis between H. pylori and H. suis. From the available literature data it

111

Experimental Studies: Chapter 2 remains, however, unclear whether H. suis strains of different host origin may differ in pathogenesis. In contrast to the studies described above, several experimental infection studies have been performed using gastric mucosal homogenates or mucus from H. suis-infected animals instead of pure in vitro isolated strains. When using these homogenates, several other micro- organisms are likely administered to the animals as well, which may aggravate the course of infection and influence the outcome of the results (Flahou et al., 2010). Besides homogenate obtained from pigs, several studies have used mucosal homogenates derived from H. suis- infected non-human primates. O’Rourke et al. (2004) reported the presence of “Helicobacter heilmannii”-associated gastric MALT lymphomas in BALB/c mice, which started to develop six months after infection. The most severe pathological responses were consistently seen in animals infected with stomach material obtained from mandrill monkeys and a cynomolgus monkey, which were in fact shown to be infected with H. suis. In another study, urease positive gastric mucosal and mucus homogenate from a cynomolgus monkey was used to inoculate mice (Nakamura et al., 2007). The bacterium in the homogenate was designated as “Candidatus Helicobacter heilmannii”, but in fact was shown to belong to the species H. suis (Baele et al., 2009). Infection resulted in the formation of MALT lymphomas in 50% of the C57BL/6 mice 3 months post infection and in 100% of the animals six months post infection. A similar quick onset of severe gastric disease has so far not been demonstrated in mice infected with pure in vitro isolated H. suis strains obtained from pigs (Flahou et al., 2012; Zhang et al., 2015). Since the isolate used by Nakamura and colleagues has been maintained in mice for 12 years, host adaptation may have increased the virulence of the involved bacterial strains in this animal model. Several studies attribute a major role to IFN-γ, mainly produced by B-cells, in gastric lymphoid follicle formation in mice experimentally inoculated with stomach homogenate from H. suis-infected animals (Mimura et al., 2011; Yang et al., 2014). This finding, again, partly contradicts the findings obtained when infecting mice with in vitro isolated H. suis strains colonizing pigs (Flahou et al., 2012; Zhang et al., 2015). Clearly, conflicting results have been published regarding the pathogenesis of H. suis infection in various rodent models of human gastric disease. Although differences seem to exist in terms of virulence between H. suis isolates obtained from pigs and cynomolgus monkeys, comparison between these pig- and primate-associated H. suis strains is complicated since no pure in vitro isolated H. suis cultures from primates were available so far. Recently, we succeeded in in vitro cultivating H. suis strains from the stomach of

112

Experimental Studies: Chapter 2 cynomolgus monkeys, as well as rhesus monkeys. To our knowledge, no experimental infection studies have been performed in rodent models using pure H. suis strains obtained from these animals. In addition, no experimental infection studies have been performed so far in Mongolian gerbils using H. suis bacteria colonizing the stomach of cynomolgus monkeys or rhesus monkeys. Nevertheless, this animal model has been suggested to be more suitable than mouse models for studying H. suis-host interactions (Flahou et al., 2010). In the present study, in vitro isolated H. suis strains obtained from a pig, a cynomolgus monkey and a rhesus monkey were used for experimental infection of BALB/c mice and Mongolian gerbils, in an attempt to obtain better insights in potential differences between pig- and primate-associated H. suis strains in terms of virulence and pathogenesis.

113

Experimental Studies: Chapter 2

Materials and methods

Ethics statement The in vivo experimental protocol was approved by the Ethical Committee of the Faculty of Veterinary Medicine, Ghent University, Belgium (EC2015/23; April 3rd, 2015).

Animals Forty-eight specific-pathogen-free (SPF) female six-week-old BALB/c mice and twenty-four SPF female outbred gerbils (Crl:MON (Tum)) of six weeks old were purchased from an authorized breeder (HARLAN, Horst, The Netherlands and Charles River Laboratories, Brussels, Belgium, respectively). All animals tested negative for the presence of Helicobacter spp.. The animals were housed on autoclaved soft wood shavings (Van Huffel, Nevele- Poesele, Belgium) in filter top cages. They were fed an autoclaved commercial diet (TEKLAD 2018 S, HARLAN). Autoclaved drinking water was provided ad libitum. The animals were monitored several times a day during the whole experiment. Enrichment was provided in the form of paper tissues, mouse houses and other homemade available enrichment products. All animals were exposed to a 12:12 light:dark cycle.

Bacteria H. suis strain HS1 was isolated from the gastric mucosa of a sow as described previously (Baele et al., 2008). H. suis strains HsMmR08041a and HsMf505/1 were isolated from the gastric mucosa of a rhesus monkey (Macaca mulatta) and a cynomolgus monkey (Macaca fascicularis), respectively. These monkeys were bred and housed at the Biomedical Primate Research Centre (BPRC, Rijswijk, The Netherlands). The animals were socially housed in spacious cages and were provided with commercial food pellets (SSniff®, Soest, Germany) supplemented with appropriate treats. Drinking water was provided ad libitum. Enrichment was provided in the form of pieces of wood, mirrors, food puzzles and other homemade or commercially available enrichment products. Animals were monitored daily for health and discomfort. BPRC facilities comply with Dutch law on animal experiments and the EU Directive 63/2010, and are AAALAC International accredited. Stomachs were collected at necropsy from animals that were euthanized, for reasons unrelated to this study.

Bacteria were cultured under microaerobic conditions (85% N2, 10% CO2, 5% O2; 37°C) on biphasic Brucella (Oxoid, Basingstoke, UK) culture plates supplemented with 20% fetal calf serum (HyClone, Logan, UT, USA), 5 mg amphotericin B/l (Fungizone; Bristol-Myers

114

Experimental Studies: Chapter 2

Squibb, Epernon, France), Campylobacter selective supplement (Skirrow, Oxoid; containing 10 mg/l vancomycin, 5 mg/l trimethoprim lactate and 2500 U/l polymyxin B) and Vitox supplement (Oxoid). In addition, the pH of the agar was adjusted to 5 by adding HCl to a final concentration of approximately 0.05%. Brucella broth (Oxoid) with a pH of 5 was added on top of the agar to obtain biphasic culture conditions. After three days of incubation, the bacteria were harvested and the final concentration was adjusted to 2×108 viable bacteria/ml Brucella broth, as determined by counting in an improved Neubauer counting chamber. The total number of in vitro passages to which the H. suis strains used for experimental inoculation of the mice and Mongolian gerbils were subjected, varied between 15 and 18.

Experimental design One week after arrival, three groups, each consisting of 12 mice and 6 gerbils were inoculated twice at 48 hour interval with one of the three pure H. suis strains: HS1, HsMmR08041a and HsMf505/1. A volume of 0.3 ml was used. Twelve mice and six gerbils were twice inoculated with 0.3 ml Brucella broth (Oxoid) with a pH of 5 and served as negative controls. Inoculation was performed intragastrically under isoflurane anaesthesia, using a ball-tipped gavage needle. The mice were held in an upright position until they regained consciousness, to minimize the risk of reflux. At nine weeks after the first inoculation, 18 H. suis infected and six control mice and all gerbils were euthanized by cervical dislocation under isoflurane anaesthesia. Six months after the first inoculation the twenty-four remaining mice were euthanized. The stomach of each animal was resected and samples were taken for PCR analysis and histopathological examination. The antral and fundic region of the stomach were preserved in RNAlater (Ambion, Austin, TX, USA) at -70°C until RNA extraction. For RNA isolation, the stomachs were homogenized in 1 ml Tri-reagent (MRC, Brunschwig Chemie, Amsterdam, The Netherlands) using a MagnaLyser (Roche Applied Science, Mannheim, Germany). Total RNA was extracted from the upper aqueous phase using the RNeasy mini kit (Qiagen, Venlo, The Netherlands). DNA was extracted from the antral and fundic stomach tissue using the ISOLATE II Genomic DNA kit (Bioline, Luckenwalde, Germany) according to the manufacturer’s instructions. A longitudinal strip of tissue taken along the curvatura major of the stomach was fixed in phosphate buffered formaline (4%) for histopathological analyses.

115

Experimental Studies: Chapter 2

Histological examination A longitudinal strip of gastric tissue was cut from the oesophagus to the duodenum along the greater curvature. This strip was fixed in 4% phosphate buffered formaldehyde, processed by standard methods, and embedded in paraffin for light microscopy. Five sections of 5 µm were cut. After deparaffinization and hydration, heat-induced antigen retrieval was performed in citrate buffer (pH 6.0) using a microwave oven. Slides were incubated with 3% H2O2 in methanol (5 min) and 30% goat serum (30 min) to block endogenous peroxidase activity and non-specific reactions, respectively (Flahou et al., 2010). The first section was stained with haematoxylin and eosin (H&E) to score the intensity of the gastritis, using a visual analog scale similar to the Updated Sydney System but with some modifications (Stolte et al., 2001). Both diffuse infiltration and the presence of lymphoid aggregates and lymphoid follicles were examined. In addition, in these H&E stained sections the presence of neutrophils was scored. On the second section, a Periodic acid- Schiff (PAS) staining was performed to evaluate the presence of pseudo-pyloric metaplasia of the fundus. For detection of T and B lymphocytes, staining of CD3 and CD20 respectively, was performed on section three and four, using a polyclonal rabbit anti-CD3 antibody (1/100; DakoCytomation, Glostrup, Denmark) and a polyclonal rabbit anti-CD20 antibody (1/25; Thermo Scientific, Fremont, USA). These sections were further processed with Envision + System-HRP (DAB) (DakoCytomation) for use with rabbit primary antibodies. Parietal cells were identified by immunohistochemical staining for hydrogen potassium ATPase using a mouse monoclonal antibody on section five (1/200; Abcam Ltd, Cambridge, UK). This section was further processed with Envision + System-HRP (DAB) (DakoCytomation) for use with mouse primary antibodies.

Quantitative Real-Time PCR for the quantification of the bacteria Quantitative Real-Time PCR (RT-PCR) was performed using the C1000TM Thermal cycler (CFX96TM Real-Time System, Bio-Rad, Hercules, CA, USA). Each sample contained 5 µl of iQTM SYBR® Green Supermix (Bio-Rad), 0.25 µl of each primer, 3.5 µl of distilled water and 1 µl of DNA. For enumeration of colonizing bacteria, a fragment of the ureA gene of H. suis was amplified using the following primers: sense primer BF_HsuisF1: 5′-AAA ACA MAG GCG ATC GCC CTG TA-3′ and anti-sense primer BF_HsuisR1: 5′-TTT CTT CGC CAG GTT CAA AGC G-3′. For generation of the standard, part of the ureAB gene cluster (1236 bp) from H. suis strain HS5 was amplified using primers U430F and U1735R, as described

116

Experimental Studies: Chapter 2 previously (O’Rourke et al., 2004). The copy number concentration was calculated based on the length of the amplicon and the mass concentration. The standard consisted of 10-fold dilutions starting at 108 PCR amplicons for each 10 µl of reaction mixture. Data analysis was done using the Bio-Rad CFX Manager Version 3.0 software (Bio-Rad).

Quantitative Real-Time PCR for the analysis of cytokine and chemokine expression Total RNA was extracted from the stomach tissue, which was stored in RNAlater (Ambion) using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The RNA concentration was adjusted to 1 μg/μL and cDNA was synthesized immediately after RNA purification using the iScript™ cDNA Synthesis Kit (Bio-Rad). Messenger RNA expression levels in fundus and antrum were determined for the following genes: IL-1β, IL-4, IL-10, IL-17, IFN-γ, CXCL-13. In addition, mRNA expression levels were determined for hydrogen potassium ATPase and ASCT2, which were previously shown to reflect effects of H. suis infection on the gastric epithelium of the host (Zhang et al., 2015). The H+/K+ ATPase is responsible for acid secretion by parietal cells (Forte et al., 1989). ASCT2 is described to be a major glutamine transporter (Shimizu et al., 2014). For the RT- PCR reaction, a C1000TM Thermal cycler (CFX96TM Real-Time System, Bio-RAD, Hercules, CA, USA) was used. All reactions were performed in a final volume of 12 µl containing 5 pmole of the sense and 5 pmole of the antisense primers, 5 µl iQ SYBR mix (Bio-Rad) and 2 µl cDNA. The reaction protocol consisted of an initial activation phase at 95°C for 15 minutes followed by 40 cycles of 95°C for 20 seconds, 60°C for 30 seconds and 73°C for 30 seconds. Melting curve analysis was done by increasing the temperature with 0.5°C every 5 seconds starting from 65°C until 95°C. The reference genes H2afz, PPIA and HPRT were shown to have a stable expression in mice and were included as references. For the gerbil model, β- actin, GADPH and HPRT1 were used as reference genes (Zhang et al., 2015). The sequences of all used primers are summarized in Table I and II. The threshold cycle values (Ct) were first normalized to the geometric means of the reference genes and the normalized mRNA levels were calculated according to 2(-∆∆Ct) method for each individual animal (Livak and Schmittgen, 2001)

117

Experimental Studies: Chapter 2

Table I. List of genes and primers sequences used for quantitative RT-PCR in Mongolian gerbils

Gene Primer Sequence (5'-3') Reference CXCL-13 sense GAATGGCTGCCCCAAAACTGAA Zhang et al., 2015 antisense TCACTGGAGCTTGGGGAGTTGAA GAPDH sense AACGGGAAGCTCACTGGCATG Zhang et al., 2015 antisense CTGCTTCACCACCTTCTTGATGTCA HPRT1 sense GCCCCAAAATGGTTAAGGTTGCA Zhang et al., 2015 antisense TCAAGGGCATATCCAACAACAAAC IL-1β sense GGCAGGTGGTATCGCTCATC Zhang et al., 2015 antisense CACCTTGGATTTGACTTCTA IFN-γ sense CCATGAACGCTACACACTGCATC Zhang et al., 2015 antisense GAAGTAGAAAGAGACAATCTGG IL-10 sense GGTTGCCAAGCCTTATCAGA Joosten et al., 2013 antisense GCTGCATTCTGAGGGTCTTC IL-17 sense AGCTCCAGAGGCCCTCGGAC Zhang et al., 2015 antisense AGGACCAGGATCTCTTGCTG ATP4b sense GGGGGTAACCTTGAGACCTGATG Joosten et al., 2013 antisense AAGAAGTACCTTTCCGACGTGCAG β-actin sense TCCTCCCTGGAGAAGAGCTA Zhang et al., 2015 antisense CCAGACAGCACTGTGTTGGC

118

Experimental Studies: Chapter 2

Table II. List of genes and primers sequences used for quantitative RT-PCR in BALB/c mice

Gene Primer Sequence (5'-3') Reference CXCL-13 sense GAATGGCTGCCCCAAAACTGAA Zhang et al., 2015 antisense TCACTGGAGCTTGGGGAGTTGAA

GAPDH sense AACGGGAAGCTCACTGGCATG Flahou et al., 2012 antisense CTGCTTCACCACCTTCTTGATGTCA

HPRT1 sense GCCCCAAAATGGTTAAGGTTGCA Flahou et al., 2012 antisense TCAAGGGCATATCCAACAACAAAC

IL-1β sense GGCAGGTGGTATCGCTCATC Flahou et al., 2012 antisense CACCTTGGATTTGACTTCTA

IFN -γ sense CCATGAACGCTACACACTGCATC Flahou et al., 2012 antisense GAAGTAGAAAGAGACAATCTGG

IL-10 sense GGTTGCCAAGCCTTATCAGA Flahou et al., 2012 antisense GCTGCATTCTGAGGGTCTTC

IL-17 sense AGCTCCAGAGGCCCTCGGAC Flahou et al., 2012 antisense AGGACCAGGATCTCTTGCTG

ATP4b sense GGGGGTAACCTTGAGACCTGATG Zhang et al., 2015 antisense AAGAAGTACCTTTCCGACGTGCAG

β -actin sense TCCTCCCTGGAGAAGAGCTA Flahou et al., 2012 antisense CCAGACAGCACTGTGTTGGC

ASCT2 sense GCTACCGGAATCATAATTCATTGTTAACCTCC Bungard et al., 2004 antisense AGATCTGGAGTAGCGGTTACCAGCCAGAGAAAG

Statistical analysis For all analyses, SPSS23 (IBM, Armonk, New York, USA) was used. Differences in H. suis colonization and cytokine expression among groups were assessed by using one-way ANOVA analysis. A Bonferroni post-hoc test was used for comparisons between the different groups. Histological inflammation scores, ATPase and ASCT expression were compared by a Kruskal-Wallis analysis, followed by a Mann-Whitney U test. A level of probability of 0.05 was used as criterion for significance.

119

Experimental Studies: Chapter 2

Results

Colonization All animals in the negative control groups were negative for the presence of H. suis as determined by quantitative RT-PCR. Colonization rates at nine weeks after the first inoculation with the H. suis strains HS1, HsMmR08041a and HsMf505/1 in the Mongolian gerbil model and BALB/c mouse model are shown in figure 1A and figure 1B. Strains HsMmR08041a and HS1 were able to colonize both fundus and antrum of the BALB/c mice and Mongolian gerbils. Interestingly, strain HsMf505/1 could not be detected in the gerbil stomachs. This strain did colonize the stomach of the mice but colonization rates were lower compared to strains HsMmR08041a and HS1. In the mouse model, colonization was seen throughout the entire glandular stomach, both in antrum and fundus. In Mongolian gerbils, colonization levels were significantly higher in the antrum compared to the fundic region (P<0.01). At six months after the first inoculation, the three H. suis strains did not differ from each other in their capacity to colonize BALB/c mice (Figure 1C).

120

Experimental Studies: Chapter 2

A B

H. suis colonization in Mongolian gerbils 9w pi H. suis colonization in BALB/c mice 9w pi *** * 8 ** * 8 * ** 6 6

Log10 H. suis 4 Log10 bacteria/mg H. suis 4 bacteria/mg

2 2

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus 505/1 Antrum505/1 Fundus 505/1 Antrum505/1 Fundus R08041a Antrum R08041a Antrum Neg. con.Neg. Antrum con. Fundus R08041a Fundus Neg. con.Neg. Antrum con. Fundus R08041a Fundus c

H. suis colonization BALB/c mice 6m pi

Log10 H. suis 4 bacteria/mg

HS1 AntrumHS1 Fundus 505/1 Antrum505/1 Fundus Neg. con.Neg. Antrum con. FundusR08041aR08041a Antrum Fundus

Figure 1. Colonization rates nine weeks post infection with H. suis strains HS1, HsMmR08041a and HsMf505/1 in the Mongolian gerbil model (A) and in the BALB/c mice model (B). Colonization rates six months after infection with the H. suis strains HS1, HsMmR08041a and HsMf505/1 in the BALB/c mice model (C). The amount of bacteria colonizing the antrum and the fundic region of the stomach are illustrated as log (10) of H. suis copies/mg stomach. The individual animals are presented as triangles. Significant differences between the different groups are noted by * (P<0.05) and ** (P<0.01). H. suis strain HS1 was isolated from the gastric mucosa of a sow. H. suis strains HsMmR08041a and HsMf505/1 were isolated from the gastric mucosa of a rhesus monkey (Macaca mulatta) and a cynomolgus monkey (Macaca fascicularis), respectively. A negative control group (Neg. con.) was included.

121

Experimental Studies: Chapter 2

Histopathological evaluation of the gastric mucosa The stomachs of all negative control animals and the gerbils that were infected with strain HsMf505/1 showed very little infiltration of inflammatory cells. In gerbils infected with rhesus monkey strain HsMmR08041a and porcine strain HS1, the observed inflammation was characterized by a diffuse infiltration of T lymphocytes, as shown by immunohistochemical CD3 staining, and the formation of lymphoid follicles in the lamina propria in the antrum of the stomach. The presence of gastric lymphoid follicles seemed more pronounced in the gerbils infected with HsMmR08041a compared to the porcine strain HS1, although this was not statistically significant (P=0.171) (Figure 2). Immunohistochemical CD20 staining of the stomach of Mongolian gerbils infected with strains HS1 and HsMmR08041a showed the presence of B lymphocytes in the germinal centers of lymphoid follicles (Figure 3). In the fundic region of the stomach, very little infiltration of inflammatory cells was observed. In the forestomach-stomach transition zone, limited infiltration of lymphocytes was also observed.

Figure 2. Immunohistochemical CD3 staining of the antrum of a gerbil infected with primate- associated H. suis strain HsMmR08041a for nine weeks, showing infiltration of T-lymphocytes (brown) in large gastric lymphoid follicles with expanding germinal centers, lamina propria and submucosa (Original magnification 100x).

122

Experimental Studies: Chapter 2

Figure 3. Immunohistochemical CD20 staining of the antrum of a Mongolian gerbil infected with pig- associated H. suis strain HS1 at 9 weeks post inoculation, showing B lymphocytes (brown) in germinal centers of a lymphoid follicle (arrow) (Original magnification: 100x).

In the mouse model, diffuse infiltration of lymphocytes was seen throughout the entire glandular stomach, both in antrum and fundus for all strains. Neutrophil infiltration was moderate in the stomach mucosa in all infected mice and gerbils. In contrast to the gerbil model, no lymphoid follicles were observed at nine weeks and six months after infection in BALB/c mice. Overall gastric inflammation scores are presented in figure 3.

123

Experimental Studies: Chapter 2

9 weeks pi 9 weeks pi * 5 ** * ** * * * 4 * ** 4 ** 3 * * ** ** 3 ** ** ** 2 2 **

1 1

0 0

Inflammation scores ANTRUM scores Inflammation Inflammation scores FUNDUS scores Inflammation - - HS1 HS1 HS1 HS1 505/1 505/1 505/1 505/1 Neg conR08041a Neg conR08041a Neg conR08041a Neg conR08041a Gerbils Mice Gerbils Mice

BALB/c mice 6 months pi

4 ** ** ** ** 3 ** * * ** 2

1 Inflammation scores Inflammation 0 - HS1 HS1 505/1 505/1 Neg conR08041a Neg conR08041a ANTRUM FUNDUS

Figure 3. Overall gastric inflammation scores after experimental infection. Antral (a) and fundic (b) inflammation in BALB/c mice and Mongolian gerbils was scored using a visual analog scale similar to the Updated Sydney System but with some modifications. Both diffuse infiltration and the presence of lymphoid aggregates and lymphoid follicles were examined. Scoring: 0=normal, 1=mild, 2=moderate, 3=marked, 4=severe inflammation. Individual animals are depicted as triangles around the mean (lines). Statistical significant differences between the groups are indicated by * (P<0.05) and ** (P<0.01).

124

Experimental Studies: Chapter 2

Relative gene expression of cytokines and chemokines In the mouse model, a clear Th17 response was observed, as shown by increased expression levels of IL-17 mRNA (P<0.05) for all H. suis strains in the fundic region. Increased mRNA expression levels were observed for IL-4, but this was only statistically significant (P=0.043) for the fundic region of HsMf505/1 infected mice. An increased expression of the anti- inflammatory IL-10 was observed in the fundic region of infected BALB/c mice for all three H. suis strains (P<0.01). Although mRNA expression levels of IL-1β also seemed higher in the fundus of H. suis infected mice, this was not statistically significant. CXCL-13 expression was significantly (P<0.05) upregulated in the fundic region of all infected animals and in the antrum of HS1 infected animals. In the gerbil model, a clear increased expression of IL-17 mRNA levels was shown in the antrum (P<0.01) of infected animals. Increased expression levels of IL-1β, one of the important pro-inflammatory mediators of the innate immune system, were observed in the antrum of animals infected with HsMmR08041a (P<0.001) and HS1 (P<0.001). For INF-γ, a signature Th1 cytokine, an increased expression was observed in gerbils inoculated with HsMmR08041a (P<0.01) and HS1 (P<0.01) when compared to the non-infected control animals. In contrast, this was not the case in H. suis infected mice. Increased CXCL-13 mRNA expression levels were observed both in the antrum and fundic region for gerbils infected with HsMmR0841a and HS1, although this was only significant (P= 0.026) in the fundus of animals infected with strain HsMmR08041a. The relative gene expression levels of cytokines and chemokines in the stomach of BALB/c mice and Mongolian gerbils after nine weeks of infection, are presented in figures 4 and 6. The immune response was also investigated six months after infection in BALB/c mice. Interestingly, CXCL-13 was the only cytokine for which expression levels remained significantly upregulated in all infected animals, both in antrum and fundus, when compared to the negative control animals. mRNA expression levels of IL-17 seemed increased in the antrum of infected BALB/c mice, but this was not statistically significant (Figure 5).

125

Experimental Studies: Chapter 2

IL-17 IL-10

800 60 ** * 600 40 **

400 ** ** 20 **

200

Relative expression Relative expression

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

Neg controlNeg Antrum control Fundus HsMf505/1HsMf505/1 Antrum Fundus Neg controlNeg Antrum control Fundus HsMf505/1HsMf505/1 Antrum Fundus HsMmR08041aHsMmR08041a Antrum Fundus HsMmR08041aHsMmR08041a Antrum Fundus

CXCL-13 IL-4

50 50 * * 40 40 * 30 30 * 20 * 20

10 10

Relative expression Relative expression

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

IL-1 IFN-

15 50

40 10 30

20 5

Relative expression Relative expression Relative

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

126

Experimental Studies: Chapter 2

Figure 4. Relative gene expression of cytokines and chemokines in the stomach of challenged mice nine weeks post infection. Cytokine mRNA expression levels in the fundus and antrum of the stomach were examined by quantitative RT-PCR. mRNA expression levels of IL-17, CXCL-13, IL- 10, IL-4, IFN-γ and IL-1β are shown. Data are presented as the fold change in gene expression normalized to three reference genes and relative to the negative control group (Neg. con.). The results are shown as means with standard deviation (n=6). Significant differences in expression levels between infected groups and the negative control group are noted with an * (P<0.05) or ** (P<0.01). H. suis strain HS1 was isolated from the gastric mucosa of a sow. H. suis strains HsMmR08041a and HsMf505/1 were isolated from the gastric mucosa of a rhesus monkey (Macaca mulatta) and a cynomolgus monkey (Macaca fascicularis), respectively. No significant differences were observed between the different H. suis infected groups.

IL-17 CXCL-13 *** 400 50 ***

40 300 ***

30 200 20 *** 100

10 Relative expression Relative expression ** ** ** *** 0 0

HS1 AntrumHS1 Fundus HS1 Fundus 505/1 Antrum505/1 FundusHS1 Antrum R08041a R08041aAntrum Fundus HsMf505/1 Fundus Neg controlNeg Antrum control Fundus HsMf505/1 Antrum Neg controlNeg Antrum control Fundus HsMmR08041aHsMmR08041a Antrum Fundus

Figure 5. Relative gene expression of IL-17 and CXCL-13 in the stomach of challenged mice six months after infection. Cytokine mRNA expression levels in the fundus and antrum of the stomach were examined by quantitative RT-PCR. mRNA expression levels of IL-17 and CXCL-13 are shown. The results are presented as the fold change in gene expression normalized to three reference genes and relative to the negative control group (Neg. control). Data are shown as means with standard deviation (n=6). Significant differences in expression level between inoculated groups and the negative control group are noted with an ** (P<0.01) or *** (P<0.001). H. suis strain HS1 was isolated from the gastric mucosa of a sow. H. suis strains HsMmR08041a and HsMf505/1 were isolated from the gastric mucosa of a rhesus monkey (Macaca mulatta) and a cynomolgus monkey

127

Experimental Studies: Chapter 2

(Macaca fascicularis), respectively. No significant differences were observed between the different H. suis infected groups.

128

Experimental Studies: Chapter 2

IL-17 CXCL-13

60 40 ** *

30 40 ** 20 20

Relative expression Relative expression Relative

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

HsMf505/1HsMf505/1 Antrum Fundus HsMf505/1HsMf505/1 Antrum Fundus Neg controlNeg controlAntrum Fundus Neg controlNeg controlAntrum Fundus HsMmR08041aHsMmR08041a Antrum Fundus HsMmR08041aHsMmR08041a Antrum Fundus

IL-10 IFN-

40 150

30 100

20 ** 50

10 **

Relative expression Relative expression Relative

0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

IL-1

*** *** 20

10 Relative expression Relative

HS1 AntrumHS1 Fundus

HsMf505/1HsMf505/1 Antrum Fundus Neg controlNeg controlAntrum Fundus HsMmR08041aHsMmR08041a Antrum Fundus

129

Experimental Studies: Chapter 2

Figure 6. Relative gene expression of cytokines and chemokines in the stomach of challenged gerbils nine weeks post infection. Cytokine mRNA expression levels in the fundus and antrum of the stomach were examined by quantitative RT-PCR. mRNA expression levels of IL-17, CXCL-13, IL- 10, IFN-γ and IL-1β are shown. Data are presented as the fold change in gene expression normalized to three reference genes and relative to the negative control group (Neg. con.). Data are shown as means with standard deviation (n=6). Significant differences in expression levels between infected groups and the negative control group are noted with an * (P<0.05), ** (P<0.01) or *** (P<0.001). H. suis strain HS1 was isolated from the gastric mucosa of a sow. H. suis strains HsMmR08041a and HsMf505/1 were isolated from the gastric mucosa of a rhesus monkey (Macaca mulatta) and a cynomolgus monkey (Macaca fascicularis), respectively. No significant differences were observed between the different H. suis infected groups.

Changes in expression of epithelial cell-related factors in the stomach A decrease of ATP4a and ATP4b mRNA expression levels was observed in the stomach of H. suis-colonized mice and gerbils at nine weeks post inoculation, although this decrease was only statistically significant in the antrum of colonized gerbils (p<0.05) and in the fundic region of HS1 infected mice (P<0.05). In accordance with the H+/K+ ATPase staining of the stomach mucosa of the gerbils, the loss of parietal cells was only clear in the antrum and the transition zone between fundus and antrum, and not in the fundic region (Figure 7). The expression of ASC amino-acid transporter 2 (ASCT2) is depicted in figure 8. Compared to the control animals, a distinct decrease in ASCT2 mRNA expression levels was observed in H. suis infected BALB/c mice after six months of infection.

130

Experimental Studies: Chapter 2

Immunohistochemical ATPase staining

mRNA expression levels of H+/K+ ATPase

ATPase Mice - 9 weeks pi ATPase Gerbils - 9 weeks pi 4 4

3 3

2 2

* 1 1 * * *

Relative expression Relative expression 0 0

HS1 Fundus HS1 Antrum HS1 Fundus HS1 Antrum

HsMf505/1 Fundus HsMf505/1 Antrum HsMf505/1 Fundus HsMf505/1 Antrum Neg control Fundus Neg control Antrum Neg control Fundus Neg control Antrum HsMmR08041a Fundus HsMmR08041a Antrum HsMmR08041a Fundus HsMmR08041a Antrum

Figure 7. Immunohistochemical staining of the hydrogen potassium ATPase, responsible for gastric acid secretion by parietal cells. The figure on the left shows the ATPase staining of the proximal antrum of the stomach of an uninfected Mongolian gerbil. The figure on the right shows the ATPase staining of the proximal antrum of the stomach of a Mongolian gerbil, infected with primate- associated H. suis strain HsMmR08041a, showing abrupt parietal cell loss (Original magnification: 50x). mRNA expression levels of hydrogen potassium ATPase (H+/K+ ATPase) in the antrum and fundic region of the stomach of BALB/c mice and Mongolian gerbils nine weeks post infection.

131

Experimental Studies: Chapter 2 mRNA expression levels were examined by quantitative RT-PCR. The results are presented as the fold change in gene expression normalized to three reference genes and relative to the negative control group. Data is shown as means with standard deviation. Significant differences in expression levels between inoculated groups and negative control group are indicated by * (P <0.05). No significant differences were observed between the different H. suis infected groups.

ASCT2 Mice - 9 weeks pi ASCT2 Mice - 6 months pi 4 4

3 3

2 2 * *

1 1 ** ** ** **

Relative expression Relative expression 0 0

HS1 AntrumHS1 Fundus HS1 AntrumHS1 Fundus

Figure 8. mRNA expression levels of ASC amino-acid transporter 2 (ASCT2) in the antrum and fundic region of the stomach of BALB/c mice nine weeks and six months post infection. mRNA expression levels were determined by quantitative RT-PCR. The results are presented as the fold change in gene expression normalized to three reference genes and relative to the negative control group. Data is shown as means with standard deviation. Significant differences in expression levels between infected groups and negative control group are indicated by * P <0.05 or ** P <0.01. No significant differences were observed between the different H. suis infected groups.

132

Experimental Studies: Chapter 2

Discussion

In the present study, the porcine H. suis strain HS1 and rhesus monkey-associated H. suis strain HsMmR08041a were able to colonize the stomachs of both BALB/c mice and Mongolian gerbils. In contrast, the cynomolgus monkey-associated H. suis strain HsMf505/1 could be detected in the stomachs of BALB/c mice, both at nine weeks and six months pi, but not in those of gerbils. This might indicate that the infection was cleared within nine weeks or that strain HsMf505/1 was not at all capable of colonizing the gastric mucosa of Mongolian gerbils. Liang and colleagues (2015) have previously described the unsuccessful colonization of porcine H. suis strain HS5aKOL in Mongolian gerbils, which was probably due to longterm, suboptimal in vitro culture, which may have altered the expression of factors essential for colonization and adhesion. The present study, however, is the first to report the failure of a low-passage H. suis strain to colonize the stomach of Mongolian gerbils. Several studies describe the development of MALT lymphoma (-like lesions) after infection with cynomolgus monkey-associated H. suis in mice (O’Rourke et al., 2004; Nakamura et al., 2007; Yang et al., 2014). In contrast, when using pure in vitro isolated porcine H. suis cultures, MALT lymphoma-like lesions were observed in some gerbils, but not in mice (Flahou et al., 2010). Therefore, we hypothesized that primate-associated H. suis strains might be more virulent than porcine strains, at least in mouse models of human gastric disease. In the present study, however, no gastric lymphoid follicles were observed in stomachs of BALB/c mice after nine weeks and six months of infection with H. suis strains HS1, HsMmR08041a or HsMf505/1, indicating no differences between pig- and primate-associated H. suis strains in terms of immunopathogenesis. On the other hand, O’Rourke et al. (2004) detected gastric lymphoid follicles, from which MALT lymphoma develops, in BALB/c mice only from six months infection onwards. So possibly, differences between H. suis strains used in this study may appear after longer duration of infection. In accordance with the study by Flahou and colleagues (2010), we did observe the formation of gastric lymphoid follicles with expanding germinal centers in virtually all gerbils that were infected with strains HsMmR08041a and HS1. MALT lymphoma is characterized by an extensive proliferation of B-lymphocytes which may be dependent on Th2-type cytokines. Previous studies have shown that an experimental H. suis infection, with a strain obtained from pigs, in BALB/c mouse models evokes a Th17/Th2-polarized response (Flahou et al., 2012), which is confirmed by the results of the present study. Th2 cells are known to secrete IL-4, IL-5, IL-10 and IL-13, which mediate B-

133

Experimental Studies: Chapter 2 cell activation and antibody production (Murphy et al., 2012). In the fundic region of the stomach of mice, we detected an increased expression of IL-4, which was, however, only significant in animals infected with HsMf505/1. Expression levels of CXCL-13, a B lymphocyte chemoattractant that is mainly produced by follicular dendritic cells and that has been shown to play a role in Helicobacter-induced lymphoid follicle formation (Yamamoto et al., 2014), were also increased in the stomach of all infected mice. No differences were observed between animals infected with pig- and primate-associated H. suis strains. Previous studies have revealed a role for IFN-γ in the pathogenesis of gastric lymphoid follicle formation in mice experimentally infected with cynomolgus-associated H. suis (Mimura et al., 2011). The present study is the first to confirm these results when using pure in vitro isolated primate and porcine H. suis strains, as shown by the significant increase of IFN-γ mRNA expression levels in the antrum of infected Mongolian gerbils. In BALB/c mice on the other hand, mRNA expression levels of IFN-γ seemed increased, but this increase was not statistically significant and not associated with the formation of gastric lymphoid follicles. Gastric acid secretion is mediated by the gastric hydrogen potassium ATPase (H+/K+ ATPase), that functions as a proton pump in gastric acid-secreting parietal cells (Forte et al., 1989). Histopathological evaluation of the stomach mucosa of H. suis infected Mongolian gerbils revealed parietal cell loss at the transition zone between fundus and antrum in all H. suis infected gerbils. These observations were confirmed by quantitative RT-PCR. A clear downregulation of ATP4a and ATP4b mRNA expression levels was observed in the stomach of infected mice and gerbils at nine weeks post infection and no differences were observed between animals infected with primate- and pig-associated H. suis strains. This, along with the alterations in ASCT2 expression as described above, shows that infection with all three H. suis strains has a profound effect on the function and homeostasis of the gastric epithelium. Long term infection with different H. suis strains in BALB/c mice, showed that H. suis colonization persisted during at least six months. Colonization rates at six months pi were indeed similar to those at nine weeks pi, with no significant differences between the different H. suis strains used in this study (P>0.05). Interestingly, only CXCL-13 showed increased mRNA expression levels compared to the uninfected control mice at six months post inoculation, whereas expression levels of IL-17 were less pronounced compared to those at nine weeks post inoculation. Previous studies have shown a direct relation between IL-17 expression levels and protection against H. suis infection, so the attenuated IL-17 expression

134

Experimental Studies: Chapter 2 levels after six months of infection observed in the present study might contribute to the chronicity of the infection (Vermoote et al., 2012). In conclusion, the results of this comparative virulence study indicate that no substantial differences in virulence exist between in vitro cultured pig-associated, cynomolgus monkey- associated and rhesus monkey-associated H. suis strains in mouse models of gastric disease, in contrast to what may be expected based on previous studies performed by different research groups. Cynomolgus monkey-associated strain HsMf505/1 was not capable of colonizing the stomach of Mongolian gerbils, which have been suggested to be superior to mice for studying H. suis-host interactions. The present study also revealed that mainly the experimental host determines the outcome of the immune response against H. suis infection, rather than the original host where strains are isolated from. Future research should include comparative genomics/transcriptomics of the primate-associated H. suis strains, which may help to elucidate the underlying reasons why the cynomolgus monkey-associated strain HsMf505/1 was unable to colonize the gastric mucosa of Mongolian gerbils. In addition, it might be interesting to verify whether these primate-associated strains are able to colonize the stomach of pigs.

Acknowledgements

The authors thank Sofie De Bruyckere, Christian Puttevils, Delphine Ameye, Sarah Loomans and Astra Dhanijns for their excellent technical assistance.

135

Experimental Studies: Chapter 2

References

Baele M, Pasmans F, Flahou B, Chiers K, Ducatelle R, Haesebrouck F. 2009. Non- Helicobacter pylori helicobacters detected in the stomach of humans comprise several naturally occurring Helicobacter species in animals. FEMS Immunol Med Microbiol. 55:306-13. Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A, Mast J, Chiers K, Ducatelle R, Haesebrouck F. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. Int J Syst Evol Microbiol. 58:1350-8. Bosschem I, Bayry J, De Bruyne E, Van Deun K, Smet A, Vercauteren G, Ducatelle R, Haesebrouck F, Flahou B. 2015. Effect of Different Adjuvants on Protection and Side-Effects Induced by Helicobacter suis Whole-Cell Lysate Vaccination. PLoS One. 10:e0131363. Bungard C, McGivan J. 2004. Glutamine availability up-regulates expression of the amino acid transporter protein ASCT2 in HepG2 cells and stimulates the ASCT2 promoter. Biochem J. 382:27-32. Flahou B, De Baere T, Chiers K, Pasmans F, Haesebrouck F, Ducatelle R. 2010. Gastric infection with Kazachstania heterogenica influences the outcome of a Helicobacter suis infection in Mongolian gerbils. Helicobacter. 15:67-75. Flahou B, Deun KV, Pasmans F, Smet A, Volf J, Rychlik I, Ducatelle R, Haesebrouck F. 2012. The local immune response of mice after Helicobacter suis infection: strain differences and distinction with Helicobacter pylori. Vet Res. 43:75. Flahou B, Haesebrouck F, Pasmans F, D'Herde K, Driessen A, Van Deun K, Smet A, Duchateau L, Chiers K, Ducatelle R. 2010. Helicobacter suis causes severe gastric pathology in mouse and mongolian gerbil models of human gastric disease. PLoS One. 5:e14083. Forte JG, Hanzel DK, Urushidani T, Wolosin JM. 1989. Pumps and pathways for gastric HCl secretion. Ann N Y Acad Sci. 574:145-58. Greiner A, Knörr C, Qin Y, Sebald W, Schimpl A, Banchereau J, Müller-Hermelink HK. 1997. Low-grade B cell lymphomas of mucosa-associated lymphoid tissue (MALT- type) require CD40-mediated signaling and Th2-type cytokines for in vitro growth and differentiation. Am J Pathol. 150:1583-93.

136

Experimental Studies: Chapter 2

Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M, Meyns T, Decostere A, Ducatelle R. 2009. Gastric helicobacters in domestic animals and non-human primates and their significance for human health. Clin Microbiol Rev. 22:202-23. Joosten M, Blaecher C, Flahou B, Ducatelle R, Haesebrouck F, Smet A. 2013. Diversity in bacterium-host interactions within the species Helicobacter heilmannii sensu stricto. Vet Res. 44:65. Liang J, De Bruyne E, Ducatelle R, Smet A, Haesebrouck F, Flahou B. 2015. Purification of Helicobacter suis Strains From Biphasic Cultures by Single Colony Isolation: Influence on Strain Characteristics. Helicobacter. 20:206-16. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402-8. Mimura T, Yoshida M, Nishiumi S, Tanaka H, Nobutani K, Takenaka M, Suleiman YB, Yamamoto K, Ota H, Takahashi S, Matsui H, Nakamura M, Miki I, Azuma T. 2011. IFN-γ plays an essential role in the pathogenesis of gastric lymphoid follicles formation caused by Helicobacter suis infection. FEMS Immunol Med Microbiol. 63:25-34. Morgner A, Bayerdorffer E, Neubauer A, Stolte M. 2001. Helicobacter pylori associated gastric B cell MALT lymphoma: predictive factors for regression. Gut. 48:290-292. Murphy K, Travers P, Walport M, Janeway C. Janeway's immunobiology. Garland Science, New York. 2012. Nakamura M, Murayama SY, Serizawa H, Sekiya Y, Eguchi M, Takahashi S, Nishikawa K, Takahashi T, Matsumoto T, Yamada H, Hibi T, Tsuchimoto K, Matsui H. 2007. "Candidatus Helicobacter heilmannii" from a cynomolgus monkey induces gastric mucosa-associated lymphoid tissue lymphomas in C57BL/6 mice. Infect Immun. 75:1214-22. O'Rourke JL, Solnick JV, Neilan BA, Seidel K, Hayter R, Hansen LM, Lee A. 2004. Description of 'Candidatus Helicobacter heilmannii' based on DNA sequence analysis of 16S rRNA and urease genes. Int J Syst Evol Microbiol. 54:2203-11. O'Rourke JL, Dixon MF, Jack A, Enno A, Lee A. 2004. Gastric B-cell mucosa-associated lymphoid tissue (MALT) lymphoma in an animal model of 'Helicobacter heilmannii' infection. J Pathol. 203:896-903. Shimizu K, Kaira K, Tomizawa Y, Sunaga N, Kawashima O, Oriuchi N, Tominaga H, Nagamori S, Kanai Y, Yamada M, Oyama T and Takeyoshi I. 2014. ASC amino-acid

137

Experimental Studies: Chapter 2

transporter 2 (ASCT2) as a novel prognostic marker in non-small cell lung cancer. British Journal of Cancer. 110:2030-2039. Stolte M, Meining A. 2001. The updated Sydney system: classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 15:591-8. Vermoote M, Van Steendam K, Flahou B, Smet A, Pasmans F, Glibert P, Ducatelle R, Deforce D, Haesebrouck F. 2012. Immunization with the immunodominant Helicobacter suis urease subunit B induces partial protection against H. suis infection in a mouse model. Vet Res. 43:72. Wiedemann T, Loell E, Mueller S, Stoeckelhuber M, Stolte M, Haas R, Rieder G. 2009. Helicobacter pylori cag-Pathogenicity island-dependent early immunological response triggers later precancerous gastric changes in Mongolian gerbils. PLoS One. 4:e4754. Yamamoto K, Nishiumi S, Yang L, Klimatcheva E, Pandina T, Takahashi S, Matsui H, Nakamura M, Zauderer M, Yoshida M, Azuma T. 2014. Anti-CXCL13 antibody can inhibit the formation of gastric lymphoid follicles induced by Helicobacter infection. Mucosal Immunol. 7:1244-54. Yamasaki R, Yokota K, Okada H, Hayashi S, Mizuno M, Yoshino T, Hirai Y, Saitou D, Akagi T, Oguma K. 2004. Immune response in Helicobacter pylori-induced low- grade gastric-mucosa-associated lymphoid tissue (MALT)lymphoma. J Med Microbiol. 53:21-9. Yang L, Yamamoto K, Nishiumi S, Nakamura M, Matsui H, Takahashi S, Dohi T, Okada T, Kakimoto K, Hoshi N, Yoshida M, Azuma T. 2014. Interferon-γ-producing B cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection. Mucosal Immunol. 8:279-95. Zhang G, Ducatelle R, De Bruyne E, Joosten M, Bosschem I, Smet A, Haesebrouck F, Flahou B. 2015. Role of γ-glutamyltranspeptidase in the pathogenesis of Helicobacter suis and Helicobacter pylori infections. Vet Res. 46:31.

138

Experimental Studies: Chapter 3

Chapter 3

Effect of different adjuvants on protection and side- effects induced by Helicobacter suis whole-cell lysate

vaccination

1 2,3,4,5 1 1 1 Iris Bosschem , Jagadeesh Bayry , Ellen De Bruyne , Kim Van Deun , Annemieke Smet ,

Griet Vercauteren1, Richard Ducatelle1, Freddy Haesebrouck*,1 and Bram Flahou*,1

1Department of Pathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University, Merelbeke, Belgium

2Institut National de la Santé et de la Recherche Médicale, Unité 1138, Paris, France

3Centre de Recherche des Cordeliers, Equipe-Immunopathology and therapeutic immunointervention, Paris, France

4Sorbonne Universités, UPMC Univ Paris 06, UMR_S 1138, Paris, France

5Université Paris Descartes, Sorbonne Paris Cité, UMR_S 1138, Paris, France

*Freddy Haesebrouck and Bram Flahou share senior authorship

Adapted from: PlosOne (2015); 10:e0131364

139

Experimental Studies: Chapter 3

Abstract

Helicobacter suis (H. suis) is a widespread porcine gastric pathogen, which is also of zoonotic importance. The first goal of this study was to investigate the efficacy of several vaccine adjuvants (CpG-DNA, Curdlan, Freund’s Complete and Incomplete, Cholera toxin), administered either subcutaneously or intranasally along with H. suis whole-cell lysate, to protect against subsequent H. suis challenge in a BALB/c infection model. Subcutaneous immunization with Freund’s complete adjuvant (FA)/lysate and intranasal immunization with Cholera toxin (CT)/lysate were shown to be the best options for vaccination against H. suis, as determined by the amount of colonizing H. suis bacteria in the stomach, although adverse effects such as post-immunization gastritis/pseudo-pyloric metaplasia and increased mortality were observed, respectively. Therefore, we decided to test alternative strategies, including sublingual vaccine administration, to reduce the unwanted side-effects. A CCR4 antagonist that transiently inhibits the migration of regulatory T-cells was also included as a new adjuvant in this second study. Results confirmed that immunization with CT (intranasally or sublingually) is among the most effective vaccination protocols, but increased mortality was still observed. In the groups immunized subcutaneously with FA/lysate and CCR4 antagonist/lysate, a significant protection was observed. Compared to the FA/lysate immunized group, gastric pseudo-pyloric metaplasia was less severe or even absent in the CCR4 antagonist/lysate immunized group. In general, an inverse correlation was observed between IFN-γ, IL-4, IL-17, KC, MIP-2 and LIX mRNA expression and H. suis colonization density, whereas lower IL-10 expression levels were observed in partially protected animals.

140

Experimental Studies: Chapter 3

Introduction

Helicobacter suis (H. suis) is a Gram-negative, spiral-shaped bacterium and a worldwide spread pathogen colonizing the stomach of up to 90% of slaughter pigs. Even higher colonization rates are observed in adult boars and sows (Hellemans et al., 2007). Infection with H. suis causes gastritis and a decrease in daily weight gain (De Bruyne et al., 2012). Although not always straightforward, several studies attribute a role to this pathogen in the development of gastric ulcer disease in pigs (De Bruyne et al., 2012). Economic losses due to the stomach ulcerations are believed to be substantial (Haesebrouck et al., 2009). H. suis is also of zoonotic importance. Infection in human patients has been associated with gastritis, peptic ulceration and mucosa-associated lymphoid tissue lymphoma (Haesebrouck et al., 2009). Vaccination is considered to be a potentially valuable approach to control gastric Helicobacter infections and related disease development (Blanchard and Nedrud et al., 2010). Besides the use of the appropriate antigen or combination of antigens, the choice of the immunization route and adjuvant play an important role in the outcome of vaccination studies. The use of an appropriate adjuvant has several benefits. Among other things, it reinforces the immune response, providing better and longer lasting protection against the pathogen. An adjuvant also allows the dose and dosing schedule of the antigen(s) to be decreased and modulated, reducing the cost and logistical complexity of administering vaccines (Davies et al., 2009). Most Helicobacter vaccination strategies have been designed to generate an optimal immune response at the mucosal surface, in line with strategies applied for other mucosal bacterial infections (Blanchard and Nedrud et al., 2010). As adjuvants for mucosal immunization, Cholera Toxin (CT) and the heat-labile toxin of enterotoxigenic Escherichia coli (LT) have been the most widely used in mice, although they are known to have side- effects in humans, such as the development of diarrhoea, even at low doses (Corthésy- Theulaz et al., 1995; Guy et al., 1998; Guy et al., 1999; Banerjee et al., 2002; Garhart et al., 2002; Nyström et al., 2006; Sutton et al., 2007; Svennerholm et al., 2007). Several other adjuvants have also been used in H. pylori vaccination studies. These include linear polysaccharides such as chitosan (Xie et al., 2007) and immunostimulatory CpG oligonucleotides (Jiang et al., 2003; Raghavan et al., 2003). Different vaccination protocols against H. pylori have already been tested in different animal models. They usually resulted in a reduction in the number of bacteria colonizing the stomach, but few strategies conferred protection in terms of sterilizing immunity (Anderl et al., 2014).

141

Experimental Studies: Chapter 3

In a previous H. suis vaccination study in mice, prophylactic intranasal immunization with CT adjuvanted H. suis whole-cell lysate resulted in a minority of animals being H. suis negative, as shown by conventional PCR (Flahou et al., 2009). However, increased mortality rates were observed in these vaccinated and challenged animals. This side-effect has not been thoroughly investigated yet. In addition to increased mortality rates, intranasal vaccination with a CT adjuvanted whole-cell lysate vaccine, induced post-vaccination gastritis as another major side-effect. This has also been described in H. pylori vaccination studies and its role in protection remains largely unclear (Vermoote et al., 2013). Besides CT adjuvanted vaccines, a saponin-based adjuvanted H. suis whole-cell lysate has been tested in mice. This vaccine formulation was administered subcutaneously and although it induced less severe adverse effects, its protective efficacy was shown to be inferior to CT-based vaccine formulations. Recent studies describe the adjuvant activity of small molecule CC chemokine receptor 4 (CCR4) antagonists (Bayry et al., 2008; Bayry et al., 2014). CCR4 is expressed on regulatory T-cells (Tregs) and Th2 cells and regulates the migration of these T cell subsets in response to MDC (macrophage derived chemokine, CCL22) and TARC (thymus and activation-regulated chemokine, CCL17) (Bonecchi et al., 1998; Sather et al., 2007). CD4+ Tregs express high levels of CD25 (IL-2Rα) and actively control or suppress the function of both innate and adaptive immune cells (Anderl et al., 2014). One of the most important cytokines secreted by these Tregs is the anti-inflammatory interleukin-10 (IL-10) (André et al., 2009). Therefore, IL-10-producing Tregs play a role in suppressing inflammation-related pathological changes. This mechanism is, however, most likely also involved in persistence of H. suis infection in its hosts due to suppression of immune responses (Flahou et al., 2009; Vermoote et al., 2013). CCR4 antagonists have been described to amplify cellular and humoral immune responses in vivo in experimental models when injected in combination with Mycobacterium or Plasmodium yoelii vaccine antigens (Bayry et al., 2008; Davies et al., 2009). In addition, CCR4 antagonists induced antigen-specific CD8+ T-cells and tumor immunity against self- antigens (Pere et al., 2011). Thus far, this promising adjuvant has not been tested in vaccination and challenge studies involving pathogens. The CCR4 antagonist AF- 399/42018025 used in this study is a small chemical molecule with a molecular weight of 565.93. It contains six 5 or 6 membered aromatic rings and 3 nitrogen, sulfur, and oxygen atoms. The chemical name of the molecule is 4-(1-benzofuran-2-ylcarbonyl)-1-{5-[4- chlorobenzyl)sulfanyl]-1,3,4-thiadiazol-2-yl}-3-hydroxy-5-(2-thienyl)-1,5-dihydro-2H-pyrrol- 2-one (Davies et al., 2009; Figure 1).

142

Experimental Studies: Chapter 3

Figure 1. The chemical structure of the CCR4 antagonist. The CCR4 antagonist AF-399/42018025 is a small chemical molecule with a molecular weight of 565.93. It contains five 5 or 6 membered aromatic rings and 3 nitrogen, sulfur, and oxygen atoms. The chemical name of the molecule is 4-(1- benzofuran-2-ylcarbonyl)-1-{5-[4-chlorobenzyl)sulfanyl]-1,3,4-thiadiazol-2-yl}-3-hydroxy-5-(2- thienyl)-1,5-dihydro-2H-pyrrol-2-one (Davies et al., 2009).

The purpose of the first study was (1) to explore the efficacy of several established vaccine adjuvants (CpG-DNA, Curdlan, Freund’s complete (FA), Freund’s incomplete (IFA) and CT) administered subcutaneously or intranasally along with H. suis lysate to protect against H. suis challenge in mice and (2) to assess the adverse effects associated with these vaccination protocols. Since substantial side-effects were observed in all vaccination strategies, a second study was performed, aiming at reducing these unwanted side-effects. Administered vaccine volumes as well as routes of administration were modified and a new adjuvant, a CCR4- antagonist, was included.

143

Experimental Studies: Chapter 3

Materials and Methods

Animals In a first study, a total of 96 seven-week-old female Helicobacter specific pathogen-free BALB/c mice were purchased from an authorized breeder (HARLAN, Horst, The Netherlands). The animals were housed on autoclaved wood shavings in filter top cages. They were fed an autoclaved commercial diet (TEKLAD 2018 S, HARLAN). In a second study, a total of 66 seven-week-old female Helicobacter spp.-free BALB/c mice were used. All animal experiments were approved by the Ethics Committee of the Faculty of Veterinary Medicine, Ghent University (EC2010/043 and EC2013/024). The animals were monitored several times a day during the whole experiment. When the animals were visibly less active, lost weight or showed symptoms of illness, the weight of the animal was compared with the other animals of the group. When a decrease of 20% of the body weight was observed, the animal was euthanized.

Antigens for immunization H. suis strain HS5bLP, isolated from the gastric mucosa of a sow (Baele et al., 2008), was grown on Brucella agar (Oxoid, Basingstoke, UK) supplemented with 20% fetal calf serum, 5 mg amphotericin B/l (Fungizone; Bristol-Myers Squibb, Epernon, France), Campylobacter selective supplement (Skirrow, Oxoid; containing 10 mg/l vancomycin, 5 mg/l trimethoprim lactate and 2500 U/l polymyxin B) and Vitox supplement (Oxoid). In addition, the pH of the agar was adjusted to 5 by adding HCl to a final concentration of approximately 0.05%. Brucella broth (Oxoid) with a pH of 5 was added on top of the agar to obtain biphasic culture conditions. After 3 days of incubation at 37°C under microaerobic conditions (85% N2, 10%

CO2, 5% O2), the Brucella broth, containing the bacteria, was harvested (Flahou et al., 2009). Bacteria were washed, concentrated by centrifugation (5000g, 10 min, 4°C) and suspended in phosphate buffered saline (PBS). The bacterial suspension was sonicated 8 times for 30 seconds, with a frequency of 20 kHz (Sonicator ultrasonic processor XL 2015; MISONIX, Farmingdale, USA), resulting in lysis of the bacteria (Flahou et al., 2009). After centrifugation (13000g, 10 min, 4°C), the supernatant fluid was collected and stored at -70°C until further use. The protein concentration of the sonicate was determined using the Lowry assay (Flahou et al., 2009).

144

Experimental Studies: Chapter 3

Preparation of the challenge material

For the challenge of the mice, H. suis strain HS5bLP was cultured as described above. The final concentration was determined by counting the bacteria in an improved Neubauer counting chamber.

Immunization/challenge study design In the first study, the mice were divided into 10 groups (Table I) and in the second study, 11 groups of mice were used (Table II). In both studies, immunizations were performed under light isoflurane anaesthesia (IsoFlo; Abbott, Il, USA) on days 7, 14 and 35 after arrival. Appropriate controls were included consisting of sham-immunized mice that were either challenged (positive controls) or not (negative controls) (see Tables I and II). For sham- immunization, Hank’s Balanced Salt Solution (HBSS; Invitrogen, Paisley, England) was used. Several adjuvants were used, inducing different immune responses. Curdlan is known to elicit a predominant Th17 response (Higashi et al., 2010). CpG-DNA and Freund’s complete are known to elicit a predominant Th1 response, whereas Freund’s incomplete and Cholera toxin elicit a predominant Th2 response (Cox et al., 1997). In the first study, subcutaneous vaccination was done by mixing 100 µg of H. suis sonicate (in a volume of 50 µl) with an equal volume of FA (Sigma-Aldrich, St. Louis, MO, USA), IFA (Sigma-Aldrich, St. Louis, MO, USA) or 200 µg Curdlan (Sigma-Aldrich, St. Louis, MO, USA). This mixture was injected at the lower back of the animals. For intranasal vaccination, a total volume of 15 µl was used, containing 100 µg of H. suis sonicate mixed with 5 µg CT (Sigma-Aldrich, St. Louis, MO, USA), 20 µg CpG-DNA (Hycult, biotech, The Netherlands) or 200 µg Curdlan (Sigma-Aldrich, St. Louis, MO, USA). The mixture was then applied on the external nares of the mice. In the second study, subcutaneous vaccination was done by mixing 100 µg of H. suis sonicate with 1.5 µg CCR4 antagonist or 50 µl FA. For sublingual and intranasal vaccination, a total volume of 7 µl was used, containing 100 µg of H. suis sonicate mixed with 5 µg CT or 1.5 µg CCR4 antagonist. Sublingual vaccination was performed by stretching the mouth of the mice open and applying the vaccine under the tongue using a micropipette. On day 56 of both studies, the mice were intragastrically inoculated with 0.3 ml of the challenge material, containing approximately 2 x 108 viable H. suis bacteria/ml, using a ball-

145

Experimental Studies: Chapter 3 tipped gavage needle. The mice were held in an upright position until they regained consciousness, to minimize the risk of reflux. In both studies, all animals were euthanized 3 weeks after challenge by cervical dislocation under deep isoflurane anaesthesia (IsoFlo; Abbott, Il, USA). The stomachs were removed and preserved in RNAlater (Ambion, Austin, TX, USA) at -70°C until DNA and RNA extraction. A longitudinal strip of tissue taken along the curvatura major of the stomach was fixed in phosphate buffered formaline (4%) for histopathological analyses. For DNA and RNA isolation, the stomachs were homogenized in 1 ml Tri-reagent (MRC, Brunschwig Chemie, Amsterdam, The Netherlands) using a MagnaLyser (Roche Applied Science, Mannheim, Germany). The interphase and organic phase were kept at -20°C for subsequent DNA extraction according to the instructions of the manufacturer. Meanwhile, total RNA was extracted from the upper aqueous phase using the RNeasy mini kit (Qiagen, Venlo, The Netherlands).

146

Experimental Studies: Chapter 3

Table I: Experimental set-up Study 1

Total volume Number of Immunization1 Administration route2 Adjuvant/mouse3 administered4 Challenged5 animals6 1 Neg. Control IN / 15 µl No 6 SC / 100 µl No 6 2 FA SC 50 µl 100 µl Yes 12 3 IFA SC 50 µl 100 µl Yes 12 4 Curdlan SC 200 µg 100 µl Yes 12 5 CT IN 5 µg 15 µl Yes 12 6 CpG-DNA IN 20 µg 15 µl Yes 12 7 Curdlan IN 200 µg 15 µl Yes 12 8 Pos. Control IN / 15 µl Yes 6 SC / 100 µl Yes 6

Shown is the 1immunization protocol, 2the administration route of the vaccine, 3the amount of adjuvant used per mouse, 4the volume of the vaccine, 5whether the animals were challenged with H. suis or not and 6the number of animals in each group. (FA: Freund’s complete, IFA: Freund’s incomplete, CT: Cholera toxin, IN: intranasally, SC: subcutaneously, Pos. control.: sham-immunized/challenged, Neg. control: sham-immunized/not challenged).

147

Experimental Studies: Chapter 3

Table II: Experimental set up Study 2

Total volume

Immunization1 Administration route2 Adjuvant/mouse3 administered4 Challenged5 Number of animals6 1 Neg. Control IN / 7 µl No 6 2 HBSS/CCR4 SC 1.5 µg 100 µl Yes 6 3 HBSS/CCR4 IN 1.5 µg 7 µl Yes 6 4 HBSS/CCR4 SL 1.5 µg 7 µl Yes 6 5 CT/lysate IN 5 µg 7 µl Yes 6 6 CT/lysate SL 5 µg 7 µl Yes 6 7 FA/lysate SC 50 µl 100 µl Yes 6 8 CCR4/lysate IN 1.5 µg 7 µl Yes 6 9 CCR4/lysate SL 1.5 µg 7 µl Yes 6 10 CCR4/lysate SC 1.5 µg 100 µl Yes 6 11 Pos. Control IN / 7 µl Yes 6

Shown is the 1immunization protocol, 2the administration route of the vaccine, 3the amount of adjuvant used per mouse, 4the volume of the vaccine, 5whether the animals were challenged with H. suis or not and 6the number of animals in each group. (HBSS: Hank’s balanced salt solution, CCR4: CC chemokine receptor 4 antagonist, CT: Cholera toxin, FA: Freund’s complete, IN: intranasally, SC: subcutaneously, SL: sublingually, Neg. control: sham-immunized/not challenged, Pos. control: sham-immunized/challenged).

148

Experimental Studies: Chapter 3

Quantitative Real-Time PCR for the quantification of the bacteria Quantitative Real-Time PCR (RT-PCR) was performed using the C1000 Thermal cycler (CFX96 Real-Time System, Bio-Rad, Hercules, CA, USA). Each sample contained 5 µl of iQ SYBR Green Supermix (Bio-Rad), 0.25 µl of each primer, 3.5 µl of distilled water and 1 µl of DNA. For enumeration of colonizing H. suis bacteria in the first study, a 218 bp fragment of the ureB gene of H. suis was amplified using the following primers: sense primer: 5’-TTA CCA AAA ACA CCG AAG CC-3’, antisense primer: 5’-CCA AGT GCG GGT AAT CAC TT-3’. A 1146 bp PCR fragment of the ureB gene served as an external standard (sense primer: 5’- CGG GAT TGA TAC CCA CAT TC-3’; antisense primer: 5’- ATG CCG TTT TCA TAA GCC AC-3’) (Flahou et al., 2012). For enumeration of colonizing bacteria in the second study, a fragment of the ureA gene of H. suis was amplified using the following primers: sense primer BF_HsuisF1: 5′-AAA ACA MAG GCG ATC GCC CTG TA-3′ and anti-sense primer BF_HsuisR1: 5′-TTT CTT CGC CAG GTT CAA AGC G-3′. For generating the standard, part of the ureAB gene cluster (1236 bp) from H. suis strain HS5 was amplified using primers U430F and U1735R, as described previously (O’Rourke et al., 2004). The copy number concentration was calculated based on the length of the amplicon and the mass concentration. The standard consisted of 10-fold dilutions starting at 107 PCR amplicons for each 10 µl of reaction mixture. Data analysis was done using the Bio-Rad CFX Manager Version 3.0 software (Bio-Rad).

Quantitative Real-Time PCR for the analysis of cytokine and chemokine expression Messenger RNA expression levels in stomach tissue were determined for the following genes: IL-17, IL-4, IFN-γ, keratinocyte chemoattractant (KC or CXCL1), LPS-induced CXC chemokine (LIX), macrophage inflammatory protein 2 (MIP-2 or CXCL2) and IL-10. For the RT-PCR reaction, a C1000 Thermal cycler (CFX96 Real-Time System, Bio-RAD, Hercules, CA, USA) was used. All reactions were performed in a final volume of 10 µl containing 5 pmole of the sense and 5 pmole of the antisense primers, 5 µl iQ SYBR mix (Bio-Rad) and 1 µl cDNA. The reaction protocol consisted of an initial activation phase at 95°C for 15 minutes followed by 40 cycles of 95°C for 20 seconds, 60°C for 30 seconds and 73°C for 30 seconds. A melting curve was included by increasing the temperature with 0.5°C every 5 seconds starting from 65°C until 95°C. The reference genes H2afz, PPIA and HPRT were shown to have a stable expression in all samples tested (data not shown) and were included as references. The sequences of all used primers are summarized in Table III. The threshold cycle values (Ct) were first normalized to the geometric means of the reference genes and the

149

Experimental Studies: Chapter 3 normalized mRNA levels were calculated according to 2(-∆∆Ct) method for each individual animal (Livak and Schmittgen, 2001). Table III: List of genes and sequences of the primers used for RT-PCR gene expression analysis (Flahou et al., 2012).

Gene Primer Primer Sequence

IFN-γ sense 5'-GCG TCA TTG AAT CAC ACC TG-3'

antisense 5'-TGA GCT CAT TGA ATG CTT GG-3'

IL -4 sense 5'-ACT CTT TCG GGC TTT TCG AT-3'

antisense 5'-AAA AAT TCA TAA GTT AAA GCA TGG TG-3'

IL -10 sense 5'-ATC GAT TTC TCC CCT GTG AA-3'

antisense 5'-CAC ACT GCA GGT GTT TTA GCT CC-3'

IL -17 sense 5'-TTT AAC TCC CTT GGC GCA AAA-3'

antisense 5'-CTT TCC CTC CGC ATT GAC AC-3'

KC sense 5'-GCT GGG ATT CAC CTC AAG AA-3'

antisense 5'-TCT CCG TTA CTT GGG GAC AC-3'

MIP -2 sense 5'-AAA GTT TGC CTT GAC CCT GA-3'

antisense 5'-TCC AGG TCA GTT AGC CTT GC-3'

LIX sense 5'-CCC TGC AGG TCC ACA GTG CC-3'

antisense 5'-TGG CCG TTC TTT CCA CTG CGA-3'

H2afz sense 5’-CGT ATC ACC CCT CGT CAC TT-3’

antisense 5’-TCA GCG ATT TGT GGA TGT GT-3’

PPIA sense 5’-AGC ATA CAG GTC CTG GCA TC-3’

antisense 5’-TTC ACC TTC CCA AAG ACC AC-3’

HPRT sense 5’-CAG GCC AGA CTT TGT TGG AT-3’

antisense 5’-TTG CGC TCA TCT TAG GCT TT-3’

150

Experimental Studies: Chapter 3

Histopathological evaluation of the gastric wall Samples of the gastric wall were formalin-fixed, paraffin wax embedded, cut at 5 µm and stained with hematoxylin and eosin according to standardized protocols. Inflammation (infiltration of granulocytes as well as mononuclear cells) was scored separately for the mucosa and submucosa, using a scoring system adapted from the human updated Sydney System (Stolte et al., 2001). Scoring of inflammatory cell infiltration was performed as follows: 0=normal, 1=multifocal mild, 2=diffuse mild or multifocal moderate, 3=diffuse mild and (multi)focal moderate, 4=diffuse moderate or multifocal severe, 5=diffuse moderate and (multi)focal severe, 6=diffuse severe. Numbers of globular leukocytes were scored as follows: 0=no globular leukocytes, 1=mild increase in globular leukocyte numbers, 2=moderate increase in globular leukocyte numbers, 3=severe increase in globular leukocyte numbers. In the second study, the presence of lymphocyte and neutrophil infiltration in the mucosa of the fundus was scored separately as follows: 0= normal, 1=mild, 2=moderate, 3=severe. In addition, Periodic acid-Schiff (PAS) staining was performed to evaluate the presence of pseudo-pyloric metaplasia of the fundus.

Statistical analysis For all analyses, SPSS22 (IBM, USA) was used. Differences in H. suis colonization and cytokine expression among groups were assessed by using one-way ANOVA analysis. A Bonferroni post-hoc test was used for comparisons between the different groups. Histological inflammation scores were compared by a Kruskal-Wallis analysis, followed by a Mann- Whitney U test. For correlations between different variables, Spearman’s rho coefficient (ρ) was calculated. A level of probability of 0.05 was used as criterion for significance.

151

Experimental Studies: Chapter 3

Results

Cholera toxin, Freunds’ complete adjuvant and CCR4 antagonists confer the highest level of protection against colonizing H. suis bacteria In the first study, all immunization strategies with various adjuvants and routes of immunization (i.e. subcutaneous immunization with FA, IFA, Curdlan or intranasal immunization with CT, CpG and Curdlan) resulted in the reduction of bacterial burden following H. suis challenge, when compared to the sham-immunized/challenged animals (Figure 2). However, striking differences were observed among various adjuvants in their capacity to decrease the amount of colonizing H. suis bacteria. Only subcutaneous FA/lysate (p<0.05) administration and intranasal CT/lysate (p<0.05) administration induced significant protection. The results obtained with CT/lysate were also confirmed in the second study, wherein the intranasal as well as sublingual route of immunization conferred the highest protection against colonization of H. suis in the stomach (P<0.001) (Figure 3). In addition, animals subcutaneously immunized with FA/lysate and CCR4 antagonist/lysate showed significantly lower H. suis colonization levels after experimental challenge (P<0.01). In contrast, mucosal immunization with a CCR4 antagonist (both intranasally and sublingually) and lysate showed no significant decrease in bacteria colonizing the stomach. Colonization levels in animals that were administrated the CCR4 antagonist in the absence of lysate and that were subsequently challenged, were similar to those in the sham-immunized and challenged positive control animals.

152

Experimental Studies: Chapter 3

6 * *

Log10 H. suis 4 bacteria/mg

FA/lysate/SCCT/lysate/IN IFA/lysate/SC CpG/lysate/INCurd/lysate/IN HBSS SC+IN inf Curd/lysate/SC HBSS SC+IN con

Figure 2. The protective efficacy of different adjuvants on the amount of colonizing H. suis bacteria, 3 weeks after challenge, in study 1. Subcutaneous immunization (SC) was done by mixing H. suis sonicate with Freund’s complete (FA), Freund’s incomplete (IFA) or Curdlan (Curd) and injecting this mixture at the lower back of the mice. Intranasal immunization (IN) was done by mixing H. suis sonicate with Cholera toxin (CT), CpG-DNA (CpG) or Curdlan (Curd) and applying this mixture on the external nares of the mice. Animals in the control groups were sham-immunized with Hank’s Balanced Salt Solution (HBSS). The bacterial load is illustrated as log(10) of H. suis copies/mg stomach tissue. Individual mice are illustrated as dots. Significant differences between immunized/challenged and non-immunized/challenged animals are noted by * (p<0.05). (con: uninfected, inf: infected).

153

Experimental Studies: Chapter 3

6 **

Log10 H. suis 4 bacteria/mg *** ***

Neg. conPos. con CT/lysate/INCT/lysate/SLFA/lysate/SC CCR4/HBSS/INCCR4/HBSS/SL CCR4/lysate/IN CCR4/HBSS/SC CCR4/lysate/SLCCR4/lysate/SC

Figure 3. The protective efficacy of the different immunization protocols on the amount of colonizing H. suis bacteria, 3 weeks after challenge, in study 2. Subcutaneous immunization (SC) was done by mixing H. suis sonicate with Freund’s complete (FA) or the CCR4 antagonist (CCR4) and injecting this mixture at the lower back of the mice. Intranasal immunization (IN) was done by mixing H. suis sonicate with Cholera toxin (CT) or the CCR4 antagonist (CCR4) and applying this mixture on the external nares of the mice. Sublingual immunizations (SL) were done by mixing H. suis sonicate with Cholera toxin (CT) or the CCR4-antagonist (CCR4). Animals in the control groups were sham-immunized with Hank’s Balanced Salt Solution (HBSS). The amount of bacteria colonizing the stomach of the mice are illustrated as log(10) of H. suis copies/mg stomach. The individual animals are presented as dots. Significant differences between the immunized and challenged groups and the positive control group are noted by ** (p<0.01) and *** (p<0.001). (neg. con.: sham-immunized/not challenged, pos. con.: sham-immunized/challenged).

154

Experimental Studies: Chapter 3

Mice immunized with a CCR4 antagonist display minimal pseudo-pyloric metaplasia as compared to the Freund’s complete adjuvant group upon challenge with H. suis In both studies, a number of animals died in each group immunized with CT (both intranasally and sublingually), within 48 hours after challenge with H. suis. The most likely cause was an immunization/challenge related pneumonia, for histopathological evaluation showed the presence of oedema in the interstitial space of the lungs of these mice. In the first study, two mice from the Curdlan/intranasally vaccinated group died before challenge, and one mouse from the CpG/intranasally vaccinated group died of an unknown cause at week eleven following challenge.

In both studies, all negative control mice showed normal histomorphology with very little to no inflammatory cell infiltration in the gastric mucosa (Figure 4). All positive control groups showed moderate to severe inflammation.

Figure 4. H&E and PAS staining of a normal fundus. H&E (A) and PAS staining (B) of a normal fundus of an animal from the negative control group (original magnification: 100x).

In the first study, mice immunized subcutaneously with IFA/lysate, FA/lysate and Curdlan/lysate clearly showed a stronger infiltration of neutrophils in the fundic mucosa and submucosa (p<0.05) (Table IV) as compared to animals from the intranasally immunized/challenged groups. Detection of neutrophils was restricted to the mucosa of the subcutaneously immunized groups. In addition, all immunized and challenged groups showed moderate lymphocyte infiltration, which was most pronounced in the group immunized with CT/lysate (Table IV).

Results from the second study revealed that, compared to the positive control group, mice that received CT/lysate by the sublingual route showed significantly increased neutrophil

155

Experimental Studies: Chapter 3 infiltration in the fundus (p<0.01) upon challenge with H. suis. In addition, compared to the positive control groups, lymphocyte infiltration was significantly increased in all the immunized and challenged groups except for the groups immunized with the CCR4 antagonist/lysate by sublingual and intranasal routes (Table V).

156

Experimental Studies: Chapter 3

Table IV: Histopathological scoring of inflammation Study 1

Pseudo-pyloric metaplasia Neutrophil infiltration Mononuclear cell infiltration HBSS/sc/con 0 (0-0) 0 (0-1) 0 (0-0.5) HBSS/in/con 0 (0-0) 0 (0-0) 0 (0-0.5) HBSS/sc/inf 0 (0-0) 1 (0.5-1) 0.5 (0.5-1.5) HBSS/in/inf 0 (0-0) 1 (0.5-2.5) 1.5 (0.5-1.5) FA/lysate/SC 2.5 (0-3)* 1.5 (0.5-2)* 0.5 (0.5-1) IFA/lysate/SC 3 (3-3)* 1.5 (05-2)* 0.5 (0-0.5) Curd/lysate/SC 3 (3-3)* 1.5 (0.5-2)* 0.5 (0.5-1) CT/lysate/IN 0 (0-0) 0.5 (0-0.5) 0.5 (0.5-1) CpG/lysate/IN 0 (0-0) 0 (0-1) 0.5 (0.5-1) Curd/lysate/IN 0 (0-0) 0 (0-0.5) 0.5 (0.5-0.5)

Shown are the median scores (min-max) of pseudo-pyloric metaplasia of the fundus, infiltration of the mucosa of the fundus with neutrophils and mononuclear cells 3 weeks after challenge of the vaccinated mice. Scoring: 0=normal, 1= mild, 2= moderate, 3= severe. Significant differences between the positive control group and the immunized and challenged groups are noted by * (p<0.05). (HBSS: Hank’s balanced salt solution FA: Freund’s complete, IFA: Freund’s incomplete, CT: Cholera toxin, Curd: Curdlan, CpG: CpG-DNA IN: intranasally, SC: subcutaneously, con: uninfected group, inf: infected group).

157

Experimental Studies: Chapter 3

Table V: Histopathological scoring of inflammation Study 2

Mononuclear cell Pseudo-pyloric metaplasia Neutrophil infiltration infiltration Neg. Control 0 (0-0) 0 (0-0) 0 (0-0) CCR4/SC 0 (0-0) 1.5 (0-2) 1.5 (0-2) CCR4/IN 0 (0-0) 0.5 (0-2) 0.5 (0-1)* CCR4/SL 0 (0-0) 1 (0-2) 1.5 (1-2)* CT/lysate/IN 0 (0-0) 1.5 (0-3) 2 (1-3) CT/lysate/SL 1.5 (1-2)* 2.5 (2-3)* 3 (3-3)* FA/lysate/SC 3 (3-3)* 1.5 (1-2) 2.5 (2-3) CCR4/lysate/IN 0 (0-0) 1 (0-1)* 0.5 (0-1)* CCR4/lysate/SL 0.5 (0-1) 0.5 (0-1)* 0.5 (0-1)* CCR4/lysate/SC 2 (0-3)* 1 (1-2) 2.5 (1-3) Pos. Control 1.5 (0-2) 1 (1-1) 2 (1-3)

Shown are the median scores (min-max) of pseudo-pyloric metaplasia of the fundus, infiltration of the mucosa of the fundus with neutrophils and mononuclear cells 3 weeks after challenge of the vaccinated mice. Scoring: 0=normal, 1= mild, 2= moderate, 3= severe. Significant differences between the positive control group and the immunized and challenged groups are noted by * (p<0.05). (CCR4: CC chemokine receptor 4 antagonist, CT: Cholera toxin, FA: Freund’s complete, IN: intranasally, SC: subcutaneously, SL: sublingually, Neg. control: sham-immunized/not challenged, Pos. control: sham- immunized/challenged).

158

Experimental Studies: Chapter 3

Interestingly, in the first study, pseudo-pyloric metaplasia was detected in the stomach of 75% of the mice from the FA/lysate immunized and challenged group and even in 100% of the animals belonging to the IFA/lysate and SC Curdlan/lysate immunized and challenged animals. In all other groups, no pseudo-pyloric metaplasia was observed (Figure 5). In the second study, pseudo-pyloric metaplasia of the fundus was present in the group immunized with FA/lysate and CT/lysate/SL and challenged (Figure 6). Although pseudo-pyloric metaplasia was also present in the CCR4 antagonist/lysate/SC immunized and challenged group (Figure 7), this was nevertheless less severe and not present in all animals, compared to the group immunized with FA/lysate (Table V).

A B

Figure 5. Histopathological analysis of fundus by H&E staining. Normal fundus from an uninfected BALB/c mouse (A). Metaplastic fundus of a Freund’s complete/lysate immunized and H. suis-infected BALB/c mouse, showing severe parietal cell loss, with replacement of the epithelium by a common glandular epithelium (B). Original magnification: 200x.

159

Experimental Studies: Chapter 3

Figure 6. H&E and PAS staining of the fundus showing pronounced inflammation and severe pseudo-pyloric metaplasia. H&E (A) and PAS staining (B) of the fundus of an animal in the FA subcutaneously immunized and challenged group, showing pronounced inflammation and severe pseudo-pyloric metaplasia (original magnification: 100x).

Figure 7. H&E and PAS staining of the fundus, showing mild inflammation and pseudo-pyloric metaplasia. H&E (A) and PAS staining (B) of the fundus of an animal from the CCR4 antagonist subcutaneously immunized and challenged group, showing mild inflammation and pseudo-pyloric metaplasia (original magnification: 100x).

160

Experimental Studies: Chapter 3

Immunization with adjuvants modulates the cytokine responses in the stomach upon H. suis challenge In the first study, data from immunized/challenged groups were compared to pooled data from the sham-immunized/challenged positive control groups (Figure 8). Expression of IL-10, an important immunoregulatory cytokine, was significantly lower in all the adjuvant groups as compared to the sham-immunized and challenged groups (p<0.0001). In the subcutaneously immunized/challenged groups, adjuvants showed distinct differences in their ability to mount helper T-cell responses. Although FA/lysate, IFA/ lysate and Curdlan/lysate groups showed significantly higher Th1 and Th2 cytokine signatures (IFN-γ; p<0.0001 and IL-4; p<0.01), Th17 cytokine responses (IL-17) were only observed with Freund’s complete and incomplete adjuvant groups. Mice immunized by mucosal routes displayed distinct helper T-cell responses as compared to subcutaneous immunization routes. No Th2 response (IL-4) was induced in CT/lysate, CpG/lysate and Curdlan/lysate immunized groups, suggesting that these adjuvants selectively induce Th1 and Th17 responses when administered by mucosal routes. Clearly, Curdlan/lysate, irrespective of the route of vaccination, was less efficient to induce chemokine expression as compared to Freund’s adjuvants. In all immunized/challenged animals, LIX showed higher mRNA expression levels (p<0.05) when compared to the sham- immunized/challenged animals. This was not the case for MIP-2 and KC. However, a clear upregulation of MIP-2 mRNA expression levels was observed in the FA/lysate and IFA/lysate groups, while a clear upregulation of KC expression was only observed in the FA/lysate and CT/lysate groups. Messenger RNA expression levels of these cytokines are presented in figure 8.

161

Experimental Studies: Chapter 3

IL-17 IL-10 b 100 6 ab ab * * b 80 * a a * b 4 a a 60 a a * * * a * * * 40 * * a a 2

Relative expression Relative Relative expression Relative

0 0

Neg. conPos. con Neg. conPos. con CT/lysate/IN FA/lysate/SC CT/lysate/IN FA/lysate/SCFIA/lysate/SC CpG/lysate/IN IFA/lysate/SC CpG/lysate/INCurd/lysate/IN Curd/lysate/SC Curd/lysate/IN Curd/lysate/SC

MIP-2 LIX 30 ab 20 * ab ab ac 15 * * 20 * * ad ab 10 * b b b 10 bcd * bcd * *

bd 5 *

Relative expression Relative expression Relative

0 0

Neg. conPos. con Neg. conPos. con CT/lysate/IN CT/lysate/IN FA/lysate/SCIFA/lysate/SC CpG/lysate/IN FA/lysate/SCIFA/lysate/SC CpG/lysate/IN Curd/lysate/SC Curd/lysate/IN Curd/lysate/SC Curd/lysate/IN

ab KC IFN- 30 * 10 a a ab a a * a * 8 * * * a 20 ab ab * * ab * b b 6

4 10

Relative expression Relative Relative expression Relative

0 0

Neg. conPos. con Neg. conPos. con CT/lysate/IN CT/lysate/IN FA/lysate/SCIFA/lysate/SC CpG/lysate/IN FA/lysate/SCIFA/lysate/SC CpG/lysate/IN Curd/lysate/SC Curd/lysate/IN Curd/lysate/SC Curd/lysate/IN

IL-4

40 a a * 30 * a * 20

10 b

b b b Relative expression Relative

Neg. conPos. con CT/lysate/IN FA/lysate/SCIFA/lysate/SC CpG/lysate/IN Curd/lysate/SC Curd/lysate/IN

162

Experimental Studies: Chapter 3

Figure 8. Relative gene expression of cytokines and chemokines in the stomach of challenged animals after immunization or after sham-inoculation in study 1. The first bar represents the pooled data of the animals that were sham-immunized with HBSS (intranasally and subcutaneously) and that were not challenged with H. suis (Neg. con). The second bar represents the pooled data of the animals that were sham-immunized with HBSS (intranasally and subcutaneously) and that were challenged with H. suis (Pos. con). Bars 3, 4 and 5 represent the groups of animals that were immunized subcutaneously with Freund’s complete (FA/lysate/SC), Freund’s incomplete (IFA/lysate/SC) or Curdlan (Curd/lysate/SC) and challenged with H. suis. Bars 6, 7 and 8 represent the animals that were immunized intranasally with Cholera Toxin (CT/lysate/IN), CpG-DNA (CpG/lysate/IN) or Curdlan (Curd/lysate/IN) and challenged with H. suis. An * (p<0.05) indicates a significant modulation of mRNA expression levels compared to the sham-immunized/challenged groups. Cytokine expression between immunized and challenged groups was also compared with each other. When no differences could be found between the different immunized groups, the same letter designation was attributed.

Similar results were obtained in the second study (Figure 9). IL-10 expression was clearly lower in all vaccinated groups as compared to positive control groups. Of note, the use of the CCR4 antagonist by the subcutaneous route induced highest IFN-γ responses confirming the previous results obtained with this adjuvant in other models where cellular immune responses were significantly induced (Bayry et al., 2008; Pere et al., 2011). However, Th1 responses were not induced when the CCR4 antagonist was used for mucosal immunization, a protocol which was shown not to be able to confer protection upon challenge with H. suis. In both studies, correlation analysis showed a clear, positive correlation between IL-10 expression and H. suis colonization rates. A significant inverse correlation was found between the mRNA expression levels of helper T-cell cytokines and chemokines tested and the bacterial load (Figure 10).

163

Experimental Studies: Chapter 3

IL-17 IL-10 ab 150 80 b ab 60 100 b b 40 b b b b b b ab 50 ab 20 ab b

ab a Relative expression Relative Relative expression Relative a a 0 0

Neg. conPos. con Neg. conPos. con CT/lysate/INCT/lysate/SLFA/lysate/SC CT/lysate/INCT/lysate/SLFA/lysate/SC CCR4/lysate/INCCR4/lysate/SLCCR4/lysate/SC CCR4/lysate/INCCR4/lysate/SLCCR4/lysate/SC

IFN- 25 ab 20

15 b b

10 b

5 a b Relative expression Relative

Neg. conPos. con CT/lysate/INCT/lysate/SLFA/lysate/SC CCR4/lysate/INCCR4/lysate/SLCCR4/lysate/SC

Figure 9. Relative gene expression in the stomach in challenged animals after immunization or after sham-inoculation in study 2. The first bar represents the pooled data of negative control animals that were sham-immunized with HBSS and remained unchallenged (Neg. con). The second bar represents positive control group where mice were sham-immunized with HBSS and were subsequently infected with H. suis (Pos. con). Bars 3 and 4 represent Cholera Toxin groups immunized intranasally (CT/lysate/IN) or sublingually (CT/lysate/SL) and challenged with H. suis. Bar 5 represents Freund’s complete adjuvant group (FA/lysate/SC). Bars 6 to 8 denote CCR4 antagonists group immunized by intranasal (IN), sublingual (SL) or subcutaneous (SC) routes respectively followed by challenge with H. suis. The letter ‘a’ indicates a significant (p<0.05) difference of mRNA expression levels compared to positive control groups. The letter ‘b’ indicates significant (p<0.05) changes of expression levels compared to the negative control groups.

164

Experimental Studies: Chapter 3

IL-17 IL-10 8 8 = 0.5120 (p<0.01)

6 = -0.4107 (p<0.01) 6

4 4

Log10 Log10

H. H. suis H. suis bacteria/mg bacteria/mg 2 2

0 0 0 100 200 300 0 2 4 6 8 10 Relative Il-17 expression Relative Il-10 expression

KC MIP-2 8 8 = -0.5269 (p<0.01)  = -0.6572 (p<0.01) 6 6

4 4

Log10 Log10

H. H. suis H. suis bacteria/mg bacteria/mg 2 2

0 0 0 20 40 60 80 0 20 40 60 Relative KC expression Relative MIP2 expression

IFN- LIX 8 8 = -0.5102 (p<0.01) 6 6 = -0.6572 (p<0.01)

4 4

Log10

H. H. suis

H. H. suis bacteria/mg bacteria/mg 2 2

0 0 0 10 20 30 0 10 20 30 40 Relative IFNg expression Relative LIX expression

IL-4

8 = -0.3572 (p<0.01)

Log10 H. suis H.

bacteria/mg 2

0 0 10 20 30 40 50 Relative Il-4 expression

165

Experimental Studies: Chapter 3

Figure 10. Correlation between cytokine and chemokine expression and H. suis colonization in study 1. Shown are the correlation analyses between IL-17, IL-10, MIP-2, LIX, IFN-γ and IL-4 mRNA expression levels on the one hand and the number of H. suis bacteria colonizing stomach of mice in the immunized and challenged groups on the other hand. Correlation was measured by Spearman’s Rho (ρ). Statistical significance between the immunized and challenged groups and the positive control group is noted by the P-value.

166

Experimental Studies: Chapter 3

Discussion

In a previous study we showed that intranasal immunization with a CT/H. suis lysate vaccine, induced a partial protection against subsequent H. suis challenge, with some animals even showing no detectable H. suis colonization by conventional PCR (Flahou et al., 2009). In this same study, animals were also immunized subcutaneously using a H. suis lysate/saponin- based adjuvant vaccine, which clearly was shown to be inferior to the intranasal immunization protocol with regards to its capacity to protect against a subsequent H. suis challenge (Flahou et al., 2009). Our current results confirm that the choice of adjuvant plays an important role in the efficacy of a vaccine formulation. Indeed, subcutaneous vaccination with H. suis lysate adjuvanted with FA or with the CCR4 antagonist induced a similar protection compared to intranasal vaccination with CT as an adjuvant. In contrast to parenteral immunization, mucosal immunization using this CCR4 antagonist as an adjuvant did not induce a good protection against H. suis challenge. CCR4+ effector memory regulatory T cells (Tregs) have homing capacity to skin and lungs (Sather et al., 2007). Therefore, the use of CCR4 antagonists as molecular adjuvant is strictly dependent on the route of immunization. It is possible that lack of migration of CCR4+ Tregs to the sublingual region might have contributed to ineffectiveness of this route of vaccination with CCR4 antagonists. Conflicting results have been reported when comparing the efficacy of mucosal versus systemic immunization routes for Helicobacter vaccination, but most studies suggest that mucosal immunization is the better one of the two options (Ermak et al., 1998; Sutton et al., 2007; Svennerholm et al., 2007). Results from the present study however indicate that subcutaneous vaccination, using various well-established vaccine adjuvants, in general yields the best results with regards to reduction of H. suis colonization. The only mucosally applied adjuvant generating similar levels of protection was CT, which was shown to be equally effective when used for sublingual immunization (Figure 3). In the present study, protection was obtained in mice immunized subcutaneously with FA as adjuvant, which was accompanied by high expression rates of MIP-2, LIX and KC (Figure 8). These chemokines are known to be involved in the recruitment of neutrophils. Indeed, infiltration with (neutrophilic) granulocytes was more pronounced in subcutaneously immunized mice, both compared to intranasally immunized/challenged mice as well as sham- immunized/challenged positive control animals. This however contrasts somewhat with the results of our second study, showing an increased infiltration of neutrophils in animals immunized mucosally using CT as an adjuvant. In any case, a more pronounced post-

167

Experimental Studies: Chapter 3 vaccination gastritis was associated with a higher degree of protection observed in both studies. This is in accordance with data found in the literature for H. pylori vaccination (Goto et al., 1999; Morihara et al., 2007; Garhart et al., 2008). However, the disparity in gastritis between infected animals and immunized/challenged animals has been described to disappear, showing that this is most likely a transient event (Garhart et al., 2002; Sutton et al., 2007). Whether post-vaccination gastritis is also a transient event in H. suis vaccination and subsequent challenge remains to be determined. Compared to the non-immunized/challenged animals, IL-10 expression levels were consistently lower in animals from all immunized/challenged groups. In addition, a mild positive correlation between IL-10 expression and gastric H. suis colonization rates was demonstrated (Figure 10). It has been suggested that H. suis and H. pylori suppress the generation of an efficient immune response by inducing expression of anti- inflammatory/regulatory IL-10, which contributes to the suppression of pro-inflammatory Th17 and Th1 responses (Flahou et al., 2009; Kao et al., 2010). IL-10 is one of the most important cytokines secreted by regulatory T cells (Tregs), which actively control or suppress the function of other cells. Infection of IL-10-/- mice, lacking IL-10 expression, with H. pylori and H. felis elicited a more severe chronic gastritis compared with that seen in wild-type mice (Ismail et al., 2003), which even led to spontaneous eradication of Helicobacter infection (Matsumoto et al., 2005; Blanchard and Nedrud, 2010). Kao et al. showed that mucosal dendritic cells induce a Treg-biased response suppressing the induction of a Th17 response, which could in part be responsible for the chronicity of the infection (Kao et al., 2010). Since Tregs and IL-10 may contribute to persistence of an infection with H. suis, we hypothesized that CCR4 antagonists might help to induce protective immunity. Results of our study indeed reveal that a significant level of protection was achieved when using the CCR4 antagonist as an adjuvant and this was associated with only a mild pseudo-pyloric metaplasia, which was sometimes even absent. By inhibition of Treg migration at the time of vaccination we could achieve a certain degree of protection without undesirable side effects. A clear upregulation of IFN-γ mRNA expression levels was observed in all vaccinated/challenged groups when compared to challenged control animals. In general, an inverse correlation was observed between the bacterial load and IFN-γ expression levels. In non-immunized/H. suis-infected mice, a persistent H. suis infection does not induce a Th1 response (Flahou et al., 2012). This indicates that immunization-evoked production of IFN-γ, a signature Th1 response cytokine, most likely plays a role in suppression and clearance of H. suis.

168

Experimental Studies: Chapter 3

The majority of the immunization protocols that induced good protection against infection with H. suis, showed a clear upregulation of IL-17 mRNA expression levels. DeLyria and co- workers showed that IL-17 expression induces the production of KC, MIP-2 and LIX primarily by murine fibroblasts and gastric epithelial cells (DeLyria et al., 2009). In the present study, this relationship was confirmed in subcutaneously immunized animals and in particular with Freund’s adjuvants. Although a marked upregulation of IL-17 mRNA expression levels was also observed in the group intranasally immunized with lysate and CT, this was not accompanied by an upregulation of mRNA expression levels of KC, MIP-2 and LIX. Also, despite imparting protection, subcutaneous vaccination with H. suis lysate adjuvanted with the CCR4 antagonist did not induce Th17 responses. Therefore, the role of IL-17 in the protection against H. suis infection requires further investigation (Figures 8 and 9). The major side-effects concerning vaccination against H. suis were found to be post- vaccination gastritis and increased mortality rates, especially when using CT-based vaccination protocols. In this study we aimed at reducing these side effects. In all immunization protocols using CT as an adjuvant, an increased vaccination/challenge-related mortality was observed as compared to other adjuvants. Four mice that were immunized intranasally with CT as adjuvant in the first study, died within 48 hours after H. suis challenge, most likely because of a pneumonia, which was confirmed histopathologically. In the second study, two mice also died in each group immunized with CT (IN and SL), within 24 hours after challenge with H. suis, most likely of an immunization/challenge related pneumonia, despite drastically lowering the volume of the vaccines. Histopathological evaluation showed the presence of oedema in the interstitial space of the lungs of these mice. In the other groups, the mortality rates were lower. In all subcutaneously immunized/challenged groups of the first study, severe post-vaccination gastritis and pseudo-pyloric metaplasia of the stomach epithelium were observed. In the second study, pseudo-pyloric metaplasia was most pronounced in the groups immunized with CT/lysate/SL and FA/lysate/SC. Interestingly, in the CCR4 antagonist/lysate/SC immunized animals, showing a similar level of protection, this pseudo-pyloric metaplasia was shown to be less severe and sometimes even absent. This clearly warrants further studies with CCR4 antagonists as adjuvant, aiming at further optimization of immunization protocols. Once further optimized in rodent models, these studies should also be performed in pigs, which are the natural hosts of H. suis. Although CT was shown to induce substantial side effects in mice in the present study and is known to be enterotoxic in humans, Cox et al. describe less toxicity

169

Experimental Studies: Chapter 3 in pigs, the natural host of H. suis. In 3 to 4-week-old piglets, a dose of 1mg of CT induced only a pasty to semiliquid diarrhea for 2h (Cox et al., 1997). A major focus for further research should be the use of non-toxic derivates of CT that still retain significant adjuvanticity. In addition, future research should be performed on the potential use of CCR4 antagonists in pig vaccination. In conclusion, subcutaneous immunization protocols with FA/lysate were shown to confer an equally good protection against subsequent H. suis challenge compared to the previously used CT/lysate intranasal immunization protocols, although a severe pseudo-pyloric metaplasia was observed as well. Interestingly, a newly developed CCR4 antagonist was shown to induce similar levels of protection when used as a vaccine adjuvant for subcutaneous vaccination, whilst clearly triggering less side effects. Finally, the vaccination protocols that showed good results in the current rodent model should be confirmed in a pig model.

Acknowledgements The authors thank Sofie De Bruyckere, Nathalie Van Rysselberghe and Christian Puttevils for their excellent technical assistance.

170

Experimental Studies: Chapter 3

References

Anderl F, Gerhard M. 2014. Helicobacter pylori vaccination: Is there a path to protection? World Journal of Gastroenterology. 20:11939-11949. André S, Tough DF, Lacroix-Desmazes S, Kaveri SV, Bayry J. 2009. Surveillance of antigen- presenting cells by CD4+CD25+ regulatory T-cells in autoimmunity: immunopathogenesis and therapeutic implications. Am J Pathol. 174:1575-87. Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A, Chiers K, Ducatelle R, Haesebrouck F. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. International Journal of Systematic and evolutionary Microbiology. 58:1350-1358. Banerjee S, Medina Fatimi A, Nichols R, Tendler D, Michetti M, Simon J, Kelly CP, Monath TP, Michetti P. 2002. Safety and efficacy of low dose Escherichia coli enterotoxin adjuvant for urease based oral immunization against Helicobacter pylori in healthy volunteers. Gut. 51:634-640. Bayry J, Tartour E, Tough DF. 2014. Targeting CCR4 as an emerging strategy for cancer therapy and vaccines. Trends Pharmacol Sci. 35:163-165. Bayry J, Tchilian EZ, Davies MN, Forbes EK, Draper SJ, Kaveri SV, Hill AV, Kazatchkine MD, Beverley PC, Flower DR, Tough DF. 2008. In silico identified CCR4 antagonists target regulatory T cells and exert adjuvant activity in vaccination. Proc Natl Acad Sci USA. 105:10221-10226. Blanchard TG, Nedrud JG. 2010. Helicobacter pylori vaccines. In: Sutton P, Mitchell HM (eds.), Helicobacter pylori in the 21st century CAB International, Oxfordshire, UK, pp. 167-189. Bonecchi R, Bianchi G, Bordignon PP, D'Ambrosio D, Lang R, Borsatti A, Sozzani S, Allavena P, Gray PA, Mantovani A, Sinigaglia F. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med. 187:129-134. Corthésy-Theulaz I, Porta N, Glauser M, Saraga E, Vaney AC, Haas R, Kraehenbuhl JP, Blum AL, Michetti P. 1995. Oral immunization with Helicobacter pylori urease B subunit as a treatment against Helicobacter infection in mice. Gastroenterology. 109:115-121. Cox JC, Coulter AR. 1997. Adjuvants-a classification and review of their modes of action. Vaccine. 15:248-56.

171

Experimental Studies: Chapter 3

Davies MN, Bayry J, Tchilian EZ, Vani J, Shaila MS, Forbes EK, Draper SJ, Beverley PC, Tough DF, Flower DR. 2009. Toward the Discovery of Vaccine Adjuvants: Coupling In Silico Screening and In Vitro Analysis of Antagonist Binding to Human and Mouse CCR4 Receptors. PLoS One. 4:e8084. De Bruyne E, Flahou B, Chiers K, Meyns T, Kumar S, Vermoote M, Pasmans F, Millet S, Dewulf J, Haesebrouck F, Ducatelle R. 2012. An experimental Helicobacter suis infection causes gastritis and reduced daily weight gain in pigs. Veterinary Microbiology. 160:449-544. DeLyria ES, Redline RW, Blanchard TG. 2009. Vaccination of mice against H. pylori induces a strong Th-17 response and immunity that is neutrophil dependent. Gastroenterology. 136:247-256. Ermak TH, Giannasca PJ, Nichols R, Meyers GA, Nedrud J, Weltzin R, Lee CK, Kleanthous H, Monath TP. 1998. Immunization of mice with urease vaccine affords protection against Helicobacter pylori infection in the absence of antibodies and is mediated by MHC class-II restricted responses. The Journal of Experimental Medicine. 188:2277- 2288. Flahou B, Hellemans A, Meyns T, Duchateau L, Chiers K, Baele M, Pasmans F, Haesebrouck F, Ducatelle R. 2009. Protective immunization with homologous and heterologous antigens against Helicobacter suis challenge in a mouse model. Vaccine. 27:1416- 1421. Flahou B, Van Deun K, Pasmans F, Smet A, Volf J, Rychlik I, Ducatelle R, Haesebrouck F. 2012. The local immune response of mice after Helicobacter suis infection: strain differences and distinction with Helicobacter pylori. Veterinary Research. 43:75. Garhart CA, Redline RW, Nedrud JG, Czinn SJ. 2002. Clearance of Helicobacter pylori infection and resolution of post-immunization gastritis in a kinetic study of prophylactically immunized mice. Infection and Immunity. 70:3529-3538. Goto T, Nishizono A, Fujioka T, Ikewaki J, Mifune K, Nasu M. 1999. Local secretory immunoglobulin A and post-immunization gastritis correlate with protection against Helicobacter pylori infection after oral vaccination of mice. Infection and Immunity. 67:2531-2539. Guy B, Hessler C, Fourage S, Haensler J, Vialon-Lafay E, Robki B, Millet MJ. 1998. Systemic immunization with urease protects mice against Helicobacter pylori infection. Vaccine. 16:850-856.

172

Experimental Studies: Chapter 3

Guy B, Hessler C, Fourage S, Robki B, Millet MJ. 1999. Comparison between targeted and untargeted systemic immunizations with adjuvanted urease to cure Helicobacter pylori infection in mice. Vaccine. 17:1130-1135. Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M, Meyns T, Decostere A, Ducatelle R. 2009. Gastric Helicobacters in domestic animals and non-human primates and their significance for human health. Clinical Microbiology Reviews. 22:203-223. Hellemans A, Chiers K, Maes D, De Bock M, Decostere A, Haesebrouck F, Ducatelle R, Maes D. 2007. Prevalence of ‘Candidatus Helicobacter suis’ in pigs of different ages. Veterinary record. 161:189-192. Higashi T, Hashimoto K, Takagi R, Mizuno Y, Okazaki Y, Tanaka Y, Matsushita S. 2010. Curdlan induces DC-mediated Th17 polarization via Jagged1 activation in human dendritic cells. Allergol Int. 59:161-6. Ismail HF, Fick P, Zhang J, Lynch RG, Berg DJ. 2003. Depletion of neutrophils in IL-10-/- mice delays clearance of gastric Helicobacter infection and decreases the Th1 immune response to Helicobacter. Journal of Immunology. 170:3782-3789. Jiang W, Baker HJ, Smith BF. 2003. Mucosal immunization with Helicobacter, CpG DNA, and cholera toxin is protective. Infection and Immunity. 71:40-46. Kao JY, Zhang M, Miller MJ, Mills JC, Wang B, Liu M, Eaton KA, Zou W, Berndt BE, Cole TS, Takeuchi T, Owyang SY, Luther J. 2010. Helicobacter pylori escape is mediated by dendritic cell-induced Treg skewing and Th17 suppression in mice. Gastroenterology. 138:1046-1054. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402-408. Matsumoto Y, Blanchard TG, Drakes ML, Basu M, Redline RW, Levine AD, Czinn SJ. 2005. Eradication of Helicobacter pylori and resolution of gastritis in the gastric mucosa of Il-10-deficient mice. Helicobacter. 10:407-415. Morihara F, Fujii R, Hifumi E, Nishizono A, Uda T. 2007. Effects of vaccination by a recombinant antigen ureB 138 (a segment of the β-subunit of urease) against Helicobacter pylori infection. Journal of Medical Microbiology. 56:847-853. Nyström J, Raghavan S, Svennerholm AM. 2006. Mucosal immune responses are related to the reduction of bacterial colonization in the stomach after therapeutic Helicobacter pylori immunization in mice. Microbes and Infection. 8:442-449.

173

Experimental Studies: Chapter 3

O'Rourke JL, Solnick JV, Neilan BA, Seidel K, Hayter R, Hansen LM, Lee A. 2004. Description of ‘Candidatus Helicobacter heilmannii’ based on DNA sequence analysis of 16S rRNA and urease genes. Int J Syst Evol Microbiol. 54:2203-11. Pere H, Montier Y, Bayry J, Quintin-Colonna F, Merillon N, Dransart E, Badoual C, Gey A, Ravel P, Marcheteau E, Batteux F, Sandoval F, Adotevi O, Chiu C, Garcia S, Tanchot C, Lone YC, Ferreira LC, Nelson BH, Hanahan D, Fridman WH, Johannes L, Tartour E. 2011. A CCR4 antagonist combined with vaccines induces antigen- specific CD8+ T cells and tumor immunity against self antigens. Blood. 118:4853-62. Raghavan S, Nyström J, Frederiksson M, Holmgren J, Harandi AM. 2003. Orally administered CpG oligodeoxynucleotide induces production of CXC and CC chemokines in the gastric mucosa and suppresses bacterial colonization in a mouse model of Helicobacter pylori infection. Infection and Immunity. 71:7014-7022. Sather BD, Treuting P, Perdue N, Miazgowicz M, Fontenot JD, Rudensky AY, Campbell DJ. 2007. Altering the distribution of Foxp3(+) regulatory T cells results in tissue-specific inflammatory disease. J Exp Med. 204:1335-147. Stolte M, Meining A. 2001. The updated Sydney system: classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 15: 591-8. Sutton P, Doidge C, Pinczower G, Wilson J, Harbour S, Swierczak A, Lee A. 2007. Effectiveness of vaccination with recombinant HpaA from Helicobacter pylori is influenced by host genetic background. FEMS Immunology and Medical Microbiology. 50:213-219. Svennerholm AM, Lundgren A. 2007. Progress in vaccine development against Helicobacter pylori. FEMS Immunology and Medical Microbiology. 50:146-156. Vermoote M, Flahou B, Pasmans F, Ducatelle R, Haesebrouck F. 2013. Protective efficacy of vaccines based on the Helicobacter suis urease subunit B and γ-glutamyl transpeptidase. Vaccine. 31:3250-6. Xie Y, Zhou NJ, Gong YF, Zhou XJ, Chen J, Hu SJ, Lu NH, Hou XH. 2007. The immune response induced by Helicobacter pylori vaccine with chitosan as adjuvant and its relation to immune protection. World Journal of Gastroenterology. 13:1547-1553.

174

General Discussion

175

176

General Discussion

Helicobacter (H.) suis is a pathogen, colonizing the stomach of more than 60% of pigs at slaughter age worldwide. Infections in these animals are associated with chronic gastritis and a decreased daily weight gain (De Bruyne et al., 2012). Although not always straightforward, several studies attribute a role to this pathogen in the development of gastric ulcer disease in pigs (De Bruyne et al., 2012). Economic losses due to these stomach ulcerations are believed to be substantial (Haesebrouck et al., 2009). H. suis is also the most prevalent non- Helicobacter pylori Helicobacter (NHPH) species in humans and has been associated with gastritis, peptic ulcers and mucosa-associated lymphoid tissue (MALT) lymphoma (Haesebrouck et al., 2009). Unlike H. pylori, limited information is available about H. suis infections in the natural hosts and humans. This is due to the fastidious nature of this bacterium, which was only successfully cultivated in vitro in 2008 (Baele et al., 2008). The development of an isolation and cultivation protocol paved the way for further research on pathogenesis, evoked innate and adaptive host immune responses and possible strategies to control H. suis infections. This PhD aimed at gaining better insights in different aspects of the immune response which should allow to make progress in the development of an efficacious vaccine.

1. Better insights in immune evasion mechanisms used by Helicobacter suis to establish chronic inflammation of the stomach mucosa

H. suis is very successful in the way it colonizes the porcine stomach. The high prevalence in pigs indicates that this bacterium has adapted well to its specific environment. It is not only able to overcome the gastric acidic pH, but also evades the host immune responses. For H. pylori, several mechanisms have been described that might contribute to its persistence, which lead to chronic inflammation. Inhibition of innate immune recognition is caused by evasion of recognition by pattern recognition receptors, inhibition of phagocytic killing and inhibition of killing by reactive oxygen species and nitric oxide. Adaptive immunity is compromised by apoptosis of macrophages, inhibition of dendritic cell (DC) maturation and function, inhibition of antigen presentation and apoptosis of gastric epithelial cells. H. pylori is also known to inhibit T-cell responses by suppressing proliferation and mediating skewing of T- cell responses towards a regulatory T-cell response. In addition, H. pylori is able to evade immune responses by its genomic diversity (Lina et al., 2014). Several of the immune evasion mechanisms described for H. pylori are attributed to its major virulence factors CagA and VacA, which are absent in H. suis (Vermoote et al., 2011). A better understanding of the

177

General Discussion mechanisms used by H. suis to evade the host immune response is crucial for the design of successful vaccines to eliminate this highly prevalent pathogen.

In chapter 1, we compared immunity to Helicobacter suis infection in a BALB/c mouse model and in its natural host, the pig. Remarkable differences were observed when comparing the function of porcine and murine DCs after stimulation with H. suis in vitro. Mature murine bone marrow-derived DCs were able to elicit a major Th17 polarized response. In contrast, H. suis stimulation of porcine monocyte-derived DCs resulted in a semi-mature phenotype, as shown by the impaired expression of MHC class II molecules on the cell surface of these cells. Like H. pylori, H. suis might induce semi-maturation of porcine DCs conferring a tolerogenic phenotype that elicits the expansion of Tregs, while maintaining a suboptimal level of Th17 cells. The results obtained in pigs might be more relevant than those obtained in BALB/c mice, since pigs are the natural host of H. suis and care should be taken when extrapolating data between different animal models. It remains to be determined whether DCs from humans, will act like porcine DCs or rather like murine DCs.

Further research should also focus on virulence factors present in H. suis (including gamma- glutamyl transpeptidase (GGT) and urease) and their molecular mechanisms that might be involved in immune evasion and subsequently promote persistent infection. This may ultimately lead to the recognition of potential intervention targets to prevent the progression of chronic gastritis. GGT has previously been shown to play a critical role in the tolerizing effects of H. pylori on murine DCs in vivo and in vitro, by mechanisms which are independent of their suppressive activities on T-cells. Zhang et al. (2015) have demonstrated that a H. suis∆ggt deletion mutant was able to colonize the stomach of BALB/c mice at levels comparable to WT strains. However, this deletion mutant induced significantly less inflammation. Zhang et al. (2015) conclude that the higher expression levels of IL-10 in HS5cLP∆ggt infected mice may be partially responsible for the attenuated inflammatory response, when compared to WT- infected animals. Previously published data from in vitro experiments have shown that H. pylori GGT suppresses IL-10 secretion by activated human CD4+ T-cells (Beigier-Bompadre et al., 2011). This contrasts with the role of GGT in reprogramming DCs towards a tolerogenic phenotype. Therefore, its role in immune evasion during H. suis infection requires further investigation.

178

General Discussion

Another enzyme which is known to promote persistent gastric Helicobacter colonization by establishing a local microenvironment is urease (Weeks and Sachs, 2001). It protects helicobacters against gastric acid and facilitates the colonization of the gastric epithelium. Urease has also been shown to stimulate cytokine secretion by human monocytes (Harris et al., 1996; Phadnis et al., 1996). Experimental studies with gastric epithelial cells (GEC) have suggested that urease leads to increased gastric cell death. Clearly, urease plays an important role in the inflammatory response by H. pylori and its associated tissue damage. Several studies attribute a role to H. pylori urease in inducing gastric epithelial cell death by binding to class II MHC molecules on these cells. Beswick et al. (2006) have previously shown that H. pylori urease B binds to CD74, the MHC class II-associated invariant chain (Li) on GEC and induces NF-kB activation and IL-8 production. CD74 is best known for its role in regulating the intracellular transport and functions of class II MHC in antigen presenting cells (Elliot et al., 1994). The MHC II expression on the surface of these cells increases in the H. pylori-infected tissue. In addition, urease also binds to a panel of human B-cell lines expressing a diverse set of class II alleles (Fan et al., 2000). This unsuspected role for urease in H. pylori pathogenesis adds support for the use of this bacterial product in the development of vaccination strategies to reduce infection and cellular injury by this pathogen. It might be worthwhile to investigate whether this is also the case for H. suis infections. The development of antibodies that would block the binding of urease to class II MHC may effectively prevent bacterial binding to the target tissue and subsequent colonization. To further elucidate the molecular mechanisms by which these virulence factors play a role in modulating the immune response after gastric Helicobacter infection, experimental studies may be carried out with H. suis mutant strains lacking one or a combination of its most important virulence factors.

2. Better insights in the development of mucosa-associated lymphoid tissue (MALT) lymphoma-like lesions following experimental Helicobacter suis infection in rodent models

Besides pigs and humans, H. suis has also been detected in the stomach of several non-human primates. However, no information on the pathogenic outcome of H. suis infection for these animals is available, and the source of infection remains to be determined. Phylogenetic analysis has shown that pig- and human-associated (1), cynomolgus monkey-associated (2) and rhesus monkey-associated (3) H. suis strains form 3 distinct clusters. Surprisingly,

179

General Discussion macaques might be the ancestral source of H. suis infection in pigs (Flahou et al., unpublished results). Cynomolgus monkey-associated H. suis strains have been used in several infection studies in mice and were associated with the development of MALT lymphoma-like lesions in these animals. These lesions are not observed in mice when using pure in vitro-cultured porcine H. suis strains. In any case, direct comparison between H. suis strains from these different hosts was difficult before the start of this research, since no pure in vitro-cultured primate-associated H. suis strains were available. Previous studies used gastric mucus or gastric mucosal homogenate from mice to inoculate the animals. These inocula not only contained H. suis but also other micro-organisms, which might influence the infection and the host immune response. This has been demonstrated for Kazachstania heterogenica, a yeast which was found colonizing the exact same regions of the stomach of Mongolian gerbils as gastric helicobacters. The presence of this yeast in gerbil stomachs led to more severe inflammation after H. suis infection (Flahou et al., 2010). Recently, we succeeded in cultivating pure H. suis strains, obtained from the stomach mucosa from rhesus monkeys and cynomolgus monkeys. In chapter 2, we describe a virulence study comparing pure in vitro- cultured pig-associated and primate-associated H. suis strains in BALB/c mice and Mongolian gerbils. No substantial differences were observed between the different H. suis strains in the BALB/c mouse model. The cynomolgus monkey-associated H. suis strain was unable to colonize the stomach of Mongolian gerbils. Future research should include comparative genomics/transcriptomics to elucidate the underlying reasons why this strain was unable to colonize in Mongolian gerbils, the animal model which has been previously described to be superior to mice for studying H. suis-host interactions (Flahou et al., 2010).

In the Mongolian gerbil model, both the rhesus monkey-associated H. suis strain and the porcine H. suis strain elicited severe inflammation in the stomach mucosa, which was characterized by a diffuse infiltration of T lymphocytes and the formation of lymphoid follicles, which resembled MALT lymphoma-like lesions. As shown by the abrupt parietal cell loss at the transition zone between fundus and antrum, it is clear that both strains have a profound effect on the function and homeostasis of the gastric epithelium. These parietal cells are abundant in the fundic gland region. They secrete HCl and play a vital role in the maintenance of the normal structure and function of the gastric mucosa. Malfunction of these cells leads to gastric inflammation. H. suis is often observed near or even inside the canaliculi of parietal cells in experimentally infected Mongolian gerbils and mice, in which signs of degeneration are shown. Similar observations have been made in humans with H. suis, but not

180

General Discussion with H. pylori (Joo et al., 2007). A recent study describes an upregulation of ATPase, a marker for parietal cells in the stomach of H. suis positive pigs compared to uninfected animals (Zhang et al., 2016).

In contrast with H. pylori which is known to cause gastric adenocarcinomas, H. suis is mainly associated with the development of MALT lymphoma-like lesions as a consequence of chronic inflammation in the gastric mucosa of the infected host (Nakamura et al., 2007). These differences may be caused by differences in host immune response towards both species. The development of B-cell MALT lymphoma has been associated with a Th2 response, rather than a Th1-predominant response (Greiner et al., 1997; Stolte et al., 2002). However, others describe that these tumour infiltrating T-cells represent a heterogeneous population consisting of multiple functional subsets which secrete different combinations of cytokines of both the Th1- and Th2-type (D’elios et al., 2003; Floch et al., 2015). It has been widely reported that mainly CD4+ T cells produce IFN-γ, but there is also evidence that other immune cells such as B-cells, DCs, and natural killer cells have the ability to secrete this cytokine (Yang et al., 2015). Several studies attribute a major role for IFN-γ in the formation of gastric lymphoid follicles after H. suis infection (Mimura et al., 2011; Yang et al., 2015). In addition, IFN-γ-producing B-cells evoke gastric lymphoid follicle formation independent of T-cell help, suggesting that they are crucial for the development of gastric MALT lymphoma induced by Helicobacter infection (Yang et al., 2015). Our results are in agreement with these previous studies, confirming the role of IFN-γ in the development of gastric lymphoid follicles after infection with pure in vitro-cultured H. suis strains in Mongolian gerbils.

As mentioned before, CD4+CD25+ regulatory T-cells are important in protecting the Helicobacter infected host against excessive gastric inflammation and disease signs, while on the other hand, they may promote bacterial colonization which may increase the risk to develop gastric MALT lymphoma. Local Tregs could also be of major importance for perseverance of a minimal bacterial load, thereby maintaining an antigen-dependent disease that could regress after eradication by antimicrobials (Laur et al., 2016). As shown in a gastric MALT lymphoma murine model involving a H. felis infection, Tregs are recruited by cytokines such as CCL17, CCL22 (Craig et al., 2010), CCL20 and CXCL13 (Cook et al., 2014). Indeed, the administration of anti-CXCL13 antibodies yields promising results in patients where the MALT lymphoma did not regress after standard antibiotic treatment (Yamamoto et al., 2014). The crucial role of CXCL13 for lymphoid infiltrate formation has also been demonstrated for H. suis in animal models (Zhang et al., 2015). Our results in

181

General Discussion chapter 2 show increased CXCL13 mRNA expression levels in both BALB/c mice and Mongolian gerbils. However, MALT lymphoma-like lesions were only observed in H. suis infected gerbils and not in mice, even after 6 months post infection. In addition, in chapter 1 we demonstrated that in naturally H. suis infected pigs at slaughter age, increased CXCL13 levels were present in the entire glandular stomach, which was associated with the formation of gastric lymphoid follicles. Therefore, the role of this B-cell chemoattractant in MALT lymphomagenesis might be dependent on the infected host. Other factors possibly involved in gastric follicle formation are CD40 and its receptor CD40L, which play an important role in the co-stimulation of B-cells (Greiner et al., 1997; Craig et al., 2010). CD40 signaling in B-cells is also known to promote germinal center formation, and might be essential for the survival of many cell types, including gastric cancer B-cells under normal and inflammatory conditions (D’Orlando et al., 2007). Floch et al. (2015) also attribute a major role for lymphotoxin-α, lymphotoxin-β and numerous members of the tumour necrosis factor family in MALT lymphoma-related pathologies. In addition to the involvement of cytokines, several mechanisms have been described to stimulate lymphomagenesis in this setting. An overexpression of miR-142-5p and miR-155 as well as increased lymphangiogenesis and angiogenesis, all have been shown to be involved in H. suis-induced gastric MALT lymphoma (Nakamura et al. 2008; Saito et al. 2012).

3. The newly developed CCR4 antagonist might be a promising adjuvant in Helicobacter suis vaccine development

Currently, no specific control strategies are available to decrease the prevalence of H. suis infections and its related pathologies in pigs. Stricter hygiene measures which have been shown to be useful to control the spread of other major swine pathogens, might also be successful in preventing the introduction of H. suis (Melnichouk et al., 1999). Eradication of gastric Helicobacter infections using antimicrobial therapy is expensive, time-consuming and may favor spread of antimicrobial resistance in the pig’s microbiota, which is also of public health concern (Malfertheiner et al., 2012). Moreover, antimicrobial resistance has been reported among porcine H. suis isolates (Vermoote et al., 2011b). A widespread control strategy of H. suis infections in pigs by antibiotic-based therapy is hence not recommended. Therefore, vaccination might be a valuable alternative approach.

Several H. pylori immunization strategies have been tested with a wide variety of antigens, adjuvants and delivery routes that can significantly reduce H. pylori colonization levels in

182

General Discussion mice. However, sterilizing immunity has rarely been achieved in animal models and the few clinical trials in humans have been unsuccessful. Before the start of this research, only a limited number of vaccination studies against H. suis infection had been performed. Promising results have been published using either H. suis whole-cell lysate or recombinant (r) UreB but not rNapA given prophylactically to protect against an experimental H. suis infection in BALB/c mice (Vermoote et al., 2012). It was also shown that vaccination with a combination of rGGT and rUreB protect mice against subsequent H. suis infection and is not associated with severe post-vaccination gastric inflammation (Vermoote et al., 2013). Despite the induction of a considerable degree of protection against infection, increased mortality rates were observed in these studies. This was most likely due to the intranasal use of Cholera Toxin (CT) as adjuvant, which might have caused swelling of the nasal cavity mucosae, resulting in asfyxia. No other adjuvants besides CT (for intranasal vaccine delivery) and a saponin-based adjuvant (for subcutaneous vaccine delivery) had been tested in H. suis vaccination studies before the start of this research. Therefore, in the third chapter we aimed at exploring the efficacy and safety of several established and new vaccine adjuvants (CpG- DNA, Curdlan, Freund’s complete (FA), Freund’s incomplete (IFA), CT, CCR4 antagonist) administered subcutaneously, intranasally or sublingually along with H. suis whole-cell lysate to protect against H. suis challenge in BALB/c mice.

In line with other infectious agents that use the mucosal surface as entry point for infection, it might be expected that topical application of Helicobacter vaccines at the mucosal surface is more suitable to induce a protective immune response than systemic application (Ogra et al., 2001). However, our study revealed that subcutaneous immunization protocols with FA/lysate conferred an equally good protection against subsequent H. suis challenge compared to the previously used CT/lysate intranasal immunization protocols, although severe pseudo-pyloric metaplasia and post-immunization gastritis were observed as well. This post-immunization gastritis appears to be the result of a heightened immune response to residual Helicobacter bacteria. This has also been observed in murine vaccination studies with H. pylori. Its role in protection remains largely unclear (Vermoote et al., 2013). A hypothesis for the development of post-immunization gastritis is that in an immunized host, challenge with a gastric Helicobacter sp. will lead to an enhanced gastric inflammatory response which could be critical for the elimination of the bacteria. Several experimental studies have indeed shown that the severity of this gastritis is inversely correlated with the degree of protection, which is also confirmed by the results of the present study (Vermoote et al., 2012; Vermoote et al.,

183

General Discussion

2013). However, post-immunization gastritis was found to be negligible in mice vaccinated with single proteins and mice immunized with combinations of rUreB and rGGT, although in these groups a significant reduction or even clearance of H. suis was achieved (Vermoote et al., 2013). Longterm experimental studies will have to be performed in order to determine whether this post-immunization gastritis is transient and if it also occurs in the natural hosts of H. suis. Interestingly, over the past ten years, several studies have demonstrated that prime-boost immunizations can be given with unmatched vaccine delivery methods while using the same antigen, in a “heterologous” prime-boost format. The most interesting and unexpected finding is that, in many cases, heterologous prime-boost is more effective than the “homologous” prime-boost approach. Further studies will be necessary to optimize such vaccination strategies in rodent models and pigs.

In our study, CT was used for comparison with other adjuvants. CT in its current form can not be used in pigs due to its toxicity. Much effort has been made recently to detoxify the adjuvants CT and LT and simultaneously maintain the stimulatory effect. A double mutant form of LT (dmLT) seems to be a promising adjuvant with reduced toxicity and preserved stimulatory capacity (Sjökvist Ottsjö et al., 2013). In addition, CTA1-DD combines the activity of the holotoxin (CTA1) and an immunoglobulin binding domain (DD fragment) that targets and mainly activates B-cells. This adjuvant shows no toxicity in rodents (Eriksson et al., 2004) and non-human primates (Sundling et al., 2008). A significant reduction of H. pylori was observed when this adjuvant was administered intranasally together with whole- cell lysate in a therapeutic setting in C57BL/6 mice (Akhiani et al., 2006).

Although the use of FA was shown to induce protection in mice, its use is not permitted in food-producing animals, since the oil remains at the injection site and the killed mycobacteria in the adjuvant may induce a positive reaction to the tuberculin test. In laboratory animals, the use of FA is acceptable when scientifically justified and the search for alternatives is considered. Immunization of laboratory animals may also be performed with FA containing a complex glycolipid, muramyl dipeptide, which can be extracted from mycobacterial cell walls or synthesized, and which contains much of the adjuvant activity of whole killed mycobacteria (Ogawa et al., 2011). Interestingly, vaccination with the newly developed CCR4 antagonist together with H. suis whole-cell lysate induced protection when applied subcutaneously, whilst clearly triggering

184

General Discussion less side effects. Mucosal administration of this adjuvant did not confer significant protection. CCR4 is a receptor for CCL22 and CCL17, the chemotactic agents attracting Tregs both in vivo and in vitro. Both chemokines are produced in large amounts by DCs upon activation and promote the contact between DC and CCR4+ T-cells. This small molecular weight antagonist to CCR4, identified by in silico approach, has previously been demonstrated to block the migration of CCR4+ Tregs in vitro and in vivo and to enhance DC mediated human CD4+ T- cell proliferation in vitro (Figure 1) (Bayry et al., 2008; Vitali et al., 2012). IL-10 producing Tregs are known to be increased in the gastric mucosa of H. pylori infected patients. They play a role in controlling immunopathology but also promote persistent infection. Since Tregs and IL-10 contribute to persistence of an infection with H. suis, we hypothesized that CCR4 antagonists might help to enhance immunogenicity of H. suis vaccines. Small molecule antagonist-based approach targeting the interaction between chemokines and their receptors to inhibit transiently the recruitment of Tregs at the site of immunization has been explored previously in other settings (Bayry et al., 2008; Davies et al., 2009). In chapter 3, we demonstrated that this CCR4 antagonist might be a new, promising adjuvant in H. suis vaccination. This adjuvant is safe and efficient, since the major advantage is that the recruitment of Tregs at the site of immunization is blocked transiently, with no subsequent marks of auto-immunity (Bayry et al., 2014a). This molecular adjuvant amplifies cellular and humoral responses when injected in combination with various vaccine antigens (Bayry, 2014b). This is another advantage compared to aluminum adjuvants, the only adjuvants licensed for human use worldwide, which almost exclusively induce humoral immune responses. At the downside, Tregs share most of the surface markers that are common with effector T-cells and hence many of the strategies that target Tregs lack specificity. CCR4 is also expressed by Th2 cells and by a small subset of Th17 cells. Therefore, CCR4 antagonists might inhibit antibody responses when used in the context of booster immunization as they might prevent interaction of DCs with memory Th2 cells (Bayry, 2014b). In any case, the use of CCR4 antagonists as adjuvant in future Helicobacter vaccines, and vaccines in general, requires further research before use in clinical trials.

185

General Discussion

Figure 1. Presentation of the CCR4 antagonist-based approach to target Treg-DC interaction in vaccination. (a) DC undergo maturation and activation upon receiving the signals from vaccine antigens. These DC secrete large amounts of chemokines CCL17 and CCL22 that attract CCR4- positive Tregs to the proximity of DC. (b) The migrated Tregs inhibit the activation and functions of DC and hence dampen the immune response to vaccines. (c) The small molecule antagonists to CCR4 block the interaction of CCR4 with CCL17 and CCL22 thus prevent the inhibitory action of Tregs on DC. As a consequence, DC undergo a complete activation process and induce maximum immune responses to vaccines (Bayry, 2014b).

4. The choice of antigen plays a major role in gastric Helicobacter vaccine efficacy

Previous immunization studies and the study described in chapter 3, have shown promising results in terms of protection when using H. suis whole-cell lysate as vaccine antigen (Vermoote et al., 2012; Vermoote et al., 2013). However, it is not likely, if not impossible, that a vaccine containing crude antigens will be authorized by regulatory authorities due to batch-to-batch variation and lack of thorough characterization of the preparation (Raghavan and Quiding-Järbrink, 2016). Good results on vaccine-induced protection have also been obtained using recombinant antigens from H. suis either alone or in combination. Urease has been proven to be an attractive vaccine antigen because it is highly conserved in the genus Heliocbacter and is required for colonization. Combination of urease with other antigens yields better results (Vermoote et al., 2013). Two or more recombinant proteins can also be genetically fused to create a multivalent vaccine, which might overcome logistical and

186

General Discussion manufacturing problems that would be associated with a vaccine composed of multiple antigens. The search for new vaccine antigens that are surface exposed and highly conserved in the genus Heliocbacter is still ongoing using genomic and proteomic approaches (Bumann et al., 2002; Dutta et al., 2006). Another possible and promising vaccination strategy against Helicobacter infections, that recently received attention is mRNA vaccination. The use of this type of vaccines has several advantages. The genetic construct harbors only the elements directly required for expression of the encoded protein. Moreover, while recombination between single-stranded RNA molecules may occur in rare cases, mRNA does not interact with the genome (Chetverin et al., 2004). Thus, potentially detrimental genomic integration is excluded. This lack of genomic integration in combination with mRNA being non-replicative as well as metabolically decaying within a few days, makes mRNA a merely transient carrier of information (Probst et al., 2007). In addition, mRNA binds to pattern recognition receptors and mRNA vaccines may be designed to be self-adjuvanting (Fotin-Mleczek et al., 2011). A mRNA vaccine expressing major H. suis virulence factors, together with the CCR4 antagonist as adjuvant might be a promising strategy. Future studies in this field will provide more information on the use of mRNA vaccines to combat Helicobacter infections. For the further development of a successful H. suis vaccine, better understanding of the mechanisms of vaccine-induced protection is necessary. Results from our study are in line with those of previous immunization studies against H. suis infections in mice. Probably a combination of local Th1 and Th17 responses play a role in protective immunity (Vermoote et al., 2012; Vermoote et al., 2013). It remains, however, unclear why subcutaneous vaccination with H. suis lysate together with the CCR4-antagonist did not induce Th17 responses, while still achieving protection. Therefore, the role of IL-17 in protection against H. suis infection requires further investigation. In previous immunization studies it was shown that circulating antibodies could also play a role in protection, as indicated by the correlation between the reduction of gastric H. suis colonization and the increase of antigen-specific antibodies (Vermoote et al., 2012; Vermoote et al., 2013). Our results demonstrated that serum levels of anti-lysate IgG in immunized mice were significantly elevated compared to negative controls at 3 weeks post-immunization and to both negative controls and sham-immunized mice at final euthanasia, which may support a role for antibodies in protection. However, several other H. pylori and H. felis immunization studies have demonstrated that antibodies are not essential (Blanchard et al., 1999; Gottwein et al., 2001; Garhart et al., 2003). Table I

187

General Discussion summarizes the remaining obstacles and the progress made in H. pylori and H. suis vaccination.

188

General Discussion

Table I. Summary of the remaining obstacles and the progress made in H. pylori and H. suis vaccination. H. pylori vaccination Obstacles Progress Protective immune mechanisms ➢ Complex pathogenesis and immune response ➢ Mice: CD4+ T helper cells but not CD8+ cytotoxic T- ➢ Immune evasion strategies (Treg response) cells or antibodies are crucial for vaccine induced ➢ Protective immune mechanisms that will lead to protection bacterial eradication in humans need to be further ➢ Probably, both Th1 and Th17 responses contribute to identified bacterial clearance Choice of antigen(s) ➢ Many different virulence factors with large genetic Major H. pylori virulence factors (cagPaI, CagA, VacA) have variability been well-studied and characterized. ➢ CagA, VacA, GGT both have pro-inflammatory and anti-inflammatory properties ➢ No consensus on which antigen or combination of antigens should be used Administration routes No consensus on which administration route should be used. Emphasis has been given to immunization via mucosal routes. Parenteral route has also been evaluated. Choice of adjuvants ➢ CT and LT: potent inducers of immune response but Efforts have been made to develop molecules with reduced toxic in humans (diarrhea, facial paralysis) toxicity but intact adjuvanticity (CTA1-DD, dmLT,..). ➢ Obvious need for safe adjuvants that are potent enhancers of both cellular and humoral immunity ➢ No consensus on which adjuvant should be used Side-effects Post-immunization gastritis Future studies are required H. suis vaccination Obstacles Progress Protective immune mechanisms ➢ Limited information on immune responses to H. suis Mice: probably a combination of Th1, Th17 and antibody infection (especially in natural hosts) responses are necessary ➢ Immune evasion strategies (Treg-response) ➢ Immune response elicited by H. suis infection is host species-specific Choice of antigen(s) ➢ Limited number of studies on H. suis virulence factors Good results obtained in terms of protection with a subunit ➢ H. suis lacks most important H. pylori virulence factors vaccine: combination of rUreB and rGGT in BALB/c mice. (cagPaI, CagA, VacA) that have been extensively studied Administration routes No consensus on which administration route should be used. Most studies suggest that the mucosal route should be used. This research suggests that subcutaneous vaccination can be used as well. Choice of adjuvants ➢ Previously used adjuvants in H. suis vaccination CCR4-antagonist: promising adjuvant to include in H. suis studies in mice: vaccines (good protection, less pseudo-pyloric metaplasia). ▪ CT: toxic for humans and pigs ▪ saponin-based adjuvant: low efficacy ➢ Obvious need for safe and efficient adjuvants

189

General Discussion

Side-effects Post-immunization gastritis, pseudo-pyloric metaplasia Vaccination with combination of rUreB and rGGT together with CT induced less post-vaccination gastritis. Vaccination with CCR4 antagonist and whole cell lysate also induced less post-vaccination gastritis.

5. Pro- and prebiotics: alternative treatment options

Finally, it might also be worthwhile to investigate if pre- or probiotics can be used as an alternative therapy for H. suis-related diseases in pigs. Probiotics are live microorganisms which, confer a health beneﬁt to the host, when administered in adequate amounts. Probiotics are not part of the current treatment therapies prescribed for H. pylori eradication, but there are numerous studies, most of them using probiotics as adjuvants to therapy, showing a reduction of side-effects in the greater majority of cases. The most frequently used probiotics for H. pylori infection are composed of Lactobacillus, Biﬁdobacterium, Saccharomyces, and Streptococcus spp. The mode of action of these probiotics relies on competition for nutrients and for adhesion to cell receptors, antimicrobial activity, and modulation of the immune system and microbiota. However, the clinical trials using probiotics as a complement to H. pylori eradication treatment are very diverse in their design and probiotic content, which may explain the contradicting published reports. Further studies in this field are required (Vale et al., 2016).

6. General conclusions

The results described in this doctoral thesis provide new insights into host immune responses evoked by H. suis infections. We demonstrated that H. suis is able to evade host immune responses by reprogramming porcine DCs towards a tolerogenic phenotype which skew T- cell responses to Treg-biased responses. These mechanisms are independent of the major H. pylori virulence factors CagA and VacA, which are absent in H. suis. Future research should focus on the H. suis virulence factors and their molecular mechanisms that might be involved in immune evasion and subsequently promote persistent infection. This may ultimately lead to the recognition of potential intervention targets to prevent the progression of chronic gastritis. We provided new insights in the development of MALT lymphoma-like lesions following H. suis infection in Mongolian gerbils. These lesions might be associated with the induction of a mixed inflammatory response probably involving Th1 signature cytokine IFN-γ, the upregulation of B-cell promoting factors, including CXCL13, and the possible involvement of Tregs. In any case, the mechanisms that regulate the development of MALT lymphoma following H. suis infections need to be further elucidated.

190

General Discussion

Before the start of this research, few H. suis vaccination studies had been performed. H. suis vaccine research has been promising, but has not yet delivered an effective vaccine. We describe the potential use of a novel, promising adjuvant, a CCR4 antagonist that transiently blocks Treg migration at the site of immunization, when administered subcutaneously together with H. suis whole-cell lysate. The mechanisms of vaccine-induced protection, identification of novel H. suis antigens and the presence of post-immunization gastritis warrant further research.

191

General Discussion

References

Akhiani AA, Stensson A, Schön K, Lycke N. 2006. The nontoxic CTA1-DD adjuvant enhances protective immunity against Helicobacter pylori infection following mucosal immunization. Scand J Immunol. 63:97-105. Baele M, Decostere A, Vandamme P, Ceelen L, Hellemans A, Chiers K, Ducatelle R, Haesebrouck F. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. Int J Syst Evol Microbiol. 58:1350-1358. Bayry J, Tchilian EZ, Davies MN, Forbes EK, Draper SJ, Kaveri SV, Hill AV, Kazatchkine MD, Beverley PC, Flower DR, Tough DF. 2008. In silico identified CCR4 antagonists target regulatory T cells and exert adjuvant activity in vaccination. Proceedings of the National Academy of Sciences of the United States of America. 105:10221-10226. Bayry J, Tartour E, Tough DF. 2014a. Targeting CCR4 as an emerging strategy for cancer therapy and vaccines. Trends Pharmacol Sci. 35:163-165. Bayry J. 2014b. Regulatory T cells as adjuvant target for enhancing the viral disease vaccine efficacy. Virusdisease. 25:18-25. Beigier-Bompadre M, Moos V, Belogolova E, Allers K, Schneider T, Churin Y, Ignatius R, Meyer TF, Aebischer T. 2011. Modulation of the CD4+ T-cell response by Helicobacter pylori depends on known virulence factors and bacterial cholesterol and cholesterol alpha-glucoside content. J Infect Dis. 204:1339-1348. Beswick EJ, Pinchuk IV, Minch K, Suarez G, Sierra JC, Yamaoka Y, Reyes VE. 2006. The Helicobacter pylori urease B subunit binds to CD74 on gastric epithelial cells and induces NF-kappaB activation and interleukin-8 production. Infect Immun. 74:1148- 55. Blanchard TG, Czinn SJ, Redline RW, Sigmund N, Harriman G, Nedrud JG. 1999. Antibody independent protective mucosal immunity to gastric Helicobacter infection in mice. Cell Immunol. 191:74-80. Bumann D, Aksu S, Wendland M, Janek K, Zimny-Arndt U, Sabarth N, Meyer TF, Jungblut PR. 2002. Proteome analysis of secreted proteins of the gastric pathogen Helicobacter pylori. Infect Immun. 70:3396-403. Chetverin AB. Replicable and recombinogenic RNAs. 2004. FEBS Lett. 567:35-41. Cook KW, Letley DP, Ingram RJ, Staples E, Skjoldmose H, Atherton JC, Robinson K. 2014. CCL20/CCR6-mediated migration of regulatory T cells to the Helicobacter pylori- infected human gastric mucosa. Gut. 63:1550-1559.

192

General Discussion

Craig VJ, Cogliatti SB, Arnold I, Gerke C, Balandat JE, Wundisch T, Muller A. 2010. B-cell receptor signaling and CD40 ligand-independent T cell help cooperate in Helicobacter-induced MALT lymphomagenesis. Leukemia. 24:1186-1196. Davies MN, Bayry J, Tchilian EZ, Vani J, Shaila MS, Forbes EK, Draper SJ, Beverley PC, Tough DF, Flower DR. 2009. Toward the discovery of vaccine adjuvants: coupling in silico screening and in vitro analysis of antagonist binding to human and mouse CCR4 receptors. PLoS One. 4:e8084. De Bruyne E, Flahou B, Chiers K, Meyns T, Kumar S, Vermoote M, Pasmans F, Millet S, Dewulf J, Haesebrouck F, Ducatelle R. 2012. An experimental Helicobacter suis infection causes gastritis and reduced daily weight gain in pigs. Vet Microbiol. 160:449-454. D'Elios MM, Amedei A, Del Prete G. 2003. Helicobacter pylori antigen-specific T-cell responses at gastric level in chronic gastritis, peptic ulcer, gastric cancer and low- grade mucosa-associated lymphoid tissue (MALT) lymphoma. Microbes Infect. 5:723- 30. D'Orlando O, Gri G, Cattaruzzi G, Merluzzi S, Betto E, Gattei V, Pucillo C. 2007. Outside inside signaling in CD40-mediated B cell activation. J Biol Regul Homeost Agents. 21:49-62. Dutta A, Singh SK, Ghosh P, Mukherjee R, Mitter S, Bandyopadhyay D. 2006. In silico identification of potential therapeutic targets in the human pathogen Helicobacter pylori. In Silico Biol. 6:43-7. Elliott EA, Drake JR, Amigorena S, Elsemore J, Webster P, Mellman I, Flavell RA.1994. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J. Exp. Med. 179:681-694. Eriksson AM, Schön KM, Lycke NY. 2004. The cholera toxin-derived CTA1-DD vaccine adjuvant administered intranasally does not cause inflammation or accumulate in the nervous tissues. J Immunol. 173:3310-9. Fan X, Gunasena H, Cheng Z, Espejo R, Crowe SE, Ernst PB, Reyes VE. 2000. Helicobacter pylori urease binds to class II MHC on gastric epithelial cells and induces their apoptosis. J Immunol. 165:1918-24. Flahou B, De Baere T, Chiers K, Pasmans F, Haesebrouck F, Ducatelle R. 2010. Gastric infection with Kazachstania heterogenica influences the outcome of a Helicobacter suis infection in Mongolian gerbils. Helicobacter. 15:67-75.

193

General Discussion

Floch P, Laur AM, Korolik V, Chrisment D, Cappellen D, Idrissi Y, Dubus P, Mégraud F, Lehours P. 2015. Characterisation of inflammatory processes in Helicobacter pylori-induced gastric lymphomagenesis in a mouse model. Oncotarget. 6:34525-36. Fotin-Mleczek M, Duchardt KM, Lorenz C, Pfeiffer R, Ojkić-Zrna S, Probst J, Kallen KJ. 2011. Messenger RNA-based vaccines with dual activity induce balanced TLR-7 dependent adaptive immune responses and provide antitumor activity. J Immunother. 34:1-15. Garhart CA, Nedrud JG, Heinzel FP, Sigmund NE, Czinn SJ. 2003. Vaccine-induced protection against Helicobacter pylori in mice lacking both antibodies and interleukin- 4. Infect Immun. 71:3628-33. Gottwein JM, Blanchard TG, Targoni OS, Eisenberg JC, Zagorski BM, Redline RW, Nedrud JG, Tary-Lehmann M, Lehmann PV, Czinn SJ. 2001. Protective anti-Helicobacter immunity is induced with aluminum hydroxide or complete Freund's adjuvant by systemic immunization. J Infect Dis. 184: 308-314. Greiner A, Knörr C, Qin Y, Sebald W, Schimpl A, Banchereau J, Müller-Hermelink HK. 1997. Low-grade B cell lymphomas of mucosa-associated lymphoid tissue (MALT- type) require CD40-mediated signaling and Th2-type cytokines for in vitro growth and differentiation. Am J Pathol. 150:1583-93. Haesebrouck F, Pasmans F, Flahou B, Chiers K, Baele M, Meyns T, Decostere A, Ducatelle R. 2009. Gastric helicobacters in domestic animals and non-human primates and their significance for human health. Clin Microbiol Rev. 22:202-23. Harris PR, Mobley HL, Perez-Perez GI, Blaser MJ, Smith PD. 1996. Helicobacter pylori urease is a potent stimulus of mononuclear phagocyte activation and inflammatory cytokine production. Gastroenterology. 111:419-25. Joo M, Kwak JE, Chang SH, Kim H, Chi JG, Kim KA, Yang JH, Lee JS, Moon YS, Kim KM. 2007. Helicobacter heilmannii-associated gastritis: clinicopathologic findings and comparison with Helicobacter pylori-associated gastritis. J Korean Med Sci. 22:63-69. Laur AM, Floch P, Chambonnier L, Benejat L, Korolik V, Giese A, Dubus P, Mégraud F, Bandeira A, Lehours P. 2016. Regulatory T cells may participate in Helicobacter pylori persistence in gastric MALT lymphoma: lessons from an animal model. Oncotarget. 7:3394-402.

194

General Discussion

Lina TT, Alzahrani S, Gonzalez J, Pinchuk IV, Beswick EJ, Reyes VE. 2014. Immune evasion strategies used by Helicobacter pylori. World J Gastroenterol. 20:12753-66. Malfertheiner P, Megraud F, O’Morain CA, Atherton J, Axon AT, Bazzoli F, Gensini GF, Gisbert JP, Graham DY, Rokkas T, El-Omar EM, Kuipers EJ; European Helicobacter Study Group. 2012. Management of Helicobacter pylori infection - the Maastricht IV/Florence Consensus report. Gut. 61:646-664. Melnichouk SI, Friendship RM, Dewey CE, Bildfell RJ, Smart NL. 1999. Helicobacter-like organisms in the stomach of pigs with and without gastric ulceration. Swine Health Prod. 7:201-205. Mimura T, Yoshida M, Nishiumi S, Tanaka H, Nobutani K, Takenaka M, Suleiman YB, Yamamoto K, Ota H, Takahashi S, Matsui H, Nakamura M, Miki I,Azuma T. 2011. IFN-γ plays an essential role in the pathogenesis of gastric lymphoid follicles formation caused by Helicobacter suis infection. FEMS Immunol Med Microbiol. 63:25-34. Nakamura M, Murayama SY, Serizawa H, Sekiya Y, Eguchi M, Takahashi S, Nishikawa K, Takahashi T, Matsumoto T, Yamada H, Hibi T, Tsuchimoto K, Matsui H. 2007. “Candidatus Helicobacter heilmannii” from a cynomolgus monkey induces gastric mucosa-associated lymphoid tissue lymphomas in C57BL/6 mice. Infect Immun. 75:1214-1222 Nakamura M, Takahashi S, Matsui H, Murayama SY, Aikawa C, Sekiya Y, Nishikawa K, Matsumoto T, Yamada H, Tsuchimoto K. 2008. Microcirculatory alteration in low- grade gastric mucosa-associated lymphoma by Helicobacter heilmannii infection: its relation to vascular endothelial growth factor and cyclooxygenase-2. J Gastroenterol Hepatol. 23:S157-S160. Ogawa C, Liu YJ, Kobayashi KS. 2011. Muramyl dipeptide and its derivatives: peptide adjuvant in immunological disorders and cancer therapy. Curr Bioact Compd. 7:180- 197. Ogra PL, Faden H, Welliver RC. 2001. Vaccination Strategies for Mucosal Immune Responses. Clinical Microbiology Reviews. 14:430-445. Phadnis SH, Parlow MH, Levy M, Ilver D, Caulkins CM, Connors JB, Dunn BE. 1996. Surface localization of Helicobacter pylori urease and a heat shock protein homolog requires bacterial autolysis. Infect Immun. 64:905-12.

195

General Discussion

Probst J, Weide B, Scheel B, Pichler BJ, Hoerr I, Rammensee HG, Pascolo S. 2007. Spontaneous cellular uptake of exogenous messenger RNA in vivo is nucleic acid- specific, saturable and ion dependent. Gene Ther. 14:1175-80. Raghavan S and Quiding-Järbrink M. 2016. Vaccination against Helicobacter pylori infection. Book: Helicobacter pylori research: from bench to bedside, Springer Japan. Saito Y, Suzuki H, Tsugawa H, Imaeda H, Matsuzaki J, Hirata K, Hosoe N, Nakamura M, Mukai M, Saito H, Hibi T. 2012. Overexpression of miR-142-5p and miR-155 in gastric mucosa-associated lymphoid tissue (MALT) lymphoma resistant to Helicobacter pylori eradication. PLoS One. 7:e47396. Sjökvist Ottsjö L, Flach CF, Clements J, Holmgren J, Raghavan S. 2013. A double mutant heat-labile toxin from Escherichia coli, LT (R192G/L211A), is an effective mucosal adjuvant for vaccination against Helicobacter pylori infection. Infect Immun. 81:1532-40. Stolte M, Bayerdörffer E, Morgner A, Alpen B, Wündisch T, Thiede C, Neubauer A. Helicobacter and gastric MALT lymphoma. 2002. Gut. 50:III19-24. Sundling C, Schön K, Mörner A, Forsell MN, Wyatt RT, Thorstensson R, Karlsson Hedestam GB, Lycke NY. 2008. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization. J Gen Virol. 89:2954-64. Vale FF, Vitor JMB, Oléastro M. 2016. Vaccination against Helicobacter pylori infection. Book: Helicobacter pylori research: from bench to bedside, Springer Japan. Vermoote M, Vandekerckhove TTM, Flahou B, Pasmans F, Smet A, De Groote D, Van Criekinge W, Ducatelle R, Haesebrouck F. 2011a. Genome sequence of Helicobacter suis supports its role in gastric pathology. Veterinary Research. 42:51. Vermoote M, Pasmans F, Flahou B, Van Deun K, Ducatelle R, Haesebrouck F. 2011b. Antimicrobial susceptibility pattern of Helicobacter suis strains. Vet Microbiol. 153:339-42. Vermoote M, Van Steendam K, Flahou B, Smet A, Pasmans F, Glibert P, Ducatelle R, Deforce D, Haesebrouck F. 2012. Immunization with the immunodominant Helicobacter suis urease subunit B induces partial protection against H. suis infection in a mouse model. Vet Res. 43:72. Vermoote M, Flahou B, Pasmans F, Ducatelle R, Haesebrouck F. 2013. Protective efficacy of vaccines based on the Helicobacter suis urease subunit B and γ-glutamyl transpeptidase. Vaccine. 31:3250-6.

196

General Discussion

Vitali C, Mingozzi F, Broggi A, Barresi S, Zolezzi F, Bayry J, Raimondi G, Zanoni I, Granucci F. 2012. Migratory, and not lymphoid-resident, dendritic cells maintain peripheral self-tolerance and prevent autoimmunity via induction of iTreg cells. Blood. 120:1237-45. Weeks DL, Sachs G. Sites of pH regulation of the urea channel of Helicobacter pylori. 2001. Mol Microbiol. 40:1249-59. Yamamoto K, Nishiumi S, Yang L, Klimatcheva E, Pandina T, Takahashi S, Matsui H, Nakamura M, Zauderer M, Yoshida M, Azuma T. 2014. Anti-CXCL13 antibody can inhibit the formation of gastric lymphoid follicles induced by Helicobacter infection. Mucosal Immunol. 7:1244-54. Yang L, Yamamoto K, Nishiumi S, Nakamura M, Matsui H, Takahashi S, Dohi T, Okada T, Kakimoto K, Hoshi N, Yoshida M, Azuma T. 2015. Interferon-γ-producing B cells induce the formation of gastric lymphoid follicles after Helicobacter suis infection. Mucosal Immunol. 8:279-95. Zhang G, Ducatelle R, Mihi B, Smet A, Flahou B, Haesebrouck F. 2016. Heliocbacter suis affects the health and function of gastric parietal cells. Vet Res. 47:101. Zhang G, Ducatelle R, De Bruyne E, Joosten M, Bosschem I, Smet A, Haesebrouck F, Flahou B. 2015. Role of γ-glutamyltranspeptidase in the pathogenesis of Helicobacter suis and Helicobacter pylori infections. Vet Res. 46:31.

197

General Discussion

198

Summary

199

200

Summary

In 1984, it was reported for the first time that a bacterium, residing in the stomach, plays a role in the development of gastritis, peptic ulcers and gastric cancer in humans. This bacterium was later named Helicobacter (H.) pylori. Since the discovery of H. pylori, a large number of non-Helicobacter pylori helicobacter (NHPH) species have been described in a wide variety of animals. H. suis colonizes the stomach of more than 60% of pigs at slaughter age worldwide, and is also of zoonotic importance. H. suis infection in pigs causes chronic gastritis and a decrease in daily weight gain. It may be involved in the development of gastric ulcers. Since economic losses due to these infections are believed to be substantial, preventive measures to combat this highly prevalent pathogen are necessary. Antibiotic-based therapy for large scale control of gastric Helicobacter infections is a non-sustainable and sometimes inadequate strategy as it may favor spread of antimicrobial resistance. Alternatively, vaccination could potentially be used to control gastric Helicobacter infections. Although efforts have been made to develop safe and efficient H. suis vaccines, hitherto there is no consensus on which vaccine antigen or combination of antigens, adjuvants and administration route should be used. Unlike H. pylori, limited information is available on the immune response following H. suis infections in rodent models and the natural hosts. This is mainly due to the fastidious nature of this bacterium, which was only successfully cultivated in vitro in 2008. This has paved the way for further research on H. suis infections.

The general aim of this doctoral research was to develop new control strategies against H. suis infection, based on a better understanding of the mechanisms of a protective immune response.

Experimental H. suis infection in BALB/c and C57BL/6 mice, generally causes a predominant Th17 response in the stomach. Mainly in BALB/c mice this is accompanied by a mild Th2 response. The immune response induced by H. pylori infection on the other hand, is characterized by a Th17/Th1 response and the absence of a Th2 response in humans and rodent models. This different immune response could play a role in the development of different pathologies by Helicobacter species. Chronic H. suis infection in humans is associated with the development of mucosa-associated lymphoid tissue (MALT) lymphoma- like lesions, whereas H. pylori infection causes predominantly adenocarcinoma. Both H. pylori and H. suis are able to evade the host immune responses and may cause persistent infection of the stomach in the absence of proper treatment. Several immune evasion mechanisms have been proposed for H. pylori, which focus to a great extent on its major virulence factors: the CagA protein encoded in the cag (cytotoxin-associated gene)

201

Summary pathogenicity island (cagPAI) and vacuolating toxin A (VacA). However, both virulence factors are absent in H. suis. In Chapter 1 we aimed at investigating the species-specific immune response following H. suis infection. Therefore, the dynamics of cytokine expression were monitored in the stomach of BALB/c mice experimentally infected with H. suis and revealed a local Th17/Th2 response. Despite the subsequent neutrophil and mononuclear cell influx in the murine stomach, the host was unable to clear H. suis infection. The cytokine expression profile in the stomach of pigs naturally infected with H. suis was also determined. Natural H. suis infection in pigs evoked increased expression levels of IL-17 mRNA in the antrum and IL-10 mRNA in the fundus. In the next part of this study, the effect of H. suis on murine and porcine dendritic cell (DC) maturation and their ability to elicit T-cell effector responses was analyzed in vitro. This revealed remarkable differences between both hosts. H. suis-stimulated murine bone marrow-derived DCs induced IL-17 secretion by CD4+ cells in vitro. In contrast with mice, H. suis-stimulated porcine monocyte-derived DCs were unable to express MHCII molecules on their cell surface. These semi-mature DCs induced activation and proliferation of T-cells, which showed an increased expression of TGF-β and FoxP3 mRNA levels which may result in the inhibition of Th17 responses. This led us to conclude that H. suis might evade host immune responses by skewing T-cell responses towards a Treg- biased response, by mechanisms which are independent of the H. pylori virulence factors CagA and VacA. In order to elucidate these mechanisms and to further unravel the species- specific differences in immunity to H. suis, further studies are required.

H. suis mainly colonizes the stomach of pigs, but it has also been detected in the stomach of several non-human primates. Phylogenetic analysis has shown that pig and human-associated (1), cynomolgus monkey-associated (2) and rhesus monkey-associated (3) H. suis strains form 3 distinct clusters. Cynomolgus monkey-associated H. suis strains have been used in several infection studies in mice and were associated with the development of MALT lymphoma-like lesions in these animals. These lesions are not observed in mice when using pure in vitro-cultured porcine H. suis strains. In any case, direct comparison between H. suis strains from these different hosts was difficult before the start of this research, since no pure in vitro-cultured primate-associated H. suis strains were available. Our research group was the first to succeed in cultivating pure H. suis strains from cynomolgus monkeys (Macaca fascicularis) and rhesus monkeys (Macaca mulatta). In Chapter 2 we described the experimental infection of BALB/c mice and Mongolian gerbils with in vitro isolated H. suis strains obtained from pigs, cynomolgus monkeys and rhesus monkeys, in an attempt to obtain

202

Summary better insights into potential differences between pig- and primate-associated H. suis strains in terms of virulence and immuno-pathogenesis. Both porcine and primate H. suis strains caused severe gastric inflammation in both rodent models, except for the cynomolgus monkey- associated H. suis strain which was unable to colonize the stomach of Mongolian gerbils. All H. suis strains evoked a marked Th17 response in both mice and gerbils, accompanied by increased CXCL13 expression levels. In Mongolian gerbils increased expression of Th1 marker IFN-γ was also observed. Nine weeks after infection, gastric lymphoid follicles containing CD20 positive B-cells organized in germinal centers and destruction of the antral epithelium were observed in all H. suis infected Mongolian gerbils, but not in mice. These histopathological findings resemble MALT lymphoma-like lesions, as observed in humans infected with NHPH. In addition, this is the first study to confirm the role of IFN-γ in the development of MALT lymphoma-like lesions following infection with pure in vitro isolated pig- and primate-associated H. suis strains.

In conclusion, apart from the cynomolgus monkey-associated strain which was unable of colonizing the stomach of Mongolian gerbils, no substantial differences in virulence were found in rodent models between in vitro cultured pig-associated, cynomolgus monkey- associated and rhesus monkey-associated H. suis strains. It was shown that mainly the experimental host determines the outcome of the immune response against H. suis infection, rather than the original host where the strains were obtained from.

Before the start of this research, only a limited number of vaccination studies against H. suis infection had been performed. Promising results have been obtained using either H. suis whole-cell lysate or a combination of recombinant (r) GGT and rUreB to protect mice against subsequent H. suis infection. No other adjuvants besides Cholera toxin (CT) and a saponin- based adjuvant had previously been tested in H. suis vaccination studies. However, due to the toxicity of CT, and the low efficacy of the saponin-based adjuvant, there was an obvious need for the introduction of new, safe vaccine adjuvants that might induce both cellular and humoral immune responses. Therefore, in Chapter 3, we investigated the efficacy of several established vaccine adjuvants (CpG-DNA, Curdlan, Freund’s Complete (FA) and Incomplete (IFA), CT), administered either subcutaneously or intranasally along with H. suis whole-cell lysate, to protect against subsequent H. suis challenge in a BALB/c infection model. Subcutaneous immunization with FA/lysate and intranasal immunization with CT/lysate were shown to be the best options for vaccination against H. suis, as determined by the amount of colonizing H. suis bacteria in the stomach, although adverse effects such as post-

203

Summary immunization gastritis/pseudo-pyloric metaplasia and increased mortality were observed, respectively. Therefore, alternative vaccination strategies were tested, including sublingual vaccine administration, to reduce the unwanted side-effects. A C-C chemokine receptor type 4 (CCR4) antagonist, that transiently inhibits the recruitment of regulatory T-cells (Tregs) at the site of immunization, was also included as a new adjuvant in this second study. Results confirmed that immunization with CT (intranasally or sublingually) is among the most effective vaccination protocols, but increased mortality was still observed. In the groups immunized subcutaneously with FA/lysate and CCR4 antagonist/lysate, a significant protection was observed. Compared to the FA/lysate immunized group, gastric pseudo-pyloric metaplasia was less severe or even absent in the CCR4 antagonist/lysate immunized group. In general, in animals vaccinated with strategies that conferred the highest degree of protection, increased expression levels of IFN-γ, IL-4, IL-17, KC, MIP-2 and LIX mRNA were observed. Compared to the non-immunized and H. suis challenged animals, IL-10 expression levels were consistently lower in animals from all immunized/challenged groups. The use of a CCR4 antagonist as adjuvant in H. suis vaccines might be a promising strategy, however, future studies should aim at further optimization of these immunization protocols.

In conclusion, the results described in this doctoral thesis provide new insights into host immune responses evoked by H. suis infections in animal models and in its natural host, the pig. We suggested that H. suis is able to evade host immune responses by reprogramming porcine DCs towards a tolerogenic phenotype which skews T-cell responses towards Treg- biased responses. In addition, we provided new insights in the development of MALT lymphoma-like lesions following infection with in vitro cultured primate and pig-associated H. suis strains in Mongolian gerbils. Finally, we describe the potential use of a new, promising adjuvant, a CCR4 antagonist, in H. suis vaccination.

204

Samenvatting

205

206

Samenvatting

In 1984 werd voor het eerst beschreven dat een bacterie, die aanwezig is in de maag, een rol speelt in de ontwikkeling van maagontsteking, peptische ulcera en maagkanker bij mensen. Deze bacterie werd later Helicobacter (H.) pylori genoemd. Na de ontdekking van H. pylori, werden Helicobacter species ook aangetoond bij verschillende diersoorten. H. suis koloniseert de maag van meer dan 60% van de slachtvarkens wereldwijd en is ook van zoönotisch belang. H. suis infecties veroorzaken bij varkens een chronische maagontsteking, een daling van de dagelijkse gewichtsaanzet en ze worden geassocieerd met de ontwikkeling van maagulcera. Gezien de economische verliezen die gepaard gaan met deze infecties en het zoönotisch karakter ervan, zijn preventieve maatregelen om deze veel voorkomende bacterie te bestrijden noodzakelijk. Antibioticatherapie levert niet altijd goede resultaten op. Bovendien is het geen duurzame methode om H. suis infecties op grote schaal te bestrijden, aangezien het de spreiding van antimicrobiële resistentie in de hand kan werken. Vaccinatie zou mogelijks gebruikt kunnen worden om gastrale Helicobacter infecties te bestrijden. Hoewel er reeds onderzoek is gebeurd om een veilig en efficiënt H. suis vaccin te ontwikkelen, is er tot dusver geen consensus over welke antigenen, adjuvantia en toedieningsroutes gebruikt moeten worden. In tegenstelling tot H. pylori, werd slechts sporadisch onderzoek uitgevoerd naar de immuunrespons na een H. suis infectie. Dit geldt voor knaagdieren zoals muizen en Mongoolse gerbils, die vaak als model voor de mens gebruikt worden, maar is nog meer het geval voor de natuurlijke gastheer, het varken. Dit is vooral te wijten aan het feit dat H. suis zeer moeilijk te cultiveren is. Pas in 2008 werd deze kiem succesvol geïsoleerd in vitro. Dit zorgde ervoor dat verder onderzoek naar H. suis infecties mogelijk was.

Het algemene doel van dit doctoraatsonderzoek was om nieuwe controle strategieën te ontwikkelen tegen H. suis infecties, gebaseerd op een betere kennis van de mechanismen van een beschermende immuunrespons.

Een experimentele H. suis infectie in BALB/c en C57BL/6 muizen veroorzaakt over het algemeen een predominante Th17 respons in de maag. Voornamelijk in BALB/c muizen wordt deze vergezeld door een milde Th2 respons. In knaagdiermodellen en bij de mens is de opbouw van immuniteit als reactie op een H. pylori infectie, daarentegen gekenmerkt door een Th17/Th1 respons en de afwezigheid van een Th2 respons. Dit verschil in immuunrespons zou een rol kunnen spelen in de ontwikkeling van de verschillende pathologieën door deze Helicobacter species. Een chronische H. suis infectie wordt bij mensen geassocieerd met de ontwikkeling van mucosa-geassocieerd lymfoïd weefsel (MALT) lymfomen, terwijl een H. pylori infectie voornamelijk adenocarcinoma’s kan

207

Samenvatting veroorzaken. Zowel H. pylori als H. suis zijn in staat om de immuunrespons van de gastheer te omzeilen en kunnen aldus een chronische maaginfectie teweeg brengen in afwezigheid van een gepaste behandeling. Verschillende mechanismen om het immuunsysteem van de gastheer te omzeilen werden reeds beschreven voor H. pylori. De belangrijkste virulentiefactoren die hierbij tussen komen zijn het CagA eiwit, dat gecodeerd wordt in het cag (cytotoxine-geassocieerd gen) pathogeniciteitseiland (cagPAI) en het vacuoliserend toxine A (VacA). Deze zijn echter afwezig in H. suis. In hoofdstuk 1 werd de immuniteit na een H. suis infectie bij muizen en varkens onderzocht. De dynamiek van de cytokine expressie werd opgevolgd in de maag van BALB/c muizen die experimenteel geïnfecteerd werden met H. suis en bracht een lokale Th17/Th2 respons aan het licht. Ondanks de hierop volgende infiltratie van neutrofielen en mononucleaire cellen in de maag van de muizen, waren deze niet in staat de infectie te eradiceren. Bij varkens die geïnfecteerd waren werd het expressie profiel van verschillende cytokines in de maag bepaald. Een natuurlijke H. suis infectie veroorzaakte bij varkens een verhoogde expressie van IL-17 mRNA in het antrum en IL-10 mRNA in de fundus. In het volgende deel van deze studie werd het effect van H. suis op dendritische cellen (DC), afkomstig van muizen en varkens in vitro geanalyseerd. Het vermogen van deze antigen-presenterende cellen om T-cel responsen uit te lokken werd eveneens onderzocht. Dit bracht opmerkelijke verschillen tussen beide gastheren aan het licht. H. suis-gestimuleerde DCs afkomstig van het beenmerg van BALB/c muizen induceerden IL- 17 secretie door CD4+ cellen. In contrast met het muismodel, waren H. suis-gestimuleerde DCs afkomstig van monocyten van varkens niet in staat om MHCII moleculen tot expressie te brengen op hun celoppervlak. Deze onvolledig gematureerde DCs induceerden activatie en proliferatie van T-cellen, die een verhoogde expressie van TGF-β en FoxP3 mRNA vertoonden. Dit zou kunnen resulteren in de inhibitie van Th17 responsen. Dit duidt erop dat H. suis de immuunrespons van de gastheer kan ontwijken door het uitlokken van een Treg- gemedieerde respons, via mechanismen die onafhankelijk zijn van de H. pylori virulentiefactoren CagA en VacA. Verdere studies zijn noodzakelijk om deze mechanismen verder te ontrafelen en om de verschillen in immuniteitsopbouw bij verschillende gastheerspecies te verklaren.

H. suis koloniseert niet enkel de maag van varkens en mensen. Deze bacterie werd ook gedetecteerd in de maag van verschillende niet-humane primaten. Fylogenetische analyse heeft uitgewezen dat de H. suis stammen kunnen ingedeeld worden in drie verschillende clusters. Een eerste cluster omvat stammen die voorkomen bij varkens en mensen. Stammen

208

Samenvatting die aangetoond werden bij cynomolgus apen (Macaca fascicularis) vormen een tweede cluster. Een derde cluster omvat H. suis stammen van rhesus apen (Macaca mulatta). In de literatuur werd beschreven dat muizen die geïnoculeerd werden met H. suis stammen die aanwezig waren in maaghomogenaat van cynomolgus apen, MALT lymfomen ontwikkelden. Deze letsels werden niet geobserveerd bij muizen na infectie met zuivere in vitro gecultiveerde porciene H. suis stammen. Hoe dan ook, een directe vergelijking tussen de H. suis stammen van deze verschillende gastheren was voor de start van dit onderzoek niet mogelijk omdat er geen zuivere, in vitro gecultiveerde H. suis stammen van apen beschikbaar waren. Onze onderzoeksgroep slaagde er als eerste in om zuivere H. suis stammen van cynomolgus apen en rhesus apen te cultiveren. In hoofdstuk 2 werd een experimentele infectie van BALB/c muizen en Mongoolse gerbils beschreven met in vitro gecultiveerde H. suis stammen, die werden geïsoleerd uit de maag van varkens, cynomolgus apen en rhesus apen. Deze studie had als doel een beter inzicht te verwerven in potentiële verschillen betreffende virulentie en immunopathogenese tussen deze H. suis stammen. Zowel de varken- als de primaat-geassocieerde H. suis stammen veroorzaakten ernstige gastrale inflammatie in beide diermodellen, met uitzondering van de cynomolgus aap-geassocieerde H. suis stam die niet in staat was om de maag van Mongoolse gerbils te koloniseren. Alle H. suis stammen induceerden een uitgesproken Th17 respons, vergezeld van verhoogde CXCL13 mRNA expressie in zowel muizen als Mongoolse gerbils. Bij Mongoolse gerbils werd eveneens een verhoogde expressie van IFN-γ mRNA geobserveerd. Bij vrijwel alle geïnfecteerde gerbils werd 9 weken na de infectie destructie van het maagepitheel ter hoogte van het antrum aangetoond en werden gastrale lymfoïde follikels teruggevonden met CD20 positieve B- cellen die georganiseerd waren in germinale centra. Dergelijke histologische bevindingen lijken op de MALT lymfomen, die gezien worden bij mensen die geïnfecteerd zijn met H. suis. Ze werden niet aangetoond bij de muizen. Dit is de eerste studie die de rol van IFN-γ bevestigt in de ontwikkeling van MALT lymfomen na een infectie met zuivere in vitro geïsoleerde varken- en primaat-geassocieerde H. suis stammen. Als conclusie kunnen we stellen dat, behalve de cynomolgus aap-geassocieerde stam die niet in staat was om de maag van Mongoolse gerbils te koloniseren, er geen noemenswaardige verschillen in virulentie werden gevonden in beide knaagdiermodellen tussen in vitro gecultiveerde varken-geassocieerde, cynomolgus aap-geassocieerde en rhesus aap- geassocieerde H. suis stammen. Er werd aangetoond dat het type van immuunrespons verschilt afhankelijk van de diersoort die geïnfecteerd wordt. Dit geld zowel voor stammen die geïsoleerd werden bij varkens als voor stammen afkomstig van apen.

209

Samenvatting

Voor de start van dit onderzoek waren er maar een beperkt aantal vaccinatie studies tegen H. suis uitgevoerd. In experimentele infectiestudies bij muizen, werden veelbelovende resultaten bekomen wanneer een cellysaat van H. suis of een combinatie van recombinant (r) aangemaakt γ-glutamyl transpeptidase (rGGT) en Urease B (rUreB) gebruikt werden als vaccin. Enkel Cholera toxine (CT) en een saponine-gebaseerd adjuvans werden in deze voorgaande H. suis vaccinatie studies gebruikt. Omwille van de toxiciteit van CT, en de beperkte werkzaamheid van het saponine-gebaseerd adjuvans, was er duidelijk nood aan de introductie van een nieuw, veilig vaccin adjuvans dat zowel cellulaire als humorale immuniteit zou kunnen induceren. In hoofdstuk 3, werd er onderzoek gedaan naar de werkzaamheid van verschillende bestaande adjuvantia (CpG-DNA, Curdlan, volledig (FA) en onvolledig Freund’s adjuvans (IFA), CT). Deze werden subcutaan of intranasaal samen met H. suis cellysaat toegediend aan BALB/c muizen die daarna intragastraal geïnoculeerd werden met H. suis. Subcutane vaccinatie met FA/lysaat en intranasale vaccinatie met CT/lysaat induceerden de beste bescherming, wat zich onder andere uitte door een significant lager aantal H. suis bacteriën in de maag. Er werd evenwel ook een post-immunisatie gastritis/pseudo-pylorische metaplasie vastgesteld bij de muizen die subcutaan gevaccineerd werden met FA/lysaat en een verhoogde mortaliteit bij muizen die intranasaal gevaccineerd werden met CT/lysaat. Om deze ongewenste bijwerkingen tegen te gaan, werden in een tweede studie alternatieve vaccinatie strategieën uitgetest, waaronder sublinguale vaccinatie. Als nieuw adjuvans werd een C-C chemokine receptor type 4 (CCR4) antagonist uitgetest. Deze zorgt voor een kortstondige inhibitie van de rekrutering van regulatoire T-cellen naar de plaats van immunisatie. De resultaten van deze studie bevestigden dat immunisatie met CT (intranasaal of sublinguaal) behoort tot de meest effectieve vaccinatie protocollen, maar de verhoogde mortaliteit was nog steeds aanwezig. In de groepen die gevaccineerd werden met FA/lysaat en CCR4 antagonist/lysaat, werd een significante bescherming waargenomen. In vergelijking met de FA/lysaat gevaccineerde groep was gastrale pseudo-pylorische metaplasie minder ernstig en soms zelfs afwezig in de CCR4 antagonist/lysaat gevaccineerde groep. Over het algemeen werd bij dieren gevaccineerd met protocollen die de beste bescherming boden, een verhoogde expressie van IFN-γ, IL-4, IL-17, KC, MIP2 en LIX mRNA aangetoond. In vergelijking met de niet-gevaccineerde en H. suis geïnfecteerde dieren, was de IL-10 mRNA expressie consequent lager bij alle gevaccineerde en H. suis geïnfecteerde dieren. Het gebruik van een CCR4 antagonist als adjuvans in H. suis vaccins zou een veelbelovende strategie kunnen zijn. Een verdere optimalisatie van deze vaccinatie strategieën is evenwel noodzakelijk.

210

Samenvatting

Als conclusie kan gesteld worden dat dit doctoraatsonderzoek toeliet om nieuwe inzichten te bekomen in de immuunrespons na een H. suis infectie in knaagdiermodellen en de natuurlijke gastheer, het varken. De resultaten duiden erop dat H. suis bacteriën in staat zijn om de immuunrespons bij een geïnfecteerd varken te ontwijken door DCs te reprogrammeren naar een tolerogeen fenotype dat een Treg-gemedieerde respons uitlokt. Er werden eveneens meer inzichten bekomen in de ontwikkeling van MALT lymfomen na infectie van Mongoolse gerbils met zuivere, in vitro gecultiveerde H. suis stammen, afkomstig van varkens en primaten. Tenslotte werd aangetoond dat het gebruik van een CCR4 antagonist als adjuvans in een H. suis vaccin, nuttig kan zijn.

211

212

Curriculum Vitae

213

214

Curriculum Vitae

Iris Bosschem werd geboren op 14 september 1987 te Zottegem. Na het beëindigen van haar middelbare studies Latijn-Wiskunde aan het Koninklijk Atheneum Zottegem, startte ze in 2005 met de studies Diergeneeskunde aan de Universiteit Gent. In 2011 behaalde ze het diploma van Dierenarts, optie Onderzoek. Enkele maanden na het behalen van dit diploma, startte ze aan diezelfde universiteit een doctoraatsonderzoek aan de Vakgroep Pathologie, Bacteriologie en Pluimveeziekten, waarbij ze onderzoek verrichtte naar de immuunrespons en vaccinatie strategieën tegen een Helicobacter suis infectie onder de begeleiding van Prof. dr. Freddy Haesebrouck, Prof. dr. Richard Ducatelle en Dr. Bram Flahou. Dit doctoraatsonderzoek werd gefinancierd door een beurs van het Onderzoeksfonds van de Universiteit Gent (GOA 01G00408) en resulteerde in het huidige proefschrift. Gedurende deze periode heeft zij ook gewerkt aan de doctoraatsopleiding in ‘Life Sciences and Medicine’ van de Universiteit Gent, waarvan zij het diploma behaalde in 2017. Ze is auteur en mede-auteur van meerdere wetenschappelijke publicaties in internationale tijdschriften. Zij nam actief deel aan internationale congressen en was daar meermaals spreker.

215

216

Bibliography

217

218

Bibliography

List of publications in international journals

Zhang G, Pasmans F, De Bruyne E, Joosten M, Bosschem I, Smet A, Ducatelle R, Haesebrouck F, Flahou B. 2015. Role of γ-glutamyltranspeptidase in the pathogenesis of Helicobacter suis and Helicobacter pylori infections. Veterinary Research. 46:31.

Bosschem I, Van Deun K, De Bruyne E, Bayry J, Smet A, Vercauteren G, Pasmans F, Ducatelle R, Haesebrouck F, Flahou B. 2015. The effect of different adjuvants on the protective efficacy of a Helicobacter suis lysate vaccine. PloS ONE. 10:e0131364.

Bosschem I, Flahou B, Bakker J, Heuvelman E, Langermans JA, De Bruyne E, Joosten M, Smet A, Ducatelle R, Haesebrouck F. 2017. Comparative virulence of in vitro-cultured primate- and pig-associated Helicobacter suis strains in a BALB/c mouse and a Mongolian gerbil model. Helicobacter. 22:e12349.

Davies MN, Pere H, Bosschem I, Haesebrouck F, Flahou B, Tartour E, Flower DR, Tough DF, Bayry J. 2017. In Silico Adjuvant Design and Validation. Methods in Molecular Biology. 1494:107-125.

Bosschem I, Flahou B, Van Deun K, De Koker S, Volf J, Smet A, Ducatelle R, Devriendt B, Haesebrouck F. 2016. Species-specific immunity to Helicobacter suis. Helicobacter. doi: 10.1111/hel.12375. Article in press.

Stephen-Victor E, Bosschem I, Haesebrouck F, Bayry J. 2017. The Yin and Yang of regulatory T cells in infectious diseases and avenues to target them. Cellular microbiology. doi: 10.1111/cmi.12746. Article in press.

De Witte C, Devriendt B, Flahou B, Bosschem I, Ducatelle R, Smet A, Haesebrouck F. 2017. Helicobacter suis causes changes in expression of markers for inflammation and acid secretion in pigs of different ages. Veterinary Research. Manuscript submitted.

219

Bibliography

Abstracts on national and international meetings

Bosschem I, Van Deun K, De Bruyne E, Bayry J, Smet A, Vercauteren G, Pasmans F, Ducatelle R, Haesebrouck F, Flahou B. 2014. The effect of different adjuvants on the protective efficacy of a Helicobacter suis lysate vaccine. 11th International Workshop on Pathogenesis and Host Response in Helicobacter Infections. July 2-5, Helsingör, Denmark. Oral and poster presentation.

Bosschem I, Van Deun K, De Bruyne E, Bayry J, Smet A, Vercauteren G, Pasmans F, Ducatelle R, Haesebrouck F, Flahou B. 2014. The effect of different adjuvants on the protective efficacy of a Helicobacter suis lysate vaccine. Annual BIS-meeting- Immunology of Zoonotic infections in animal models. September 19th, Merelbeke, Belgium. Poster presentation.

Bosschem I, Flahou B, Bakker J, Heuvelman E, Langermans JA, De Bruyne E, Joosten M, Smet A, Ducatelle R, Haesebrouck F. 2016. Comparative virulence of in vitro-cultured primate- and pig-associated Helicobacter suis strains in a BALB/c mouse and a Mongolian gerbil model. 4th VETPATH Conference on the Pathogenesis of Bacterial Diseases of Animals. October 11-14, Prato, Italy. Oral presentation.

220

Dankwoord

221

222

Dankwoord

Een doctoraat behaal je zeker niet alleen. Daarom zou ik hier graag een aantal mensen willen bedanken die door hun goede begeleiding, enthousiasme, motivatie en steun ervoor gezorgd hebben dat ik mijn doel heb kunnen bereiken.

In de eerste plaats gaat mijn dank uit naar mijn promotoren. Prof. Haesebrouck, hartelijk bedankt om mij de kans te geven dit doctoraat te starten en voor uw vertrouwen. Uw lessen hebben er destijds voor gezorgd dat mijn interesse in het onderzoek en de bacteriologie groeiden. Dankzij uw uitstekende begeleiding is dit doctoraat tot een goed einde gekomen. Uw interesse en steun voor het verdere verloop van mijn loopbaan zullen mij ook altijd bijblijven. Bedankt! Prof. Ducatelle, bedankt voor de professionele ondersteuning, de zorgvuldige verbeteringen van mijn artikels en deze doctoraatsthesis, de constructieve gesprekken en vooral het enthousiasme voor mijn onderzoek. Uw feedback bracht steeds nieuwe ideeën en inzichten met zich mee. Dr. Flahou, Bram, bedankt voor de goede begeleiding tijdens alle aspecten van dit onderzoek. Ondanks je druk werkschema maakte je toch tijd vrij om mij te helpen. Je hebt me ook alle inzichten gegeven om zelfstandig te kunnen werken als wetenschappelijk onderzoekster. Ik kan met zekerheid zeggen dat je expertise in het labo en daarbuiten gemist worden. Veel geluk en succes met je carrière bij Novartis!

Mijn oprecht dank gaat eveneens uit naar de leden van mijn begeleidings- en examencommissie: prof. dr. Dominiek Maes, prof. dr. Niek Sanders, prof. dr. Fátima Gärtner, prof. dr. Irina Amorim, dr. Bert Devriendt en prof. dr. Cox. Hartelijk dank om mijn doctoraatsthesis zo zorgvuldig na te lezen. De constructieve opmerkingen hebben ervoor gezorgd dat dit werk sterk verbeterde. Prof. Gärtner and prof. Amorim, I am very grateful to you both for accepting the invitation to be a member of my examination committee and for flying over from Portugal to attend my public defense.

Dit onderzoek was mogelijk door een geconcerteerde onderzoeksactie (GOA 01G00408) van de Universiteit Gent, waarvoor dank.

Ik zou ook graag alle co-auteurs van de publicaties in deze doctoraatsthesis willen bedanken voor de fijne samenwerking: prof. dr. Jiri Volf, dr. Stefaan De Koker, dr. Jaco Bakker, dr. Edwin Heuvelman, dr. Jan AM Langermans en prof. dr. Jagadeesh Bayry.

223

Dankwoord

Ik heb altijd met heel veel plezier gewerkt aan de Vakgroep Bacteriologie, Pathologie en Pluimveeziekten en zou dan ook iedereen willen bedanken voor de voorbije 5 jaar. Een aantal mensen verdienen een extra woordje van dank.

De Helicobacter onderzoeksgroep was een zeer leuke groep om in terecht te komen, en ik wil dan ook iedereen die er de afgelopen jaren deel van uit maakte bedanken voor de goede samenwerking. Ellen, ik overdrijf niet als ik zeg dat ik hier zonder jou niet zou gestaan hebben. Jij liet me 5 jaar geleden weten dat er misschien wel een functie zou vrijkomen aan de vakgroep bacteriologie, en de rest is geschiedenis. Je zorgde ervoor dat ik snel geïntegreerd was en mijn plan kon trekken in het labo. Bedankt! Ik kijk er al naar uit om terug collega’s te zijn! Myrthe, Dr. Joosten ondertussen, jij was dan ook één van de eersten aan wie ik door Ellen werd voorgesteld. Bedankt voor alle hulp tijdens mijn onderzoek en bij de laatste fases van mijn doctoraat, ik had me geen betere voorganger kunnen voorstellen! Ellen en Myrthe, bedankt om er altijd voor mij te zijn, zowel tijdens de leuke, als tijdens de iets minder leuke momenten. Ik heb heel erg veel aan jullie steun en ben erg dankbaar dat we zo’n goede vriendinnen zijn. Hannah, jij was deel van het Helicobacter team voor 2 jaar. Bedankt voor de leuke tijd en de steun! Ondertussen ben je een nieuwe weg ingeslagen, heel veel succes hiermee.

Guangzhi, I enjoyed our conversations in the office a lot. Good luck with your postdoctoral research in Berkeley and regards to Yan and Zebao. Hopefully we can meet up again one day in California! Lien DC, bedankt voor de steun en de leuke momenten tijdens het congres in Helsingör. Miet en Kim VD, bedankt aan beiden om het pad naar de zoektocht naar een H. suis vaccin al wat te effenen. Prof. Smet, Annemieke, ook al was je geen officiële promotor, je deur stond altijd open als ik vragen had. Bedankt! Cheng, I wish you good luck with your career in China! Chloë, al van in het begin was het duidelijk dat je een gemotiveerde onderzoekster bent! Het was heel leuk om samen aan enkele projecten te kunnen werken. Ik wil je nog heel veel succes wensen met het verdere verloop van je doctoraat! Caroline, bedankt voor alle leuke momenten en de steun. Heel veel succes met de laatste loodjes van je doctoraat, je bent er bijna! Eva, ik bewonder je gedrevenheid voor het onderzoek, ook als het niet loopt zoals gepland. Bedankt voor de steun en de leuke babbeltjes. Nog heel veel succes met je doctoraat! Helena, de allernieuwste aanwinst van het Helicobacter team. Met jouw enthousiasme voor het onderzoek zal je zeker een mooi doctoraat behalen. Sofie DB, de snelheid waarmee jij qPCR’s tot een goed einde brengt is ongezien. Heel erg bedankt voor al

224

Dankwoord

je hulp in het labo! De gezellige ritjes naar Moeskroen zullen me ook bij blijven, ook al was de bestemming iets minder gezellig. Nathalie VR, ook van jou heb ik veel geleerd. Bedankt voor alle hulp in het labo!

Marleen, ook jij begeleidde me bij mijn eerste stappen in het labo. Heel erg bedankt voor de leuke babbeltjes, uw enthousiasme en vrolijkheid.

De routine diagnostiek was voor mij een hele leuke afwisseling tussen het labo- en schrijfwerk door. Filip B, bedankt om me zoveel bij te leren over bacteriële diagnostiek en antimicrobiële resistentie. Serge en Arlette, bedankt voor alle hulp en tips in het labo. Koen, Jo en Gunter, heel erg bedankt voor de hulp bij administratieve en/of computerproblemen. Erna, heel erg bedankt om onze bureaus zo proper te houden en voor de leuke babbeltjes.

Ilias, you joined our office more than a year ago. Good luck with the completion of your thesis, I’m sure you will do great. We will meet up soon! Jonas, it was fun having you as an office member. Good luck with the completion of your PhD in Denmark. Kirsten, nog maar net gestart met je doctoraat en direct de stress en chaos van de laatste loodjes meemaken…sorry daarvoor. Maar tegelijk ook heel erg bedankt voor de oppeppende babbeltjes en de hulp met de lay-out van mijn doctoraatsthesis! Succes met je doctoraat! Lore, ik vind het echt jammer dat we maar 1 maandje samen de bureau hebben kunnen delen. Veel succes!

Christian, hartelijk bedankt voor de snelle verwerking van mijn weefselstaaltjes en dit altijd met enthousiasme. Ook bedankt aan Delphine, Sarah en Astra voor de hulp met het kleuren van de weefselstaaltjes.

De vakgroep immunologie was een beetje mijn ‘tweede thuis’ tijdens het laatste jaar van mijn onderzoek. In het bijzonder zou ik Bert willen bedanken voor de introductie in de wereld van MACS en flowcytometrie, ook al zorgde deze laatste af en toe voor frustraties. Zonder uw hulp en begeleiding was het eerste hoofdstuk van deze doctoraatsthesis er niet gekomen. Bedankt voor de waardevolle discussies en de leuke samenwerking! Christophe, ook jij bent heel erg bedankt voor de hulp met de flowcytometer.

Jonah, jij hebt de vakgroep een tijdje geleden verlaten, veel succes met de nieuwe uitdagingen! Sofie K, het was altijd heel gezellig als je ons kwam bezoeken op bureau. Bedankt voor de babbeltjes en de steun! Veel succes op de nieuwe job. Karen, uw

225

Dankwoord

enthousiasme en lach werken zeer aanstekelijk. Bedankt voor de oppeppende gesprekken en om jullie reservatie in Oak aan ons af te staan! Evy, bedankt voor de steun en alle tips and tricks in verband met het doctoraat. Annatachja, bedankt voor je enthousiasme en positivisme!

Graag wil ik ook alle (ex-)collega’s bedanken voor alle leuke momenten op het werk en daarbuiten. Alexandra, An G, Anja R, Anja VDB, Anneleen, Annelies DC, Annelies M, Beatrice, Bregje, Céline, Chana, Connie, David, Deon, Dorien, Elin, Evelien, Fien, Gunther A, Gwij, Han, Ilse, Jackeline, Jasmien, Joachim, Julie, Justine M, Karolien, Keely, Laura, Leen, Leslie, Lien VDM, Lieze, Linda, Lonneke, Lore, Lotte, Marc, Magda, Marieke, Marjan, Mark, Maxime, Melanie, Mojdeh, Nathalie G, Nele, Pascale, Pearl, Pudsa, Roel, Ruth, Sarah, Shaoiji, Silvana, Sofie G, Stefanie, Tijn, Tom, Venessa, Veronique en alle proffen: bedankt!

Ook buiten het werk kon ik rekenen op steun en motivatie. An-Sofie, Emmy, Mien, Joy. Bedankt dat jullie ons weekend een weekje wilden verzetten zodat ik me zonder stress kon voorbereiden op mijn verdediging. Om het even wat we samen doen en als het even wat minder ging, brachten onze ladies nights er mij terug bovenop. Dat we samen nog veel sushi mogen gaan eten, cinema bezoekjes doen en op weekend gaan! An-Sofie, bedankt voor je enthousiasme en ook om die spandoek toch maar thuis te laten. Brenda en Nathalie. Ook met jullie kon ik de ups and downs van het doctoraat delen. Bedankt om zulke goede vriendinnen te zijn. Marieke, Pauline, Thomas en Mariel. Het doet me veel plezier dat we elkaar nog veel zien, ook al liggen de studies Diergeneeskunde al ver achter ons. Bedankt voor de steun en interesse in mijn doctoraat!

Ook een dikke merci aan alle vrienden en vriendinnen uit het Waasland en omstreken voor de interesse in mijn doctoraat en jullie steun. Ik kijk al uit naar het volgende vriendenweekend! Justine DM, bedankt om er mee voor te zorgen dat mijn conditie op peil bleef de laatste maanden van mijn doctoraat! En ook bedankt aan Maarten om de receptie te verzorgen.

Manuela en Bo, bedankt voor jullie steun en alles wat jullie voor Wolf en mij doen. De gezellige etentjes in Nieuwkerken zijn altijd iets om naar uit te kijken. Ook nog een extra woordje van dank voor Bo, voor het ontwerpen van de prachtige kaft van mijn boek! Bedankt Kim en Arno, voor de steun en oppeppende babbeltjes. Nonkel Hugo, bedankt voor de interesse in mijn doctoraat en de steun.

226

Dankwoord

Het is een geen gemakkelijke opgave om in enkele regels te beschrijven waarvoor ik mijn ouders dankbaar ben. Jullie zijn er altijd voor ons en zonder jullie had ik hier sowieso niet gestaan. Bedankt om misschien wel meer vertrouwen in mij te hebben dan dat ik soms in mezelf had. Tessa, ook al zit je samen met Vincent in het ‘verre’ Genève, we horen elkaar bijna elke dag. Bedankt voor de steun en de vriendschap. Ik kijk al uit naar ons reisje in juni!

En tenslotte: Wolfie, bedankt voor je eindeloze geduld, steun, mopjes en liefde die ervoor gezorgd hebben dat de stress (in de mate van het mogelijke) beperkt bleef. Bedankt dat ik in alle rust mijn doctoraat kon schrijven en voorbereiden en gewoon om er te zijn als ik je nodig had. Het was niet gelukt zonder jou…

Iris

227