The role of interleukin-21

in type-1 diabetes

Helen McGuire

A thesis submitted for the degree of Doctor of Philosophy in the Faculty of Science, University of New South Wales

Immunology and Inflammation Research Program Garvan Institute of Medical Research Darlinghurst, Sydney, Australia

September 2010 ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ...... Helen McGuire

Date ......

i COPYRIGHT STATEMENT

‘I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or hereafter known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the abstract of my thesis in Dissertations Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.’

Signed ......

Date ......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ......

Date ......

ii ABSTRACT

Cytokines are an essential component of both normal and aberrant immune responses, such as in autoimmune disease. Interleukin (IL)-21 is a member of the common gamma chain family of cytokines and is adjacent to IL-2 within the strongest non-MHC-linked locus for type-1 diabetes (T1D) susceptibility in non- obese diabetic (NOD) mice. Recent studies demonstrate that IL-21 is necessary for the development of autoimmune disease in several models including T1D in NOD mice. This study explores the critical role of IL-21 in the pathogenesis of T1D. In this study, we demonstrate that the amount of IL-21, but not IL-2, correlated with T1D incidence. Whilst IL-21 is found in high expressing and low expressing allelic forms, IL-2 appears to be kept at a similar level between mouse strains due to differences in mRNA stability. IL-21 is produced in abundance within the autoimmune lesions of the NOD mouse by a novel CD4+ T helper (Th) subset, marked by co-expression of the gut-homing chemokine receptor CCR9. Whilst these CCR9+ IL-21-producing Th cells could be found in healthy mice and humans, they were concentrated in the inflamed pancreas. Critically, the ultimate target of IL-21 is CD8+ T cells whose receptiveness to IL-21 is necessary for the development of diabetes. We also demonstrate successful intervention at a late preclinical stage through neutralisation of IL-21 with IL-21R/Fc. Indeed, when combined with islet allograft transplantation, this therapeutic approach could cure diabetes. We found that the influence of IL-21 on a graft-mounted immune response was robust, as absence of IL-21 signalling was also found to prevent islet allograft rejection. These findings suggest that therapeutic manipulation of IL-21 may serve as a suitable treatment for patients with T1D.

iii PUBLICATIONS, PRESENTATIONS AND PRIZES ARISING FROM THIS THESIS

PUBLICATIONS

FIRST AUTHOR MANUSCRIPTS

H.M. McGuire, A. Vogelzang, C.S. Ma, P. Silviera, S.G. Tangye, D. Christ, D.A. Fulcher, C. King T helper cells that co-express interleukin-21 and CCR9 target accessory organs of the digestive system for autoimmunity. (Paper submitted)

H.M. McGuire, S. Walters, A. Vogelzang, C.M.Y. Lee, K.E. Webster, J.Sprent, D. Christ, S.T. Grey, C. King Interleukin-21 is critically required in autoimmune and allogeneic responses to islet tissue. Diabetes (Paper accepted)

H.M. McGuire, A. Vogelzang, N. Hill, M. Flodström-Tullberg, J. Sprent, C. King 2009. Loss of parity between il2 and il21 in the NOD Idd3 locus. Proc Natl Acad Sci. Nov 17;106(46):19438-19443.

CONTRIBUTING AUTHOR MANUSCRIPTS

A. Vogelzang, E. Malle, H.M. McGuire, C. Jandl, P. Earls, D. Croucher, R. Daly, J. Sprent, C. King Interleukin-21 supports the survival of lymphocytes during PD-1:PD- L1 interactions. (Paper submitted)

C.M. Lee, H.M. McGuire, A. Basten, C. King, D. Christ Expression, purification and characterization of recombinant interleukin-21. J. Immunol. Methods. Epub 2010 Aug 24.

M.C. Akerfeldt, J. Howes, J.Y. Chan, V.A. Stevens, N. Boubenna, H.M. McGuire, C. King, T.J. Biden, D.R. Laybutt 2008. Cytokine-induced beta cell death is independent of endoplasmic reticulum stress signaling. Diabetes. Nov;57(11):3034- 44.

iv A. Vogelzang, H.M. McGuire, D. Yu, J. Sprent, C. Mackay, C. King 2008. A fundamental role for Interleukin-21 in the generation of T follicular helper cells.

Immunity. Jul 18;29(1):127-37.

ORAL PRESENTATIONS

H.M. McGuire, A.R. Vogelzang, C. Natividad, J. Sprent, C. King. CD4+ T cells co-expressing interleukin-21 and CCR9 provide help to autoreactive CD8+ T cells in type-1 diabetes. ASI Annual Scientific Meeting, Gold Coast (December 2009)

H.M. McGuire, A.R. Vogelzang, N. Hill, M. Flodström-Tullberg, J. Sprent, C. King. Interleukin-21 generates autoimmune infiltration in type-1 diabetes. ASI Annual Scientific Meeting, Canberra (December 2008)

H.M. McGuire, A.R. Vogelzang, N. Hill, M. Flodström-Tullberg, J. Sprent, C. King. Interleukin-21 generates autoimmune infiltration in type-1 diabetes. The 4th Congress of the Federation of Immunology Societies of Asia-Oceania, Taiwan (October 2008)

H.M. McGuire, A.R. Vogelzang, N. Hill, M. Flodström-Tullberg, J. Sprent, C. King. Interleukin-21 generates autoimmune infiltration in type-1 diabetes. 18th St Vincent’s and Mater Health Sydney Research Symposium, Sydney (September 2008)

H.M. McGuire, A.R. Vogelzang, C. King. Interleukin-21 generates autoimmune infiltration in type-1 diabetes. Australasian Society for Immunology annual conference, Sydney (December 2007)

POSTER PRESENTATIONS

H.M. McGuire, A.R. Vogelzang, C. Ma, S. Tangye, P. Silveira, D. Christ, J. Sprent, C. King. Diabetogenic CD4+ T cells comprise a novel T helper subset that co-express interleukin-21 and the chemokine receptor CCR9. Tolerance and Autoimmunity Keystone Symposia, Taos, USA (February 2010)

v PRIZES

Finalist in the prestigious New Investigator Forum, at the Australasian Society of Immunologists Annual Meeting, 2009.

Postgraduate Research Student Support Scheme Award (UNSW) for travel to the Australasian Society of Immunologist Annual Meeting, 2009.

Recipient of the inaugural Castle Harlan Award US$10,000 for best early career PhD student, Garvan Institute of Medical Research, 2008, facilitating a one- month lab placement with Professor Anne Cooke, Cambridge, UK, 2009.

School of Biotechnology and Biomolecular Sciences Seminar prize for second year PhD progress review, 2008.

Australasian Society of Immunologists Travel Bursary awarded to travel to the Australasian Society of Immunologist Annual Meeting, 2008.

Best student oral presentation at the 18th St Vincent’s and Mater Health Sydney Research Symposium, 2008.

Australasian Society of Immunologists Travel Bursary awarded to travel to the Federation of Immunological Societies of Asia-Oceania 4th Congress, Taiwan, 2008.

vi ACKNOWLEDGEMENTS

Many thanks go to my supervisor, Dr. Cecile King for challenging me and providing continued guidance throughout the course of this project. To the King lab, with members past and present, in particular Alexis. A real friend I am lucky to have made in this process.

Special thanks go to the Sprent lab and Marcel for our shared lab meetings. These have been a great arena to receive feedback and constructive comments. Particular thanks go to Kylie and her helpful sometimes sanity-saving words and assistance. There is nobody better for a serious dose of peer support! And thanks to Heeok for always being available to hear my latest western blot woes. Thanks also to Prof. Tony Basten for always being available for advice.

Thanks to the generous support provided in the Garvan facilities, particularly the flow cytometry facility and the BTF. A huge thanks goes to the guru of transplantation, Stacey, for teaching me the art. And of course, I’d like to thank the Immunology department as a whole for both friendships created, and generous contribution of reagents and help during my PhD.

For all the support and sympathy I have received along the way, I give special thanks to both my family and Kev, whom I think can now call himself an honorary and perhaps sympathetic Immunologist. He very soon discovered that FACS analysis was very different from sending one giant fax! Thank you in particular to my parents, whom have always been a source of inspiration for me.

Experiments that were not the sole work of the author All experiments were performed by the author at the Garvan Institute, with the following exceptions:

Fig. 4.5 – experiment performed by Dr. Cindy Ma Fig. 4.11 – experiment performed by Dr. Cindy Ma and Anna Chan Fig. 5.12 – experiment performed by Stacey Walters

vii TABLE OF CONTENTS

1 Introduction...... 1 1.1 The Immune system...... 1 1.2 Adaptive immune responses...... 2 1.2.1 Lymphocyte development ...... 2 1.2.1.1 T cell development...... 2 1.2.1.2 B cell development...... 5 1.2.2 Lymphocyte activation...... 6 1.2.2.1 T cell activation...... 6 1.2.3 CD8+ T cells...... 8 1.2.4 CD4+ T cells...... 8 1.2.5 CD4+ T cells- T helper subsets...... 9

1.2.5.1 Th1 and Th2 cells ...... 10

1.2.5.2 Th17 cells...... 11 1.2.5.3 T follicular Helper cells...... 11 1.2.5.4 Regulatory T cells ...... 13 1.2.6 T cell memory and homeostasis...... 14 1.2.7 B cell activation ...... 15 1.2.7.1 T dependent antibody production...... 15 1.3 Autoimmunity...... 18 1.3.1 Autoimmune Disease: Breakdown of Tolerance...... 18 1.3.1.1 Tolerance ...... 18 1.3.2 Autoimmune diseases...... 20 1.3.3 Environmental Contributions to autoimmunity...... 21 1.3.4 Genetic Contributions to autoimmunity...... 22 1.3.4.1 MHC genes ...... 22 1.3.4.2 Non-MHC genes ...... 23 1.4 Idd3- Contribution to autoimmunity...... 24 1.4.1 Type-1 Diabetes (T1D) ...... 25 1.4.2 Sjögren’s syndrome...... 27 1.4.3 Human Linkage Studies ...... 28 1.5 Exploring gene contributions to the Idd3 effects...... 28 1.5.1 IL-2 in immunity and autoimmunity...... 30

viii 1.5.1.1 Allelic variations and diabetes susceptibility of IL-2...... 31 1.5.2 IL-21 in immunity and autoimmunity...... 32 1.5.2.1 IL-21 and T cell priming...... 35

1.5.2.2 IL-21, Th1 and Th2 cells ...... 36

1.5.2.3 IL-21 and Th17 cells...... 36

1.5.2.4 IL-21 and TFH cells...... 37 1.5.2.5 IL-21 and Tregs...... 37 1.5.2.6 IL-21 and CD8+ T cells...... 38 1.5.2.7 IL-21 and B cells...... 39 1.5.2.8 Expression of IL-21 and IL-21R...... 41 1.5.2.9 Therapeutic Intervention in Autoimmune Disease...... 41 1.6 Experimental objectives...... 42 2 Materials and methods...... 43 2.1 Buffers...... 43 2.2 Mice ...... 44 2.3 Human samples...... 46 2.4 T cell stimulation ...... 46 2.5 RNA and quantitative RT-PCR...... 47 2.6 Pyrosequencing...... 48 2.7 Luciferase Assay...... 48 2.8 EMSA...... 50 2.9 In vivo bioactive IL-2 assay ...... 50 2.10 Flow cytometry...... 51 2.11 Intracellular Staining...... 53 2.12 CFSE Proliferation studies ...... 53 2.13 Western Blotting...... 53 2.14 Chemotaxis assay...... 54 2.15 T helper in vitro polarisation and CCR9 induction...... 54 2.16 Sheep red blood cell immunisation...... 55 2.17 B cell help assay and antibody isotype ELISA...... 56 2.18 Pancreas and Salivary Gland infiltrate isolation...... 56 2.19 LPL and IEL isolation...... 57 2.20 Sublethal irradiation...... 57

ix 2.21 IL-21R/Fc fusion protein experiments...... 58 2.22 Immunohistochemistry...... 59 2.23 Islet isolation...... 59 2.24 Islet transplantation...... 60 2.25 Genotyping PCR...... 60 2.26 Data analysis and Statistics ...... 61 3 Examining IL-2 and IL-21 expression in Idd3...... 62 3.1 Introduction ...... 62 3.2 Results...... 65 3.2.1 Increased IL-21 in NOD mice is controlled by the Idd3 locus...... 65 3.2.2 Increased expression of the NOD IL-21 allele ...... 66 3.2.3 Promoter polymorphisms increase IL-21 transcript levels through Sp1 binding ...... 71 3.2.4 NOD IL-2 allele is highly expressed, but mRNA is less stable...... 76 3.2.5 Equivalent amount of IL-2 protein in NOD and NODB6.Idd3 ...... 79 3.2.6 Expression profiles for IL-2 and IL-21 form two distinct groups ...... 83 3.2.7 Investigating central locus regulation within Idd3...... 85 3.3 Discussion ...... 87 4 IL-21 producing CD4+ T cells in the lesions of the pancreas and salivary gland are marked by co-expression of CCR9...... 90 4.1 Introduction ...... 90 4.2 Results...... 93 4.2.1 An abundance of IL-21 producing cells in NOD mice ...... 93 4.2.2 Characterisation of IL-21+ T helper subsets in the islet lesion ...... 95 4.2.3 CCR9+ CD4+ T cells migrate towards CCL25...... 100 4.2.4 CCR9+ IL-21 producing Th cells exhibit a restricted cytokine profile102

4.2.5 CCR9+ IL-21 producing Th cells exhibit a TFH-like phenotype ...... 105 4.2.6 CCR9+ CD4+ T cells preferentially form B cell conjugates ...... 113 4.2.7 CD8+ T cells are the downstream target for IL-21 in T1D...... 117 4.2.8 IL-21 promotes spontaneous expansion of CD8+ T cells...... 118 4.2.9 Tccr9 cells help CD8+ T cells to cause rapid diabetes ...... 120 4.3 Discussion ...... 123 5 Interleukin-21: modulator of tolerance in autoimmunity and transplantation ... 127

x 5.1 Introduction ...... 127 5.2 Results...... 130 5.2.1 Pancreatic islet lesion is chronically dependent on IL-21...... 130 5.2.2 Neutralisation of IL-21 eliminates lymphocytes from the islet lesion. 134 5.2.3 Combination therapy with pancreatic islet transplantation ...... 140 5.2.4 Assessing the role of IL-21 in allograft survival ...... 143 5.2.5 CD8 T cell responsiveness is crucial to allograft rejection ...... 146 5.3 Discussion ...... 148 6 General Discussion ...... 154 6.1 Research outcomes...... 154 6.2 Clinical Relevance ...... 159 6.3 Future Directions ...... 163 6.4 Concluding remarks...... 164 7 References...... 165 8 Appendices...... 200 8.1 Appendix 1 ...... 200 8.2 Appendix 2 ...... 202 8.3 Appendix 3: First Author Publication Arising From This Thesis ...... 204

xi LIST OF FIGURES

Figure 1.1 T cell development: thymic developmental stages...... 3 Figure 1.2 Cartoon representing RAG1 and RAG2 mediated TCR recombination on the β chain gene...... 4 Figure 1.3 Pluripotent model of T helper differentiation ...... 10 Figure 1.4 Extrafollicular and follicular pathways to humoral immunity...... 17 Figure 1.5 Four cellular strategies are used to regulate self-reactive receptors at different points during B and T cell differentiation...... 19 Figure 1.6 Cytokine receptors containing the common cytokine receptor γ chain (γc) ...... 33 Figure 1.7 IL-21R signalling pathway...... 34 Figure 3.1 Increased IL-21 in NOD mice is controlled by the Idd3 locus ...... 66 Figure 3.2 The abundance of two alleles can be quantified using a pyrosequencing ‘reporter’ SNP sequencing reaction...... 67 Figure 3.3 NOD intronic and exonic IL-21 allele is preferentially transcribed in NOD.Idd3NOD/B6 splenocytes...... 68 Figure 3.4 NOD intronic and exonic IL-21 allele is preferentially transcribed in NOD.Idd3NOD/B6 cells isolated from lymph nodes and pancreas ...... 69 Figure 3.5 NOD intronic and exonic IL-21 allele is preferentially transcribed in naïve and activated NOD.Idd3NOD/B6 CD4+ T cells, and NOD/B6 F1 splenocytes ....70 Figure 3.6 Increase transcription of NOD IL-21 mRNA does not reflect differences in mRNA stability...... 71 Figure 3.7 The NOD IL-21 promoter exhibits increased transcriptional activity...... 73 Figure 3.8 The NOD IL-21 promoter exhibits increased Sp1 binding...... 75 Figure 3.9 Preferential transcription of IL-2 premRNA from NOD allele...... 77 Figure 3.10 Exonic IL-2 show similar abundance of NOD and B6 alleles ...... 78 Figure 3.11 Intronic and exonic IL-2 mRNA display different profiles ...... 79 Figure 3.12 Decreased stability of NOD IL-2 mRNA ...... 79 Figure 3.13 Administering rmIL-2 and IL-2 mAb reveals the same profile of MP CD8+ T cell proliferation across different organs...... 80 Figure 3.14 S4B6 equivalently expands endogenous MP CD8+ T cells in NOD and NODB6.Idd3 mice...... 81

xii Figure 3.15 Equivalent amounts of bioavailable IL-2 in NOD and NODB6.Idd3 mice 81 Figure 3.16 Equivalent amounts of IL-2 in NOD and NODB6.Idd3mice...... 82 Figure 3.17 Equivalent expression of IL-2 in NOD and NODB6.Idd3 CD4 and CD8+ T cells...... 82 Figure 3.18 Two distinct expression profiles occur for IL-2 and IL-21...... 84 Figure 3.19 IL-2 mRNA stability occurs as two profiles in extended strain analyses ...... 85 Figure 3.20 A loss of uniformity between IL-2 and IL-21 alleles in the NOD mouse...... 85 Figure 4.1 Increased production of IL-21 in NOD CD4+ T cell subsets ...... 93 Figure 4.2 Increased number of IL-21+ T cells in NOD mice...... 94 Figure 4.3 Increased percentage and expression of IL-21 in NOD mice ...... 95 Figure 4.4 CCR9 marks IL-21 expressing cells in the NOD pancreas...... 97 Figure 4.5 CCR9 expression by humans CD4+ T cells is elevated in Sjögren's syndrome patients...... 99 Figure 4.6 CCR9+ CD4+ T cells migrate towards CCL25 ...... 101 Figure 4.7 CCL25 blockade stops migration of CCR9+ T cells in vivo ...... 102 Figure 4.8 Pancreatic CCR9+ Th cells show a limited cytokine profile...... 103 Figure 4.9 CCR9+ Th cells are not NKT cells...... 105 Figure 4.10 Transcription factor analysis of Tccr9 cells...... 107 Figure 4.11 RT-PCR analysis of human Tccr9 cells...... 108

Figure 4.12 Phenotyping of Tccr9 cells for markers of TFH cells...... 109 hi Figure 4.13 Potential to modulate TFH and CCR9+ CD44 CD4+ T cells ...... 111 Figure 4.14 Tccr9 cells are competent at helping B cells to produce antibody...... 113 Figure 4.15 CCR9+ CD4+ T cells interact with B cells...... 114 Figure 4.16 Transfer of CCR9+ Th cells can rescue NODB6.Idd3 defects in T and B conjugates and CD8+ T cells ...... 115 Figure 4.17 Optimal IL-21 production requires help from B cells ...... 116 Figure 4.18 CD8+ T cell responsiveness to IL-21 is required to transfer disease in the NOD/Scid diabetes model...... 118 Figure 4.19 IL-21 promotes CD8+ T cell proliferation and survival...... 120 Figure 4.20 Pancreatic and salivary gland pathology can be caused by CCR9+ CD4+ T cells, and interrupted by IL-21 neutralisation...... 122

xiii Figure 5.1 IL-21 help is required to maintain pancreatic immune cell infiltrate..... 133 Figure 5.2 IL-21R/Fc treatment shows minimal effect in NODB6.Idd3 mice ...... 134 Figure 5.3 IL-21 neutralisation reduces lymphocyte populations...... 135 Figure 5.4 Reduced number of activated lymphocytes in NODB6.Idd3 mice ...... 136 Figure 5.5 IL-21 neutralisation modulates activated Th subsets but not T regs...... 137 Figure 5.6 Neutralising IL-21 has an effect on IL-21 production...... 138 Figure 5.7 IL-21 transcript can be used as a predictive marker...... 139 Figure 5.8 IL-21 neutralisation prolongs survival of autoimmune diabetic mice.... 141 Figure 5.9 Histology of IL-21R/Fc treated syngeneic islet graft recipients show cleared infiltrate but reduced pancreatic islet mass...... 143 Figure 5.10 Islet allografts exhibit prolonged survival in Il21r-/- mice...... 144 Figure 5.11 Il21r-/- mice exhibit prolonged stable blood glucose following contralateral kidney islet allograft...... 145 Figure 5.12 Long-term surviving graft in Il21r-/- mice are functional and free from immune cell infiltration...... 146 Figure 5.13 Restoring CD8 T cell responsiveness to IL-21 results in rapid islet allograft rejection...... 147 Figure 8.1 Sequence alignment of the IL-21 distal promoter for the NOD and B6 alleles...... 201 Figure 8.2 Map of the Idd3 region ...... 203

xiv LIST OF TABLES

Table 1.1 Disease association with Idd3 locus in mice, and 4q27 region in humans 25 Table 1.2 Defining Idd3: Studies to narrow Idd3 from 21.5 cM to 650 kb...... 27 Table 2.1 Buffers commonly used ...... 43 Table 2.2 Fine mapping of Idd3 in backcrossed lines...... 45 Table 2.3 RT-PCR primer sequences...... 48 Table 2.4 Pyrosequencing primer sequences...... 48 Table 2.5 Luciferase construct primer sequences ...... 49 Table 2.6 Primers used for EMSA analysis...... 50 Table 2.7 Flow cytometric antibodies and reagents...... 52 Table 2.8 Th Polarisation Conditions...... 55 Table 2.9 Genotyping primer sequences ...... 61 Table 3.1 Putative IL-21 promoter regulatory sitesa in NOD and NODB6.Idd3...... 72 Table 3.2 Putative Sp1 site in IL-21 distal promoter correlates with Idd3 ‘B’ Allele84 Table 4.1 Phenotypic analysis of CCR9+ CD4+ T cells...... 98 Table 5.1 Activated lymphocytes following IL21R/Fc treatment ...... 136

xv ABBREVIATIONS

Ab Antibody AP Alkaline phosphatase APC Antigen-presenting cell APC Allophycocyanin AEEC Australian Experimentation Ethics Committee B6 C57BL/6 mouse strain BCR B-cell receptor BCS Bovine calf serum BGL Blood glucose level β-cell Beta cell (of the pancreatic islet) β-ME β-mercaptoethanol BSA Bovine serum albumin CCR Chemokine motif receptor CD Cluster of differentiation CFSE Carboxyfluorescein succinimidyl ester CHO Chinese hamster ovary CTLA-4 Cytotoxic T lymphocyte antigen-4 CXCR CXC motif receptor DC Dendritic cell DN Double negative thymocytes DNA Deoxyribose nucleic acid DP Double positive thymocytes DTT Dithiothreitol EAE Experimental allergic encephalomyelitis EDTA Ethylenediamine-tetraacetate ERK Extracellular signal-related kinases FACS Flourescence activated cell sorting FcRn Neonatal Fc receptor FCS Fetal calf serum FDC Follicular DC FITC Fluorescein isothiocyanate Foxp3 Forkhead box P3 Gapdh Glyceraldehyde 3 phosphate dehydrogenase GC Germinal centre GVHD Graft-versus-host disease H Hour H&E Haematoxylin and eosin ICOS Inducible co-stimulation factor IDD Insulin-dependent diabetes IEL Intraepithelial lymphocytes IFNγ Interferon-gamma Ig Immunoglobulin IL Interleukin I.V. Intravenous JNK Jun N-terminal kinases LPL Lamina propria lymphocytes

xvi LPS Lipopolysaccharide LTβ Lymphotoxin β mAb Monoclonal antibody MACS Magnetic activated cell sorting MAPK Mitogen-activated protein kinases MHC Major histocompatibility complex MP Memory phenotype MS Multiple sclerosis MSX Methionine sulphoximine MZ Marginal zone NFAT Nuclear factor of activated T cells NK Natural killer NOD Non-obese diabetic PBS Phosphate buffered saline PCR Polymerase chain reaction PD-1 Programmed cell death-1 PE R-phycoerythrin PerCP Peridinin chlorophyll protein PMA Phorbol 12-myristate 13-acetate PRR Pattern recognition receptors RA Rheumatoid arthritis RBC Red blood cell rm Recombinant mouse RNA Ribonucleaic acid RORγT Retinoic-acid-receptor-related orphan receptor-γt SAP SLAM associated protein SCID Severe combined immunodeficiency SDS Sodium dodecyl sulfate SEM Standard error of the mean SHM Somatic hypermutation SLE Systemic lupus erythematosus SNP Single nucleotide polymorphism SP Single positive thymocytes SRBC Sheep red blood cells STAT Signal transducers and activators of transcription STZ Streptozotocin T1D Type-1 diabetes TCR T-cell receptor TD T-dependent TFH T follicular helper Th T helper TI T-independent TGFβ Transforming growth factor beta TLR Toll like receptor TNFα Tumor necrosis factor alpha Treg Regulatory T cells UTR Untranslated region WT Wild-type

xvii 1 Introduction

The immune system consists of many cell types and organs, functioning in a network to protect the body from invading pathogens whilst limiting destruction of self-tissues. T cell tolerance to self, involves a combination of thymic deletion and peripheral mechanisms including the active regulation of effector T cells by regulatory T cells. When self-tolerance fails, the immune system acquires the ability to attack our own cells and organs, leading to the development of autoimmune diseases, including type-1 diabetes (T1D), in which T cells destroy the insulin- producing beta (β)-cells of the pancreatic islets. The aim of this thesis is to study the mechanisms responsible for development of T1D using the well-defined non-obese diabetic (NOD) mouse model with specific emphasis on the role played by the multi- functional cytokine, interleukin-21 (IL-21).

1.1 The Immune system

Many cell types cooperate to form a functioning immune system (Gowans and Knight, 1964). These cells originate and develop within the bone marrow and thymus, and subsequently populate these primary lymphoid organs in addition to secondary lymphoid organs such as the thymus, spleen and peripheral lymph nodes (Kay et al., 1979). Whilst some immune subsets are resident in these organs, others are able to survey the body for foreign pathogens and tumour growth, circulating through blood and the lymphatic system.

The immune system can be broadly divided into two functional arms, the innate (natural) and the adaptive (acquired). Innate immunity is not antigen specific and operates continuously. It consists of cells such as macrophages, dendritic cells (DCs), mast cells, neutrophils, eosinophils, basophils, natural killer (NK) cells, and natural killer T (NKT) cells, which cooperate to mount a rapid response to conserved molecules on microorganisms and tumour cells. Importantly, because these cells do not have the ability to alter the reactivity of their receptors, and there is no development of immunologic memory, this response does not lead to long lasting protective immunity (Delves and Roitt, 2000). As a result, response speed is not

1 enhanced upon re-exposure to the same foreign substance (Bendelac et al., 2001; Yamagata et al., 2006).

The second arm of the immune system, adaptive immunity, is mediated by T and B cells (Mitchell and Miller, 1968), which carry receptors for specific antigens. This type of specific immunity involves both primary and secondary responses that lead, in turn, to the development of immunological memory. The generation of long- lived memory lymphocytes ensures that the outcome of repeated exposure to a particular antigen will result in a more rapid and robust immune response. Natural experiments demonstrating immunological memory are documented as early as the 18th century, when repeated measles epidemics on the remote Faroe Islands in 1781 and 1846 showed that not only was immunity to measles long-term, but that it was also not dependent on re-exposure to the disease (Panum, 1847). This was a critical insight into what we now understand as immunological memory (Ahmed and Gray, 1996).

The clonally expanded antigen receptors are encoded in rearranging gene families that confer unique antigen specificity to each T and B cell. ‘Clonal selection’ drives the expansion of lymphocyte clones bearing rearranged receptors that successfully bind antigen, while leaving cells bearing non-productive receptors to die by neglect. This process ensures the maintenance of useful affinities within the clonal repertoire with the smallest metabolic cost (Burnet and Holmes, 1965; Cohn et al., 2007).

1.2 Adaptive immune responses

1.2.1 Lymphocyte development

1.2.1.1 T cell development Development of T cells occurs in the thymus from precursors that migrate from the bone marrow. Thymocytes, begin as double negative for the expression of cluster of differentiation (CD)4 and CD8 T cell coreceptors (DN CD4-CD8-). This subset is separated into four sequential phenotypic stages (DN1 to DN4), based on CD44 and CD25 expression (Figure 1.1). Commitment to the T cell lineage is

2 achieved through sustained repression of alternative gene expression programs, of other lineages. In early thymocyte development (up to the DN2 stage) T cell commitment is ensured through the activation of target genes, downstream of Notch1, which interacts with its thymic stroma expressed ligand, Delta-like 4 (DL4) (Chi et al., 2009; Maillard et al., 2005). In addition, transcription factors including Runx, GATA3 and E-box proteins, help to initiate T cell differentiation through Notch1 (Rothenberg et al., 2008).

Figure 1.1 T cell development: thymic developmental stages Expression of CD4 and CD8 separates CD4−CD8− double negative (DN), CD4+CD8+ double- positive (DP) and single-positive (SP) cells, whereas the expression of CD44 and CD25 defines four DN subsets: CD44+CD25− (DN1), CD44+CD25+ (DN2), CD44−CD25+ (DN3) and CD44−CD25− (DN4). The earliest precursors that enter the thymus derive from hematopoietic stem cells (HSCs) in the bone marrow and are known as early T cell progenitors (ETP). They are part of a heterogeneous DN1 subset that includes both subsequent intermediates in the T cell differentiation pathway and cells belonging to dendritic (DC), natural killer (NK) or myeloid (M) lineages (Porritt et al., 2004). The DN2 and DN3 subsets are themselves divided into two stages, based on expression of the receptor c-Kit and of CD27, respectively (Rothenberg et al., 2008). Critical checkpoints are shown in red. Cell subsets are grouped according to key developmental steps: early uncommitted progenitors (blue), T cell committed progenitors before the separation of αβ and γδ lineages (purple) and cells committed to the αβ (yellow) or γδ (green) lineages. Dashed lines indicate minor or speculative differentiation routes. (Figure reproduced from (Carpenter and Bosselut, 2010)).

The crucial rearrangement of the antigen receptor variable gene segments occurs in T-committed DN3 cells, although some incomplete rearrangements of the T cell receptor (TCR) β and γ can occur early (Krangel, 2009). In the case of both TCR receptor chains, α and β and heavy and light chain B cell receptors (BCRs), these chains are composed of constant and variable regions. The exons encoding the variable regions are assembled from variable (V); joining (J); and in some cases, diversity (D) gene segments. These gene segments are flanked by DNA recognition sequences, recombination signals (RSs), in which the recombinase activating gene-1

3 (RAG-1) and RAG-2) proteins bind, and initiate recombination (Oettinger et al., 1990). The RAG complexes loop out segments of DNA, and the recombinase activity splices the DNA. A productive rearrangement results in feedback signals that prevent further rearrangements on the alternative allele, termed allelic exclusion (Uematsu et al., 1988). RAG mediated TCR recombination of the β chain gene is depicted in Figure 1.2.

Figure 1.2 Cartoon representing RAG1 and RAG2 mediated TCR recombination on the β chain gene The TCR genes are organised into Variable (V), Diversity (D) and Joining (J) regions and a constant (C) region. The current theory is that one of two constant regions is joined to a series of V, D and Js to comprise translocons. RAG1 and RAG2 form a complex that binds to the D and J regions of one of the translocons, splicing out the interval DNA to create a DJ join. The next round involves the RAG complex binding to a V region that then is connected to the DJ region creating a V(D)J join. The DNA then is transcribed to mRNA, and the protein is translated. This process is controlled, but the outcome is relatively random. (Figure reproduced from (Wagner, 2007)).

The process of RAG-mediated recombination commonly gives rise to out-of- frame rearrangements, and thus, non-functional proteins. As such, an important checkpoint is to verify proper TCR gene rearrangement at the DN3 stage, which for αβ precursors is β-selection (Figure 1.1), through expression of a properly rearranged TCRβ chain, CD3 chains and the pre-Tα (Dillon and Fink, 1995; Huang et al., 2005). If the thymocytes successfully pass β-selection, they become double

4 positive for CD4 and CD8 expression (DP CD4+CD8+) and initiate rearrangement of TCRα, which results in surface expression of TCRαβ complexes (Lacorazza and Nikolich-Zugich, 2004). Importantly, three key events mark the further developmental progression of these cells; positive selection, negative selection and acquisition of functional competence. Positive selection ensures that TCRs display sufficient affinity for self major histocompatibility foreign peptide antigen complexes (MHC) (Stefanski et al., 2000; Wang et al., 1998), while negative selection leads to elimination of TCR rearrangements that can respond to self peptide epitopes bound to MHC (von Boehmer et al., 1989). Based on MHC specificity, the thymocytes terminate expression of either CD8 or CD4 expression, to become single positive CD4 or CD8 (SP CD4+ or CD8+) T cells (Corbella et al., 1994; Matechak et al., 1996), which recognise antigen peptide in the context of MHC class II or class I respectively. Differentiation into CD4+ T cells is controlled by transcription factor Thpok and CD8+ T cells by Runx3 (Collins et al., 2009; Wang and Bosselut, 2009). Mature T cells emigrate from the thymus and circulate lymphoid tissue. On encounter with their cognate antigen CD4+ T cells act as effectors of cell mediated immunity against intracellular bacteria or as helper for humoral antibody responses against extra-cellular pathogens, whereas CD8+ T cells directly kill cells infected by intra-cellular pathogens. If they do not interact with antigen, life span is reduced and they die.

1.2.1.2 B cell development

Development of B cells is initiated in the bone marrow, where germ-line heavy and light chain immunoglobulin (Ig) genes are rearranged. The variable (V), diversity (D) and junctional (J) segments of the immunoglobulin heavy chain locus are rearranged by excision of the intervening DNA, resulting in a VDJ segment, which encodes a complete μ heavy chain. As mentioned earlier, this process also relies on RAG-1 and RAG-2 (Oettinger et al., 1990). If successful, the heavy chain can go on to interact with protein complexes to form the Pre-B cell receptor. A similar process of rearrangements follows at the light chain V and J locus, such that the completed light chain can then form a surface IgM B cell receptor (BCR) following which immature B cell with foreign specificities are released into the

5 periphery (Hsu, 2009). Approximately 90% of all B cells, most of which are self- reactive, die at or before the immature B cell stage (Osmond, 1991).

On reaching the spleen, immature B cells differentiate into transitional B cells. These B cells are sensitive to apoptosis upon BCR ligation and develop into two different B cells subsets, marginal zone (MZ) and follicular (FO), which are demarcated by their location and function. MZ B cells are restricted to the splenic white pulp, allowing them to respond rapidly to blood borne antigens. While FO B cells which make up the majority of mature B cells, circulate the blood and lymph nodes in search of antigen (Pillai and Cariappa, 2009). In the absence of antigen, they like T cells, die.

1.2.2 Lymphocyte activation

TCRs and BCRs generated by the random recombination of gene segments can recognise an estimated 1015 possible antigen specificities (Delves and Roitt, 2000), which confers on the immune system the capacity of responding essentially to all antigenic determinants present in the environment and host tissues. As discussed later, tolerance mechanisms are in place to minimise reactivity to one’s own cellular components.

1.2.2.1 T cell activation

T cells recognise peptide MHC complexes to be presented on professional antigen presenting cells (APCs), where as B cells recognise conformational determinants on antigen directly (Coquerelle and Moser, 2010; Reichardt et al., 2010; Ron and Sprent, 1987).

Naïve T cells circulate through lymphoid organs and the blood, surveying APCs for recognition of cognate MHC-peptide complexes. Once matured in the thymus, T cells co-express either CD8 or CD4 on their surface, which dictates whether they respond to antigen in the context of MHC class I or class II, respectively (Germain, 2002). As stated before, APCs present peptide loaded MHC class II to CD4+ T cells. Activation versus tolerance depends on simultaneous delivery of second signals in the form of cytokine and costimulatory signal

6 molecules (Bretscher, 1999; Schwartz, 1992). When presented with costimulation signals, the complete activation of CD4+ T cells ensues (Kubach et al., 2005; Morelli et al., 2001; Skoberne et al., 2004). Members of the B7 family, B7.1 (CD80) and B7.2 (CD86) expressed on mature APCs, capable of binding CD28 on T cells, can provide the costimulation signal required. Another pairing is achieved with ICOSL on B cells binding ICOS on T cells. An additional consideration, capable of tempering the immune response is the expression of inhibitory molecules, including PDL-1 and PDL-2 on APC and CTLA-4 and PD-1 on T cells (Coyle et al., 2000; Greenwald et al., 2005; Rudd et al., 2009; Tafuri et al., 2001). Many cytokines produced by APCs at the time of antigen presentation can enhance or modulate the T cell response, including interleukin (IL)-1, IL-6, Tumor necrosis factor alpha (TNFα), Transforming growth factor beta (TGFβ) and IL-12 (Rojas et al., 1999).

Indeed cytokines, immune cell growth factors secreted by cells of both innate and adaptive immunity, are important regulators of many immune functions. Their presence in an immune response can stimulate diverse responses by the cells present. Of particular interest is the cytokine IL-21, produced by activated CD4+ T cells and NKT cells (Coquet et al., 2007; Parrish-Novak et al., 2000), which will be discussed in detail later, and is integral to this thesis.

After engagement of the TCR and its specific ligand, the peptide MHC/complexes, a cascade of biochemical changes occurs, which leads to transcriptional activation and cell cytoskeletal re-arrangement. TCR engagement and the subsequent downstream biochemical signalling pathways needs to be exquisitely sensitive to discriminate between the small amounts of foreign cognate peptide and many thousands of self peptides displayed on the plasma membrane of the APC. Engagement of TCRs causes activation of Src and Syk/ZAP-70 family proteins and the tyrosine phosphorylation of various cellular substrates, calcium (Ca2+) mobilisation with activation of mitogen-activated protein kinases (MAPKs), including extracellular signal-related kinases (ERK), jun N-terminal kinases (JNK), and p38 MAPK, which translate the receptor signal to transcriptional activation of effector genes (Chakraborty and Das, 2010; Whitmarsh and Davis, 2004). TCR engagement alone activates the ERK cascade to activate the transcription factor,

7 nuclear factor of activated T cells (NFAT), which in turn regulates the expression of the T cell growth cytokine IL-2 (Hermann-Kleiter and Baier, 2010). Like TCR signalling, CD28 costimulation also leads to dramatic up-regulation of IL-2 expression, however in this case via JNK (Su et al., 1994). On the other hand, CD28 signalling also induces the transcription of anti-apoptotic molecules such as Bcl-xL to promote T cell survival (Boise et al., 1995), amplifying the Ca2+increase, and cytoskeletal changes, to lower the activation threshold (Yokosuka and Saito, 2009) as well as inducing cell cycle progression (Lenschow et al., 1996). As such, it is through these cellular signalling pathways that the engagement of external receptors results in modulation of effector T cell genes.

1.2.3 CD8+ T cells

In the case of CD8+ T cells, peptide is presented in context of MHC class I. It is of note that unlike MHC class II, which has restricted expression by APCs, MHC class I is ubiquitously expressed by all nucleated cells. Cellular products (primarily cytosolic in origin) form the source of their presented peptides. As such, when a cell becomes infected, pathogen-derived peptides are generated by proteosomal degradation, and as the same as self-peptides, are processed for presentation on MHC class I molecules. By this mechanism, CD8+ T cells can survey cells for intracellular infections, and similarly monitor for tumorigenic signals. CD8+ T cells are able to directly lyse infected and/or abnormal cells with perforin, and are also capable of Fas mediated killing. Activated CD8+ T cells secrete a range of cytokines such as TNFα and IFNγ, which can also influence microbial defence (Wong and Pamer, 2003).

1.2.4 CD4+ T cells

Activation of T cells is the first step in mounting a response to an invading pathogen. Naïve CD4+ T cells recirculate from the blood through lymphoid organs surveying DCs for activating MHC–peptide complexes. As stated earlier, naïve CD4+ T cells recognise peptide antigen complexed with MHC class II, presented on professional APCs. This recognition triggers a series of events that activate T cell proliferation and differentiation, with signalling cascades outlined above in section 1.2.3. This is conducted with a second signal, also provided by APCs to allow costimulation and thus full effective T cell activation (Bretscher, 1999). This second

8 signal constitutes the interaction of costimulatory molecules expressed on APCs with costimulatory receptors on CD4+ T cells. Thus, the expression of costimulatory molecules on APCs is a critical component of their activating potential. Without sufficient costimulation T cell activation is ineffective and T cells may either become anergic (unresponsive) or undergo programmed cell death (apoptosis) (Bretscher, 1999). Successful activation of CD4+ T cells results in acquisition of effector functions, allowing the CD4+ T cells the ability to regulate cellular and humoral immune responses (T-helper cells) (Abbas et al., 1996).

1.2.5 CD4+ T cells- T helper subsets

CD4+ T cells and their secreted cytokines constitute a vital component of the immune system. Following activation, CD4+ T cells acquire various effector functions such as cytokine secretion, adhesion molecule expression allowing migration to sites of infection and also chromatin changes which may maintain differentiated T helper states and ensure their progeny have a similar phenotype (Wilson et al., 2009). As outlined below, these effector subsets have specific roles in the immune response. Initially delineated as T helper (Th)1 and Th2 cells, further subset divisions continue to be proposed, as modelled recently in Figure 1.3. Importantly, it remains controversial whether a given cell is committed to one lineage, or whether plasticity is retained throughout differentiation (O'Shea and Paul, 2010). Also, as this thesis focuses on autoimmunity, it is interesting to find that whilst these T cell polarisations may have evolved to combat specific types of pathogens, in a faltered immune response, these polarisations can drive specific autoimmune or allergic reactions. For example, Th1 cells have been identified as driving colitis (Hans et al., 2000), and have found to be involved in T1D pathogenesis (Liblau et al., 1995). In contrast, Th2 T cells participate in allergic and atopic reactions such as asthma (Cohn et al., 2004). Th17 cells have found to be important to autoimmune conditions such as the mouse model of multiple sclerosis

(MS), experimental allergic encephalomyelitis (EAE) (Langrish et al., 2005) and TFH cells in humoral immunity based diseases such as lupus (Bubier et al., 2009; Linterman et al., 2009; Vinuesa et al., 2009; Vinuesa et al., 2005b).

9

Figure 1.3 Pluripotent model of T helper differentiation Differentiated T helper subsets are derived from naïve CD4+ T cells, with the pluripotent model suggesting that all Th subsets arise from a common pluripotent Th cell precursor. (Figure reproduced from (King, 2009)).

1.2.5.1 Th1 and Th2 cells

Th1 and Th2 cells were the first CD4+ T cell subsets described, characterised by their mutually exclusive expression of IFNγ or IL-4, 5 and 13, respectively (Mosmann et al., 1986). Later studies revealed that intracellular infections such as

Leishmania major involved Th1 cells, whereas Th2 cells were specialised for protection against extracellular pathogens such as Helminths (Heinzel et al., 1989).

Th1 and Th2 cells are derived from a common naïve precursor (Abbas et al., 1996) with instructive signals in the form of cytokines and cell surface molecules expressed by APCs important for the polarisation of Th cell responses (O'Garra and Murphy, 1994; Szabo et al., 2003). For example, presence of cytokines such as IFNγ and IL-12 at the time of CD4+ T cell activation initiates activation of the transcription factor STAT1, and Th1 cell development ensues. STAT1 in combination with TCR signals switches on the T-bet and RUNX3 transcription factors which amplify the Th1 phenotype by creating IFNγ production and inhibiting

Th2 transcription factors and gene products such as IL-4 (Djuretic et al., 2007). APC derived IL-12 also reinforces Th1 commitment through the STAT4 transcription

10 factor, again enhancing IFNγ and creating a positive feedback loop (Wilson et al.,

2009). Th1 cells activate macrophages and CD8+ T cells that can directly lyse target cells containing intracellular pathogens.

Conversely, Th2 cell differentiation is mediated by STAT6 activation through IL-4 signalling at the time of TCR priming. STAT6 and signals derived from transmembrane receptor, Notch, induce the transcription factors GATA3 and MAF, which lead to transcription of the signature Th2 cytokines IL-4, IL-5 and IL-13

(Amsen et al., 2007). These Th2 transcription factors also concomitantly antagonise

Th1 differentiation and IFNγ production (Ansel et al., 2006). Th2 cytokines and costimulation molecules help humoral immunity and also activated epithelial defence mechanisms that target parasites in the mucosa.

1.2.5.2 Th17 cells

Th17 cells, another Th subset, have been linked with clearance of bacterial and fungal infections through mobilisation of neutrophils and release of inflammatory chemokines (Ivanov et al., 2009; Ma et al., 2003; Pepper et al., 2010). This effector subset shares interesting similarities with Treg induction, as they are also generated in response to TGFβ exposure, when combined with IL-6 rather than IL-2 (Manel et al., 2008). These cytokines upregulate the retinoic-acid receptor- related orphan receptor-γt (RORγt), which can also antagonise Treg development

(Ivanov et al., 2007). Th17 cells produce IL-21, which can add to STAT3 activation driven by APC derived IL-23 and IL-6 to stabilise Th17 commitment (Korn et al.,

2007a; Zhou et al., 2007). Th17 cells are often associated with mucosal surfaces and can sometimes produce IL-22, another STAT3 signalling cytokine which targets epithelial cells with diverse effects such as cell survival and proliferation, promoting maintenance of epithelial barriers as well as induction of inflammatory proteins (Aujla and Kolls, 2009).

1.2.5.3 T follicular Helper cells

A more recently described Th subset is the T follicular helper (TFH) cells. TFH cells have the ability to migrate from T cell zones into B cell follicles. Within germinal centers (GCs), TFH cells provide help to B cells in order to produce high

11 affinity antibodies. They are characterised by high expression of surface markers CXCR5, ICOS and PD-1, the transcription factor BCL-6, as well as cytokines such as IL-21, IL-10, IL-4 and IFN-γ.

The provision of help by T cells within the GC is essential for production of high affinity, long lasting humoural immunity. The specific CD4+ T cell subset responsible for B cell help, termed TFH cells, were initially identified due to their unique ability to migrate into B cell follicles due to surface expression of the chemokines receptor CXCR5, and they were also shown to induce antibody production when cultured with B cells in vitro (Breitfeld et al., 2000; Schaerli et al.,

2000). TFH cells also express the B7 family molecule ICOS that stimulates antibody production by B cells, as well as PD-1, which is upregulated following TCR engagement. TFH cells also secrete cytokines such as IL-21, IL-10 and IL-4, which can influence B cell antibody production and class switching, as well as the follicular B cell chemoattractant CXCL13 (Haynes et al., 2007; Kim et al., 2004; Reinhardt et al., 2009).

The provenance of the recently described TFH subset and the exact sequence of events during their differentiation are subject to ongoing investigation. TFH are derived from naïve T cells that are primed to antigen by the DC that populate the T cell zone like other T helper subsets. Upon TCR engagement, the progeny of the first IL-2 induced clonal expansion express the early activation marker CD69 and downregulate sphingosine 1 phosphate receptor 1 (S1P1R1), which sequesters these cells within the lymph node (Shiow et al., 2006). After 2-3 days some cells exit the lymph node as effector cells that can traffic to infection sites, and some retain CD69 expression and remain in the lymph node. These include potential TFH cells, which express the chemokines receptor CXCR5, allowing movement towards the B cell border with the T cell zone (Haynes et al., 2007). T cells that form strong interactions with B cells may migrate into the primary follicle or GC where constant interactions with antigen specific B cells may cement the TFH differentiation process (Ebert et al., 2004). Those CD4+ T cells that do not form strong conjugates with B cells may enter different T helper lineages or participate in extrafollicular B cells responses (Odegard et al., 2008; Reinhardt et al., 2009).

12 1.2.5.4 Regulatory T cells

As outlined earlier, through mechanisms of thymic selection, cells with TCRs that inappropriately respond to self-antigen expressed in the thymus, undergo apoptosis. Occasionally though, these self-reactive T cells are released into the periphery (Sakaguchi, 2000). Tolerance mechanisms, instigated by regulatory T cells (Tregs) are in place to counteract possible damage to self-tissues caused by these self-reactive T cells, and immune responses in general, that persist longer than is necessary or are too strong. Tregs can inhibit immune response with a combination of anti-inflammatory cytokines, cell-to-cell contact and modulation of APC function (Vignali et al., 2008). Tregs are generated both in the thymus (natural Tregs) and in the periphery (inducible Treg) in response to tolerising signals (Josefowicz and Rudensky, 2009). Tregs express the high affinity IL-2 receptor, CD25, on their surface and also characteristically express the forkhead box (Fox)p3 transcription factor (Schubert et al., 2001), which inhibits proinflammatory cytokine expression by this subset (Williams and Rudensky, 2007). Humans or mice with defects in the Foxp3 locus suffer from a fatal lymphoproliferative disease, IPEX, which affects many tissues (Bennett and Ochs, 2001; Brunkow et al., 2001). Natural Tregs are generated in the thymus, where strong TCR affinity for self peptide:MHC that falls just below the threshold for negative selection is thought to correlate with Foxp3 expression (Hsieh et al., 2006). Peripheral naïve CD4+ T cells can also acquire Foxp3 expression when exposed to TGFβ and high IL-2 levels (Zheng et al., 2007). Recent research has shown the gut to be a particularly effective location for the generation of inducible Tregs through combinations of tolerising APCs, dietary derived retinoic acid and cytokines such as TGFβ (Annacker et al., 2005; Benson et al., 2007; Coombes et al., 2007).

Tr1 cells can also suppress several types of autoimmune disease, although they do not express Foxp3 (Cottrez and Groux, 2004). They are thought to arise from antigenic stimulation in concert with high levels of the suppressive cytokine IL-10, which they also produce in order to dull local immune responses. These cells are also said to utilise IL-21 and IL-27 in order to amplify IL-10 production (Bubier et al., 2009; Pot et al., 2009).

13 1.2.6 T cell memory and homeostasis

The adaptive immune system is characterised by a powerful ability to form memory cells in response to a primary infection. This allows a more robust and rapid response to any subsequent infections of the same pathogen. It is interesting to find that once a pathogen is cleared, about 90-95% of the now redundantly expanded T cell pool responsible for this clearance dies. This is achieved by mechanisms of non- sustaining levels of proinflammatory cytokines and other signals. As a result, only a small population survive as memory cells, due to competition for homeostatic cytokine signals (Surh and Sprent, 2002). Whilst these memory cells carry the same specificity for antigen as the naïve cells, they have a markedly lower activation threshold and are less dependent on costimulation in order to be reactivated (Cho et al., 1999; Rees et al., 1999). They display diverse homing abilities and can remain in lymph nodes to aid antibody production or alternatively migrate to inflamed tissue sites. Based on this preference, memory T cells can be loosely partitioned into central memory cells, which patrol lymphoid organs, and effector memory cells which survey tissues such as the gut for reinfection (Sallusto and Lanzavecchia, 2009).

The size of the T cell pool within an individual is very stable due to homeostatic balance between naïve, effector and memory T cells. The pool is maintained by a combination of pro and anti-apoptotic molecules, proliferation and differentiation. The γ-chain family of cytokines play a pivotal role in maintaining various T cell populations (Surh and Sprent, 2005). The naïve T cell population is maintained by a combination of signals derived from the IL-7 receptor and continued contact between the TCR and self-MHC, which sustain survival in interphase. This is achieved by Bcl-2 and Mcl-1 expression preventing apoptosis via the mitochondrial pathway. Memory cells survive due to a mixture of signals from IL-7 and IL-15 (Surh and Sprent, 2008). These support not just survival of memory T cells, but also occasional cell division that promotes the longevity of a certain useful TCR specificity within the T cell repertoire. IL-2 drives proliferation of naïve T cells on exposure to antigen, and is also vital for Treg survival or metabolic fitness in the periphery (Fontenot et al., 2005). Differential receptor expression and transfer experiments suggest that IL-2 favours effector memory survival, while IL-15 sustains long-lived central memory (Cho et al., 2007).

14 1.2.7 B cell activation

B cells are very important in the immune system, as they secrete antibodies to protect against invading pathogens. Antibodies protect against pathogens in three ways; (i) by binding to extracellular components of pathogens required for adhesion or entry into host cells, thereby neutralising them. (ii) Antibodies can also protect against pathogens in intercellular spaces by binding and enhancing their phagocytic uptake through FcR signalling on granulocytes and APC (Radaev and Sun, 2002). (iii) Certain antibody isotypes, principally IgG, can opsonise pathogens by binding components of the complement system, causing cytolysis and release of pro inflammatory proteins (Peng et al., 2005).

As a result of binding surface antigen receptors to specific foreign antigen, B cells become activated, clonally proliferate, and differentiate into antibody-secreting effector cells, called plasma cells. A portion of these plasma cells become resident in the BM as non-dividing, long-lived plasma cells. These are important for the generation of antibody-mediated memory (Manz et al., 2002; Ribatti, 2009).

In the vast majority of cases, B cells rely on CD4+ T cell help at the time of BCR cross-linking for the generation of an antibody response (T-dependent; TD), however in some cases, certain antigens (T-independent; TI) can activate B cells without T cell help (Vinuesa et al., 2003).

1.2.7.1 T dependent antibody production

T cell help is a crucial component in antibody production in order to achieve high affinity memory cells and long lived plasma cells specific for foreign antigens. For the initiation of a TD response, B cells bind to the cognate antigen though their BCR. Antigens binding to the BCR are internalised and then presented to T cells as short peptides in association with MHC class II. In return, the activated helper T cell provides a costimulatory signal, such as CD40L, which interacts with its receptor, CD40 on B cells to stimulate B cell proliferation and isotype switching (Elgueta et al., 2009). Interaction of B and T cells result in proliferation only if T cells have previously been stimulated to become effector cells by contact with other APCs.

15 T cell help can lead to isotype class switching, with the process influenced by the presence of immune regulating proteins, cytokines (Stavnezer, 1996). For instance, in mice, the Th1 cytokine interferon gamma (IFNγ), stimulates the expression of immunoglobulin of the IgG2a isotype and inhibits the production of

IgG3, IgG1, IgG2b, and IgE (Snapper and Paul, 1987). Conversely the Th2 cytokine, IL-4 promotes isotype switching to IgG1 and IgE, but markedly inhibits IgM, IgG3, IgG2a, and IgG2b (Snapper and Paul, 1987). It has been shown recently on T-B cell conjugate experiments that IL-4+ T-B conjugates purified from immunised mice contain increased class switching to IgG1, whereas IFNγ+ conjugates tended to express IgG2a (Reinhardt et al., 2009).

T cell help for B cells occurs in secondary lymphoid tissues, which provide the ideal microenvironment for T and B cells to interact with each other and with other cell types such as DCs and follicular DCs (FDCs) (King, 2009; Nurieva and Chung, 2010; Vinuesa et al., 2005b). The initial interaction is thought to occur at the border of the T and B cell zones (Okada et al., 2005). B cells that receive costimulation via CD40L on T cells at this site migrate deep into the B cell area where they form a primary follicle close to FDCs, which serve as local depots of antigen due to retention of immune complexes on their surface (Allen and Cyster, 2008). B cells dividing in newly formed germinal centres (GCs) move between sub structures called the light zone, which is filled with ‘centrocytes’ with lower proliferation rates, and the dark zone filled with dividing ‘centroblasts’ undergoing mutation of the BCR (Okada and Cyster, 2006). These two regions are compartmentalised based on sensitivity to the chemokine CXCR4 in the dark zone and CXCL13 in the light zone (Allen et al., 2007; Pereira et al., 2010). TFH cells can also be found in both regions but are more common within the light zone, as are

FDCs (Allen and Cyster, 2008; Carter and Myers, 2008). TFH cells provide vital survival signals such as ICOS, CD40 and cytokines like IL-21 and IL-4, which are only available to the B cell clones that can compete for T cell help (Haynes, 2008).

T cell help, primarily in the GC leads to the affinity maturation of isotype class-switched antibody with somatic hypermutation of their Ig variable (V) region gene segments (King et al., 2008) (Figure 1.4). BCRs undergo a complex series of

16 DNA rearrangements by somatic mutation and through a process called affinity maturation, allowing for the generation of additional B cell diversity (Tarlinton and Smith, 2000). As the BCR mutations occur, high affinity antigen-specific B cells are positively selected though competitive interactions with antigen presented as immune complexes with Igs on the surface of FDCs with the highest affinity B cells favoured and those with inadequate affinity, undergo death (Allen and Cyster, 2008). Upon subsequent antigenic rechallenge, these memory B cells rapidly undergo terminal differentiation into plasma cells producing large amounts of high-affinity antibodies.

Figure 1.4 Extrafollicular and follicular pathways to humoral immunity After exposure to a foreign protein antigen, both T and B cells home to the secondary lymphoid tissues where they are able to meet and interact. T cells are primed by dendritic cells and B cells take up antigen through their BCR, these activated cells meet in the T zone where they interact. B cells present antigen to helper T cells on MHC class II, and cognate interactions occasionally occur. Following this interaction, B cells either enter the B cell follicle to seed the GC or they migrate to the lymph node medullary cords or the splenic bridging channels to form extrafollicular foci. Within the extrafollicular foci, plasmablasts proliferate and secrete low affinity immunoglobulin for a few days and subsequently die in situ. The B cells that seed the GC undergo rapid rounds of proliferation that are termed centroblasts (CB) and undergo somatic hypermutation (SHM) of their IgV-region genes. SHM alters the specificity of the BCR for antigen; the affinity of the BCR for antigen can increase, decrease or remain unchanged. After SHM centroblasts stop proliferating and are termed centrocytes (CC), the CC scavenge antigen from follicular dendritic cells and present this antigen to a specialised subset of helper T cells, T follicular helper cells (TFH). GC TFH cells provide positive survival signals to CC with the highest affinity for antigen, and these cells are able to exit the GC as long-lived plasma cells or memory B cells. (Figure reproduced from (Linterman and Vinuesa, 2010)).

17 An alternative B cell fate to the follicle migration and formation of GCs, is to migrate instead to extrafollicular sites (Figure 1.4). This will result in a short burst of proliferation and differentiation into short-lived plasma cells. Extrafollicular derived antibody is generally low affinity as it occurs independent of somatic hypermutation (SHM) and B cell selection in the germinal centre (Berek et al., 1991). The decision between GC and extrafollicular responses may be driven by affinity for antigen, with very high affinity moving quickly to extrafollicular development to make a first wave of low affinity antibody while slightly lower affinity cells are refined in the GC (Chan et al., 2009; Paus et al., 2006).

1.3 Autoimmunity

1.3.1 Autoimmune Disease: Breakdown of Tolerance

The strength of the adaptive immune system lies in its ability to facilitate antigen specific responses, but one must consider the possibility that this process may lead to mistakes. Indeed, a paradox to consider is how the immune system must be able to mount a sufficiently strong response to any invading pathogen, yet it must also be able to avoid recognition of antigens produced by the body’s own cells, i.e. self-antigens. It was Paul Ehrlich, at the beginning of the 20th century who first proposed the concept of immunological distinction between self- and non-self tissues, which he termed “horror autotoxicus”, cited by (Silverstein, 2001). Ehrlich suggested that there were mechanisms in place to ensure that the immune system did not respond to self-antigens. Autoimmune disease occurs when loss of tolerance results in targeting of self-antigens by the immune system. Research is ongoing as to how autoreactive cells exist at all and why they do not cause problems in healthy individuals.

1.3.1.1 Tolerance

Tolerance is broadly described as the failure to form an immune response to an antigen. Tolerogenesis is the process by which self-reactive cells are eliminated, functionally altered or inhibited in order to regulate a normal functioning immune system. It is estimated that up to 75% of B and T cells generated, bind to self- antigens (Wardemann et al., 2003; Zerrahn et al., 1997). Since only 3-8% of humans

18 develop an autoimmune disease, tolerance to self-antigens is kept intact in most individuals (Jacobson et al., 1997; Marrack et al., 2001). To ensure tolerance to self- antigens, the immune system has evolved an array of mechanisms designed to delete or inhibit self-reactive lymphocytes. Mechanisms used to suppress self-reactive lymphocytes, ensuring multiple checkpoints in place, are illustrated in Figure 1.5 (Goodnow et al., 2005).

Figure 1.5 Four cellular strategies are used to regulate self-reactive receptors at different points during B and T cell differentiation. (A) The cell is deleted through induction of cell death. (B) The antigen receptor is edited to one that is less self-reactive. (C) Biochemical or gene-expression changes intrinsically dampen the self-reactive receptor's ability to activate the cell. (D) The ability of self-reactive cells or antibody to cause autoimmunity is limited by using extrinsic suppression and by limiting essential growth factors, costimulation and inflammatory mediators. (Figure reproduced from (Goodnow et al., 2005)).

B cells are susceptible to peripheral tolerance mechanisms such as clonal deletion or clonal anergy, depending on the maturation stage of B cells and the molecular nature of the self-antigens (Basten and Silveira, 2010; Nossal, 1991). Tolerance mechanisms relevant to T cells will be discussed further, as they are most pertinent to the topic of this thesis.

T cell tolerance can be divided into thymus acting (central) and peripheral tolerance. As discussed earlier, maturation of T cells occurs in the thymus. In order to pass central tolerance, T cells must be positively selected by MHC:self-peptide

19 complexes on the surface of cortical thymic epithelial cells, enabling movement to the medulla. Furthermore, they must be negatively selected for overly strong TCR binding to the MHC:self-peptide complex (Palmer, 2003). The gene Aire promotes the ectopic expression of peripheral tissue-restricted antigens in medullary epithelial cells of the thymus, which allows the developing T cells the opportunity to be negatively selected against peripheral antigens (Anderson et al., 2002). Whilst these mechanisms of central tolerance are in place, they may not be infallible. As such, peripheral tolerance is necessary to ensure ongoing tolerance in the mature repertoire.

In the periphery, T cell tolerance is achieved by a number of mechanisms, including clonal deletion, induction of anergy following encounter with self-antigen and suppression of T cell proliferation by Treg cells (Lohr et al., 2005; Sakaguchi, 2004; Walker and Abbas, 2002). Tregs, as outlined earlier, have a critical role in maintaining tolerance. The systemic autoimmune disease, IPEX, which results from depletion of Tregs (Walker and Abbas, 2002), demonstrates this. Apoptosis also plays a key role in peripheral tolerance, as apoptotic fragments of epithelial cells derived from cellular turnover are presented by immature DCs and generate tolerance to tissue-specific autoantigens (Bretscher and Cohn, 1970; Nepom, 1998). However, a fine balance must be kept. Excessive generation of apoptotic cells has been implicated in the precipitation of autoimmune events, particularly in systemic lupus erythematosus (SLE), due to presentation by mature DCs leading to T cell activation (Takeda et al., 1999). Ultimately, a loss of tolerance results in self-reactivity present in the mature lymphocyte repertoire, which may in turn lead to autoimmunity.

1.3.2 Autoimmune diseases

Sustained immune responses against self-antigens can be due to a breakdown in self-tolerance at the level of T and/or B cells. These self-reactive immune responses characterise autoimmune diseases (Jacobi and Diamond, 2005). The antigenic targets of different autoimmune diseases vary, and as such, pathological signs and symptoms presented are diverse. Many autoimmune diseases involve a specific immune response to a self-antigen expressed solely in one organ. For example, follicular cells of the thyroid are targeted in Graves disease, the parietal

20 cells of the stomach in pernicious anaemia and the pancreatic β cells in T1D. However, there are also autoimmune diseases where the response is directed against antigens ubiquitously expressed throughout the body. Nuclear antigens such as DNA and RNA are common targets of the autoimmune response in SLE, such that patients often develop pathology in their skin, heart, joints, lungs, blood vessels, liver, kidneys and nervous system as a result of deposits of immune complexes of antibody and nuclear antigens. The causes of autoimmune diseases are multifactorial, consisting of both environmental and genetic components.

1.3.3 Environmental Contributions to autoimmunity

It is clear that environmental factors must contribute to autoimmunity, because concordance rates of autoimmune diseases in monozygotic twins are never 100%. Environmental factors that have shown association with autoimmune diseases include diet, infectious organisms, stress, UV exposure and chemical exposure.

The association of autoimmune disease with infection, has suggested that the initiation of autoimmune disease may occur by permitting bystander damage, or cross-reactivity of responding lymphocytes with antigens, termed molecular mimicry (Richer and Horwitz, 2008). An example of this is the link between infection with Coxsackie virus and the onset of T1D, which results in an enhanced expansion of autoreactive T cells through non-specific mechanisms (Horwitz et al., 1998).

The “hygiene hypothesis” states that a lack of early childhood exposure to infectious agents and parasites increases susceptibility to autoimmune diseases by modulating the development of the immune system. Improved hygiene practices and increased medical care has seen childhood exposure to microorganisms and parasites generally decreased in most developed countries. Whether we need these exposures to create a fully ‘educated’ immune system remains debatable. The hygiene hypothesis would suggest that this decrease in exposure to infections during childhood might be linked to the increasing incidence of autoimmune diseases (Garn and Renz, 2007). In developing countries, where rates of childhood infection are much greater than in developed countries, much lower rates of autoimmune disease ensue. The theory proposes that children in developing countries receive stimuli from

21 infectious agents and parasites which allows for correct development of Tregs and hence suppression of immune responses against self (Bufford and Gern, 2005).

A plausible example of the hygiene hypothesis in action is seen in the NOD model of T1D. It is well established that NOD mice have a high susceptibility to T1D if kept in pathogen-free conditions. However, the incidence of T1D in these animals is greatly reduced if kept in facilities with no pathogen control, or if given a purposeful infection with various viruses, bacteria or components of killed bacterial (i.e. CFA) (Bach, 2002). Some evidence indicates that protection from T1D conferred by infection in young NOD mice is caused by skewing of the immune response away from the inflammatory Th1 towards Th2 type responses.

1.3.4 Genetic Contributions to autoimmunity

Genetics plays a major influence in the occurrence of autoimmune disease (Rioux and Abbas, 2005). Siblings of individuals with autoimmune disease display a higher disease susceptibility than non-related individuals (Alper and Awdeh, 2000). Furthermore, the concordance rates for autoimmune diseases are always higher in monozygotic (identical) rather than dizygotic twins (Hawa et al., 2002; Kumar et al., 1993). It has been found that often, the genes conferring susceptibility to autoimmune disease regulate either the function of the immune system or the ability of target tissues to modulate an impending immune attack.

1.3.4.1 MHC genes

The link between MHC alleles and predisposition to autoimmune disease has been well documented. In particular, polymorphisms in MHC class II genes have shown a strong association with certain autoimmune diseases. For example, the human HLA-DQB1 allele has particularly strong association with T1D predisposition, and there is evidence that suggests that a major genetic contribution to rheumatoid arthritis (RA) is conferred by HLA-DR4 alleles (Nepom, 1998; Nepom and Kwok, 1998). Strong associations with MHC class I also exist, where the association of HLA-B27 to ankylosing spondylitis is one of the strongest between a MHC molecule and a disease (Marcilla and Lopez de Castro, 2008).

22 Polymorphisms in MHC molecules conferring susceptibility to autoimmune diseases mainly occur within the peptide binding cleft and result in either inefficient presentation of particular self-peptides during T cell selection, or inhibition of the selection of Tregs in the thymus (Kanagawa et al., 1998). Another hypothesis is that MHC can direct the specificity of the autoimmune response by preferentially binding particular types of autoantigen peptides, which they subsequently present to CD4+ T cells. For example, mouse I-Ag7 or human DQ-8 are particularly good at presenting glutamic acid decarboxylase (GAD)-65 or insulin peptides to T cells due to a peptide pocket that is wider, shallower and open towards the C-terminus, therefore being more accommodating for these autoantigens (Stratmann et al., 2000).

1.3.4.2 Non-MHC genes

Autoimmune disease quite often involves a combination of susceptible alleles at multiple loci. While these susceptible alleles may occur at high frequencies in the general population (Rioux and Abbas, 2005), it is proposed that the combined affect of multiple alleles may lead to the presentation of an autoimmune disease. On their own these susceptibility alleles are not detrimental, and may even provide a selective advantage in some environments, which may explain their high frequency.

As genes influencing immuno-reactivity are generally not disease specific (Marrack et al., 2001), it is common for patients with a certain autoimmune disease to report family members with other systemic or organ-specific autoimmune diseases (Rhodes and Vyse, 2007; Shamim and Miller, 2000). Furthermore, while T1D patients present with autoantibodies against pancreatic β cell antigens, they can also show autoantibodies to a variety of different tissue targets (Betterle et al., 1984; De Block et al., 2001; Jaeger et al., 2001).

A number of non-MHC susceptible genes, and genetic regions, loci, have been linked with conferring susceptibility to multiple autoimmune diseases. Examples include disruptions in the PTPN22 gene, implicated in T1D, RA and SLE (Rioux 2005), STAT4, implicated in SLE and RA (Remmers et al., 2007) and the CTLA-4 locus, which is implicated in both Graves’ disease and T1D (Ueda et al., 2003). Whilst the list of associated loci is considerable, including Insulin-dependent

23 diabetes locus (Idd)5 with T1D and sialadenitis (Brayer et al., 2000), and Idd13 with T1D and lupus (Esteban et al., 2003), we are most importantly concerned with Idd3. Of the more than 20 Idd loci, Idd3 is the strongest non-MHC linked locus in the NOD model of T1D, and will be discussed at length in later sections.

The observation that some genes have been associated with multiple disorders is consistent with the theory that certain immunological pathways are common to multiple autoimmune diseases. In addition, disruptions in genes within the same biochemical pathway can predispose to the onset of autoimmune disease. For example, alterations in numerous genes involved in Fas-induced apoptosis are detected in autoimmune diseases such as T1D and MS, implying that mutations in Fas function can predispose the immune system to autoimmunity (Comi et al., 2000; DeFranco et al., 2001). Furthermore, in one outcross study, numerous Idd genes were all associated with a generalised inability to delete self-reactive T cells in the thymus (Liston et al., 2004), which leads to persistence in the periphery of autoreactive T cells.

1.4 Idd3- Contribution to autoimmunity

The strongest non-MHC linked locus in the NOD model of T1D is Idd3 on mouse chromosome 3. The profound influence of this locus is evidenced by the introduction of the C57BL/6 (B6) Idd3 region into the NOD genome, which results in a reduction of diabetes incidence by ~75% (Lyons et al., 2000; Wicker et al., 1994). The most restricted mapping identifies only 6 genes within this locus (Tenr, Il2, Il21, Cetn4, Bbs12 and Fgf2) and 2 predicted genes (Gm12540 and KIAA1109) (Yamanouchi et al., 2007), as listed on T1DBase (http://T1DBase.org) (Smink et al., 2005). It is interesting to note that the region Idd3 in T1D overlaps with disease susceptibility in several murine models of autoimmunity as well as the equivalent genetic locus on chromosome 4, in human autoimmune diseases (Table 1.1). Emerging data of the genes contained within the Idd3 region show that it contains both known strong immunoregulators (Il2 and Il21) as well as genes yet to be analysed in terms of contributing to an immune response. The link between Idd3 and multiple autoimmune diseases is outlined in Table 1.1, with the experimental

24 evidence discussed specifically for mouse models of T1D and Sjögren’s syndrome, and human autoimmune disease linkage.

Table 1.1 Disease association with Idd3 locus in mice, and 4q27 region in humans Disease Evidence for Idd3 Disease References association Characteristic Linked Mouse models of autoimmune disease Autoimmune ovarian Linkage analysis Ovarian atrophy (Roper et al., 2002; dysgenesis induced by Teuscher et al., 1996) neonatal thymectomy Diabetes Linkage analysis Disease incidence and (Ghosh et al., 1993; (In NOD mice) and congenic promotion of immune Lyons et al., 2000; mapping cell infiltration in Todd et al., 1991; pancreatic islets, Wicker et al., 1994) insulitis Experimental Linkage analysis Disease severity and (Encinas et al., 1996; autoimmune infiltrating immune Encinas et al., 1999; encephalomyelitis cell histopathology Sundvall et al., 1995) associated with CNS Sjögren’s Syndrome Congenic strains- Disease severity and (Boulard et al., 2002; protected alleles on immune cell infiltrate Brayer et al., 2000; susceptible NOD in salivary glands Cha et al., 2002a; Cha background and et al., 2002b; Killedar reverse congenic et al., 2006; Nguyen et strains al., 2006) Human autoimmune diseases Coeliac Disease Linkage analysis (Hunt et al., 2008; van Heel et al., 2007) Graves Disease Linkage analysis (Todd et al., 2007) Systemic Sclerosis Linkage analysis (Mattuzzi et al., 2007) Rheumatoid arthritis Linkage analysis (van Heel et al., 2007) (RA) Type-1 Diabetes Linkage analysis (Asano et al., 2007; Todd et al., 2007; Zhernakova et al., 2007)

1.4.1 Type-1 Diabetes (T1D)

The NOD mouse spontaneously develops diabetes similar to human T1D, and has been used to study the causal effects of this disease (Anderson and Bluestone, 2005). Todd and colleagues initially localised Idd3 on chromosome 3, proposed its nomenclature as a disease susceptibility locus after observing the influence of Idd3 on T1D incidence of the NOD mouse (Todd et al., 1991). Utilising segregation analysis to assess the progeny of a (NOD x B10.H2g7) F1 backcrossed to NOD for

25 one generation, they found that, of the diabetic offspring, there was an increase in disease incidence in mice homozygous for the Idd3 region, suggesting that the Idd3 locus contained genes, which conferred diabetes susceptibility in the NOD mice. A subsequent study also found that only chromosome 3 in addition to chromosome 1, showed significant influence in both frequency and severity of immune cell infiltration in the pancreas, insulitis, with chromosome 1 containing the MHC genes (Ghosh et al., 1993). We now appreciate that the magnitude of the chromosome 3 effect was probably due largely to the additive effect of two or more susceptibility loci on chromosome 3, which we know recognise as Idd3 and Idd10 (Ghosh et al., 1993).

Wicker was the first to use congenic strains to study Idd3, successfully separating Idd3 and Idd10 in two congenic strains, to prove that the combination of these resistant alleles had an additive effect on disease protection (Wicker et al., 1994). Using congenic mapping, Wicker localised Idd3 to a 21.5 cM region on the proximal segment of chromosome 3. Subsequent studies (Denny et al., 1997; Lord et al., 1995; Lyons et al., 2000; Yamanouchi et al., 2007) (outlined in Table 1.2) further narrowed the congenic region describing Idd3 to the 650 kb region we recognise today (Yamanouchi et al., 2007). Interestingly, even as the Idd3 region was dramatically minimised, the resulting protection afforded from diabetes incidence remained comparable. This suggests that all of the required elements for the protection conferred by Idd3 are contained completely in the 650 kb region. It is however important to highlight that other elements of the NOD genome contribute to cause diabetes, as mice with the regions for diabetes susceptible MHC (Idd1) and Idd3 introduced alone onto the B6 background do not develop diabetes (Ikegami et al., 2004).

26 Table 1.2 Defining Idd3: Studies to narrow Idd3 from 21.5 cM to 650 kb Reference: study type Size of region Markers localised

(Lord et al., 1995): Analysis of congenic Less than 4.1 cM Between but not including strain (derived from NOD.B6Il2 strain D3Mit167 and D3Mit295 (Wicker et al., 1994)) for diabetes About one-third the size incidence previously reported (Wicker et al., 1994) (Denny et al., 1997): Analysis of 0.35 cM interval Between but not including congenic strains for diabetes incidence D3Nds55 and D3Nds40

(Lyons et al., 2000): Combined analysis Maximum size of Between the markers D3Nds36 of novel congenic strains for diabetes the Idd3 interval at and D3Nds76, incidence and an ancestral haplotype 780 kb With haplotype mapping analysis approach suggests Idd3 should lie in a 145 kb segment between D3Nds6 and the SNP 81.3 (Yamanouchi et al., 2007): Additional Redefine the Idd3 polymorphic markers were used on the interval to consist congenic strains analysed in (Lyons et of only 650 kb al., 2000)

1.4.2 Sjögren’s syndrome

Further to its recognition as a mouse model for T1D, the NOD strain has become an accepted model of Sjögren’s syndrome (SjS) (Humphreys-Beher and Peck, 1999). NOD mice spontaneously develop SjS, similar to the human condition in which inflammatory infiltrate appear in the salivary and lacrimal glands. By screening the available congenic NOD strains with which non-susceptible B6 loci is introgressed, Brayer et al. found that Idd5 and Idd3 in combination greatly influenced the susceptibility to development of SjS-like autoimmune exocrinopathy (Brayer et al., 2000). This was confirmed by a linkage study in a ((NOD x B6) x NOD) cross (Boulard et al., 2002). By utilising a B6 mouse carrying NOD loci for Idd3 and Idd5, Cha and colleagues showed that both Idd5 and Idd3 from NOD mice are necessary and sufficient to cause disease on a non-susceptible background (Cha et al., 2002a). Interestingly though, these mice did not carry any increased susceptibility to diabetes compared to B6. This double NOD susceptibility loci carrying mouse strain (compared to the singular locus carrying strains) showed the full SjS phenotype of the NOD mice. They proposed the designation of Aec1 for the genetic interval corresponding to Idd3 and Aec2 for the genetic interval

27 corresponding to Idd5. This study used a 43 cM region of Chr 3 to describe Aec1, which was subsequently narrowed to 19.2 cM, whilst still overlapping with Idd3 (Nguyen et al., 2006) and confirmed that the immunological aspects of the SjS disease were associated with this region.

1.4.3 Human Linkage Studies

Idd3, the strongest non-MHC linked locus to T1D in NOD mice, is orthologous to 4q27, a region on human chromosome 4, suggesting that these genes are inherited as a functional unit. Bearing this in mind, it is interesting to find that linkage studies, initiated by the Wellcome Trust Case-Control Consortium genome wide association studies (GWAS) of 500,000 genome wide single nucleotide polymorphisms (SNPs), support an association of the orthologous locus in humans, chromosome 4q27 with T1D incidence (Todd et al., 2007). In an independent case- control cohort, linkage studies confirmed this association in patients with T1D and Rheumatoid Arthritis (RA) (Zhernakova et al., 2007). But what is further striking is the number of other autoimmune diseases revealing associations with the Il2/Il21 region, including coeliac disease (Hunt et al., 2008; van Heel et al., 2007) together with ulcerative colitis (Festen et al., 2009; Glas et al., 2009; Marquez et al., 2009), autoimmune thyroid disease (Graves’ disease) (Todd et al., 2007) and systemic sclerosis (Mattuzzi et al., 2007). The association Idd3 holds across multiple autoimmune disorders, and across species, makes it very interesting to consider in terms of correlating roles of immune dysregulation.

1.5 Exploring gene contributions to the Idd3 effects There is extensive evidence for the association of multiple autoimmune diseases with the mouse Idd3 region. This raises the interesting possibility that the same genes may be involved in each of the diseases. In each case, the tissue targeted by the autoimmune assault is different, but consistency lies in the general state of immune dysregulation. Also, it seems that in each disease Idd3 is associated with the accumulation of immune cells in the site of inflammation. This could imply a role of an immune cell growth factor, to support tertiary lymphoid neogenesis, or a chemo- attractant of the immune cells to the region (Hjelmstrom, 2001). If one gene was responsible for the collective phenotype, it is likely that the gene encodes a protein involved in immune function. The Idd3 region contains two such candidate genes, Il2

28 and Il21. In addition to these well-explored candidates lie six additional genes contained within the Idd3 region, with their known function outlined below. Although they may not be immunoregulators genes in the most traditional sense, it is important to consider their presence in this locus, and how they may contribute to the Idd3 effect, particularly if the phenotype conferred is a result of dysregulation of a central locus control, and not as simply resulting from one gene candidate.

BBS12, a homologue of a human gene has been mapped to Idd3. Mutations in the human gene are associated with Bardet-Biedl syndrome, a malfunctioning cilia genetic disorder. As ciliated cells are important in many physiological settings, the clinical features of the disease are diverse, including obesity, retinitis pigmentosa, polydactyly, mental retardation, hypogonadism, and renal failure (Stoetzel et al., 2007). The human BBS12 encodes a protein similar to members of the type II chaperonin superfamily. In mice, BBS12 is expressed in the pancreas, so it may hold a role in Idd3 in NOD.

Centrin4 has been identified as a novel mammalian centrin, uniquely expressed in ciliated cells (Gavet et al., 2003). It is highly expressed in the brain, lungs, kidneys and ovaries and does not appear to have a role in the immune system.

Fibroblast growth factor 2 (Fgf2), previously called basic Fgf, is expressed in the basement membrane and subendothelial extracellular matrix of blood vessels. Fgf2 has well studied roles in wound healing and blood vessel angiogenesis (Nugent and Iozzo, 2000). Even though both CD4+ and CD8+ T cells have also been shown to produce and export Fgf2 (Blotnick et al., 1994), its association with immune responses has not been thoroughly explored. A single paper comments on a possible role for Fgf2 in Idd3-linked protection from autoimmune ovarian dysgenesis (Teuscher et al., 1996); given its presence within ovaries and demonstrated mitogenic activity on the ovary constitutive cells (Gospodarowicz et al., 1977a, b). Fgf2 shares with Fgf1, and other members of the Fgf family, the ability to signal through a family of receptors Fgfr1-4 (Chen and Forough, 2006). Interestingly, it has been recently described that Fgfr2 is upregulated on TFH cells (Chtanova et al., 2004), suggesting the importance of the Fgf family of proteins within the immune system.

29 Tenr functions in heterogeneous nuclear RNA packaging, alternative splicing and nuclear/cytoplasmic transport of mRNAs. A possible role for Tenr in Idd3 in T1D and other autoimmune diseases is unlikely, since the Tenr gene is transcribed exclusively in the testis (Schumacher et al., 1995).

Both Gm12540 and KIAA1109 are predicted genes of unknown function. Besides its initial mapping prediction, no literature has examined Gm12540. KIAA1109, as reported on T1Dbase.org, includes the pancreas in its transcript expression profile. As such, possible roles for both of these genes cannot be discounted.

1.5.1 IL-2 in immunity and autoimmunity

Interleukin- 2 (IL-2) is a potent immunoregulatory cytokine produced primarily by activated T cells. IL-2 has been the main focus of research into Idd3. The interest in IL-2 is obvious, given its abundant role in the immune system. For example, IL-2 drives Tcell proliferation and differentiation into effector cells, and was one of the first described T cell growth factors (Kelly et al., 2002; Letourneau et al., 2009). For many decades it was recognised as a potent stimulatory factor, but following the cloning of IL-2 and its individual receptor subunits, and the subsequent generation of knockout mice, its role in maintaining Tregs was recognised (Boyman et al., 2006b; Malek, 2008). Importantly, Tregs, which function to maintain tolerance to self and regulate immune responses, rely on IL-2 as a survival factor (Schubert et al., 2001). As discussed earlier, Tregs are vital for regulating immune responses and tolerance to self (Sadlack et al., 1993; Willerford et al., 1995). Indeed, lack of Il2 or Il2 receptor-alpha (CD25) is associated with the development of a severe wasting autoimmune disease, associated with hemolytic anemia and inflammatory bowel disease (Sadlack et al., 1993; Willerford et al., 1995). At the time, these knockout mouse studies revealed surprising findings, and have influenced subsequent research to focus on the role of IL-2 in supporting Treg generation.

In addition to the human 4q27 disease association studies, links with components of the IL-2 signalling pathway have been implicated in numerous human diseases. Specifically, the location of the gene encoding CD25 (IL-2Rα) on

30 chromosome 10, in humans is associated with T1D, Graves’ disease (Brand et al., 2007), multiple sclerosis (Sharfe et al., 1997), rheumatoid arthritis (Consortium, 2007). Additionally, there are inheritable mutations in CD25, which can result in the development of systemic autoimmune disease (Caudy et al., 2007; Sharfe et al., 1997).

1.5.1.1 Allelic variations and diabetes susceptibility of IL-2 At the time the NOD congenic strains of Idd3 mice were developed, IL-2 appeared to be a likely causative gene. As such, attention was focused on finding a functional difference in Il2 to explain the effect of disease susceptibility associated with Idd3. First, groups tried to see if the alleles correlated with a different stimulatory capacity. Utilising the IL-2 dependent cell lines, CTLL-2 (Chesnut et al., 1993; Matesanz et al., 1993; Podolin et al., 2000) and HT-2 (Podolin et al., 2000) these studies revealed that IL-2 originating from either NOD or protected strains induced the same amount of proliferation from the cell lines. Also assessed was whether the different alleles correlated with different amounts of mRNA or protein. Similar amounts of IL-2 protein was produced by ConA stimulated NOD and B6 T cells (Chesnut et al., 1993), as was steady-state Il2 mRNA levels as assessed by semiquantitative RT-PCR (Lyons et al., 2000).

IL-2 was analysed for sequence variations between NOD and B6, and attempts were made to correlate this with disease susceptibility. While assessment of both the length of the polyglutamine stretch in the N-terminus, and the segregation of the proline/serine SNP at position 6 of the mature protein yielded correlations with disease susceptibility of congenic Idd3 strains, there were exceptions. It is interesting to note that glycosylation profiles of IL-2 differed depending on proline/serine at position 6 (Podolin et al., 2000), which was thought to affect half-life of the circulating lL-2 protein, and was hypothesised to explain the Idd3 locus effect. Recently, this hypothesis was tested with the generation of a knock-in mouse in which exon 1 of the B6 IL-2 allele replaced the homologous region in the NOD allele. Contrary to the hypothesis, Kamanaka and colleagues found that even though the glycosylation pattern displayed was that of the B6 IL-2 isoform, the knock-in mouse was not protected from T1D (Kamanaka et al., 2009).

31

In contrast with earlier investigations that found no difference in IL-2 mRNA expression (Lyons et al., 2000), Yamanouchi and colleagues described a reduced expression of the NOD Il2 allele correlating with disease (Yamanouchi et al., 2007), which had also been stated earlier (in text only) by Wicker and colleagues (Wicker et al., 2005). Yamanouchi found following CD3 mAb administered in vivo, there was a 2-fold reduction in Il2 expression in NOD compared to NODB6.Idd3 mice. To test the implications of increased levels of Il2 in protected congenic Idd3 strains, Yamanouchi and colleagues used Il2+/- 8.3-NOD mice, heterozygous for IL-2 deficiency, to model a 50% reduction in IL-2 production. Their hypothesis, that IL-2 transcription may be differentially regulated in protected and susceptible strains, is supported by a subsequent study which identified disease associated SNPs in the IL- 2 extended promoter that control differential IL-2 transcription in CD4+ T cells (del Rio et al., 2008). We have conducted our own studies into allelic variation in IL-2 expression and is presented in Chapter 3 (McGuire et al., 2009).

In the NOD model of T1D, the role of IL-2 is a contentious issue. The difficulty lies in reconciling the reduced IL-2 hypothesis of Yamanouchi and colleagues with the wider field of IL-2 research. Experiments demonstrate that the abolishment of IL-2R+ T cells results in less disease (Killedar et al., 2006) and the transgenic expression of IL-2 in the pancreas results in more disease (Killedar et al., 2006). Furthermore, by potentiating IL-2, with the IL-2 monoclonal antibody, S4B6, diabetes incidence increases (Setoguchi et al., 2005).

1.5.2 IL-21 in immunity and autoimmunity

IL-21 is a common γ-chain-signalling cytokine (Figure 1.6) produced by activated CD4+ T cells and NK T cells (Coquet et al., 2007; Parrish-Novak et al., 2000). IL-21 signals through a heterodimer receptor, consisting of an IL-21-specific IL-21R α-chain paired with the common γ-chain (CD132) (Asao et al., 2001). As shown in Figure 1.7, binding of IL-21 activates the Jak/STAT pathway, primarily through STAT1 and STAT3. The common γ-chain is widely expressed, and is utilised by a family of cytokines, which in addition to IL-21 include IL-2, IL-4, IL-7, IL-9 and IL-15. IL-21R is expressed on a wide range of immune cells, B cells, CD4+

32 and CD8+ T cells, NK cells, dendritic cells, macrophages and non-immune cells, including keratinocytes (Jin et al., 2004; Ozaki et al., 2000; Parrish-Novak et al., 2000), which indicates the vast influence IL-21 has over a range of cell types. It has numerous effects in both humoral and cell-mediated immune responses (Leonard and Spolski, 2005).

Figure 1.6 Cytokine receptors containing the common cytokine receptor γ chain (γc) The IL-21 receptor is a member of a family of receptors that share γc. In addition to γc, each of these receptors has one or more distinctive receptor components. Mutations in γc result in X- linked severe combined immunodeficiency (XSCID); the severity of this disease results from defective signalling through all these receptors. (Figure reproduced from (Spolski and Leonard, 2008)).

33

Figure 1.7 IL-21R signalling pathway IL-21 mainly signals via the Janus-activated kinase (Jak)/STAT pathway with STAT1 and STAT3 as primary targets. Signalling through the phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) pathways may also be relevant in certain physiologic or pathologic conditions. (Figure reproduced from (Davis et al., 2007)).

Early mapping studies of Idd3 were conducted prior to the discovery of Il-21. Considering IL-2 and IL-21 sit directly next to each other, only 100kb apart, every congenic mapping study has failed to separate them. Since its discovery in 2000, a strong body of work has shown that IL-21 plays a important immunoregulatory role (Monteleone et al., 2008), with the potential to influence autoimmunity (Vogelzang and King, 2008). IL-21 has been associated with human T1D, (additively to associations of IL21R (Asano et al., 2006; Asano et al., 2007)) and other

34 autoimmune diseases including coeliac disease (Hunt et al., 2008; van Heel et al., 2007), SLE (Sawalha et al., 2008) and a proposed association with multiple sclerosis (Forte et al., 2006).

IL-21 is known to play an important role in maintaining T cell homeostasis, (Leonard and Spolski, 2005) particularly in NOD mice where responses to elevated levels of Il21 (Clough et al., 2008; D'Alise et al., 2008; King et al., 2004; Yamanouchi et al., 2007) are associated with lymphopenia and compensatory homeostatic expansion (King et al., 2004).

1.5.2.1 IL-21 and T cell priming The cytokine environment present during T cell priming can determine the function capabilities of CD4+ T cells. CD4+ T cells are the main producers of IL-21, and the IL-21R is upregulated on these cells after activation. Whilst IL-21R is also upregulated on T cells in the thymus at the double positive stage, it is unlikely that IL-21 plays a major role in thymic development or selection, and thus central tolerance as Il21r-/- mice demonstrate normal thymic development (Kasaian et al., 2002; Ozaki et al., 2004). Whilst IL-21 does not appear to have a role in the thymus, evidence suggests a role in peripheral T cell priming. EAE studies induced by immunisation of mice with myelin antigen in the presence of adjuvant, have suggested a role for IL-21 in the priming of the T cell responses to this antigen (Vollmer et al., 2005). They found that administration of rIL-21 to mice before EAE induction increased the severity of the disease.

The role of IL-21 in T helper cell differentiation remains controversial as studies attribute IL-21 to drive both Th1 (Fina et al., 2008; Strengell et al., 2004;

Strengell et al., 2002) and Th2 responses (Frohlich et al., 2007; Mehta et al., 2005; Wurster et al., 2002). It is likely that the response IL-21 drives is attributed to a combination of other cytokine and signals present. While activated CD4+ T cells in general demonstrate IL-21 production, the specific T helper cell subsets reported to produce IL-21 include TFH, Th17 and Th2 cells (Chtanova et al., 2004; Korn et al., 2007a; Nurieva et al., 2007; Pesce et al., 2006).

35 1.5.2.2 IL-21, Th1 and Th2 cells Mice deficient in IL-21R reveal that IL-21 responsiveness is critical for the differentiation of Th2 cells (Frohlich et al., 2007; Pesce et al., 2006). Infection of -/- Il21r mice with Toxoplasma Gondii induces a strong induction of a Th1 response to intracellular pathogens characterised by IFNγ production similar to wild type (WT) -/- mice (Ozaki et al., 2002). However, Th2 responses in Il21r mice appear to be compromised. Il21r-/- CD4+ T cells migrate poorly to the site of infection and produce fewer Th2 cytokines in response to infection with the extracellular parasite Nippostrongylus Brasiliensis. In contrast to earlier findings (Strengell et al., 2004;

Strengell et al., 2002), this study implies that IL-21 is necessary for potent Th2 responses, but do not play a role in the polarisation towards a Th1 response (Frohlich et al., 2007). A predominant role for IL-21 in Th2 responses is also supported by studies demonstrating an inhibitory role of IL-21 on the generation of Th1 cells in vitro. Exposure of naive Th cell precursors to IL-21 inhibited IFNγ production from developing Th1 cells through repression of eomesodermin expression (Suto et al., 2002).

1.5.2.3 IL-21 and Th17 cells

Th cells producing IL-17A (Th17) are a pro-inflammatory T helper subset, which attract neutrophils and other inflammatory cells to the site of immune response

(Ivanov et al., 2009; Khader et al., 2009; Pepper et al., 2010). Th17 cells also produce large amounts of IL-21, relative to Th1 and Th2 cells (Korn et al., 2007a). IL-21 has been shown to enhance production of IL-17 in vitro and to be able to substitute for

IL-6 in Th17 differentiation, but it remains unclear whether these results reflect what happens in vivo (Korn et al., 2007a; Wei et al., 2007).

EAE is a murine autoimmune model characterised by influx of Th17 cells into the central nervous system. Recent studies have linked IL-21 to the induction and expansion of the Th17 population and disease severity of EAE (Chen and O'Shea,

2008; Korn et al., 2007a; Nurieva et al., 2007). IL-21 appears necessary for a Th17 response in EAE in mice lacking the key differentiation factor IL-6, however, it seems unlikely that IL-21 is critical for Th17 generation either during infection or in an autoimmune setting where IL-6 is abundant. Sonderegger et al. have shown that

36 -/- IL-21 signalling is redundant for several types of in vivo Th17 responses, as Il21r mice display normal susceptibility to EAE and display a similar experimental autoimmune response directed against the myosin protein in the heart tissue (Sonderegger et al., 2008). Other groups (Coquet et al., 2008b) have also confirmed this finding. In summary, the results of tissue culture experiments imply that the action of IL-21 on Th17 cells may be more important during T cell activation only in the absence of other factors such as IL-6 or costimulatory molecules such as ICOSL (Korn et al., 2007b). As such, it is vital to dissect the actions of IL-21 in an in vivo setting.

1.5.2.4 IL-21 and TFH cells

TFH cells have been reported to express IL-21 (Chtanova et al., 2004). As such, recent research has focused on examining the role of IL-21 expression by this particular T cell subset. The role IL-21 may play in autoimmune disease may be attributable to its known role in regulating the generation of TFH cells (Nurieva et al., 2008; Vogelzang et al., 2008). This autocrine loop in turn impacts B cells and their function in an immune response, by supporting GC reactions. GC reactions are intact in NOD mice, and other models of autoimmunity (Luzina et al., 2001; Vinuesa et al., 2009) and these tertiary lymphoid structures may favour the generation of self- reactive autoantibodies. Interestingly, a novel SLE-like autoimmune syndrome described in Sanroque mice associates elevated levels of IL21 with spontaneous germinal centre formation and autoimmune pathology (Vinuesa et al., 2005a).

1.5.2.5 IL-21 and Tregs

IL-2 is essential to the function and survival of Tregs (Sadlack et al., 1993; Willerford et al., 1995). While the significance contribution of Tregs to disease progression in NOD mice remains to be conclusively shown (D'Alise et al., 2008; Feuerer et al., 2007; Mellanby et al., 2007), it is interesting to find that FoxP3 expression is enhanced in IL-21 deficient mice, and IL-21 down regulates FoxP3 expression and inhibits Treg suppressor function (Clough et al., 2008; Li and Yee, 2008; Nurieva et al., 2007; Piao et al., 2008). IL-21 has recently been shown to inhibit TGFβ driven differentiation of naïve Th cells into Foxp3+ Tregs (Fantini et al., 2007). Additionally, IL21 was found to be highly effective at overcoming T cell

37 suppression by Tregs, by acting directly on effector T cells (Clough et al., 2008; Peluso et al., 2007). These observations highlight that any Treg phenotype demonstrated in protected Idd3 congenic strains, interpreted as being due to high levels of IL-2 (Yamanouchi et al., 2007) may also be contributed by the associated lower levels of IL-21 also observed in these mice (King et al., 2004; Yamanouchi et al., 2007).

1.5.2.6 IL-21 and CD8+ T cells

The NOD mouse has a defect in CD8+ T cell tolerance (Kreuwel et al., 2001), independent of Tregs. Instead of islet antigen specific CD8+ T cells undergoing deletion in the pancreatic lymph nodes, these are retained in the repertoire and may contribute to the autoimmune response. Interestingly, Martinez and colleagues showed that NOD mice congenic for both Idd3 and Idd5 had restored CD8 tolerance, resulting in abortive activation of islet antigen-specific CD8+ T cells in the pancreatic lymph nodes, preventing the infiltration of the pancreatic islets (Martinez et al., 2005).

Hamilton-Williams and colleagues identified that DCs were primarily responsible for defective deletion of activated islet-specific CD8+ T cells in the pancreatic lymph nodes (Hamilton-Williams et al., 2009) This affect was only evident in the absence of CD4+ T cells, suggesting a role for CD4+ T cells in activation of DC costimulatory pathways, or directly or indirectly enhancing survival of activated CD8+ T cells (Hamilton-Williams et al., 2009).

It is interesting to note that IL-21 has a profound effect on expanding CD8+ T cells (Allard et al., 2007), likely to effect both their proliferation and survival (Moroz et al., 2004; Ostiguy et al., 2007). Transgenic over-expression of IL-21 predominantly expands memory CD8+ T cells (Allard et al., 2007). However, CD8+ T cell development appears normal in Il21r-/- mice suggesting other factors may be able to compensate (Kasaian et al., 2002; Ozaki et al., 2002). Given the essential role of CD8+ T cells in T1D pathogenesis it is interesting to note that CD8+ T cells show increased proliferation in NOD mice in response to elevated levels of IL21 (King et al., 2004).

38

IL-21 costimulates T cell proliferation and numerous studies demonstrate that IL-21 enhances the proliferation, IFNγ production, and cytotoxic function of CD8+ effector T cells (Kasaian et al., 2002; Liu et al., 2007). In concert with the common γ-chain cytokines IL-15 and IL-7, IL-21 can promote proliferation and the acquisition of cytotoxic effector functions of CD8+ T cells both in vitro and in vivo (Liu et al., 2007; Zeng et al., 2005). The ability of IL-21 to synergise cytokine- mediated proliferation occurs in the absence of TCR signalling which suggests that IL-21 may play a cooperative role in antigen independent expansion. In contrast to other common γ signalling cytokines such as IL-2 and IL-15, IL-21 does not augment CD8+ T cell proliferation in the absence of stimulation through the TCR or other common γ-chain cytokines. An added complexity to the effect of IL-21 on CD8+ T cells is that the proliferative and functional effects of IL-21 appear to differ for naive and memory CD8+ T cells. As noted above, IL-21 can augment IL-15 or IL-7 induced proliferation of CD8+ memory T cells, but has less of an effect on the antigen dependent proliferation of memory cells (Liu et al., 2007). However, IL-21 effectively costimulates antigen-driven proliferation of naïve CD8+ T cells (Liu et al., 2007). Interestingly, IL-21 added to CD8+ effector T cells from HIV-infected patients upregulates perforin production in the absence of cell activation or proliferation, whereas IL-15-mediated upregulation of perforin occurs only in the presence of proliferation (White et al., 2007). Furthermore, responses to viral infection are sustained in the presence of IL-21. A number of recent studies have demonstrated a role for IL-21 in supporting long term responses to viral infections by preventing CD8+ T cell exhaustion, and thereby resulting in a decrease in viral titre. However, it was apparent that IL-21 was not necessary for a successful acute viral response (Elsaesser et al., 2009; Frohlich et al., 2009; Yi et al., 2009).

1.5.2.7 IL-21 and B cells IL-21 can either deliver costimulation to B cells or induce B cell apoptosis depending on the activating signals that accompany it. These implications are important for autoimmunity as costimulation amplifies signals through the BCR to facilitate autoantibody production, whereas apoptosis is necessary for the removal of both the self-reactive clones that can target tissues for destruction and antibody-

39 producing cells generated during infection (which can cause chronic formation of inflammatory immune complexes).

IL-21R is expressed on both immature and mature B cells, and is upregulated further upon antigen binding or stimulation by TLR ligands (Strengell et al., 2002). IL-21 can also increase human B cell proliferation induced by ligation of CD40 in vitro (Ettinger et al., 2005; Good et al., 2006; Jin et al., 2004; Parrish-Novak et al., 2000). However, when paired with BCR stimulation, IL-21 reduces the response and inhibits proliferation of murine B cells induced by TLR ligands - namely LPS and CpG - by inducing apoptosis (Jin et al., 2004; Jin and Malek, 2006; Mehta et al., 2003). These different outcomes on B cells led to the hypothesis that while IL-21 could enhance antigen specific responses, it could also induce apoptosis for B cells that lack help provided by molecules such as CD40L, expressed on activated antigen specific CD4+ T cells, thus protecting against inappropriate B cell activation (Good et al., 2006). However, studies on purified murine splenic B cells indicated induction of apoptosis by IL-21 combined with both mitogens, such as LPS, and T dependent stimulation (Mehta et al., 2003). Adding IL-21 to cultures down-regulated the anti- apoptotic molecules BCL-2 and BCL-xL, suggesting the possibility of different composition in terms of maturity and activation of purified splenic B cells from mice compared to those circulating in humans (Mehta et al., 2003).

Transgenic expression of IL-21 leads to an increase in class switching to the IgG1 antibody isotype and upregulation of the germinal centre B cell transcription factor Bcl6 (Ozaki et al., 2004). Excessive levels of IL-21 also lead to preferential differentiation of B cells into plasma cells and Blimp-1 upregulation (Ozaki et al., 2004). Given this link with high IL-21 and plasma cell differentiation, it is intriguing to find that serum levels of IL-21 are elevated in SLE patients, correlating with disease severity (Wang et al., 2007). Furthermore, an increase in viability of purified tonsillar GC B cells from SLE patients was found. This is an interesting finding, as these self-antigen activated B cells are responsible for the generation of the high affinity, class switched antibody produced by in SLE (Good et al., 2006).

40 An interesting observation in Il21-/- mice is an increase in IgE following immunisation with experimental antigens (Shang et al., 2006). As such, any therapeutic intervention which may reduce IL-21 levels must acknowledge the risk of possible adverse effects of increased IgE secretion, the dominant isotype produced in allergy and atopy.

1.5.2.8 Expression of IL-21 and IL-21R Our lab originally identified increased production of IL-21 mRNA in NOD mice (King et al., 2004). Elevated levels of IL-21 are also associated with other autoimmune diseases including RA, Crohn’s disease, SLE, sjogrens syndrome (Jungel et al., 2004; Wang et al., 2007), and most recently in a mouse autoimmune uveitis model (Liu et al., 2009). Increased IL-21 transcript has also been demonstrated in biopsies of ulcerative colitis patients (Yamamoto-Furusho et al., 2009). Elevated IL-21 has also been demonstrated in human diseases, coeliac disease, as well as helicobacter pylori infections and Crohn’s disease further strengthening the suggestion that elevated levels of IL-21 may play a role in inflammation irrespective of the aetiology (Meresse et al., 2008). Importantly, during the course of this thesis, the critical link of T1D disease progression in NOD mice to responsiveness to IL-21 was demonstrated with Il21r-/- mice (Datta and Sarvetnick, 2008; Leonard and Spolski, 2005; Sutherland et al., 2009). These mice were completely protected from disease. As the details of mechanism offered by these papers differ considerably, the exact role of IL-21 in disease progression remain to be elucidated.

1.5.2.9 Therapeutic Intervention in Autoimmune Disease

Elevated production of IL-21 is demonstrated in the mouse model of lupus, the BXSB-Yaa mouse strain. In this model, neutralising circulating IL-21 delayed the disease progression, increasing survival and lowering levels of serum anti-DNA antibodies (Ozaki et al., 2004). It is suggested that the success of this treatment was through the dual effect of reducing inappropriate activation of self-reactive B cells, and inhibiting CD8+ T cells (Bubier et al., 2007). Our lab has shown a similar result of reduced and delayed incidence of diabetes in NOD mice, as is investigated in this thesis. A role for IL-21 has now been indicated in lupus, as blockade with IL21R/Fc

41 reduced disease in lupus prone mice (Herber et al., 2007; Ozaki et al., 2004), EAE and RA, both collagen-induced arthritis and adjuvant-induced arthritis (Young et al., 2007). Remarkably, although the role of IL-21 in RA remains ambiguous, studies of therapeutic modulation of IL-21 in human RA patients have been initiated (Jungel et al., 2004; Li et al., 2006).

1.6 Experimental objectives

For my thesis research, I investigated the importance of IL-21 in autoimmunity using the NOD mouse model. At the time of initiating this thesis, little was known about the role of IL-21 in T1D. My work can be divided into three studies, results of which are presented in Chapters 3, 4 and 5.

Aim 1- A comparitive study of IL-21 and IL-2 expression in Idd3 Aim 2- Characterisation of NOD pancreatic IL-21 producing CD4+ T cells Aim 3- Neutralisation of IL-21 and transplantation as a treatment for T1D

42 2 Materials and methods

2.1 Buffers

Table 2.1 Buffers commonly used Buffer/Solution Components Suppliers Avertin 2-2-2-Tribromoethanol Sigma-Aldrich 2-methyl-2-butanol Fisher Saline 0.9% Baxter Carboxyfluorescein succinimidyl ester 0.1% foetal calf serum (FCS) Gibco (CFSE) buffer 5uM CFSE Ebioscience 1x phosphate buffered saline (PBS) Gibco Cell culture media 10% FCS Gibco 50 Units/ml penicillin G sodium Gibco 50μg/ml streptomycin sulphate Gibco 2mM L-glutamine Gibco 50μM β-mercapto-ethanol (βME) Sigma-Aldrich 1X RPMI 1640 Gibco DNA isolation buffer 670 mM Tris pH8.8 Gibco 166mM Ammonium sulfate Amersham 65mM Magnesium chloride Amersham 10% 2ME Gibco 5% Triton X-100 Sigma-Aldrich 100mg/mL Proteinase K Promega ELISA buffer 1X PBS 0.1% Tween 20 ICN Biomedicals ELISA coating buffer 34.88 mM NaHCO3 Merck 15 mM Na2CO3 Merck 3.08mM NaN3 Amersham 1mM MgCl2 Merck FACS buffer 0.1% NaN3 Amersham 0.5% bovine serum albumin (BSA) Gibco 1X PBS Gibco IEL stripping buffer 1mM Ethylenediamine-tetraacetate Gibco (EDTA) Sigma-Aldrich 1mM Dithiothreitol (DTT) Gibco 5% FCS Gibco 50 Units/ml Penicillin G Sodium Gibco 50μg/ml Streptomycin Sulphate Gibco 1xPBS Islet Isolation Media M199 Gibco 4.16mM Sodium bicarbonate Sigma-Aldrich (NaHCO3) Hyclone 10% heat inactivated BCS Lymphocyte isolation media 1x RPM1 Gibco 10% bovine calf serum (BCS) Gibco MACS buffer 2mM EDTA Gibco 3% BCS Gibco 1X PBS MACS rinsing buffer 2mM EDTA Gibco 1X PBS

43 MACS running buffer 2mM EDTA Gibco 0.5% BSA Gibco 1X PBS PBS (10X) 3.6% di-sodium hydrogen Merck orthophosphate (Na2HPO4) Ajax 0.2% KCl Finechem 0.24% KH2PO4 Merck 8% NaCl Ajax Finechem Red blood cell (RBC) lysis solution 8.26g NH4Cl Merck 1g KHCO3 Merck 0.037g EDTA Gibco 1L dH20 Streptozotocin buffer 0.1M citrate buffer (pH 4.5) Garvan Institute Western running buffer 24mM tris buffer Gibco 192mM glycine Sigma-Aldrich 0.1% (w/v) SDS Merck Western transfer buffer 12 mM tris buffer Gibco 96 mM glycine Sigma-Aldrich 0.1% (w/v) SDS Merck 20% (v/v) methanol Sigma-Aldrich

2.2 Mice

NOD Ltj, C57BL/6, BALB/c, 129SvJ (129), DBA, CBA, CBAxB6, DBAxB6, DBAxBALB/c and C3HeJxB6 mice were obtained from ARC, Perth, WA. NOD/Scid mice were obtained from WEHI, Melbourne, Victoria. The congenic- C57BL/6(R450).NOD (NODB6.Idd3) mice were purchased from Taconic Farms. Additional F1 crossed mice (NODxNODB6.Idd3, NODxB6 and 129xB6) were breed at the Garvan Institute of Medical Research. The Il21-/- mice in this study were created through an NIH initiative with Lexicon and Deltagen, on a mixed C57BL/6 and 129 background and bred to B6 N10. For diabetes studies mice were also backcrossed to NOD and selected for known Idd regions by PCR of genomic DNA (speed congenics). Il21r-/- mice (Ozaki et al., 2002) were obtained from Dr Warren Leonard (NIH) via Dr Mark Smyth (Melbourne) at B6 N6 and backcrossed to N7, either C57BL/6 or NOD, by speed congenics for experimental use. μMT NOD mice (Serreze et al., 1996) were kindly provided by Dr Pablo Silveira (Garvan Institute of Medical Research, Sydney). MHC class II-/- mice (Jackson labs, stock number 3584) were kindly provided by Dr Robert Brink (Garvan Institute of Medical Research, Sydney). Animals were housed under specific pathogen-free conditions and handled in accordance with the Garvan Institute of Medical Research and St. Vincent Hospital’s Animal Experimentation and Ethics Committee, which comply with the

44 Australian code of practice for the care and use of animals for scientific purposes. Blood glucose level (BGL) was determined using Accu-chek Advantage blood glucose strips (Roche). Backcrossing of mouse lines to the NOD strain was conducted using the Idd related microsatellite markers, as originally described (Serreze et al., 1996). This involved selecting the ‘most NOD’ offspring to breed in the next round of backcrossing, until 100% NOD identity was achieved at the 23 microsatellite locations assessed. Additional attention was given to ensure the Idd3 locus was of NOD/129 origin. To achieve this, we tested multiple markers across the Idd3 region by PCR and pyrosequencing, as indicated in Table 2.2.

Table 2.2 Fine mapping of Idd3 in backcrossed lines Region examined Readout Primers Sequence 5’ to 3’ (DNA location) IL-2 (microsatellite Microsatellite Fwd GTGGGAGTGTGTGCAAAAGAC marker: D3Nds6) PCR Rev CAGAATAGGTGATTAGGTGGTTA

IL-2 (Intron 2) Pyrosequencing Fwd Biotin- GTCCCAAGTAAATCCAAGCC Rev GTGACTGTAATTAAGCTGG Sequencing CCCTGACTCAATAGGAATG Probe Fgf2 (microsatellite Microsatellite Fwd GAAAGGAAATCTCACCCCTG marker: D3Nds34) PCR Rev GAATGCTCCAGCTAGTCTTG

Fgf2 (Intron 1) Pyrosequencing Fwd Biotin- AACAGTGTGCATCTTCCCAAATA Rev AGAAACCAGCCTGGGTTACATA Sequencing AACAACAATAATTAAAACCC Probe Region extending Microsatellite Fwd TCAACACAGATTGAGACTCCTG beyond Fgf2 PCR (microsatellite marker: D3Nds40) Rev TGGCTCATTGGTGTGCAC

Region extending Microsatellite Fwd CGTTACAAAGCAAAGCAAAGC beyond Fgf2 PCR (microsatellite marker: D3Nds42) Rev ACATTAGGGTGTTGGGGACA

Region extending Microsatellite Fwd ATTGTGTGTTGTTTATGTAAGA beyond Fgf2 PCR (microsatellite marker: D3Nds43) Rev CATTTTATTTATACAAGCATTT

45 2.3 Human samples

Human tonsils were obtained from routine tonsillectomy at the St Vincent’s Hospital (Darlinghurst, NSW, Australia). Peripheral blood (PB) buffy coats were obtained from the Australian Red Cross Blood Service. Blood samples were collected from 15 patients with Sjögren's syndrome who were recruited via Immunology clinics at Westmead Hospital, Sydney. All patients were carefully phenotyped and met accepted diagnostic criteria for this condition (Vitali et al., 2002). Clinical and laboratory data were collected on all patients; clinical data included the presence of symptomatic dry eyes, mouth, skin or vagina, gastrointestinal, renal and respiratory symptoms, lachrymal or parotid swelling, Schirmer's test result, Raynaud's, presence of other autoimmune diseases, recurrent oral candidiasis, the state of dentition and the use of medication. Laboratory data included the results of testing for antinuclear antibodies, antibodies to extractable nuclear antigens, cryoglobulins, hypergammaglobulinaemia, paraproteinaemia, rheumatoid factor and anaemia. Institutional Human Research Ethics Committees approved all studies.

2.4 T cell stimulation

For collection of RNA from activated (CD44hi CD62L-) cells, sorted cells were stimulated with ionomycin (1.5 μg/mL) and phorbol 12-myristate 13-acetate (PMA) (15 ng/mL). For collection of RNA from splenocytes and lymphocytes, cells were stimulated with CD3 (2.5 μg/mL) and CD28 (2.5 μg/mL) mAb. For analysis of mRNA decay, actinomycin D (10 μg/mL) was added after 4-h stimulation. The amount of IL-21 and IL-2 mRNA for each genotype at time 0 h after actinomycin D was assigned 100%. For assay of IL-21 protein in supernatants by ELISA (R&D 5 lo hi Systems), 1 x 10 naive (CD44 ) and memory (CD44 ), ICOS+ and ICOS-, CD4+ T cells were cultured for 4 days with mouse CD3 (2.5 μg/mL) mAb and CD28 (2.5 μg/mL) mAb. IL-21 was also assayed in supernatants of 2 day CD3 and CD28 mAb cultured splenocytes and lymph nodes from NOD mice, with or without B cell depletion by MACS separation (Miltenyi Biotech), and μMT NOD mice.

46 2.5 RNA and quantitative RT-PCR

RT-PCR analysis of IL-21 and IL-2 intronic and exonic transcripts were conducted on splenocytes, lymph node samples, sorted T cell populations and pancreas infiltrating lymphocytes from NOD, NOD.Idd3.B6/NOD and NODB6.Idd3 mice. Pancreas samples were perfused through the bile duct with RNAlater (Ambion). RT- PCR was also conducted on sorted CCR9+ and CCR9- CD44hi CD4+ T cells from lo NOD pancreatic lymph node and pancreas, naïve CD44 CD4+ T cells, Th2 polarised CD4+ T cells and T follicular helper cells from D7 sheep red blood cell immunised NOD mice, defined as CXCR5hi ICOShi PD-1hi CD4+ T cells, previously described (Vogelzang et al., 2008). We also examined IL-21 induction in NOD and μMT NOD splenocytes stimulated for 4 hours with CD3 (2.5 μg/ml) and CD28 mAb (2.5 μg/ml). RT-PCR was conducted on sorted CCR9+ and CCR9- CD45RA- (memory) and naïve CD4+ T cells extracted from human tonsil. Additionally, we examined IL-21 induction in NOD and NODB6.Idd3 mice, of various tissues across an age range to map disease progression with tail vein bleeds collected into RNAlater. Total RNA was harvested from mouse cells using TRIzol (Invitrogen). Total RNA was harvested from human cells using the RNeasy kit as per manufacturer’s instructions (Qiagen). All RNA samples were treated with DNase (Promega), and cDNA was prepared using Superscript II reverse transcriptase (Invitrogen) and oligo- dT primers. We determined the relative abundance of cDNAs in triplicate by qRT- PCR analysis using the ABI Prism 7700 Sequence Detection System (Applied Biosystems), with results validity confirmed by samples located in linear range of standard curve analysis. Real-time PCR primers were obtained from Applied Biosystems with the exception of those shown in Table 2.3, with RT-PCR primers for human samples designed using the Roche UPL Primer Design Program. All gene values were normalised to the level of expression of the housekeeping gene GAPDH. Modulation of gene expression was calculated by employing a comparative CT method.

47 Table 2.3 RT-PCR primer sequences Primer Sequence UPL probe: Amplicon length (bp) Human BCL-6—fwd GAGCTCTGTTGATTCTTAGAACTGG 9: Human BCL-6—rev GCCTTGCTTCACAGTCCAA 110 Human IL-21—fwd AGGAAACCACCTTCCACAAA 7: Human IL-21—rev GAATCACATGAAGGGCATGTT 68

2.6 Pyrosequencing

Pyrosequencing was performed on cDNA synthesised from the DNase treated RNA. Assays were performed according to the manufacturer’s instructions on the PSQ96 system (Biotage). Oligonucleotides used to quantitate the NOD and B6 intronic and exonic IL-21 alleles in NOD.Idd3B6/NOD mice, and other F1 mouse strains are shown in Table 2.7. Also shown in Table 2.7 are the oligonucleotides used to quantitate exonic IL-2, with oligonucleotide primers used to quantitate NOD and B6 intronic IL-2 alleles described previously (15).

Table 2.4 Pyrosequencing primer sequences Used to analyse Primer Sequence 5’ to 3’ Exonic IL-21 Fwd Biotin-CCTTCCTGTGATTCGTATGAGA Rev CTTTTGAAGGAGCCATTTTAGTCT Sequencing Probe GGAATTCTTTGGGTGT Exonic IL-21 Fwd Biotin- TATTATGAGGGTCACCCCTGGCT (Balb/c vs C57BL/6) Rev ACATTGGGAGGAAGGCAACTT Sequencing Probe CCTTGCCTCTTTAGAAA Intronic IL-2 Fwd Biotin-GTCCCAAGTAAATCCAAGCC Rev GTGACTGTAATTAAGCTGG Sequencing Probe CCCTGACTCAATAGGAATG Exonic IL-2 Fwd Biotin-GCAGCTCGCATCCTGTGTC Rev GGTGCGCTGTTCACAAGGAG Sequencing Probe CAAGGAGCACAAGTGTC Exonic IL-2 Fwd GCACAAAGTAAGCGCTAAAATAAC (Balb/c vs C57BL/6) Rev Biotin- GCTTTATTTCTTGAAAACACTGAT Sequencing Probe TAACTTCTCAGTTATTCC Sp1 site on Fwd GGAGGCACCATTAGTGCTATTT NOD IL-21 Rev Biotin-AATGATGGGCTAGTTTTCTAACCT promoter Sequencing Probe GAAGCAAATCCTATTTTAAC

2.7 Luciferase Assay

The extended IL-21 promoter regions (from -2182 to +125), generated by PCR amplification using KOD polymerase enzyme (Novagen) from genomic DNA from NOD and C57BL/6 mice, were cloned into pGEM-T easy vector (Promega). The promoter inserts were sequenced, aligned (Appendix 1), and analysed using the

48 TRANSFAC database (http://www.cbil.upenn.edu/tess/). Putative transcription factor binding sites were matched to consensus database entries for experimentally derived models under high stringency. Decreasing lengths of the IL-21 promoter region cloned from NOD and B6 genomic DNA, using the pGEM-T easy system (Promega), were subcloned into the pGL3 enhanced promoter vector (Promega). Luciferase reporter experiments were performed as previously described (Chung et al., 2003). Mutagenesis was performed as described by the manufacturer (Invitrogen). Primers are described in Table 2.5.

Table 2.5 Luciferase construct primer sequences Used to Target Inclusive of Primer sequence 5’ to 3’ create region putative plasmid covered binding site pGEM -2182 to COMPLETE Master F sequencing +125 REGION TTTTGGTACCTCACTGTGCCCCTGACCTTATG plasmids COMPLETE Master R REGION CCCTAAGCTTTGTCCCCAAGAAGATGACTACCAG pGL3 IL- Forward 21 Nested promoter Primers pIL-21 -1774 to NOD GGGGGGTACCCCACAAAAACACTAAACTTGAAGCC (-1774) +69 Extended Oct series pIL-21 -1628 to NOD Gata GAGAGGTACCCATGACACAATGAGGCAAGAACCT (-1628) +69 pIL-21 -670 to NOD Before GGGTGGTACCTTGTTACATAAAGTGTCAGGAGGC (-670) +69 Sp-1 site pIL-21 -570 to NOD Early GGAGGGTACCGGATCTAAAATACTCTTGC (-570) +69 Gata series pIL-21 -318 to NOD CAC- GAAAGGTACCTCTGAAATCTGACGGTGCC (-318) +69 binding Common After start GAAAAAGCTTGCCACCAGAACTGAGTCTCCAG Reverse site primer pIL-21 Sp1 binding Fwd: GGAAGCAAATCCTATTTTAACACCCTTACA (-1774) site AAAAGATAAGGATC (G)(C) Mut Sp1 Rev: GATCCTTATCTTTTTGTAAGGGTGTTAAAAT AGGATTTGCTTCC (C)(G)

Cells were transfected (Lipofectamine 2000; Invitrogen) with 0.8 μg of the prepared IL-21 promoter-Luciferase constructs, 0.1 μg of βgal- expressing plasmid, and an nuclear factor of activated T cells (NFAT)-expressing plasmid (kindly

49 provided by A. Rao, Harvard University, Cambridge, MA). At 16 h after transfection, cells were stimulated with 1.5 μg/mL ionomycin (Molecular Probes) and 15 ng/mL PMA (Sigma-Aldrich) for 8 h. Cells were lysed as luciferase and βgalactosidase activity was measured, using Luciferase Assay substrate system (Promega) and Galacto-Star (Applied Biosystems) reagents.

2.8 EMSA

EMSAs were performed using nuclear extracts from EL4 cells and primary

CD4+ T cells, stimulated with PMA (15 ng/mL) and ionomycin (1.5 μg/mL) for 3 h. The annealed oligonucleotides were radiolabeled with [α-32P]dCTP using Klenow fragment. Nuclear extract was isolated following the method previously described (Kim et al., 2005). Equal amounts of nuclear extracts were incubated with the radio- labelled oligonucleotides using standard protocols, resolved on a 5% acrylamide gel, and visualised using autoradiography. Competition assays were performed with using 100-fold excess of competitor (unlabelled) oligonucleotides (Table 2.6) or an Sp1 mAb (PEP 2; Santa Cruz).

Table 2.6 Primers used for EMSA analysis Used to analyse Probe sequence 5’ to 3’ NOD Sp1 site Fwd CTAGCTTTTTGTAGGGGCGTTAAAATAG NOD Sp1 site Rev CTAGCTATTTTAACGCCCCTACAAAAAG B6 Sp1 site Fwd CTAGCTTTTTGTAAGGGTGTTAAAATAG B6 Sp1 site Rev CTAGCTATTTTAACACCCTTACAAAAAG Consensus Sp1 site Fwd CTAGATTCGATCGGGGCGGGGCGAGC Consensus Sp1 site Rev CTAGGCTCGCCCCGCCCCGATCGAAT Nonspecific competitor Fwd CTAGTCTACTCCACTGCTGTCTATC Nonspecific competitor Rev CTAGGATAGACAGCAGTGGAGTAGA

2.9 In vivo bioactive IL-2 assay

Macs sorted CD8+ T cells (>90% pure) were CFSE labelled and 8 x 106 injected i.v., followed by daily i.p. injections of PBS, S4B6 IL-2mAb (50 μg), or rmIL-2 (1.5 μg) (Peprotech) plus IL-2 mAb (50 μg) as previously described (Boyman et al., 2006a). Donor and host cells from spleen and lymph nodes were examined on day 7. S4B6 was purified in house from the S4B6.1 hybridoma.

50 2.10 Flow cytometry

Spleen and lymph nodes were homogenised using 70μm cells strainers in lymphocyte isolation buffer. For flow-cytometric analysis of lymphocytes isolated from the pancreas and salivary gland, mice were euthanised by i.p. injection of ketamine and perfused with ice-cold PBS for 10 minutes. Pancreas and salivary gland samples were then subjected to lymphocyte isolation as described (Faveeuw et al., 1995) and in detail below. For flow cytometric analysis of intraepithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs), small intestine samples were subjected to lymphocyte isolation as described in detail below. Red blood cells (RBC) were removed from spleens using 2 ml RBC lysis buffer for 1 minute on ice before washing in lymphocyte isolation buffer. 50μl of a single cell suspension at 2x107 cells/ml from spleen and lymph nodes were stained in FACS buffer containing pre-titred antibodies in 96 well V-bottomed microtitre plates (Nunc, Roskilde, Denmark) at concentrations shown in Table 2.7. To reduce non-specific binding, cells were pre-treated with anti-CD16 for 20 minutes (2.4G2 made in house). Cells were acquired using Canto cytometer (BD Biosciences, CA) and analysed using Flowjo (Treestar, CA). Doublets were excluded by forward scatter height and width, except when analysing T cell-B cell conjugates, which were defined as CD3+, CD4 and B220 double positive doublet cells. For analysis of CD4+ T cell conjugates, EDTA was omitted from sample preparation buffers. Sorted CD4+ B220+ conjugates were dissociated with 2 mM EDTA and vigorous vortexing, as previously described (Reinhardt et al., 2009). Staining for NKT cells with mouse CD1d tetramer loaded with α-GalCer was performed as published previously (Coquet et al., 2008a). Flow cytometric analyses of CCR9 and CXCR5 induction were performed as previously described (Elgueta et al., 2008) and (Nurieva et al., 2008) respectively, and outlined in detail below.

51 Table 2.7 Flow cytometric antibodies and reagents Antibody/Reagent Clone (Company) Label Dilution α4β7 DATK32 (BD Biosciences) PE 1:200 B220 RA3-6B2 (BD Biosciences) PE 1:200 PerCP-C5.5 1:200 APC 1:200 APC-Cy7 1:200 Bcl2 3F11 (Cell Signaling) FITC 1:50 A19-3 (isotype control) 1:50 BTLA 6F7 (eBioscience) PE 1:200 CCR6 140706 (BD Biosciences) Alexa Fluor 647 1:200 CCR7 4B12 (eBioscience) APC 1:30 CCR9 eBioCW-1.2 (eBioscience) FITC 1:150 CD3 145-2C11 (BD Biosciences) FITC 1:200 Pacific Blue 1:200 CD4 RM4-5 (BD Biosciences) APC 1:400 Alexa Fluor 750 1:300 Pacific Blue 1:300 CD8 53-6.7 (BD Biosciences) PE 1:200 APC 1:200 CD11b M1/70 (eBioscience) PE 1:200 CD11c N418 (eBioscience) APC 1:200 CD25 PC61 (eBioscience) FITC 1:200 CD27 LG.3A10 (BD Biosciences) PE 1:200 CD44 IM7 (eBioscience) FITC 1:200 APC 1:200 CD45.1 A20 (eBioscience) PeCy7 1:300 CD62L MEL-14 (eBioscience) FITC 1:200 PE 1:200 CD69 H1.2F3 (BD Biosciences) FITC 1:200 CD122 PO3.1 (eBioscience) PE 1:100 CD200 (OX2) OX90 (eBioscience) Alexa Fluor 647 1:200 CXCR5 2G8 (BD Biosciences) Biotin 1:100 Foxp3 FJK-165 (eBioscience) APC 1:200 ICOS C398-4A (eBioscience) PE 1:1000 IFNγ XMG1.2 (eBioscience) FITC 1:200 Pacific Blue 1:100 IgD 11-26c.2a (eBioscience) FITC 1:200 IL-2 JES6-5H4 (eBioscience) Alexa Fluor 488 1:100 IL-4 BVD6-24G2 (eBioscience) FITC 1:100 IL-17A TC11-18H10 (eBioscience) FITC 1:100 IL-21 Polyclonal (R&D Systems) Biotin 1:100 PD-1 J43 (BD Biosciences) FITC 1:100 PE 1:100 PNA Vector Laboratories (Sigma-Aldrich) Biotin 1:400 Streptavidin - (eBioscience) PerCP 1:500 APC 1:500 TCRβ H57-597 (eBioscience) APC 1:200 TNFα MP6-XT22 (BD Biosciences) PE 1:200

For human flow cytometric analysis, cells from tonsillar tissue and peripheral blood were stained with CD4 (BD biosciences), CD45RA (eBioscience), CCR9

52 (R&D Systems) with a dump channel consisting of CD20, CD8 and CD14 (BD biosciences). Data was collected on a Canto flow cytometer (BD Biosciences), and analysed using FlowJo software (Tree Star, Inc.).

2.11 Intracellular Staining

Extracellular molecules were stained as described previously. Nuclear foxp3 was detected using the eBioscience intracellular staining kit according to the manufacturer’s instructions. Intracellular molecules and were detected using the BD sciences intracellular staining kit according to the manufacturer’s instructions. Cytokines were detected either directly ex-vivo or after 4 hours stimulation at 37°C in cell culture media with PMA (50 ng/ml, BIOMOL), ionomycin (500 ng/ml, Invitrogen) and GolgiPlug (1:1000, BD Biosciences). For mouse IL-21 analysis, following ex vivo staining of surface markers, cells were fixed and permeated (BD Biosciences), followed by intracellular staining with biotin labelled polyclonal IL-21 Ab (R&D Systems).

2.12 CFSE Proliferation studies

Cells were washed twice in PBS and resuspended at 5x107 per ml for CFSE staining in CFSE buffer containing 5 μM CFSE. Cells were incubated at 37°C for 10 minutes then washed twice with ice-cold lymphocyte isolation media before being prepared for adoptive transfer. CD8+ T cells were prepared for adoptive transfer into NOD, Il21r-/- NOD and Il21-/- Il12r-/- NOD mice by MACS purification (for total CD8+ T cells, 10 x 106 cells per recipient) and cell sorting (for CD44hi and CD44lo comparison, 2 x 106 cells per recipient).

2.13 Western Blotting

SDS/PAGE was performed on total cell lysates of CD4+ and CD8+ T cells sorted from NOD and NODB6.Idd3 pancreas isolated lymphocytes, and blotted for mouse IL-2 (clone JES6–1A12). SDS-PAGE was performed on total cell lysates from NOD small intestine and isolated pancreatic islets, compared with rCCL25 (R&D Systems), blotted for mouse CCL25 (R&D Systems). SDS-PAGE was performed on total cell lysates of CD44lo CD4+ T cells from NOD spleen cultured for 3 days under polarising conditions (Nurieva et al., 2008), and CCR9+ and CCR9-

53 CD44hi CD4+ T cells cultured with CD3 (2.5 μg/ml) and CD28 mAb (2.5 μg/ml) from NOD pancreatic lymph node and pancreas, blotted for mouse T bet (Santa Cruz) and mouse Gata3 (Santa Cruz). Both westerns were blotted for housekeeping β−actin (Sigma-Aldrich). In each case, cells were lysed in RIPA buffer (Sigma- Aldrich) containing protease and phosphatase inhibitors (P8340, Sigma-Aldrich) and run by SDS-PAGE gel electrophoresis using a 4-12% gradient gel and nitrocellulose membranes (Invitrogen). Detection antibodies were diluted in 2% BSA in TBS with the addition of 0.01% Tween 20 (Sigma-Aldrich). Antibody binding was detected using HRP conjugated secondary antibodies (DAKO). Membranes were developed by incubating with enhanced chemiluminescence substrate (Perkin-Elmer) for one minute before immediate exposure to X-ray sensitive film (Fuji).

2.14 Chemotaxis assay

3 μM pore size polycarbonate filter (Millipore) Transwell tissue culture plates were used to assess the migration of lymphocytes from pancreatic lymph nodes and pancreatic infiltrate towards rCCL25. Lymphocytes were resuspended at 1 x 107 cells/ml in RPMI 1640 medium supplemented with 0.5% BSA, and 75 μl aliquots were loaded into the upper inserts. Buffer with or without rCCL25 (10 μg/ml) (R&D Systems), with or without CCL25 Ab (4 μg/ml) (R&D Systems), prepared in the same medium, were placed in the lower wells. Chambers were incubated for 2 h, and cell migration was quantified by counting the number of cells acquired by flow cytometry in an equivalent time period.

2.15 T helper in vitro polarisation and CCR9 induction

For RNA, western blot analysis and CXCR5 induction analysis, in addition to 1μg/ml CD3 mAb and 1 μg/ml CD28 mAb, in vitro conditions for T helper differentiation were as follows, in Table 2.8.

54 Table 2.8 Th Polarisation Conditions Th Polarisation Cytokines and blocking antibodies Concentration Th0 TGFβRII-Fc 0.1 μg/ml IFNγ mAb 5 μg/ml IL-4 mAb 5 μg/ml

Th1 rIL-12 3.5 ng/ml IL-4 mAb 5 μg/ml

Th2 rIL-4 3.5 ng/ml IFNγ mAb 5 μg/ml

Th17 rIL-6 5 ng/ml TGFβ1 1 ng/ml IFNγ mAb 5 μg/ml IL-4 mAb 5 μg/ml TFH rIL-21 100 ng/ml TGFβRII-Fc 0.1 μg/ml IFNγ mAb 5 μg/ml IL-4 mAb 5 μg/ml

For RNA and western blot analysis, naïve CD44lo CD4+ T cells were stimulated for 3 days (Th0, Th1, Th2 and Th17), and for CXCR5 induction analysis, cells were stimulated for 5 days under Th0 and TFH cell conditions. For CXCR5 induction analysis, naïve cells were compared to CCR9+ and CCR9- CD44hi CD4+ T cells, with data shown as mean fluorescence intensity (MFI) of CXCR5 staining of each subset in TFH condition, minus above MFI of CXCR5 in Th0 conditions.

For CCR9 induction analysis naïve and TFH cells, described as PD-1+ CXCR5+ CD44hi CD4+ T cells, were sorted from the spleen of NOD mice, 7 days after SRBC immunisation (see 2.16). These cells were cultured for 5 days, with dendritic cells, sorted from the mesenteric lymph node of the same immunised mice, in the presence of 1 μg/ml CD3 mAb and 1 x 106 SRBC/ml. CCR9 induction was compared to naïve CD4+ T cells in the same culture conditions, in the absence of mesenteric lymph node dendritic cells.

2.16 Sheep red blood cell immunisation

Mice were immunised i.p. with 2x108 sheep red blood cells (IMVS, Australia) and spleens analysed on day 7 for RNA analysis, CCR9 induction assay or flow cytometric analysis.

55 2.17 B cell help assay and antibody isotype ELISA

CD44lo B220+ naïve B cells were sorted from 9-week-old mice, and cultured with sorted naïve, CCR9+ or CCR9- CD44hi CD4+ T cells (both 5x104 cells) in 200 μl of complete cell culture media (including β-ME) in a 96-well plate, with wells pre-coated with 20 µg/ml CD3 mAb, with 1 µg/ml CD28 mAb added in suspension. As a control, B cells were stimulated with 10 µg/ml CD40 mAb with 50 ng/ml IL-4. ELISA was used to measure secreted IgG the culture supernatant after 96 h. Secreted Ig was captured by coating plates overnight with anti mouse Ig(H+L) (2 μg/ml, Southern Biotech) in ELISA coating buffer. The plate was washed then blocked with 4% milk powder (Coles) diluted in ELISA buffer for 1 h at 37°C. Plates were washed, then serum samples were incubated for 2 h at 37°C at 1:200 in ELISA buffer for antibody detection or neat for cytokine analysis along with 8-15 1:2 dilutions. After washing, analytes were detected using alkaline phosphatase (AP) conjugated anti-mouse IgG, IgG1, IgG2b, IgG2c, IgM, IgA (1:2000, BD Biosciences) at 37°C for 1 h. All standards used for each isotype were purchased from Southern Biotech and were used at a top dilution of 1μg/ml. Plates were given 5 final washes before detection of bound AP enzyme with 4-Nitrophenyl phosphate disodium salt hexahydrate at 1mg/ml (Sigma-Aldrich). The reaction was stopped using 2M NaOH.

The titre of IgG1 was calculated as Log2 of the last dilution factor where the OD was 3x that of background.

2.18 Pancreas and Salivary Gland infiltrate isolation

Mice were perfused with PBS, and pancreas and salivary gland extracted. Pancreas and salivary gland were cut into small pieces with scissors and transferred into 50 ml falcon tubes with 3mls of 0.25 mg/ml Liberase-Enzyme Blend-RI (Roche) in serum free RPMI 1640 media. The tissue was digested in a 37ºC water bath for 20 min. Tubes were centrifuged at 201 g at 4ºC for 5 min and the supernatant discarded. 10 ml of cold serum containing (10%) RPMI 1640 media was added. Tubes were vortexed and shaken to dislodge the tissue; centrifuged at 201 g at 4ºC for 5 min and the supernatant discarded. Again the supernatant was discarded, and the tissue resuspended in 5ml serum-free RPMI 1640, centrifuged at 201 g at 4ºC for 5 min. Pellets were thoroughly resuspended in 10 ml histopaque (Sigma-Aldrich) by vortexing. 5 ml of serum-free RPMI 1640 was layered on top. The tubes were

56 centrifuged at 974 g at 4ºC for 10 min without rotor acceleration or deceleration Pancreatic infiltrating lymphocytes at the media:histopaque interface were collected, and transferred into a new 15 ml tube. Tubes were the centrifuged at 340 g at 4ºC for 5 min, the supernatant discarded, the pellet washed in 5 ml PBS and centrifuged again. To dislodge clumped cells, samples were resuspended in 1 ml x for 1 min and washed in serum containing RPMI 1640.

2.19 LPL and IEL isolation

Small intestines were extracted from mice and placed in a petri dish containing pre-warmed PBS. Peyer’s patches were removed and the small intestine was cut longitudinally to allow faeces to be washed away. Samples were cut into small pieces with scissors and transferred into 50 ml falcon tubes. Samples were then washed by using a 25 ml pipette to bubble PBS through tissues for 10 seconds. This process was repeated until media cleared. To isolate intraepithelial lymphocytes (IEL), the tissues were incubated in 20 ml of IEL stripping buffer for 20 minutes at 37°C while shaking. Tissues were allowed to settle and the supernatant decanted through a cell strainer, then washed twice in lymphocyte isolation media and suspended in 8 ml of 40% Percoll (GE Healthcare). 3 ml of 70% Percol was underlayed using a glass pipette and the sample was centrifuged at 600 g for 20 minutes at room temperature. The IEL were then removed from the resulting interface, washed twice in lymphocyte isolation media by centrifuging at 300 g for 5 minutes at 4°C and used immediately for flow cytometry analysis. To isolate the lamina propria lymphocytes (LPL), the tissue remaining after treatment with stripping buffer was washed twice as above and resuspended in 5 ml of 5 mg/ml collagenase D (Roche) and 0.05% DNAse (Promega) in lymphocyte isolation media. Tissues were incubated in the enzyme solution for 15 minutes at 37°C then another 10 mL were added and incubated for another 15 minutes. Tissues were removed and washed twice as above, then passed through a 70 μm cell strainer. These cells were run on a Percoll gradient as above then used immediately for analysis.

2.20 Sublethal irradiation

Cohorts of NOD Il21r-/- mice were sublethally irradiated by a 137Cs source (two doses of 400 Rads, 4 hours apart). Irradiation therapy depleted splenic T and B

57 cell populations to less than 0.8% and 0.4% of non-irradiated mice, respectively. The following day, mice were transferred with i.v. injections of a combination of CCR9+ CD44hi CD4+ T cells and CD8+ T cells, 5 x 105 cells each. Following irradiation, mice were monitored for weight loss, blood sampling hematocrit analysis and glucose tolerance testing. Hematocrit analysis was calculated as packed blood volume as a percentage of total blood volume, after spinning down samples for 30 seconds on a desktop micro-centrifuge. Glucose tolerance was tested, as previously described (Gunton et al., 2005), after overnight fasting, using 2 g/kg of i.p. dextrose and BGL measured at time points after that, from tail bleeds.

2.21 IL-21R/Fc fusion protein experiments

IL-21R/Fc chimera was made in house as previously described (Herber et al., 2007). In brief, the DNA encoding the predicted extracellular domain (aa 1- 235) of mouse IL-21R with a GSGS linker were amplified by PCR, and linked to mIgG2a Fc. The FC domain contains 4 amino acid mutations (L285E, E368A, K370A and K372A) to minimise FC binding and complement fixation. The resulting construct was subcloned into pEE12.4 (Lonza), a mammalian glutamine synthase expression vector and transfected into Chinese hamster ovary (CHO)-K1SV cells, and grown in the presence of 25 μM methionine sulphoximine (MSX) (plasmid selection agent). CHO-conditioned medium was loaded onto a protein A affinity column, washed with PBS, and eluted with 0.1 M Glycine (pH 2.7). Fractions were neutralised with 1 M Tris-HCl (pH 9.0). The buffer was exchanged into PBS before checking purity by SDS/PAGE and tested for presence of endotoxin.

For reconstituted Il21r-/- analysis mice received, recombinant mouse IL-21R/Fc Chimera administered intravenously, 10 µg/mouse every other day for 12 days. For insulitis, flow cytometric and incidence studies, complete treatment of mice consisted of a total of 20 μg IL-21R/Fc given every other day for 11 days. Flow cytometric analyses were conducted at time points relative to this treatment regime. Treatment of NOD transplant recipients consisted of a total of 80 μg IL21R/Fc given on day -1, day 0 and every other day until day 12. A monoclonal Ig control was provided with a non-specific antibody (affinity purified, produced in house). Mice received 60 μg

58 polyclonal IL-21 antibody (goat IgG, R & D Systems) as an alternative IL-21 neutralising reagent.

2.22 Immunohistochemistry

5 μm sections of paraffin-embedded pancreas, salivary gland and pancreatic islet engrafted kidneys were conventionally stained with haematoxylin and eosin (H&E) for histological evaluation or prepared for immunocytochemical techniques. For insulitis scoring, serial sections of pancreata were matched and stained for insulin (DakoCytomation) and glucagon (Chemicon). Sections were analysed using a Leica light microscope (Leica Microsystems, Wetzlar, Germany). The images were processed using the Leica acquisition and analysis software ImageJ (Freeware NIH Bethesda, USA) and Adobe Photoshop, version 7 (San José, CA).

2.23 Islet isolation

Donor mice were anaesthetised with 400 µL of avertin solution (2.5%) and a midline incision was performed to expose the internal organs of the gut. Mouse islets were isolated via distension of the pancreas via the bile duct with 3 ml of 0.25 mg/ml Liberase-Enzyme Blend-RI (Roche) in serum free islet isolation media, using a 30- gauge needle. A maximum of three pancreata were placed in a 50 ml tube on ice for processing. The tissue was digested in a 37ºC water bath for 17 min. The tubes were then placed on ice and 30 ml of cold islet isolation media was added to stop the digestion. Tubes were vortexed and shaken to dislodge the acinar tissue from the islets; centrifuged at 311 g at 4ºC for 3 min and the supernatant discarded. This process was repeated twice. Pellets were resuspended in 20 ml islet isolation media, and passed through a 425 micron sieve (US standard sieve, A.S.T.E. E-11 specifications, Dual Manufacturing Co., Chicago), the empty tube was filled with 30 ml of islet isolation media and again passed through the sieve. The tubes were centrifuged at 311 g at 4ºC for 3 min and the supernatant discarded. Tubes were inverted on tissue paper to allow all media to drain. 10ml of Ficoll-Plaque Plus (Amersham) was added to the pellet and vortexed. An additional 10 ml of Ficoll was layered on top and then 10 ml of serum free islet isolation media was layered on top of the Ficoll. The tubes were centrifuged at 1730 g at 4ºC for 22 min without rotor acceleration or deceleration. Islets at the media:Ficoll interface were collected via a

59 30 ml syringe and cannula. Tubes were then filled with islet isolation media and centrifuged at 290 g at 4ºC for 3 min, the supernatant discarded and the islets pooled in one tube in 25 ml of media. The tube was rested on ice for 4 min, and the top 15 ml of media suctioned off via syringe and cannula. This was repeated 4 times.

2.24 Islet transplantation

To induce diabetes, recipient mice (H-2b) were injected with 180mg/kg of streptozotocin (STZ) (Sigma-Aldrich) in 10 mM citrate buffer pH 4.2. Mice with blood glucose level ≥ 18 mmol/L and a body weight of 20-25g were selected as transplant recipients. On the transplant day, islets were prepared from the pancreata of donor NOD/Scid (syngeneic) or BALB/c (H-2d) mice (allogeneic), at a ratio of three pancreata per recipient. For the transplant, anaesthesia is induced by placing animals in a chamber filled with 4% isoflurane in O2. Anaesthetised animals are maintained by ventilation with 1.5-2% isoflurane in O2 using a Bains paediatric circuit. Reflex testing of the footpad is used to determine depth of anaesthesia. Surgical anaesthesia is maintained for the entire procedure. The kidney is then accessed by a left flank incision and brought into the wound by gentle blunt dissection. A small nick was made in the kidney capsule at the inferior renal pole and the islets were deposited through the nick towards the superior pole of the kidney. After surgery and prior to the mouse awakening from anaesthesia, the analgesic Ketoprofen is administered to the animal at a dose of 0.5mg/kg. This analgesic may be used for up to three days after surgery, if mice still exhibit signs of distress. Graft function was determined by monitoring blood glucose levels (< 8 mmol/L) on post- operative days 1, 2, and 3 and then every second day till rejection occurs (when blood glucose levels returned to ≥ 18 mmol/L).

2.25 Genotyping PCR

2 mm of mouse tail was incubated overnight at 65°C in 200 μl DNA isolation buffer with 1.13 μl of Proteinase K (10 mg/ml, Promega) and 0.5 μl of the resulting digest was used as a template in PCR reactions. All primers and probes used for PCR are listed in Table 2.9 from 5’ to the 3’ end. Mice were screened for presence/absence of genes by PCR analysis. PCR was conducted using 0.5 μl of DNA template, 0.24 μM forward and reverse primer (Sigma-Aldrich), 50 μM each

60 dNTP (Promega, Madison, WI, USA), 0.625 U Taq polymerase (Promega) and 1X Green GoTaq Reaction Buffer (Promega) in a 25 μl reaction volume. All reactions were performed on an iCycler Thermal Cycler (Biorad, CA, USA). PCR products were visualised by electrophoresis on a 1-2% agarose (Sigma-Aldrich) gel containing 10 μg/ml ethidium bromide (Sigma-Aldrich).

Table 2.9 Genotyping primer sequences Primer Sequence 5’ to 3’ Annealing Temperature IL-21 F neo GCAGCGCATCGCCTTCTATC 65 IL-21 R neo ACCATTCTACTGACTTGTTAGACTC 65 IL-21 F WT GGAGACTCAGTTCTGGTGG 65 IL-21 R WT GGAGCTGATAGAAGTTCAGG 65 IL-21R F neo ATCGCCTTCTATCGCCTTCTTGACG 60 IL-21R F WT GACTCTTGGCCTGCAGTTCTGACG 60 IL-21R R common CCAAAGAGCTCCAGTAAACAG 60 F indicates the forward primer, whereas R indicates the reverse primers for each pair. Neo indicates primers that bind within the neomycin resistance cassette used to detect mutant knock out gene mice, whereas WT annotates primers that were used to detect the native gene sequence.

2.26 Data analysis and Statistics

P-values between datasets were determined by two-tailed Student’s t-test assuming equal variance. Data are reported as the mean ± standard error of the mean (SEM), along with the calculated P-values. The frequency of diabetes was compared between treatment groups with the Kaplan-Meier log-rank test using Prism software (Graphpad).

61 3 Examining IL-2 and IL-21 expression in Idd3

3.1 Introduction

Multiple genetic regions (loci) have been linked to increased susceptibility to autoimmune diseases, such as Type-1 diabetes (T1D) (Lord et al., 1995). The strongest non-MHC linked locus in the non-obese diabetic (NOD) model of T1D is Insulin-dependent diabetes 3 (Idd3), located at the proximal end of chromosome 3. Introduction of the 780 Kb Idd3 region from C57BL/6 (B6) into the NOD genome results in a reduction of diabetes incidence by ~75% (Lyons et al., 2000; Wicker et al., 1994). Fine mapping of Idd3 has identified 6 genes (Tenr, Il2, Il21, Cetn4, Bbs12 and Fgf2) including 2 genes encoding the immunoregulatory cytokines IL-2 and IL- 21 within this locus and 2 predicted genes (Gm12540 and KIAA1109) (Yamanouchi et al., 2007), as listed on T1DBase (http://T1DBase.org) (Smink et al., 2005). It is of interest to note that the Idd3 region in NOD mice has been shown to overlap with disease susceptibility in several murine models of autoimmunity (Boulard et al., 2002; Brayer et al., 2000; Cha et al., 2002b; Encinas et al., 1996; Killedar et al., 2006; Sundvall et al., 1995). Furthermore, the orthologous region on human chromosome 4 has also been associated with several autoimmune diseases (Hunt et al., 2008; Mattuzzi et al., 2007; Todd et al., 2007; van Heel et al., 2007).

The cytokines interleukin (IL)-2 and IL-21 are both crucial to drive a fully functional immune response. Studies have attempted to pinpoint the Idd3 effect to either IL-2 or IL-21, however a specific genetic irregularity implicating either gene has yet to be identified. The role IL-2 plays in T1D has been extensively analysed, with conflicting results (Kamanaka et al., 2009; Lyons et al., 2000; Podolin et al., 2000; Yamanouchi et al., 2007). Initial studies did not reveal a difference in transcript levels, the amount of IL-2 protein secreted, or functional activity of IL-2 from different mouse strains (Chesnut et al., 1993; Lyons et al., 2000; Matesanz et al., 1993; Podolin et al., 2000). However, a proline/serine conversion at position 6 of the NOD IL-2 protein was hypothesised to affect the half-life of circulating IL-2 (Podolin et al., 2000). Recently this hypothesis was tested with a knock-in mouse in which exon 1 of the B6 IL-2 allele replaced the homologous region in the NOD allele

62 (Kamanaka et al., 2009). Contrary to the hypothesis, Kamanaka and colleagues found that even though the glycosylation pattern displayed was that of the B6 IL-2 isoform, the knock-in mouse was not protected from T1D (Kamanaka et al., 2009). The researchers argued that the Idd3 locus effect might reflect a difference in the transcription of the NOD IL-2 allele rather than post-translational modifications (Kamanaka et al., 2009). In support of this notion, the loss of one copy of the IL-2 gene (in IL-2+/- mice) had been shown to increase the incidence of T1D in NOD mice (Yamanouchi et al., 2007). In this study, levels of NOD Il2 mRNA were reduced relative to the Il2 mRNA from B6 mice and this lower level of IL-2 transcription was shown to correlate with the propensity to develop T1D in a number of congenic NOD strains (Yamanouchi et al., 2007). However, the reported decreased transcription of IL-2 could not explain several previous findings. For instance, transgenic over-expression of IL-2 in the pancreas resulted in a greater incidence of T1D (Allison et al., 1994; Elliott and Flavell, 1994). In addition, the administration of S4B6 antibody, now known to potentiate the effect of IL-2 (Boyman et al., 2006a), to NOD mice prevented the development of T1D (Setoguchi et al., 2005). Both of these findings are likely to reflect the important role of IL-2 in T cell expansion and differentiation (Minami et al., 1993).

This apparent double-edged balancing act of IL-2 levels has been further complicated by the finding that IL-2 is a growth factor for regulatory T cells (Tregs) which are critical in the prevention of autoimmunity (Sadlack et al., 1993; Tang et al., 2008). Again the field of research remains divided as to whether Tregs are in fact normal in function and number in NOD mice (D'Alise et al., 2008; Feuerer et al., 2007; Mellanby et al., 2007; Yamanouchi et al., 2007). This contentious issue required further clarification.

IL-21 has more recently been identified within the Idd3 region (Parrish- Novak et al., 2000). IL-21 is produced by activated CD4+ T cells and NK T cells (Coquet et al., 2007; Parrish-Novak et al., 2000), and signals through a heterodimeric receptor, consisting of an IL-21-specific IL-21R α-chain paired with the common γ- chain (CD132) (Asao et al., 2001). IL-21R is expressed on a wide range of immune cells, B cells, CD4+ and CD8+ T cells, NK cells, dendritic cells, macrophages and

63 non-immune cells, including keratinocytes, reviewed by (Leonard et al., 2008) which indicates the vast influence IL-21 has over a range of cell types. It has numerous effects in both humoral and cell-mediated immune responses (Leonard and Spolski, 2005).

Early mapping studies of Idd3 were conducted prior to the discovery of Il-21 (Ghosh et al., 1993; Lyons et al., 2000; Wicker et al., 1994). Considering IL-2 and IL-21 sit directly next to each other, merely 100kb apart, congenic mapping studies failed to separate their effects. Since its discovery in 2000, IL-21 has been documented to have a strong immunoregulatory role (Monteleone et al., 2008), with potential to influence autoimmunity (Vogelzang and King, 2008). Linkage studies have identified associations with IL-21 and human T1D, (additively to associations of IL21R (Asano et al., 2006; Asano et al., 2007)) and other autoimmune diseases including coeliac disease (Hunt et al., 2008; van Heel et al., 2007), systemic lupus erythematosus (SLE) (Sawalha et al., 2008) and a proposed association for multiple sclerosis (Forte et al., 2006).

The studies described in this chapter were designed to examine the relative expression levels of both cytokines, IL-2 and IL-21 in relation to T1D susceptibility. Previous studies from our lab have demonstrated that IL-21 is elevated in NOD mice (King et al., 2004) and this observation is taken as a starting point for this thorough genetic analysis.

64 3.2 Results

3.2.1 Increased IL-21 in NOD mice is controlled by the Idd3 locus

We have previously observed that NOD mice express higher levels of IL-21 mRNA compared to C57BL/6 (B6) mice and the congenic strain NODB6.Idd3, which carries the B6 region of Idd3 (King et al., 2004). This thesis was undertaken to explore this observation with regards to how IL-21 may contribute to T1D. This initial observation was conducted in splenocytes and cells isolated from pancreatic lymph nodes (King et al., 2004). It was important to firstly confirm whether the increased levels of IL-21mRNA observed was due to increased expression on a cell per cell basis, or, alternatively, reflected a greater proportion of IL-21 producing cells in NOD mice, compared to B6 and NODB6.Idd3. To do this, we sorted activated (CD44hi, CD62L-) CD4+ T cells from splenocytes and subjected them to in vitro stimulation with PMA and ionomycin, after which we measured IL-21 transcript levels by real-time PCR. We found that while transcription was induced with similar kinetics, activated CD4+ T cells from NOD mice had a greater per-cell capacity to express IL-21 compared to NODB6.Idd3 (Figure 3.1A).

We confirmed that the difference in mRNA production equated to a difference in protein production (Figure 3.1B). We stimulated splenic CD4+ T cells with CD3 and CD28 mAb for 2 days, and assessed IL-21 levels in the supernatant by ELISA. Interestingly, assessment of IL-21 protein revealed that NOD.Idd3B6/NOD, F1 offspring of NOD and congenic NODB6.Idd3 mice, displayed an intermediate profile compared to the two parental strains. This correlated with an intermediate disease incidence of approximately 40% in F1 mice that was between that of NOD mice (approximately 90%), and that of the congenic NODB6.Idd3 strain (10%) (Figure 3.1C). Unfortunately, using the commercial reagents currently available IL-21 was not detected in serum.

65

Figure 3.1 Increased IL-21 in NOD mice is controlled by the Idd3 locus (A) IL-21 mRNA expression from NOD and NODB6.Idd3 activated CD4+ T cells after in vitro stimulation with PMA and ionomycin. Measured by real-time PCR and presented as fold B6.Idd3 modulation relative to unstimulated NOD cells. Data are presented as mean +SEM, n = 6-9 mice per group, three experiments. (B) IL-21 protein levels from NOD, NOD.Idd3NOD/B6 and NODB6.Idd3 CD4+ T cells after in vitro stimulation with CD3 and CD28 mAb for 2 days. Measured by ELISA, data are presented as mean + SEM, n = 6 mice per group, two experiments. (C) Cumulative incidence of diabetes in NOD, n = 15; NOD.Idd3NOD/B6, n = 25; and NODB6.Idd3 mice, n = 20.

3.2.2 Increased expression of the NOD IL-21 allele

Given the observation of increased IL-21 mRNA and protein in NOD CD4+ T cells, it was important to examine the relative activities of the NOD and B6 IL-21 alleles. The F1 progeny of NOD and congenic NODB6.Idd3 mice (NOD.Idd3B6/NOD) provided an excellent tool to address relative abundance of the NOD and C57BL/6 IL-21 alleles, as each cell has the capacity to transcribe from both alleles. Pyrosequencing is a technique that allowed us to measure the relative abundance of both alleles simultaneously. It relies on having a sequence variation in the DNA, and subsequently transcribed mRNA, between the two parental strains of the F1 mouse being assessed. Following a step of PCR amplification, this ‘reporter’ single nucleotide polymorphism (SNP), and thus relative allelic abundance, could be quantitated in a sequencing reaction. The possible readouts for such an assay are indicated in Figure 3.2. If we were to assess the relative abundance of NOD and B6 alleles in B6 mRNA, where only a B6 allele is available to transcribe, only a ‘T’ was sequenced 100% of the time, and vice versa a ‘C’ when only a NOD allele was present, if sequencing NOD mRNA. Importantly, if F1 NOD.Idd3B6/NOD DNA was used as the template, and the results showed the predicted 50% abundance for both alleles. This technique was useful to address relative abundance of transcribed mRNA when both alleles were available to be transcribed, as in a F1 NOD.Idd3B6/NOD mouse. This was also a powerful technique because both alleles

66 were exposed to the same genetic background including the same availability of transcription factors.

Figure 3.2 The abundance of two alleles can be quantified using a pyrosequencing ‘reporter’ SNP sequencing reaction Pyrograms generated from sequencing NODB6.Idd3 (T) and NOD (C) RNA, and NOD.Idd3B6/NOD DNA. Equivalent quantity of reporter T and C SNP indicates 50% abundance of both B6 and NOD alleles in NOD.Idd3B6/NOD DNA.

We used primers that spanned a ‘reporter’ SNP in intron 2 of the IL-21 gene to distinguish between the NOD IL-21 allele and the B6 IL-21 allele in NOD.Idd3B6/NOD mice. Since this SNP was located in an intron, and we were analysing DNAse treated mRNA, converted to cDNA, this gave the readout of premRNA, before introns were spliced out and mRNA became mature. Thus premRNA levels reflected early transcription whereas total mRNA, detected when using primers that spanned ‘reporter’ SNPs located in exons, reflected processed mRNA, which was translated into protein. Both intronic and exonic analyses were conducted in this study to address both concerns of transcript levels (intronic) and mRNA levels translated into protein (exonic). We assessed the relative transcription abundance after stimulation in vitro with CD3 and CD28 mAbs. These analyses showed that the dominantly transcribed IL-21 allele was NOD, resulting in an abundance of the NOD allelic variant of both premRNA (intronic) and total mRNA (exonic) in NOD.Idd3B6/NOD splenocytes (Figure 3.3).

67

Figure 3.3 NOD intronic and exonic IL-21 allele is preferentially transcribed in NOD.Idd3NOD/B6 splenocytes (A) Intronic IL-21 (premRNA) and (B) exonic IL-21 mRNA measured by allele specific pyrosequencing assay in NOD.Idd3NOD/B6 splenocytes after in vitro stimulation with CD3 and CD28 mAb, n = 25-28 mice per group, four experiments.

However, the analysis of splenocytes may not be relevant to the disease process in the NOD mouse, as T1D is thought to be initiated by activation of lymphocytes within lymph nodes, resulting in a destructive inflammation in the pancreas. So, we decided to also look in more disease relevant sites, the lymph nodes and pancreatic infiltrate. Importantly, we observed the same pattern of results as our splenocyte analyses, when assessing transcripts in cells taken from lymph nodes (Figure 3.4A) and pancreatic infiltrate (Figure 3.4B and C). These findings would suggest that, although given potential differences in environmental cues at sites of infiltration, the relative difference in the allelic abundance of IL-21 intronic and exonic transcripts in NOD.Idd3B6/NOD mice remained the same.

68

Figure 3.4 NOD intronic and exonic IL-21 allele is preferentially transcribed in NOD.Idd3NOD/B6 cells isolated from lymph nodes and pancreas (A) Intronic IL-21 (premRNA) measured by allele specific pyrosequencing assay in cells from NOD.Idd3NOD/B6 pooled mesenteric, inguinal, pancreatic lymph nodes, after in vitro stimulation with CD3 and CD28 mAb. (B) Intronic and (C) exonic IL-21 mRNA measured by allele specific pyrosequencing assay in lymphocytes isolated from NOD.Idd3NOD/B6 pancreas, after in vitro stimulation with CD3 and CD28 mAb, n = 25-28 mice per group, four experiments.

Extending the analysis of IL-21 allele abundance showed a similar dominance of the NOD IL-21 allele whether examined in sorted naïve (CD44lo) or activated/memory phenotype (CD44hi + ICOS) CD4+ T cells (Figure 3.5A and B). The activation status of the CD4+ T cells did not appear to influence the relative allelic abundance of IL-21. Interestingly, a similar profile was revealed when the analysis of IL-21 transcript abundance was conducted in F1 progeny of NOD and B6 mice (Figure 3.5C and D).

69

Figure 3.5 NOD intronic and exonic IL-21 allele is preferentially transcribed in naïve and activated NOD.Idd3NOD/B6 CD4+ T cells, and NOD/B6 F1 splenocytes Intronic IL-21 (premRNA) measured by allele specific pyrosequencing assay from sorted NOD.Idd3NOD/B6 naïve (CD44lo) CD4+ T cells and memory (CD44hi), ICOS- and ICOS+, CD4+ T cells (A) ex vivo and (B) after in vitro stimulation with CD3 and CD28 mAb for 4 h, n = 6 mice per group, two experiments. (C) Intronic and (D) exonic IL-21 mRNA measured by allele specific pyrosequencing assay from NOD/B6 F1 splenocytes, after in vitro stimulation with CD3 and CD28 mAb, n = 5-7 mice per group, two experiments.

To confirm the patterns of allelic abundance within the F1 NOD.Idd3B6/NOD pyrosequencing analyses we conducted an analysis of IL-21 levels by real-time PCR within the individual strains NOD, NODB6.Idd3 and the NOD.Idd3B6/NOD. Whilst we confirmed that the NOD IL-21 had greater activity (King et al., 2004), inclusion of F1 NOD.Idd3B6/NOD splenocytes revealed an intermediate expression in both intronic and exonic IL-21 mRNA (Figure 3.6A and B). This result would suggest that neither genetic background (NOD or B6 Idd3) were imposing a dominant effect through trans-regulating loci.

The observation that both the intronic alleles (reflecting transcript levels) and exonic alleles (reflecting mRNA levels translated into protein) had similar profiles argued against the possibility that the preference for the transcription of the NOD allele could be explained by a more rapid degradation of B6 IL-21 mRNA. However, to address this directly we assessed IL-21 mRNA stability by subjecting in vitro CD3 and CD28 mAb stimulated splenocytes and pancreatic infiltrate to actinomycin D, a transcription inhibitor. By measuring exonic IL-21 transcript levels subsequent to the

70 addition of actinomycin D, relative mRNA decay could be assessed. We found, as our pyrosequencing results had indicated, that there was no difference in IL-21 mRNA stability assessed in NOD, NOD.Idd3B6/NOD and NODB6.Idd3 splenocytes and pancreatic infiltrate (Figure 3.6C and D).

Figure 3.6 Increase transcription of NOD IL-21 mRNA does not reflect differences in mRNA stability (A) Intronic and (B) exonic IL-21 mRNA expression from NOD, NOD.Idd3NOD/B6 and NODB6.Idd3 splenocytes after in vitro stimulation with CD3 and CD28 mAb. Measured by real- time PCR, n = 15 mice per group, four experiments. Decay of exonic IL-21 mRNA expression from NOD, NOD.Idd3NOD/B6 and NODB6.Idd3 (C) splenocytes and (D) pancreatic infiltrate after in vitro stimulation with CD3 and CD28 mAb and treated with actinomycin D. Measured by real- time PCR, data shown as mean + SEM where n = 6 per group, two experiments

3.2.3 Promoter polymorphisms increase IL-21 transcript levels through Sp1 binding

The promoter region of genes can dictate transcriptional activity. NOD and B6 allelic sequence variation in this regulatory region might explain the increased IL-21 levels in NOD mice. As such, we conducted a comparison of the extended 2- Kb promoter region of NOD and B6 IL-21 (Appendix 1). This analysis identified 30 sequence SNPs, 13 of which mapped to putative transcription factor binding sites present only in the NOD allele and absent in the B6 allele (Table 3.1). These putative transcription factor binding sites were determined using the TRANSFAC database, which scores the likelihood of transcription factors successfully binding to sites on the specified DNA sequence.

71 Table 3.1 Putative IL-21 promoter regulatory sitesa in NOD and NODB6.Idd3

c Core Position # Strand / d e Model Binding Site similarity Sequence bpb Strain Lq + La/ R04336 CAC-binding -249: -244 (R) NOD 1.00 + 2.00 CACCCC - R08289 GATA -533: -517 (N) NOD 1.00 + 1.09 ATCNNNNNATCC C R01702 Sp1 -590: -584 (R) NOD 1.00 + 2.00 ACGCCCC -1459: - R08290 GATA (N) NOD 1.00 + 2.00 AGATTA 1454 -1713: - R04327 Oct series (N) NOD 1.00 + 1.33 MATNNWAAT 1681 -1812: - R04171 CP2 (N) B6 1.00 + 1.27 GCNMNANCMAG 1802 -1862: - R04336 CAC-binding (R) NOD 1.00 + 2.00 GGGGTG 1856 R04336/ CAC-binding & -1983: - CACCCC (R) NOD 1.00 + 1.62 R02132 C/EBP alpha 1971 CWWWCCAC a Putative IL-21 promoter regulatory sites determined using TRANSFAC database (http://www.cbil.upenn.edu/tess/) b Relative to transcription start site assigned by (Kim et al., 2005) c Sense of the site, N= normal, R= reverse d La/ = La / length, where La is the log likelihood score. Max 2.00 Lq = La/ (L- M) the max La possible for the site model. Best is 1.00 e N = A or C or G or T, M = A or C, W = A or T, underlined is the single nucleotide polymorphism (SNP)

Using these 13 SNPs identified at NOD-specific putative transcription factor binding sites, we designed promoter constructs to include sequential polymorphic transcription factor binding sites, spanning the entire 2-Kb promoter region. Each construct contained the minimally described promoter unit, the proximal promoter, which contained the necessary binding sites for nuclear factor of activated T cells (NFAT) transcription factor (Mehta et al., 2005). Each promoter unit was cloned into a pGL3 vector, which enabled detection of successful binding of appropriate transcription factors through the transcription of a luciferase reporter, with the amount of resulting luciferase protein quantifiable in a sensitive enzymatic assay. Figure 3.7 demonstrates that higher luciferase readings were observed when the NOD promoter was driving transcription. This indicates that the NOD IL-21 promoter had a superior promoter activity compared to the B6 IL-21 promoter. Interestingly, this advantage over the B6 IL-21 promoter was lost in the NOD

72 promoter segments, pIL-21(-570 and -318) which excluded an Sp1 transcription factor binding site, containing two polymorphisms between 591 and 582 (Figure 3.7A). This finding suggested that the putative Sp1 binding site on the NOD IL-21 promoter was contributing to the increased strength of the promoter.

Sp1 is a transcription factor that contains a DNA-binding domain consisting of three zinc fingers (Philipsen and Suske, 1999). It acts on a wide range of genes by binding to specific GC-rich regulatory DNA sequences within promoters. As a consequence, its role in transcription initiation influences numerous cellular functions, including differentiation, cell proliferation and also facets of immunological function (Kaczynski et al., 2003; Larsson et al., 2010; Shimokawa et al., 2009). In order to evaluate whether this putative Sp1 site was imparting greater transcriptional activity to the NOD IL-21 promoter, we used site directed mutagenesis (SDM) to exchange the two SNPs in the NOD IL-21 promoter Sp1 site to that of an equivalent B6 site. This targeted Sp1 site conversion effectively reduced the NOD IL-21 promoter activity to the levels of the B6 IL-21 promoter (Figure 3.7B). Conversely, the conversion of the B6 site to the NOD Sp1 site substantially increased B6 IL-21 promoter strength (Figure 3.7B).

Figure 3.7 The NOD IL-21 promoter exhibits increased transcriptional activity (A) IL-21 promoter activity measured in primary CD4+ T cells transfected with IL-21 promoter/luciferase reporter gene constructs, after 8 h in vitro stimulation with PMA and ionomycin. (B) Site directed mutagenesis (SDM) was used to convert the Sp1 site in the NOD promoter (pIL-21 -1774) to the equivalent B6 site (NOD-Sp1) or create a NOD Sp1 site in the B6 promoter (B6+Sp1) in EL4 cells. Results are presented as the mean + SEM, n = 3-4, for each luciferase assay.

The luciferase reporter construct experiments demonstrated that the NOD promoter sequence could drive increased transcription that was dependent on the Sp1

73 binding site. However, this experimental approach was an artificial system that did not allow us to directly test an interaction with Sp1 and the NOD IL-21 promoter. Therefore, we employed a technique called electromobility shift assay (EMSA) to determine whether Sp1 protein from activated T cell nuclear extracts had an increased affinity for the NOD putative Sp1 binding site, compared to the equivalent B6 site. To do this, we applied electrophoretic separation of 32P radio-labelled probes (28 base pairs in length) of either the consensus Sp1 binding site, or the NOD and B6 IL-21 promoter equivalent probes, in the presence of nuclear extract taken from PMA and ionomycin activated T cell line, EL4 cells. If a protein had successfully bound to the radio-labelled probe, it would migrate slower, since the complex had a greater combined molecular weight. Excess unlabelled ‘cold’ probes and antibodies could then be used to compete with the interaction in order to identify the proteins contributing to the probe-binding complex. Furthermore, by comparing related probes (NOD and B6 versions), the relative affinity of the protein complex could be investigated.

Firstly we tested whether the same complex appeared when radio-labelled probes for NOD, B6 or the consensus Sp1 site were incubated with stimulated EL4 nuclear extracts and subjected to electrophoretic separation. We found the same size complex, which suggested that the same protein interactions were evident when the radio-labelled consensus probe, NOD probe, and to a lesser extent, the B6 probe were incubated with nuclear extract. Furthermore, titration of the nuclear extract indicated that the B6 probe required a higher concentration of nuclear extract to form a complex than that of the NOD or consensus probes (Figure 3.8A and B). Secondly we showed that when the radio-labelled NOD Sp1 probe was incubated with excess unlabelled NOD or consensus probe, which should have the highest affinity for Sp1, the complex was reduced. This competition occurred to a much lesser extent when excess unlabelled B6 or non-specific probes were used (Figure 3.8C and D). Since the most effective competition was with the consensus Sp1 probe, it would suggest the complex was binding Sp1 from the nuclear extract. An alternative competition assay in which cold probes for consensus, NOD and B6 were titrated against a set concentration of the radio-labelled consensus Sp1 probe showed that excess amounts of the NOD probe also competed better with the consensus probe for Sp1 binding

74 than the B6 probe (Figure 3.8E and F). As expected, the consensus probe proved best at competing with itself (Figure 3.8E and F). Finally, to confirm that presence of a specific Sp1 complex in the nuclear extract, we showed that an antibody to Sp1 could block binding of the NOD Sp1 probe (Figure 3.8G and H).

Figure 3.8 The NOD IL-21 promoter exhibits increased Sp1 binding (A) EL4 NE was titrated over 32P labelled probes derived from NOD, B6 or consensus sequence as indicated. (B) The intensity of complexes is shown relative to NOD Sp1 probe in the presence of excess EL4 NE. (C) Electromobility shift assay showing Sp1 binding complex on the IL-21 promoter. Stimulated EL4 nuclear extracts (NE) were incubated with radio-labelled probe specific for the NOD Sp1 binding site, in the absence of competitor (lane 1), or in competition with unlabelled NOD (lane 2), B6 (lane 3), consensus (Con) (lane 4) or non-specific (Non) (lane 5) probes. (D) The level of inhibition for each Sp1 probe is shown relative to the total binding (100%). (E) Radio-labelled consensus Sp1 probe was titrated 1:2 (right to left) against 100-fold molar excess unlabelled consensus, NOD or B6 probe. (F) Intensity of complexes relative to total binding (100%). (G) Binding of the NOD probe is lost when nuclear extract is incubated with Sp1 mAb (Ab) (lane 2). (H) Binding with Sp1 mAb is shown relative to total binding. Each data are representative of two experiments.

75 3.2.4 NOD IL-2 allele is highly expressed, but mRNA is less stable

As shown in section 3.2.2, IL-21 was more highly expressed in NOD mice, and both the intronic and exonic IL-21 mRNA NOD alleles were more active than the B6 IL-21 alleles, whereas IL-21 transcript from both NOD and B6 displayed similar mRNA stability. Furthermore, as shown in section 3.2.3, the superior transcription ability of the NOD IL-21 promoter was associated with improved Sp1 transcription factor binding. Taken together these findings indicated that the NOD allele was differentially expressed and that diabetes in the Idd3 F1 mice reflected the levels of IL-21. However, a previous study has questioned the relevance of IL-21 expression to T1D in the NOD mouse and concluded that diabetes was instead associated with decreased expression of NOD IL-2 allele (del Rio et al., 2008; Yamanouchi et al., 2007). Therefore, we decided to apply some of the same techniques to analyse expression of IL-2. While this analysis has been previously published, there are some differences in methodological approach (Yamanouchi et al., 2007), a comparison of which will be assessed in depth in the discussion. Again, we utilised primers that bound within the introns of IL-2 and thus analysed premRNA, an indication of allelic transcriptional preference. We found that like the IL-21 mRNA, the intronic NOD IL-2 mRNA allele was much more readily transcribed than the B6 IL-2 allele, resulting in a greater abundance of the NOD intronic IL-2 allele, as assessed in in vitro activated NOD.Idd3B6/NOD splenocytes, lymph node suspensions, and lymphocytes extracted from the pancreas (Figure 3.9A- C). The same trend of intronic NOD IL-2 allelic dominance was evident when splenocytes from NOD/B6 F1 mice were analysed (Figure 3.9D).

76

Figure 3.9 Preferential transcription of IL-2 premRNA from NOD allele Intronic (premRNA) IL-2 mRNA measured by allele specific pyrosequencing assay from NOD.Idd3NOD/B6 (A) splenocytes, n = 15 mice per group, (B) pooled lymph nodes, n = 12 mice per group, and (C) lymphocytes isolated from NOD.Idd3NOD/B6 pancreas, n = 5 mice per group. (D) Intronic IL-2 mRNA measured by allele specific pyrosequencing assay from NOD/B6 F1 splenocytes, n = 5-7 mice per group. Each set of samples were stimulated in vitro with CD3 and CD28 mAb and experiments repeated between two and four times.

Interestingly, when exonic (total) IL-2 mRNA was examined in NOD.Idd3B6/NOD splenocytes, NOD IL-2 and B6 IL-2 alleles were observed in similar abundance (Figure 3.10). We found similar results when IL-2 transcripts were assessed in cells derived from NOD.Idd3B6/NOD lymph node suspensions; lymphocytes extracted from the pancreas and NOD/B6 F1 splenocytes. This result was different to what we observed for exonic IL-21 mRNA. Given this disparity between intronic and exonic mRNA transcripts, this finding suggested a difference in mRNA stability between the two alleles.

77

Figure 3.10 Exonic IL-2 show similar abundance of NOD and B6 alleles Exonic IL-2 mRNA measured by allele specific pyrosequencing assay from NOD.Idd3NOD/B6 (A) splenocytes, n = 15 mice per group, (B) pooled lymph nodes, n = 12 mice per group, and (C) lymphocytes isolated from NOD.Idd3NOD/B6 pancreas, n = 5 mice per group. (D) Exonic IL-2 mRNA measured by allele specific pyrosequencing assay from NOD/B6 F1 splenocytes, n = 5-7 mice per group. Each set of samples were stimulated in vitro with CD3 and CD28 mAb and experiments repeated between two and four times.

By also analysing IL-2 transcripts by real-time PCR, it was evident that similar levels of exonic IL-2 mRNA were found in stimulated NOD, NODB6.Idd3 and NOD.Idd3B6/NOD splenocytes whereas intronic IL-2 transcripts were higher in NOD mice (Figure 3.11). These data suggested a difference in mRNA stability, so to directly test this we analysed IL-2 mRNA decay in splenocytes stimulated with CD3 and CD28 mAb, with transcription subsequently inhibited by addition of actinomycin D. We found that NOD IL-2 mRNA displayed a decreased stability compared with B6 mRNA IL-2, whether measured in splenocytes or lymphocytes extracted from the pancreas (Figure 3.12). This finding was in contrast to the equivalent stability of the IL-21 alleles (Figure 3.6).

78

Figure 3.11 Intronic and exonic IL-2 mRNA display different profiles (A) Intronic and (B) exonic IL-2 mRNA expression measured by real-time PCR from NOD, NOD.Idd3NOD/B6 and NODB6.Idd3 splenocytes stimulated in vitro with CD3 and CD28 mAb, n = 15 mice per group from four experiments.

Figure 3.12 Decreased stability of NOD IL-2 mRNA Decay of exonic IL-21 mRNA expression from NOD, NOD.Idd3NOD/B6 and NODB6.Idd3 (A) splenocytes and (B) pancreatic infiltrate after in vitro stimulation with CD3 and CD28 mAb and treated with actinomycin D. Measured by real-time PCR, data shown as mean + SEM where n = 5 per group, two experiments

3.2.5 Equivalent amount of IL-2 protein in NOD and NODB6.Idd3

In section 3.2.4 we showed that measuring IL-2 premRNA revealed an increased abundance of the NOD allele in NOD.Idd3B6/NOD transcripts, however exonic IL-2 transcripts showed a similar prevalence of both NOD and B6 alleles, associated with a decreased stability of NOD IL-2 mRNA. What remained to be established was whether this difference in mRNA stability equated to similar IL-2 protein levels in NOD and NODB6.Idd3 mice. Since IL-2 protein levels in serum measured by ELISA are difficult to interpret due to the simultaneous production and utilisation of IL-2 in culture, we took advantage of a novel system described by Boyman, Sprent and colleagues to assess the functional levels of circulating IL-2 protein in NOD versus NODB6.Idd3 mice (Boyman et al., 2006a). The researchers found that a particular IL-2 monoclonal antibody clone (S4B6) formed a complex with bioavailable IL-2 protein, resulting in the preferential expansion of memory

79 phenotype (MP) CD8+ T cells (Boyman et al., 2006a). In addition, they showed quite elegantly that the assay could detect a 50% reduction in proliferation of MP CD8+ T cells in the presence of IL-2 mAb (S4B6), in IL-2+/- mice compared with WT mice, that is, when half as much IL-2 was available (Boyman et al., 2006a). Thus, the proliferation of MP CD8+ T cells could be used as a direct readout of IL-2 bioavailability. In accordance with these previous findings, we observed in all organs assessed, the same trend between the amount of rmIL-2 administered (with a constant dose of IL-2 mAb (S4B6)) and the proliferation of CFSE labelled CD8+ T cells (Figure 3.13).

Having established this system in our hands, we looked to measure bioavailable IL-2 in NOD and NODB6.Idd3 mice. We found that when S4B6 was administered to NOD and NODB6.Idd3 mice, IL-2:IL-2mAb- responsive endogenous CD8+ T cells expanded to the same extent (Figure 3.14). Also, when CFSE-labelled CD8+ T cells from F1 NOD.Idd3NOD/B6 mice were transferred into both S4B6 treated NOD and NODB6.Idd3 mice, they proliferated to an equivalent extent (Figure 3.15). Since the donor cells were equivalent, the fraction of CD8+ T cells proliferating in NOD and NODB6.Idd3 strains reflected host IL-2 levels. These studies indicated that there was an equivalent amount of circulating IL-2 protein in NOD and NODB6.Idd3 mice. Previous studies comparing NOD and C57BL/6 strains have only measured IL- 2 protein levels in supernatants by ELISA from in vitro stimulated T cells (Chesnut et al., 1993). This study is the first to address in vivo IL-2 levels of NOD compared to NODB6.Idd3 mice.

Figure 3.13 Administering rmIL-2 and IL-2 mAb reveals the same profile of MP CD8+ T cell proliferation across different organs Quantification of CFSE labelled proliferating CD122+ CD44hi MP CD8+ T cells transferred into NOD mice and examined on day 7 following daily i.p. injections of S4B6 and doses of rmIL-2 as indicated. Percent proliferation in each organ is expressed as delta change from S4B6 only. Data are representative of three experiments.

80

Figure 3.14 S4B6 equivalently expands endogenous MP CD8+ T cells in NOD and NODB6.Idd3 mice (A) Representative dot plots showing S4B6 IL-2 mAb induced expansion of host CD122+ CD44hi MP CD8+ T cells from NOD and NODB6.Idd3, following daily i.p. injections of S4B6 or PBS and (B) represented as delta change, where n = 12, four experiments.

Figure 3.15 Equivalent amounts of bioavailable IL-2 in NOD and NODB6.Idd3 mice (A) Representative histograms showing CFSE dilution of transferred NOD.Idd3NOD/B6 CD122+ CD44hi MP CD8+ T cells in NOD and NODB6.Idd3 hosts following daily i.p. injections of S4B6, PBS or S4B6+rmIL-2 examined on day 7, (B) shown as percentage divided CD122+ CD44hi MP CD8+ T cells where n = 10, from four experiments.

To confirm these findings, we analysed IL-2 production by intracellular immunostaining and flow cytometric analyses. We found equivalent numbers of IL-2 producing cells in NOD and NODB6.Idd3 spleens, but more IL-2-producing T cells infiltrating the pancreas of NOD mice (Figure 3.16A-C). This finding was consistent with a greater number of activated CD4+ T cells in the islets of NOD mice compared with NODB6.Idd3 mice (Figure 3.16D). Of the IL-2+ CD4 and CD8+ T cells in spleen and pancreas, equivalent amounts of IL-2 were produced, as measured by mean

81 fluorescence intensity (MFI) (Figure 3.16E and F). In agreement with these findings, IL-2 was detected equally in T cells from NOD and NODB6.Idd3 mice when analysed by western blotting (Figure 3.17).

Figure 3.16 Equivalent amounts of IL-2 in NOD and NODB6.Idd3mice. Representative dot plots from flow cytometric analyses of IL-2 in NOD and NODB6.Idd3 (A) CD4+ T cells and (B) CD8+ T cells directly ex vivo (unstimulated) and after 5 h stimulation of splenocytes and islet-extracted lymphocytes with PMA and ionomycin, n = 8, from three experiments. Absolute number of (C) IL-2+ CD4+ T cells, and (D) CD44hi CD4+ T cells in NOD and NODB6.Idd3 pancreas, n = 5, from two experiments. Mean fluorescence intensity (MFI) of IL- 2 in (E) CD4+ T cells and (F) CD8+ T cells from the spleen and pancreas of NOD and B6.Idd3 NOD mice, n = 8, from three experiments.

Figure 3.17 Equivalent expression of IL-2 in NOD and NODB6.Idd3 CD4 and CD8+ T cells IL-2 detected by Western blot analysis in total lysates of CD44hi CD4+ and CD8+ T cells with band intensity quantified in arbitrary relative units, representative of three experiments.

82 3.2.6 Expression profiles for IL-2 and IL-21 form two distinct groups

In order to understand further the relationship between IL-2 and IL-21 expression, we applied similar analyses to five additional mouse strains (CBA, DBA, 129, BALB/c and C3HeJ). We used allele-specific pyrosequencing to analyse the F1 progenies of crosses of CBA x C57BL/6, DBA x C57BL/6, DBA x BALB/c, C3HeJ x C57BL/6, 129 x C57BL/6 and BALB/c x C57BL/6 in order to determine the relative abundance of the IL-2 and IL-21 alleles. Surprisingly, this analyse revealed that there were two distinct expression patterns for IL-2 and IL-21. The first expression pattern (Idd3 Allele ‘A’), found in C57BL/6 and BALB/c strains, consisted of IL-21 and IL-2 expression both at moderate levels (Figure 3.18). In the second group (Idd3 Allele ‘B’), to which DBA, CBA, C3HeJ, NOD and 129 belong; both IL-21 and pre (intronic) IL-2 mRNA were highly expressed (Figure 3.18). Interestingly, all strains of this second ‘NOD-like’ group contained an identical IL- 21 promoter Sp1 site to NOD (Table 3.2). We also identified that IL-21 decay was similar between all assessed strains. However, in the ‘NOD-like’ group, the equivalent exonic IL-2 mRNA level was accompanied by increased decay of IL-2 mRNA (Figure 3.19). It was unexpected to find that other strains behaved similar to NOD in terms of higher expression of both IL-21 and IL-2, with decreased IL-2 mRNA stability (schematically shown in Figure 3.20). Thus, the expression patterns of the putative susceptibility genes Il2 and Il21 were not unique to the NOD strain. The implication of this finding in terms of autoimmune prone status of these ‘NOD- like’ strains has not been investigated. Of the allele B group, only the 129 strain has been assessed in a congenic Idd3 NOD strain, and it was also found to be as equivalently susceptible to diabetes as NOD mice (Podolin et al., 2000).

83

Figure 3.18 Two distinct expression profiles occur for IL-2 and IL-21. Intronic (premRNA) and exonic (A) IL-21 mRNA and (B) IL-2 mRNA measured by allele specific pyrosequencing assay in CD3 and CD28 mAb stimulated splenocytes from CBA/B6, DBA/B6, DBA/BALB/c, C3HeJ/B6, 129/B6 and BALB/c/B6 mice, where n = 3-6 mice per group, two experiments. *** p < 0.0001

Table 3.2 Putative Sp1 site in IL-21 distal promoter correlates with Idd3 ‘B’ Allele

Strain Nucleotide sequence analysed by pyrosequencing Idd3 Allele

C57BL/6 ACCCTTAC A

BALB/c ACCCTTAC A

DBA GCCCCTAC B

CBA GCCCCTAC B

NOD GCCCCTAC B

C3HeJ GCCCCTAC B

129 GCCCCTAC B Putative Sp1 site in IL-21 distal promoter correlates with Idd3 ‘B’ Allele

84

Figure 3.19 IL-2 mRNA stability occurs as two profiles in extended strain analyses Decay of (A) exonic IL-21 mRNA and (B) exonic IL-2 mRNA from stimulated B6, BALB/c, DBA, CBA and NOD splenocytes treated with actinomycin D for the times indicated. Data shown as mean + SEM where n = 3-5 per group, two experiments.

Figure 3.20 A loss of uniformity between IL-2 and IL-21 alleles in the NOD mouse. Schematic diagrams showing transcription of (A) IL-2 and (B) IL-21 NOD and C57BL/6 alleles. NOD IL-2 and IL-21 alleles are transcribed more efficiently than C57BL/6 alleles. But for NOD IL-2, this advantage is lost due to poor mRNA stability.

3.2.7 Investigating central locus regulation within Idd3

As described in sections 3.2.2 and 3.2.4 there was equally strong initiation of IL-21 and IL-2 transcription in NOD mice. These results suggest that further investigation of a coordinate regulation of promoter activity is warranted. Not only is the syntenic unit of genes contained within Idd3 inherited as one allelic unit (Ikegami et al., 2003), but it is also orthologous with the human region on chromosome 4q27. Therefore, we initiated a bioinformatic analysis of a potential centralised locus regulation of Idd3 akin to the Il4 Il13 locus (Loots et al., 2000). Locus regulatory regions are typically >100bp in length, and showing >70% identity between mammals (Li et al., 1999). We used these criteria to assess Idd3. As shown in Appendix 2, there is extensive homology between the Idd3 region of mice and

85 humans. The conserved noncoding elements in the intergenic regions > 1kb from the known genes are indicated on the left by histogram per 1 kb interval. As a similar analysis of the Il4, Il13 and Il5 locus found, these noncoding elements mainly occurred in clusters (Loots et al., 2000). Interestingly, analysis of Idd3 revealed that of these 208 conserved noncoding sequences (CNSs) contained in the 650 kb region mapped to Idd3 (Yamanouchi et al., 2007), 73 where homologous with 4 or 5 other mammals (of 5 mammals aligned), and as annotated, 9 were >600 kb in length. Findings of this comparative genomic analysis, show that highly conserved CNSs independent of gene coding regions exist, and offer potential sites for a central locus control in Idd3. It is tempting to speculate that disruption of such a control region may also contribute to or explain the Idd3 effect in autoimmunity. Future studies, investigating the DNase I-hypersensitivity status of these sites would be appropriate to examine this hypothesis further. Particularly in light of previous studies, which have demonstrated that histone, acetylation is often colocalised within CNS (Roh et al., 2005).

86 3.3 Discussion

It has been established by a number of groups that IL-21 is necessary for the development of diabetes in the NOD mouse (Datta and Sarvetnick, 2008; Spolski et al., 2008; Sutherland et al., 2009). These studies rely on whole-body knockouts for IL-21R, which do not allow for consideration that the Idd3 effect on T1D may be a result of more than one gene. While a number of important studies have argued that a decreased expression of IL-2 explains the lower incidence of diabetes in NODB6.Idd3 mice (del Rio et al., 2008; Yamanouchi et al., 2007), our findings are the first to consider a role for both important immunoregulators in Idd3. While this thesis focused on the critical role IL-21 plays in T1D pathogenesis, it did not formally rule out a role for IL-2. On the contrary, we hypothesise that it is this uncoupled high expression of IL-21, and the consistent expression of IL-2, which may be important for tipping the balance towards pathogenesis. We performed a thorough analysis of intronic and exonic allelic expression of IL-21 and IL-2 by both pyrosequencing, utilising NOD. Idd3NOD/B6 mice, and real-time PCR. We found that the NOD allele was transcribed higher in both IL-21 and IL-2, but the greater initiation of transcription of Il2 was not sustained due to reduced mRNA stability (Figure 3.20). Intriguingly, we found that this pattern of IL-21 and IL-2 expression that we hypothesised was important in tipping the balance towards autoimmunity, was far from unique. Other common mouse strains carried this combination of IL-21 and IL- 2 alleles, so it would be intriguing to test their susceptibility to diabetes given the same context of MHC and other Idd regions.

This study importantly identified that the previously reported (King et al., 2004) high expression of IL-21 in the NOD mouse was, in part due to two SNPs that improved binding of the transcription factor Sp1 to the IL-21 promoter. It was interesting to find that another research group has studied Sp1 and its role in driving IL-21R expression (Wu et al., 2005). They found that TCR stimulated upregulation of IL-21R was driven by an increase in Sp1 protein levels with a corresponding decrease in Sp1 phosphorylation, which occurred after TCR stimulation (Wu et al., 2005).

87 A major point of discussion was our findings for NOD IL-2 allele expression. Whilst we found in section 3.2.4 that the NOD IL-2 allele dominated transcription, but was less stable, a previous study described a 50% reduction in the expression of the NOD IL-2 allele compared with the B6 allele (Yamanouchi et al., 2007). This disagreement in results may be due to our different experimental designs. Whilst we used the same pyrosequencing primer sets to assess IL-2 alleles, we decided to stimulate our cells in vitro with CD3 and CD28 mAb. This was in contrast to the analyses of mRNA in mice treated in vivo with CD3 mAb (Yamanouchi et al., 2007). There are several concerns raised from studying cells from mice injected with CD3 mAbs including the demonstration that anti-CD3 in vivo kills T cells and thymocytes (Hirsch et al., 1989; Sabapathy et al., 1999; Smith et al., 1989; Webb and Sprent, 1987) and has the potential to rapidly influence the migration of T cells. The relative effects of this antibody treatment on activated versus naïve T cells (Croft et al., 1994; Iezzi et al., 1998) suggests that recovered cells may not be representative of the original population. One advantage of the in vitro stimulation of cells is that it is a closed and contained system. As such the cells assessed for mRNA levels at T = 0 are the same population subjected to analysis at later time points, without concern for migration of cells, in or out of the analysis. Clearly, in vitro stimulation is not always representative to what happens in vivo, and this may be one of the shortcomings of our experimental approach. While CD3/TCR signalling mimics T cell actvation by antigen (Meuer et al., 1983), in vitro antibody concentrations may reflect higher than physiological levels of antigen exposure.

Other differences in experimental approach can also be observed in the way we analyse IL-2 protein expression. The previous study chose to measure IL-2 protein by ELISA from cultured TCR transgenic CD8+ T cells (Yamanouchi et al., 2007), a specific population that unlike CD4+ T cells, do not have the capacity to also express IL-21. As such, if there was interplay of both cytokines this may not be addressed by observing a CD8+ TCR transgenic T cell population alone. We performed similar analysis in WT NOD mice, and were able to confirm this finding. By taking advantage of the observed expansion of MP CD8+ T cells upon administering the IL-2 mAb clone S4B6, we aimed to detect IL-2 in the NOD and NODB6.Idd3 mice in vivo. As predicted from a greater infiltration of mononuclear cells

88 within the NOD pancreas, there was also a greater number of IL-2 producing T cells and a greater number of IL-2R expressing T cells that utilise IL-2, which may explain the similar amounts of bioavailable IL-2 in the islet lesion of the two strains.

An extension of studies from this chapter should endeavour to understand the mechanism behind the difference in IL-2 mRNA stability between NOD-like and B6- like strains. Appropriate analyses would address the potential for sequence variations in the IL-2 gene to alter mRNA stability. While these can occur throughout the coding and non-coding regions of a gene, the 3’UTR is particularly prevalent in this capacity (Chen et al., 2006). An analysis of microRNAs interactions with both the NOD and B6 IL-2 allelic transcripts would also be appropriate, as microRNAs can bind 3’UTR and are capable of inducing gene silencing. As most microRNA genes are found in intergenic regions in close proximity to the target genes, analysis of Idd3 for potential microRNA transcripts may show strain sequence differences, which may equate to differences in binding and/or silencing capacity.

89 4 IL-21 producing CD4+ T cells in the lesions of the pancreas and salivary gland are marked by co- expression of CCR9

4.1 Introduction

The NOD mouse has been a valuable tool to investigate the pathogenesis of T1D, offering the ability to analyse immunological events that occur during the progressive stages of spontaneous autoimmune disease. In NOD mice, as in humans, inappropriately activated immune cells destroy the insulin-producing β-cells in the pancreas. In general terms, the islet infiltration begins at 4-6 weeks-of-age as a mild inflammation around the islets (peri-insulitis) and progresses to intraislet invasiveness (insulitis) over the next 2-3 months, resulting in clinical T1D (Bach and Mathis, 1997; Green and Flavell, 1999).

The autoimmune inflammation around and within the pancreatic islets can sometimes resemble organised structures, displaying features of lymphoid neogenesis (Jansen et al., 1993; Kendall et al., 2007; Ludewig et al., 1998; Luzina et al., 2001). The combination of cytotoxic T cell activation, together with the development of these pancreatic lymphoid structures, has been proposed to play a major role in the development of destructive autoimmunity (Ludewig et al., 1998). The ordered arrangement of ectopic lymphoid tissue is realised through a network of chemoattractants, that is, expression of homing chemokines (Hjelmstrom, 2001).

The expression of tissue-specific adhesion and chemoattractant receptors facilitate the movement of effector and memory T cells through peripheral tissues (Kunkel et al., 2003). Indeed, a link between T1D and the gastrointestinal immune system has been proposed, as pancreatic islet infiltrating lymphocytes have been found to express mucosal homing receptors (Paronen et al., 1997; Savilahti et al., 1999). CD4+ T cells activated in intestinal lymph nodes acquire the expression of the G protein-coupled chemokine receptor 9 (CCR9) (Papadakis et al., 2000), and can also induce alpha 4 beta 7 (α4β7) integrin expression (Campbell and Butcher, 2002).

90 Upon acquisition of these markers, the cells instructionally migrate towards the chemokine receptor ligands, which for CCR9 is CCL25 (TECK), expressed highly in the gut lamina propria (Calabrese et al., 2009; Wurbel et al., 2000). Interestingly, circulating autoreactive T cells from patients with T1D have been shown to express α4β7-integrin (Paronen et al., 1997), and similarly in NOD mice, a considerable proportion of islet-infiltrating lymphocytes express α4β7-integrin (Yang et al., 1997). In analogous studies, prevention of diabetes has been achieved in NOD mice and dampening of in vitro autoimmune responses in human T1D patients, by blockade of α4β7 or its ligand, the mucosal addressin cell adhesion molecule (MadCAM-1) (Hanninen et al., 1998; Paronen et al., 1997). As yet, no studies analysing the expression of CCR9 on islet infiltrating lymphocytes in T1D has been conducted.

IL-21 is an important immunomodulating cytokine that has been shown to influence the development of several gastrointestinal inflammatory and autoimmune diseases (Caruso et al., 2009; Datta and Sarvetnick, 2008; Fina et al., 2008; Spolski et al., 2008). A role for IL-21 in providing costimulation during lymphocyte activation has been described, and as such, IL-21 is capable of influencing the survival, proliferation and attainment of effector function of lymphocytes (Leonard et al., 2008; Zeng et al., 2007). However, despite the profound effect of IL-21 on autoimmune disease pathogenesis, it remains to be determined how IL-21 mediates the pathogenesis of autoimmune disease. T helper (Th) cells are known to be important in T1D through the production of cytokines, which may facilitate the maintenance of the islet infiltrate and also contribute to β-cell death either directly or by acting on CD8+ T cells, which are capable of destroying islet β-cells (Wong et al., 2008). In chapter 3 we explored the expression of IL-21 compared to IL-2, in relation to diabetes susceptibility. The presence of high levels of IL-21 in NOD mice would suggest that it plays an important role in T1D (King et al., 2004; McGuire et al., 2009).

In this chapter we aimed to characterise the IL-21 expressing cells in the pancreatic lesion, and determine whether they contribute to autoimmunity in the NOD mouse. We observed a clear correlation with cell surface expression of CCR9 and IL-21 production in CD4+ T cells that infiltrate the NOD pancreas and salivary

91 glands. We made use of the surface expression of CCR9 to isolate the IL-21 producing subset and subsequently examined the phenotype and function of these cells in relation to other defined T helper subsets. Our results highlight the intricate role IL-21 plays in maintaining the immune cell inflammation in the NOD pancreas, and demonstrate that IL-21 acts directly on CD8+ T cells to cause diabetes.

For this study we have drawn on what is known of normal chemokine interactions within a functional humoral immune response, and propose a role for these interactions in the autoimmune process of the NOD mice. Multiple chemokine networks are critical for chronic inflammation (Aloisi and Pujol-Borrell, 2006; Hjelmstrom, 2001). We question whether tissue-specific homing of IL-21-producing CD4+ T helper cells may play a role in the regional specification of organ-specific autoimmunity.

92 4.2 Results

4.2.1 An abundance of IL-21 producing cells in NOD mice

As examined in Chapter 3, IL-21 production in NOD CD4+ T cells was elevated compared to NODB6.Idd3 mice. Firstly we wanted to examine whether a particular subset of CD4+ T cells was responsible for producing IL-21. As shown in Figure 4.1, we sorted both naïve (CD44lo) and memory (CD44hi) CD4+ T cells. We assessed both thymic and splenic naïve CD4+ T cells, in order to determine IL-21 production following activation of naïve CD4+ T cells in vitro. We found that both naive CD4+ T cell populations could produce IL-21 when cultured with CD3 and CD28 mAb in vitro, and in each case the NOD subset produced more than the comparable NODB6.Idd3 subset (Figure 4.1A and B). However, by far, the highest producing subset was the NOD ICOS+ CD44hi CD4+ T cells (Figure 4.1B). It is known that ICOS is upregulated on CD4+ T cells following activation and provides a critical costimulatory signal for T helper (Th) cell differentiation (Dong et al., 2001; Tafuri et al., 2001). From this study we found that NOD ICOS+ CD44hi CD4+ T cells produced the greatest amounts of IL-21 following stimulation in vitro.

Figure 4.1 Increased production of IL-21 in NOD CD4+ T cell subsets IL-21 protein from NOD and NODB6.Idd3 (A) spleen and thymus derived naïve (CD44lo) CD4+ T cells and (B) splenic memory (CD44hi), ICOS- and ICOS+, CD4+ T cells after 4 days in vitro stimulation with CD3 and CD28 mAb. Measured by ELISA and presented as mean + SEM, n = 6 mice per group from two experiments.

To characterise further the IL-21 producing cells in the NOD mouse, we established a protocol to detect intracellular staining of IL-21 by flow cytometric analysis. In order to conclude with confidence that the antibody was specifically detecting IL-21, we compared our staining to that of cells incapable of producing IL-

93 21, from Il21-/- mice (Figure 4.2A). We measured the IL-21 expressing CD4+ T cells in the pancreas, and secondary lymphoid organs over the course of disease in the NOD mouse (Figure 4.2B-K). We found that the IL-21 expressing cells were significantly higher in both cell number (Figure 4.2C, E, G, I and K) and percentage of CD4+ T cells in each organ (Figure 4.3A-C) of NOD mice compared to the congenic NODB6.Idd3 strain. In accordance with the data in Figure 4.1, which examined the IL-21 production from sorted CD4+ T cell subsets, we could demonstrate using flow cytometric analysis that the main producers of IL-21 were the CD44hi CD4+ T cell population. Furthermore, by measuring the mean fluorescence intensity (MFI) of the IL-21 staining in the IL-21+ cells we observed an increased expression of IL-21 ‘per cell’ (Figure 4.3D-G), which supported the mRNA studies conducted in chapter 3.

Figure 4.2 Increased number of IL-21+ T cells in NOD mice (A) Representative flow cytometric plots of Il21-/- CD4+ T cells in spleen and pancreatic lymph node providing negative control for IL-21 intracellular immunostaining. IL-21 expression by NOD and NODB6.Idd3 CD4+ T cells in pancreas, pancreatic lymph node, spleen, mesenteric lymph node and blood, shown as representative intracellular flow cytometric analyses (B, D, F, H and J, respectively) and absolute number of CD4+ T cells at ages shown (C, E, G, and I) and (K) percentage of CD4+ T cells in blood, where n=16-22 mice per group from eight experiments.

94

Figure 4.3 Increased percentage and expression of IL-21 in NOD mice Percent IL-21+ CD4+ T cells measured in (A) spleen, (B) pancreatic lymph node and (C) pancreas of age matched NOD and NODB6.Idd3 mice by intracellular flow cytometric analyses, where n = 14-20 mice per group from six experiments. Mean fluorescence intensity (mfi) of IL- 21+ cells in (D) spleen, (E) pancreatic lymph node, (F) blood and (G) pancreas of 8 week old NOD and NODB6.Idd3 mice, measured by intracellular flow cytometric analyses, n = 12-18, representative from five experiments.

4.2.2 Characterisation of IL-21+ T helper subsets in the islet lesion

By analysing the IL-21 producing CD4+ T cell subsets throughout the course of disease in NOD mice, it became evident that the IL-21+ CD4+ T cells constituted a considerable fraction of the CD4+ T cell population that was infiltrating the pancreas (Figure 4.3C). It is possible that this population is playing a role in the disease process, especially as the fraction of IL-21+ cells increased with age as the mice progressed towards diabetes.

In our initial characterisation of IL-21-producing T helper (Th) cells in the pancreas infiltrate, we examined the expression of surface markers that distinguished activated/memory from naïve phenotype cells and chemokine receptors that signified homing potential. Specifically, we examined the expression of the for the G protein- coupled chemokine receptor 9 (CCR9), which on memory phenotype T cells is largely restricted to the lymphoid organs that drain the gastrointestinal tract (Mora et al., 2003; Papadakis et al., 2003). To our surprise, co-expression of CCR9 was evident with the pancreas infiltrating IL-21+ CD4+ T cells (Figure 4.4A), with approximately 50% of these cells also expressing the integrin α4β7 (Figure 4.4B),

95 another indicator of gastrointestinal origin (Campbell and Butcher, 2002). Expression of the ligand for CCR9, namely CCL25, has been predominantly observed in the thymus and small intestine (Calabrese et al., 2009; Wurbel et al., 2000). Studies have shown that CD4+ Th cells primed by intestinal lymph node DCs selectively acquire responsiveness to the ligand for CCR9 (Papadakis et al., 2000) (Elgueta et al., 2008). As such, the co-expression of CCR9 suggested that IL-21- producing Th cells in the pancreas originated from the small intestinal mucosa and/or have the potential to home to tissues that express CCL25 (TECK).

To put the co-expression of CCR9 and IL-21 in the NOD pancreas infiltrating CD4+ T cells into context, we surveyed co-expression of CCR9 and IL-21 in a range of lymphoid organs in both NOD mice, and strains not susceptible to diabetes, B6 and NODB6.Idd3 mice (Figure 4.4C and D). This analysis showed that the co- expression was highest in the NOD pancreas, with significant co-expression also evident in the NOD and NODB6.Idd3 salivary glands and NODB6.Idd3 pancreas. The presence of CCR9-expressing IL-21+ Th cells in the salivary glands was interesting for two reasons; first, it is another accessory organ of the digestive system and second, the salivary glands are a site of inflammation in the NOD mice, which are also prone to a Sjögren’s syndrome-like disease (Brayer et al., 2000; Humphreys- Beher and Peck, 1999). Importantly, we also showed that gating the CCR9 and IL-21 double positive population as a percentage of CD4+ T cells, NOD mice have significantly more of these cells than NODB6.Idd3 mice in sites of disease inflammation, the pancreatic lymph node, pancreas and salivary gland (Figure 4.4E). This is line with our analysis in Figure 4.2, which may suggest that it is the IL-21 producing CD4+ T cells that express CCR9 that are preferentially expanded in NOD mice in comparison to NODB6.Idd3 mice at sites of inflammation. CCR9+ IL-21- producing CD4+ T cells were evident across all lymphoid organs (Figure 4.4C), particularly in the mucosal lymph nodes and spleen, with a small population present in the blood. In each case, the CCR9+ population were found in the CD44hi (memory) CD4+ T cell population (Figure 4.4C). Interestingly, the IL-21-producing CCR9+ T (Tccr9) cells evident in the NOD pancreas displayed all the hallmarks of a CD4+ Th effector memory population, in regards to high expression of CD44, and loss of CD62L, CCR7 and CD27 expression (Table 4.1) This was in comparison to

96 the mesenteric and pancreatic lymph nodes which conversely displayed a predominately CD4+ Th central memory phenotype, with a preference towards expression of CD62L, CCR7 and CD27 (Table 4.1). This observation was consistent with the current literature regarding effector memory Th cells, which accumulate at non-lymphoid sites, losing expression of CCR7 (Sallusto et al., 1999). Additionally, CD27 has been described in CD8+ T cells to mark a long-lived memory population (Dolfi et al., 2008; Hendriks et al., 2000), with the same relationship proposed for CD4+ T cells (Pepper et al., 2010).

Figure 4.4 CCR9 marks IL-21 expressing cells in the NOD pancreas Representative dot plots of (A) CCR9 and IL-21 expression and (B) IL-21 and α4β7 expression by CD4+ T cells in NOD pancreas and (C) representative dot plots of CCR9 and IL-21 expression, and CD44 and CCR9 expression in NOD salivary gland, mesenteric lymph node, pancreatic lymph node, spleen and blood. Quantification of (D) IL-21+ CD4+ T cells co- expressing CCR9 in tissues shown of 9-week-old NOD mice, and (E) CD4+ T cells expressing both IL-21 and CCR9 in tissues shown of 9-week-old NOD mice, collated from four experiments, where n = 6– 15 per group. CD4+ T cells not detectable (ND) in B6 salivary gland and pancreas.

97 Table 4.1 Phenotypic analysis of CCR9+ CD4+ T cells Mesenteric Lymph Node Pancreatic Lymph Node Pancreas % CCR7+ 74.4 70.2 36.5 + SEM +1.7 +3.3 +3.5 % CD27+ 53.4 12.7 Not assessed + SEM +3.0 +2.5 % CD62L+ 58.0 66.9 7.4 + SEM +1.4 +5.2 +0.16 Quantification of marker+ as a percentage of CCR9+ CD44hi CD4+ T cells, where n = 5-8 from four experiments.

Taken together, this data demonstrated that while Tccr9 cells were distributed throughout the immune system in mice, they were enriched in the inflamed pancreas and salivary glands (Figure 4.4D). Both the pancreas and salivary glands are accessory organs to the gut, and it is interesting that these are also the specific sites of autoimmune inflammation in the NOD mouse. In accordance with surface marker expression, the pancreatic Tccr9 population had an effector memory phenotype.

As an extension of this study, we determined whether Tccr9 cells were also found in humans. To address this question, we stained CD4+ T cells extracted from human tonsil tissue, and peripheral blood for CCR9. CCR9 expression could be readily detected on CD4+ T cells in humans (Figure 4.5A). In addition to healthy control blood samples, sourced from the Australian Red Cross Blood Service, we had access to blood samples from patients with the autoimmune disease that affects the salivary glands, namely Sjögren's syndrome. An analysis of these patient samples for CCR9 expression on CD4+ T cells revealed a striking elevation in the proportion of CCR9+ CD4+ T cells in peripheral blood of most Sjögren's syndrome patients (Figure 4.5B). Importantly, the elevated population of CCR9+ cells were memory CD4+ T cells, marked by loss of CD45RA expression (Figure 4.5C), and did not simply reflect either a difference in the percentage of CD4+ T cells (Figure 4.5D) or memory CD4+ T cells (Figure 4.5E). Indeed, samples from the Sjögren's syndrome patient cohort appeared to fall into two groups, those with a similar level of circulating Tccr9 cells to control samples, and those with a higher proportion of circulating Tccr9 cells. However, while there were trends, the patients with a higher proportion of circulating Tccr9 cells failed to show any significant differences in

98 clinical or laboratory parameters in comparison to those with normal levels. In addition, there was no relationship between the proportion of circulating Tccr9 cells and CXCR5+ TFH cells in a subset of patients in which both parameters were measured (David Fulcher, personal communication, data not shown). Beyond the scope of this thesis, studies will continue to examine the role of CCR9 in human autoimmune disease. For example, it will be fascinating to determine whether an increase in CCR9+ CD4+ T cells can also be demonstrated in human patients with T1D and whether CCR9 could be used as a biomarker for disease progression in both T1D patients and patients with Sjögren's syndrome.

Figure 4.5 CCR9 expression by humans CD4+ T cells is elevated in Sjögren's syndrome patients (A) Representative dot plots of CCR9 expression in human tonsil and peripheral blood. Flow cytometric analyses of blood from healthy individuals (normal) and Sjögren's syndrome patients showing (B) CCR9+ cells as a percentage of CD4+ T cells, (C) CCR9+ CD45RA- cells as a percentage of CD4+ T cells, (D) CD4+ T cells as a percentage of peripheral blood mononuclear cells (PBMCs) and (E) CD45RA+ cells as a percentage of CD4+ T cells, where n = 9 for controls, and n = 15 for Sjögren's syndrome patients.

99 In conclusion, we found a marker of gut priming, CCR9, was co-expressed on NOD pancreas and salivary gland infiltrating IL-21+ CD4+ T cells. As this observation was made with flow cytometric analysis of a cell surface marker, it offered the opportunity to utilise live cell sorting on this marker to characterise this subset further by both in vivo and in vitro analysis.

4.2.3 CCR9+ CD4+ T cells migrate towards CCL25

Expression of the ligand for CCR9, CCL25 in mouse pancreas has been previously reported (Kutlu et al., 2009), although this was only at the level of transcription. It has been well characterised for its expression, of both transcript and protein, in both the thymus and small intestine (Calabrese et al., 2009; Hosoe et al., 2004; Wurbel et al., 2000). We next determined whether CCL25 could be found in the pancreatic islets. To do this, we extracted pancreatic islets, and compared the expression of CCL25 protein by western blot to both rCCL25 and homogenised tissue from the small intestine, as has previously been shown positive for CCL25 expression (Hosoe et al., 2004). As shown in Figure 4.6A, CCL25 expression could be demonstrated in both the small intestine and pancreatic islets of NOD mice. As indicated by the loading control, β−actin, the expression level of CCL25 whilst clearly present in the islets, was at a considerably lower level than that observed in the small intestine (Figure 4.6A). Whether this was due to a lower level of expression per cell, or a smaller subset of cells expressing CCL25, remains to be determined.

To assess the chemotactic capacity of CCR9+ CD4+ T cells towards CCL25, we first tested whether cells from both the pancreatic lymph node and pancreas infiltrate were capable of migrating towards CCL25. We found that in both cases chemotaxis was observed, above the chemotactic index value of 1, which indicates background migration (Figure 4.6B). This finding was consistent with a previous study, which showed a similar index using lamina propria lymphocytes (LPLs) (Hosoe et al., 2004). The chemotaxis assay calculated the number of cells capable of migrating across a membrane towards rCCL25 and to test the specificity of this migration, we pre-incubated the lower chamber, containing rCCL25, with an antibody that blocks CCL25:CCR9 interactions. As shown in Figure 4.6B, this significantly abolished the chemotactic response. In order to evaluate whether it was

100 the CCR9+ CD4+ T cells that were capable of migrating towards rCCL25, we assessed the population of migrated cells for expression of CCR9. We found, in comparison to the total starting population of cells, that the pancreatic lymph node and pancreatic infiltrating cells capable of migrating towards rCCL25 were enriched for CCR9 expression (Figure 4.6C and D). These results demonstrated that the Tccr9 cells from the pancreatic lesion and pancreatic lymph nodes were functionally capable of migrating towards their ligand, CCL25. Furthermore, because expression of CCL25 protein could be demonstrated in the pancreatic islets, the observed migration may be physiologically relevant.

Figure 4.6 CCR9+ CD4+ T cells migrate towards CCL25 (A) Representative western blot showing CCL25 expression in small intestine and pancreatic islets, compared to rCCL25. Blot is representative of three experiments. (B) Chemotactic index calculated for cells isolated from pancreatic lymph nodes and pancreas. Calculated as the number of cells migrated across 3 μm membrane towards rCCL25 (10 μg/ml), in the presence or absence of CCL25 Ab (4 μg/ml) over background migration. Representative dot plots of the total and migrated (C) pancreatic lymph node cells and (D) pancreatic cells in the migration assay described in (B), where n = 5-6, from two experiments.

In order to directly assess the physiological relevance of these findings, we tested the Tccr9/CCL25 interaction in vivo. We hypothesised that if the ability of Tccr9 cells to migrate towards CCL25 was important to the localisation of this subset of cells to the NOD pancreas, then blocking this interaction should reduce the number of Tccr9 cells in the NOD pancreas. To test this, we sorted Tccr9 cells from NOD pancreas and pancreatic lymph nodes. Tccr9 cells were CFSE labelled and transferred into NOD mice with or without administration of CCL25 blocking

101 antibody (40 μg in total). As shown in Figure 4.7, a significant reduction was observed in the recovered CFSE-labelled Tccr9 cells in the mesenteric lymph node and pancreas. By contrast, no reduction was evident in the spleen or pancreatic lymph nodes. However, we did not examine migration to the small intestinal lamina propria (LP), which should have the highest expression of CCL25. In summary, the Tccr9 cells found to infiltrate the NOD pancreas had the capacity to migrate towards CCL25, but CCR9 expression was not absolutely necessary for their migration to this site. Our in vivo study shown in Figure 4.7 would indicate that this plays an active role in their localisation to the pancreatic islets.

Figure 4.7 CCL25 blockade stops migration of CCR9+ T cells in vivo Numeration of recovered CFSE labelled CCR9+ CD4+ T cells in spleen, mesenteric lymph node (MLN), pancreatic lymph node (PLN) and pancreas, on day 7, after transfer into CCL25 Ab treated NOD mice (10 μg on day 0, 2, 4 and 6) where n = 5 per group, from two experiments.

4.2.4 CCR9+ IL-21 producing Th cells exhibit a restricted cytokine profile

In section 4.2.2 we found that pancreatic IL-21 producing CD4+ T cells also expressed CCR9 (Figure 4.4). In order to examine the nature of Tccr9 cells we determined their cytokine expression profile. A panel of inflammatory cytokines with a described role in autoimmune disease pathogenesis were examined (Korn et al., 2007b; Mikuls and Weaver, 2003; Schoenborn and Wilson, 2007; You et al., 2008). In order to assess this panel of cytokines, cells were either examined directly ex vivo as for IL-21 or stimulated for 4 hours in vitro with PMA and ionomycin in the presence of protein transport inhibitor, golgi plug, to examine intracellular cytokines by flow cytometry and FACs analysis. As shown in Figure 4.8A-D, IFNγ -

102 producing and IL-17-producing CD44hi CD4+ T cells were prominent in the islet lesion, but were restricted to the CCR9- population (Figure 4.8A and B). It was conceivable that expression of CCR9 may be modulated in this period of time and under mitogenic stimulation. To address this concern, we first sorted CD4+ CCR9+ cells, from the pancreas and mesenteric lymph nodes prior to in vitro stimulation for cytokine analysis. As shown in Figure 4.8E, Tccr9 cells sorted from the pancreas did not co-express TNFα or IL-17. In contrast, CCR9+ Th cells from the mesenteric lymph nodes produced both TNFα and IL-17, indicating a greater degree of heterogeneity in this population (Figure 4.8E). Considering these results together, it was apparent that the cytokine profile of pancreas infiltrating Tccr9 cells was largely restricted to IL-21 expression.

Figure 4.8 Pancreatic CCR9+ Th cells show a limited cytokine profile IFNγ and CCR9 expression, and TNFα and CCR9 expression by CD44hi CD4+ T cells in pancreatic lymph node (PLN) and pancreas, shown as (A) representative dot plots and (B) quantification of CCR9+ as a percentage of cytokine+ CD44hi CD4+ T cells, where n = 5 from three experiments. IL-4 and CCR9 expression, and IL-17 and CCR9 expression by CD44hi CD4+ T cells in PLN and pancreas, shown (C) as representative dot plots and (D) quantification of CCR9+ as a percentage of cytokine+ CD44hi CD4+ T cells, where n = 5 from three experiments. (E) CCR9+ CD44hi CD4+ T cells sorted from mesenteric lymph node and pancreas, stained with TNFα and IL-17, representative of three experiments.

103 Both CD4+ T cells and NK T cells can produce IL-21 (Coquet et al., 2007; Parrish-Novak et al., 2000). NKT cells appear to play important roles in immunoregulation (Godfrey et al., 2000) and dysfunction and/or diminished frequency of NKT cells is correlated with the development of autoimmunity in both humans and rodents (Baxter et al., 1997; Iwakoshi et al., 1999; Wilson et al., 1998). Therefore, we needed to confirm that Tccr9 cells in NOD mice were not NKT cells. To do this, we utilised a mouse CD1d tetramer loaded with α-GalCer, which has been shown to specifically immunostain NKT cells (Coquet et al., 2008a). First, we found that the NKT cell population described as tetramer+ TCRβ+, were present at a low frequency in the NOD pancreatic lymph node (Figure 4.9). Furthermore, we could not find any significant co-staining of these cells with CCR9 expression. Conversely, using our usual gating strategy for CD4+ T cells, CD4+ TCRβ+, no significant co-expression of CCR9 and tetramer could be demonstrated (Figure 4.9). These data indicate that that the population of CCR9+ T cells examined in the pancreatic lymph node were not NKT cells. Interestingly, NOD mice have a deficiency in NKT cells, both in the thymus and in the periphery (Godfrey et al., 1997; Gombert et al., 1996; Poulton et al., 2001). A specific decline in pancreatic islet infiltrating NKT cells (Naumov et al., 2001) meant an analysis of this subset at an age comparable to our CCR9 studies (9-12 weeks) was technically challenging, which was consistent with previous findings (Falcone et al., 2004; Sharif et al., 2001).

104

Figure 4.9 CCR9+ Th cells are not NKT cells Representative dot plots of α-GalCer/CD1d tetramer and TCRβ expression in NOD spleen and pancreatic lymph node, and CD4 and TCRβ expression in NOD pancreatic lymph node. Pancreatic lymph node NKT cells (tetramer+ TCRβ+), and CD4+ T cells (CD4+ TCRβ+) were divided further in expression of CCR9 against both tetramer, and CD4, with n = 5.

4.2.5 CCR9+ IL-21 producing Th cells exhibit a TFH-like phenotype In section 4.2.4 we showed that pancreas infiltrating Tccr9 cells demonstrated a largely restricted cytokine profile, that is, high expression of IL-21 and no other inflammatory cytokine examined. Tccr9 cells did not produce the Th1 cytokines IFNγ or TNFα, the Th2 cytokine IL-4 or the Th17 cytokine IL-17. Therefore, Tccr9 cells could not be decisively assigned to any known Th lineage. To characterise Tccr9 cells further, we directed our attention toward transcription factors that control cytokine gene expression to establish lineage-specific transcriptional programmes during Th cell differentiation (Ivanov et al., 2006; Pai et al., 2004; Zhou et al., 2009). The CCR9 expression on CD44hi CD4+ T cells allowed us to purify both Tccr9 cells and CCR9- CD44hi CD4+ T cells from NOD pancreatic lymph nodes and pancreas infiltrates by cell sorting. CCR9+ and CCR9- Th cells were compared with naïve, CD44lo CD4+ T cells and, as positive controls, Th subsets differentiated in vitro, as described previously (Nurieva et al., 2009), and TFH cells (PD-1+ CXCR5+) purified from SBRC immunised NOD mice by cell sorting. Analyses of the transcription factors expressed by Tccr9 cells from the pancreas revealed expression of Tbet, with

105 a lack of Gata3, at both the level of transcription (Figure 4.10A and B) and protein by western blot (Figure 4.10C). A similar profile was seen with the more heterogenous CCR9+ CD44hi CD4+ T cell population from the pancreatic lymph node (Figure 4.10A-C). T-bet expression has been reported in a number of Th subsets including TFH cells (Fazilleau et al., 2009), but is typically associated with

Th1 cells (Szabo et al., 2000). However, despite their expression of T-bet, Tccr9 cells were not Th1 cells since they failed to produce IFN-γ (Figure 4.8A, B and E). The lack of Gata3 expression was consistent with the lack of IL-4 expression (Figure

4.8C-E). In addition, insignificant levels of the Th17 cell specific transcription factor, RORγT (Ivanov et al., 2006) transcript was present on the Tccr9 cells (Figure 4.10D), which was also consistent with the lack of IL-17 expression (Figure 4.8C-E).

Interestingly, the TFH cell associated transcription factors cMaf (Bauquet et al., 2009) and Bcl6 (Johnston et al., 2009; Linterman et al., 2009; Nurieva et al., 2009) were found in abundance in Tccr9 cells from the pancreas, with levels that exceeded that of the TFH control sample (Figure 4.10E and F). Taken together, Tccr9 cells exhibited a transcription factor phenotype that most closely resembled TFH cells (King, 2009; Linterman and Vinuesa, 2010; Vinuesa et al., 2005b) or the more recently described extrafollicular Th cells (Odegard et al., 2008).

We extended our RT-PCR analysis to human tonsillar tissue CCR9 expressing memory CD4+ T cells. This analysis revealed that CCR9+ memory CD4+ T cells had superior expression of both Bcl6 and IL-21, compared to CCR9- memory CD4+ T cells and naïve CD4+ T cells (Figure 4.11A and B). This was consistent with our murine analysis, of a propensity for CCR9+ Th cells to resemble

TFH cells.

106

Figure 4.10 Transcription factor analysis of Tccr9 cells Real-time PCR analysis of transcription factors (A) Tbet and (B) Gata3 in CCR9+ CD44 hi CD4+ T cells, sorted from pancreas and pancreatic lymph node, shown relative to sorted naïve CD44lo hi CD4+ T cells, CD44 CCR9- CD4+ T cells, and Th1 or Th2 polarised cells, n = 6 from three experiments. (C) Tbet and Gata3 protein expression from sorted CD44hi, CCR9+ and CCR9- CD4+ T cells from pancreas and pancreatic lymph node, after 3 days in vitro stimulation with lo CD3 mAb and CD28 mAb (Th0), compared with lymph node derived naïve CD44 CD4+ T cells, stimulated under Th polarising conditions. Blots are representative of three experiments. Real-time PCR analysis of (D) RORγT, (E) cMaf and (F) Bcl6 in CCR9+ CD44hi CD4+ T cells, sorted from pancreas and pancreatic lymph node, shown relative to sorted naïve CD44lo CD4+ T hi cells, CCR9- CD44 CD4+ T cells and Th17 polarised cells or T follicular helper T cells (TFH) from day 7 sheep red blood cell immunised NOD mice, n = 5-6 from three experiments. Where multiple significances were found, p values were indicated as * = 0.01 to 0.05, ** = 0.001 to 0.01, and *** < 0.001.

107

Figure 4.11 RT-PCR analysis of human Tccr9 cells Real-time PCR analysis of (A) Bcl6 and (B) IL-21 in human CCR9+ CD45RA- CD4+ T cells, sorted from tonsil, in a representative experiment.

Since the analyses of transcription factors revealed a strongly TFH-like phenotype, we examined additional surface molecules known to distinguish TFH cells from other Th subsets (Deenick et al., 2010; Johnston et al., 2009; King et al., 2008). Specifically, we examined SAP in the pancreas and pancreatic lymph node derived CCR9+ CD44hi CD4+ T cells, CXCR5 and PD-1 in the pancreas and lymphoid organs, and ICOS, BTLA and CD200 expression on pancreas and pancreatic lymph node derived CCR9+ CD44hi CD4+ T cells.

These analyses revealed that SAP was expressed poorly on pancreatic Tccr9 cells compared with TFH cells (Figure 4.12A). This finding suggested that Tccr9 cells might not be as effective as TFH cells in their capacity to maintain long-term interactions with B cells (Qi et al., 2008). In comparison to CCR9- CD44hi CD4+ T cells, no particular enrichment for CXCR5 or PD-1 expression, was observed in the pancreas-derived CCR9+ samples (Figure 4.12B and C), indicating that these pancreas-located cells were not TFH cells. By contrast, CXCR5 expression was found on 15 and 30 percent of CCR9+ cells from the peyer’s patches and salivary gland, respectively. PD-1 expression was higher on Tccr9 cells from the salivary gland than pancreas (Figure 4.12B and C), which might reflect the distinct microenvironments. Interestingly, when we sorted CXCR5+ and CXCR5- CCR9+ CD44hi CD4+ T cells from the peyer’s patches we could demonstrate that the CXCR5 expression correlated with a greater expression of SAP transcript (Figure 4.12D). Additionally, we found there was no enrichment for BTLA or CD200 in pancreas-derived Tccr9 cells, while ICOS expression, a general activation marker of Th cells (Dong et al., 2001; Tafuri et al., 2001) was significantly higher (Figure 4.12E).

108

Whilst CXCR5 is acknowledged as a signature marker for TFH cells; it also transiently expressed on CD4+ T cells during activation (Ansel et al., 1999). As a site of on going antigenic stimulus from the intestinal tract, this may explain why we see an overall greater level of CXCR5 expression on CD44hi CD4+ T cells in the peyer’s patches. However, the higher levels of SAP and PD-1 also observed in this

CCR9+ population suggest that they are TFH cells. It remains to be understood why CCR9+ T cells in the peyers patches have higher levels of CXCR5, SAP and PD-1 than Tccr9 cells in the pancreas, but may reflect factors in microenvironment of a lymphoid organ versus the pancreas. In addition, it is possible that these two populations are related and future studies of epigenetic modifications in TFH- associated genes within both these populations may help to resolve this intriguing issue.

Figure 4.12 Phenotyping of Tccr9 cells for markers of TFH cells (A) Real-time PCR analysis of SAP in CCR9+ CD44hi CD4+ T cells, sorted from pancreas (pan) and pancreatic lymph node (PLN), shown relative to sorted naïve CD44lo CD4+ T cells, CCR9- hi CD44 CD4+ T cells and T follicular helper T cells (TFH) from day 7 sheep red blood cell immunised NOD mice, n = 5-6 from three experiments, with p values indicated as * = 0.01 to 0.05, ** = 0.001 to 0.01, and *** < 0.001. (B) Quantification of CXCR5 and CCR9 expression, and (C) PD-1 and CCR9 expression by CD44hi CD4+ T cells in splenocytes, mesenteric lymph node cells, small intestine intraepithelial lymphocytes and lamina propria lymphocytes, peyer’s patches cells, salivary gland infiltrating lymphocytes and pancreas infiltrating lymphocytes. Data shown as mean + SEM, where n = 5-8 from two experiments. (D) Real-time PCR analysis of hi SAP in CCR9+ CD44 CD4+ T cells, either CXCR5+ or CXCR5, and shown compared to TFH cells, as in (A), with n = 4-6. (E) CCR9 expression, with TFH associated markers; ICOS, BTLA and CD200, shown as quantification of markers by CD44hi CD4+ T cells in pancreas, where n = 4-6 from two experiments.

109 This analysis of TFH associated cell surface markers might suggest that pancreatic Tccr9 cells are a distinct subset from TFH cells. We hypothesised that the separation of these two subsets may be due to the autoimmune setting we were assessing. We therefore determined whether pancreas derived Tccr9 cells could be

‘pushed’ to a TFH phenotype, or conversely, whether TFH cells had the propensity to express CCR9. To initially assess this, we administered a polyvalent antigen, sheep red blood cells (SRBCs) to NOD mice, and analysed expression of CXCR5, PD-1 and CCR9 on CD44hi CD4+ T cells. As shown in Figure 4.13A following immunisation, TFH cells were generated in NOD mice and CXCR5 and PD-1 expression was increased on the CCR9- CD44hi CD4+ T cell subset, but not the Tccr9 cells, in both the pancreas and lymphoid organs assessed. A caveat to this study may have been in our choice of immunising antigen. Future studies may be warranted to determine whether a similar outcome occurred if we immunised with a diabetes relevant self-antigen, such as pro-insulin.

Additionally, we used in vitro stimulation conditions, which have previously been described to upregulate CCR9 expression (Elgueta et al., 2008), and those that polarise CD4+ T cells into TFH (Nurieva et al., 2008) in order to explore the potential plasticity of the TFH cells and Tccr9 cells (Wei et al., 2009). Naïve CD4+ T cells were FACs sorted from NOD mice and TFH cells (PD-1+ CXCR5+) were FACs sorted from day 7 SRBC immunised NOD mice, and cultured in the presence of DCs from the mesenteric lymph node. Whilst both CD4+ T cell subsets were capable of upregulating CCR9, the TFH cells did this to a significantly lesser extent (Figure 4.13B). We also cultured FACs sorted Tccr9 cells, and compared them to naïve and

CCR9- Th cells under TFH-inducing conditions (Nurieva et al., 2008). Even given this in vitro permissive condition, Tccr9 cells did not upregulate CXCR5 expression, in comparison to both naïve and CCR9- Th cells (Figure 4.13C). In conclusion, pancreas derived Tccr9 cells were characterised by cytokine profile that was largely restricted to IL-21, high ICOS expression, high Bcl6 expression, low SAP and PD-1 expression and an absence of CXCR5 expression.

110

hi Figure 4.13 Potential to modulate TFH and CCR9+ CD44 CD4+ T cells (A) Quantification of PD-1+CXCR5+, CXCR5+CCR9+, CXCR5+CCR9-, PD-1+CCR9+, PD- 1+CCR9-, CXCR5-CCR9+ and PD-1-CCR9+ expression as a percentage of CD44hi CD4+ T cells in untreated and SRBC immunised NOD mice. Measured in spleen, mesenteric lymph node, pancreatic lymph node and pancreas on day 7 after immunisation, where n = 7, from two experiments. (B) Percentage of CCR9+ cells from naïve (CD44lo) and CXCR5+PD-1+CD44hi CD4+ T cells from D7 SRBC immunised NOD mice, after in vitro stimulation with mesenteric lymph node derived dendritic cells and SRBC. Data shown as MFI increase above stimulation in the absence of dendritic cells (no-DC cultures), where n = 5, from two experiments. (C) MFI of CXCR5 expression from naïve (CD44lo), CCR9- and CCR9+ CD44hi CD4+ T cells, after in vitro stimulation under TFH polarising conditions. Data shown as MFI increase above stimulation in the absence of TFH polarising conditions (Th0), where n = 6, from of two experiments.

Despite our analyses revealing a lack of correlation between cell surface markers and SAP expression known to be associated with TFH cells, Tccr9 cells were

111 Th cells that expressed high levels of IL-21 and ICOS and could thus provide help to B cells. In order to test this, we FACs sorted Tccr9 cells from the pancreas, as well as CD44hi ICOShi (CCR9-) CD4+ T cells, which are thought to be the precursor B helper T cells (Rasheed et al., 2006), and naïve CD44lo CD4+ T cells from the spleen. The comparative ability of these T cell populations to support the production of antibody from B cells, that had been purified from both the spleen and pancreas, was determined after 4 days of co-culture in vitro, and compared to a positive control of CD40 mAb stimulation. As shown in Figure 4.14, both the pancreatic Tccr9 cells and splenic ICOShi (CCR9-) CD4+ T cells were equally capable of supporting the production of total IgG, particularly isotypes IgG1 and IgG2c, when compared to naïve CD4+ T cells. This was independent of the source of B cells. The production of IgM was also supported by both Th cell subsets, but all isotypes were produced a low levels relative to CD40 ligand stimulation (Figure 4.14). This analysis showed that in in vitro co-culture conditions, pancreatic Tccr9 cells were capable of supporting B cell antibody production. However, whether this was happening in a physiological setting requires confirmation. Importantly, in contrast to TFH cells (Schaerli et al., 2000), Tccr9 cells did not display a superior capacity to support antibody production.

112

Figure 4.14 Tccr9 cells are competent at helping B cells to produce antibody IgM, IgG, IgG1 and IgG2c production from sorted splenic B220+ or pancreatic B220+ CD44lo B cells cultured with plate bound CD3 mAb and soluble CD28 mAb and equal numbers of splenic naïve CD44lo CD4+ T cells (naïve), splenic CCR9- ICOS+ CD44hi CD4+ T cells (CCR9-) and pancreatic CCR9+ CD44hi CD4+ T cells (CCR9+), or CD40 mAb. Antibody isotypes measured in the supernatant by ELISA at day 4, with data presented as mean + SEM, n = 5-7 from two experiments.

4.2.6 CCR9+ CD4+ T cells preferentially form B cell conjugates

A recent study used flow cytometry to describe the detection of stable interactions between T and B cells, named “T-B conjugates” (Reinhardt et al., 2009). Importantly, cross talk between B and T cells has been shown to contribute to acquisition of cytokine competency of T cells (Cunningham et al., 2002; Toellner et al., 1998). In an immune response, these stable T-B conjugates have been shown to facilitate B cell help, modulating B cell responses such as somatic hypermutation and antibody isotype class switching (Reinhardt et al., 2009). Since these conjugates can facilitate help both in cytokine production of the T cells, and reciprocal help to the B cells, we wanted to examine whether we could detect conjugates in an autoimmune response. To assess this, we performed flow cytometric analysis using a standard protocol with the exception of a deliberate omission of EDTA from the buffers used to prepare our samples. This was to ensure conjugated cells were not disrupted during the sample preparation process. Additionally, in our analysis of data, we omitted specifically gating ‘single cells’, as determined using Forward-height versus Forward-

113 area plots. As shown in Figure 4.15 we could readily demonstrate CD4+ T cell and B cell (B220+) conjugates in NOD pancreatic lymph node and pancreas. Subsequent gating on either the CD4+ B220- population (CD4+ singlets) or the CD4+ B220+ doublets population revealed that in both the pancreatic lymph node and pancreas, the doublet population was enriched for expression of CCR9 (Figure 4.15A and B). As this gating strategy incorporated, by definition, the inclusion of B cells in the doublet gate, we could not discount that the CCR9 was expressed on the B cells. To address this specifically, we purified the CD4+ B220+ doublets by cell sorting then subsequently disrupted the conjugates with EDTA and vigorous vortexing allowing single CD4+ and single B220+ populations to be analysed by flow cytometry for expression of CCR9. As shown in Figure 4.15C, we found that the CCR9 expression was in fact limited to the CD4+ T cells. Taken together, Tccr9 cells were associated with B cells in both the pancreatic lymph node and pancreas.

Figure 4.15 CCR9+ CD4+ T cells interact with B cells Representative flow cytometric plots of CD4 and B220 expression when gated on CD4+ T cells in (A) pancreatic lymph node and (B) pancreas, following sample preparation using EDTA-free buffers. Each gated population is further analysed for CCR9 expression. (C) Pancreatic lymph node CD4+ T cells as shown in (A) were sorted on CD4+ B220+ doublets and subsequently disrupted with EDTA containing buffer. Each population is further analysed for CCR9 expression.

From our studies outlined in chapter 3 and in section 4.2.1 we showed that expression of IL-21, and number of IL-21+ CD4+ T cells was reduced in NODB6.Idd3

114 mice. These mice exhibit a markedly reduced form of insulitis and have a dramatic reduction in disease incidence (Lyons et al., 2000; Wicker et al., 1994). When we performed the same CD4+ B220+ conjugate analysis on NODB6.Idd3 mice we found a notable reduction in conjugate frequency in the pancreatic infiltrate, consistent with the reduction in both insulitis and IL-21 expression (Figure 4.16A). Interestingly, we also observed a significantly lower proportion of pancreas infiltrating CD8+ T cells in NODB6.Idd3 mice (Figure 4.16B). We hypothesised that if NODB6.Idd3 mice were reconstituted with pancreatic IL-21-producing Tccr9 cells from NOD mice, this could favour both the formation of conjugates, and greater immune cell infiltrate. We transferred CCR9+ and CCR9- CC44hi CD4+ T cells into NODB6.Idd3 mice and analysed the pancreatic infiltrate 16 days later. As shown in Figure 4.16A, transfer of NOD Tccr9 cells resulted in an increase in doublets. Interestingly, we found that the transfer of Tccr9 cells also increased the proportion of CD8+ T cells in the NODB6.Idd3 mice (Figure 4.16B). This finding suggested that the IL-21 expressing Tccr9 cells in the NOD pancreatic infiltrate play an important role in supporting inflammation in the pancreas.

Figure 4.16 Transfer of CCR9+ Th cells can rescue NODB6.Idd3 defects in T and B conjugates and CD8+ T cells 5 x 105 CCR9+ and CCR9- CD44hi CD4+ T cells sorted from pancreatic lymph nodes and pancreas were transferred into NODB6.Idd3 mice. Pancreatic lymph nodes and pancreas from NOD (black bars), NODB6.Idd3 (white bars) and NODB6.Idd3 recipients of CCR9+ cells (bars of grey shades) were analysed on day 16 for (A) CD4+ B220+ doublets and (B) CD8+ T cells, shown as numeration. Data are shown as mean + SEM, where n = 6-8 from three experiments.

The observed enrichment of CCR9 expressing cells within T-B conjugates (Figure 4.15) may reflect the reciprocal interaction between CD4+ T and B cells.

Indeed, as a lack of TFH cell surface markers may suggest, Tccr9 cells might not play

115 a critical role in delivering B cell help, but B cells may be importantly required to help CD4+ T cells. In support of this notion, both the pancreas and lymphoid organs of autoimmune NOD mice revealed few germinal centre B cells (described as PNA+ IgDlo) (Figure 4.14A). We wanted to explore the potential role of B cells, in fostering the expression of IL-21 in CD4+ T cells. We therefore determined whether expression of IL-21 by CD4+ T cells was dependent on B cells by analysing IL-21 production in NOD mice that have been made genetically deficient in B cells (μMT NOD). Both IL-21 mRNA and IL-21 protein production were significantly reduced in B cell-deficient NOD mice (Figure 4.17B and C). This finding is in line with results shown in our laboratory and by others that B cells can provide ICOSL that interacts with ICOS on CD4+ T cells to enhance IL-21 production or that B cells are important for the differentiation of IL-21-producing Th cells (Bauquet et al., 2009; Vogelzang et al., 2008). These findings would suggest that B cells in the pancreatic islet lesion might ensure the high production of IL-21 from Tccr9 cells in situ. Interestingly, these findings of reduced IL-21 production in the absence of B cell help may contribute to our understanding of the well-documented protection of μMT NOD mice from T1D (Serreze et al., 1996).

Figure 4.17 Optimal IL-21 production requires help from B cells (A) Quantification of germinal centre B cells (PNA+ IgDlo) within 12-16-week-old NOD spleen, mesenteric lymph node, pancreatic lymph node and pancreas, shown relative to spleen samples from day 7 sheep red blood cell immunized 129 mice, where n = 6-13 from four experiments. (B) IL-21 mRNA expression measured in of age-matched WT NOD and μMT NOD splenocytes stimulated for 4 hours with CD3 and CD28 mAb, n = 4. (C) Splenocytes and pancreatic lymph node cells from WT NOD, WT NOD mice depleted of B cells (WT(-B)) and μMT NOD were cultured for 2 days with CD3 and CD28 mAb. Data is presented as corrected IL-21 production per equivalent CD4+ T cells numbers as determined by FACS analysis, n = 4.

116 4.2.7 CD8+ T cells are the downstream target for IL-21 in T1D

It has been shown by a number of studies published during the course of this thesis, that IL-21R deficient NOD mice are protected from disease (Datta and Sarvetnick, 2008; Spolski et al., 2008; Sutherland et al., 2009). We back-crossed IL- 21 deficient mice onto the NOD background to perform a similar analysis and found the same result - that IL-21 is necessary to cause both immune cell infiltration of the pancreas, insulitis and diabetes in NOD mice (Figure 4.18A and B). However, the role of IL-21 in the development of diabetes remained unknown.

NOD/Scid mice are identical to NOD mice, except that they have impaired development of T and B cells due to a point mutation introducing a premature stop codon in the Prkdc gene, encoding the protein kinase, DNA activated, catalytic polypeptide, resulting in an inability to carry out V(D)J recombination (Araki et al., 1997; Blunt et al., 1996). As such, they are protected from disease. Previous studies demonstrate that adoptive transfer of T1D from NOD mice into NOD/scid mice requires both CD4+ and CD8+ T cells (Bendelac et al., 1988; Christianson et al., 1993; Phillips et al., 2009). Importantly, this adoptive T cell transfer of diabetes does not require B cell help (Bendelac et al., 1988). To establish the use of this model, we wanted firstly to determine whether IL-21 was necessary in this particular model of diabetes. Indeed, as shown in Figure 4.18C, when transfer of wild-type (WT) CD8+ T cells were paired with WT CD4+ T cells 100% of NOD/Scid recipients became diabetic by 10 weeks following transfer. By contrast, NOD/Scid recipients of Il21-/- CD4+ T cells plus WT CD8+ T cells did not develop diabetes. This result showed that IL-21 production from CD4+ T cells was crucial for the transfer of diabetes.

We next determined which T cell subset needed to respond to IL-21 for the development of diabetes. As a CD8+ T cell specific IL-21R knockout was not available in order to assess this, we examined this question using a transfer model of T1D. As shown in Figure 4.18D, IL-21 receptor expression on CD8+ T cells was critical for diabetes development. In contrast, Il21r-/- CD8+ T cells failed to induce diabetes during the study period, whether combined with WT CD4+ T cells or Il21r-/- CD4+ T cells. The mechanism behind the reliance of CD8+ T cells on IL-21 in T1D warranted further examination, as outlined in the next section.

117

Figure 4.18 CD8+ T cell responsiveness to IL-21 is required to transfer disease in the NOD/Scid diabetes model (A) Sections from paraffin embedded pancreata were stained with hematoxylin and eosin to reveal mononuclear infiltrate in and around islets of 15 week old WT NOD and Il-21-/- NOD mice, with (B) cumulative incidence of diabetes in WT NOD and Il-21-/- NOD mice, where n = 12 mice per group. Cumulative incidence of diabetes in NOD/Scid mice transferred with (C) 5 x 6 -/- 6 10 WT NOD or Il21 NOD CD4+ T cells and 5 x 10 WT CD8+ T cells, where n = 6 per group and (D) 5 x 106 CD4+ T cells and 5 x 106 CD8+ T cell transfers with combinations of donors as shown in figure, from WT and Il21r-/- NOD mice, where n = 6-7 per group.

4.2.8 IL-21 promotes spontaneous expansion of CD8+ T cells

In section 4.2.6 we discovered that the reduced numbers of CD8+ T cells in the mild infiltrate of NODB6.Idd3 mice could be improved following the transfer of IL- 21 expressing pancreatic Tccr9 cells from NOD mice (Figure 4.16). In section 4.2.7 we demonstrated that CD8+ T cell receptiveness to IL-21 was critical for diabetes transfer. It is known that one of the important roles of IL-21 is to promote the survival and expansion of CD8+ T cells (Allard et al., 2007; Elsaesser et al., 2009; Frohlich et al., 2009; Kasaian et al., 2002; Liu et al., 2007; Yi et al., 2009). Therefore, in order to explore the influence of IL-21 on CD8+ T cells, we exploited the abundance of available IL-21 in Il21r-/- NOD mice. We hypothesised that if IL-21 was important for the survival of CD8+ T cells, then this might be reflected by an increased recovery of adoptively transferred cells in Il21r-/- relative to WT recipients.

118 CFSE-labelled WT CD8+ T cells were transferred into Il21r-/- mice, and recovered cells were examined 7 days later. As a comparison, we also transferred CD8+ T cells into WT NOD mice, and IL-21R deficient mice also deficient in IL-21 production, Il21-/- Il21r-/- NOD mice. As shown in Figure 4.19, CD8+ T cells transferred into WT NOD recipients showed a small amount of spontaneous proliferation. Remarkably, extensive proliferation of the transferred CD8+ T cells was observed in IL-21R deficient NOD mice (Figure 4.19A and B). We could conclude that this extensive proliferation in Il21r-/- mice was IL-21 dependent, because transfer of CD8+ T cells into Il21-/- Il21r-/- NOD mice failed to proliferate spontaneously (Figure 4.19A). We conducted these studies with both total CD8+ T cells, and with either naïve CD44lo or memory CD44hi CD8+ T cells, to address whether IL-21 was acting preferentially on either subset. While both subsets showed similar propensity to spontaneously proliferate in response to IL-21, it appeared as though the memory subset responded with more vigour, with a tendency to divide more, and demonstrating greater recovery of cells (Figure 4.19C and D). Another striking finding from this set of analyses was the expression of pro-survival marker, Bcl2 (Marsden and Strasser, 2003) on the recovered CFSE-labelled CD8+ T cells. We found that in both the divided peaks and the undivided CD8+ T cells, Bcl2 expression was higher in the Il21r-/- hosts (Figure 4.19E and F). This would suggest that the presence of excessive IL-21 fostered enhanced survival of the CD8+ T cells, independent of whether the cells commenced proliferation.

119

Figure 4.19 IL-21 promotes CD8+ T cell proliferation and survival Total NOD CD8+ T cells (10 x 106) transferred into WT NOD, Il21r-/- NOD, and Il21-/-Il21r-/- NOD mice shown as (A) representative histograms of CFSE dilution and (B) numeration of recovered transferred CD8+ T cells. CD44hi and CD44lo CD8+ T cells (2 x 106) transferred into WT NOD and Il21r-/- NOD mice shown as (C) representative histograms of CFSE dilution and (D) numeration of recovered transferred CD8+ T cells. (E) and (F) Bcl2 expression of transferred CD8+ T cells as shown in (A) and (C), with isotype control reference (grey filled histogram). Data are shown on day 7 after transfer, where n = 5-8, representative of four experiments.

4.2.9 Tccr9 cells help CD8+ T cells to cause rapid diabetes

In an effort to determine whether IL-21 production from Tccr9 cells in particular was important for diabetes, we conducted reconstitution studies of sub- lethally irradiated Il21r-/- NOD mice. Using Il21r-/- NOD mice as the hosts ensured that the only cells capable of responding to IL-21 were the transferred subsets. To test this, we transferred half a million of each CD8+ T cells with either pancreatic CCR9+ CD44hi CD4+ T cells, or CCR9- CD44hi CD4+ T cells purified by cell sorting, into Il21r-/- NOD mice. To determine whether IL-21 produced by Tccr9 cells was important, we used a reagent that neutralises IL-21, IL-21R/Fc, which will be extensively introduced and assessed as the content of chapter 5 of this thesis.

120 Two weeks after transfer we assessed the mice for signs of diabetes and salivary gland pathology. We found that mice that had not received cells, CD8+ T cells or CCR9+ Th cells alone, were free from mononuclear infiltration in both the pancreas, and submandibular salivary glands (Figure 4.20A and B). In comparison, the mice receiving both CD8+ T cells and CCR9+ Th cells had developed pancreatic insulitis and immune cell infiltration in the salivary glands, greater than levels seen in recipients of CD8+ T cells combined with CCR9- Th cells (Figure 4.20A and B). Most strikingly, the pancreatic infiltration and salivary gland inflammation in mice receiving CD8+ T cells and CCR9+ Th cells was absent in mice that also received the IL-21 neutralising treatment (Figure 4.20A and C). Although the insulitis recorded at this early stage after transfer was far from levels seen in diabetic mice, we could also demonstrate impaired glucose tolerance in recipients of CD8+ T cells and CCR9+ Th cells, as measured in a glucose tolerance test (Figure 4.20D). This commencement in loss of glucose tolerance was not demonstrated in the mice that also received the IL-21 neutralising treatment. This observation would suggest a critical reliance of CD8+ T cells on the presence of IL-21 producing CD4+ T cells, in the pathological process of T1D. As the insulitis scoring and glucose tolerance results would suggest, rapid development of diabetes occurred in 70% of the Il21r-/- NOD recipients of Tccr9 cells combined with CD8+ T cells by 8 weeks after transfer, this was in comparison with 0% of the Il21r-/- NOD recipients of CCR9(-)

TH cells and WT CD8+ T cells (Figure 4.20E). IL-21 was crucial in this process, as IL-21R/Fc treated recipients of Tccr9 cells combined with CD8+ T cells were protected from diabetes (Figure 4.20E). This avenue of study will be examined further in chapter 5.

121

Figure 4.20 Pancreatic and salivary gland pathology can be caused by CCR9+ CD4+ T cells, and interrupted by IL-21 neutralisation Il21r-/- mice received a combination of 5 x 105 CCR9+ or CCR9- CD44hi CD4+ T cells and CD8+ T cells on day 0, with or without IL-21R/Fc 10 μg/mouse every other day for 12 days. At two weeks after transfer (A) pancreas and salivary glands were assessed by histology, with insulin stained brown and arrows indicating mononuclear cell infiltration, with pancreas scored for insulitis (B and C), where n = 3-7, from two experiments. (D) Additionally, glucose tolerance tests were conducted, with p values indicated as * = 0.01 to 0.05, between CCR9+ + CD8+ T cells + IL-21R/Fc at 30 and 60 min. (E) Mice receiving transferred cells were also assessed for diabetes incidence, where n = 6 per group, from two experiments.

The results shown here highlight a critical relationship between CCR9 expression and IL-21 production in sustaining an autoimmune response in the pancreatic islets of NOD mice. We demonstrated that these cells interact with B cells, and our findings support the role of B cells in optimal IL-21 production from T helper cells. Furthermore, through direct interaction with CD8+ T cells, IL-21 promoted CD8+ T cell survival, which ultimately supported their critical role in the demise of insulin-producing islet β-cells.

122 4.3 Discussion

Studies in this chapter were designed to phenotype the IL-21 expressing cells in the NOD pancreatic inflammatory lesion. As examined in chapter 3, we found that NOD mice express high levels of IL-21, which we hypothesised may play a critical role in the progression of diabetes. In vitro stimulation of CD4+ T cell subsets confirmed our findings of chapter 3, in terms of IL-21 protein production, which was higher in NOD compared with NODB6.Idd3 CD4+ T cells. This study identified the main producers of IL-21 to be ICOS expressing CD44hi Th cells. Thus, it was apparent that not every CD4+ T cell had the same capacity to produce IL-21. As such, further characterisation of the CD4+ T cell subset most capable of producing IL-21 at high levels was warranted.

We uncovered a striking relationship between IL-21 and CCR9 expression in the pancreas infiltrating CD4+ T cells, and the salivary gland infiltrating CD4+ T cells. A marker of gastrointestinal priming, CCR9 expression implied that the priming of these CCR9+ Th cells originated in gut lymphoid tissue. Interestingly, previous publications support a necessity of mucosal homing in autoimmune diabetes at stages of both lymphoid priming and homing to the pancreas (Hanninen et al., 1998). Indeed, we established that not only was the ligand for CCR9, CCL25 evident in the pancreatic islets, but our results of both in vitro chemotaxis assay and in vivo transfer studies suggested that CCR9 expression was functional and capable of facilitating migration of Tccr9 cells into the pancreas. Future studies exploring the nature of CCL25 expression in the pancreas may prove interesting. Particularly, whether CCL25 expression is elevated as inflammation increases. There are grounds for this hypothesis, as induction of peripheral and mucosal vascular addressins on endothelium of inflamed islets in NOD mice has been shown (Hanninen et al., 1993).

Expression of cell surface markers indicated that these pancreatic Tccr9 cells might be short-lived effector memory cells. Effector memory cells have been described as being renewed from lymph node located central memory cells (Sallusto and Lanzavecchia, 2009). Importantly, far from being a murine specific phenomenon, CCR9+ memory CD4+ T cells could be demonstrated in both healthy, and at a higher proportion in Sjogren’s syndrome patients. This finding was in line

123 with our observed enrichment of CCR9+ IL-21 producing CD4+ T cells in the inflamed pancreas and salivary glands. Both diabetes and Sjogren’s syndrome are autoimmune inflammatory diseases of the accessory organs of the intestinal tract, the pancreas and salivary glands, respectively.

Flow cytometry and FACs analyses revealed that Tccr9 cells had the phenotypic characteristics of a central memory CD4+ T cell population and were not NKT cells. Assessing expression of inflammatory cytokines revealed that Tccr9 cells displayed a highly restricted cytokine profile. The restricted IL-21 profile led us to address whether this subset of pancreatic CCR9+ expressing CD44hi CD4+ T cells were distinct from TFH cells, in both mouse and human. While they shared characteristics in common, including Bcl6, cMaf, ICOS and IL-21 expression, they were clearly different in their expression of CXCR5, BTLA, SAP, PD-1 and CD200. Even under the most permissive conditions, we were unable to induce CXCR5 expression on CCR9+ T cells. Interestingly, the cell surface markers of TFH cells tend to be markers of CD4+ T cell activation (Ansel et al., 1999). Given the striking expression of IL-21 and ICOS, but lack of TFH associated cell surface markers, it was important that we assessed their functional relationship to TFH cells, in a B helper assay. Whilst this is an in vitro system, and results may not reflect the same conditions that occur in vivo, it did suggest that Tccr9 cells were only as capable as other non-CCR9 expressing Th cells at supporting antibody production by B cells. Additionally, we showed that Tccr9 cells were enriched in CD4+ T cell:B cell conjugates. However, while the observation that CD4+ T cells were stuck to B cells was interesting, it said little about the outcome of the interaction.

Given that germinal centre B cells were not prevalent in unimmunised autoimmune NOD mice, and that T1D is not an antibody mediated disease (Jaramillo et al., 1994), we tested the hypothesis that the CD4+ T cell:B cell conjugates may be occurring to ensure optimal IL-21 production. Indeed, when we tested B cell deficient NOD mice, μMT NOD mice, we found a reduction in IL-21 production. In this regard, it would be interesting to determine in future studies whether Tccr9 cells exhibit the same phenotypic characteristics (such as high Bcl6-expression) in μMT

124 NOD mice. However, since μMT NOD mice lack pancreatic infiltration, it would only be possible to compare Tccr9 cells from lymphoid organs.

An important finding from this chapter was that IL-21 producing CD4+ T cells supported an increased number of CD8+ T cells in the pancreatic infiltrate. When we transferred Tccr9 cells into NODB6.Idd3, we could recapitulate the level of CD8+ T cells seen in pancreatic infiltrate of the NOD mice. We further tested CD8+ T cells as the downstream targets for IL-21, finding firstly that IL-21 responsiveness was crucial for CD8+ T cells to cause diabetes in the NOD/Scid transfer model of diabetes. Whilst, this model of diabetes transfer does not require B cells (Bendelac et al., 1988), it is likely that IL-21-producing CD4+ T cells had already been generated in WT NOD mice. To appropriately test this theory, we hypothesise that transfer of μMT CD4+ T cells; with WT CD8+ T cells should result in a protracted transfer of diabetes, relative to WT CD4+ T cells and WT CD8+ T cells.

IL-21 showed both a role in supporting the proliferation of both naïve and memory CD8+ T cells with a more pronounced effect on the survival of memory CD8+ T cells. This finding was consistent with previous studies that demonstrated that IL-21 improved the viability and the recovered number of T cells stimulated in vitro (Ostiguy et al., 2007). They found that only naïve, and not memory CD4+ T cells behaved this way, but both naïve and memory CD8+ T cells were supported by IL-21 in this manner. Finally we showed, in an in vivo system utilising Il21r-/- NOD mice that through the direct response of CD8+ T cells to IL-21 produced by CCR9+ Th cells, islet β-cell and salivary gland directed pathogenicity could be demonstrated.

Findings from this chapter propose a role for CCR9 interactions in the autoimmune progression, in both pancreas and salivary glands of NOD mice. We would suggest that perturbations in the gut-homing network might be important for imparting organ specificity of the autoimmune attack in NOD mice. Indeed both the pancreas and salivary gland are accessory organs of the digestive system. There is extensive evidence for the role of CCR9+ T cells in inflammatory disorders of the intestinal tract, including Crohn’s disease (Apostolaki et al., 2008; Koenecke and Forster, 2009; Rivera-Nieves et al., 2006; Saruta et al., 2007). Findings of this

125 chapter suggest a fascinating link between B cells, CD4+ T cells and CD8+ T cells in T1D. Modulated by IL-21, and CCR9 expression, this subset of pancreatic Tccr9 cells were capable of driving the pathogenesis of T1D.

126 5 Interleukin-21: modulator of tolerance in autoimmunity and transplantation

5.1 Introduction

Type-1 diabetes (T1D) in humans is a chronic autoimmune disease leading to the destruction of the insulin-producing β-cells of the pancreatic islets. It is driven by both CD4+ and CD8+ T cells, with CD8+ T cells producing cytotoxic agents, such as perforin and granzyme B, that directly kill islet cells. In addition to defects in central tolerance (Kishimoto and Sprent, 2001), NOD mice show defects in peripheral tolerance of CD8+ T cells (Kreuwel et al., 2001). That is, instead of being deleted in the pancreatic lymph node, islet antigen specific CD8+ T cells survive, and migrate to the pancreas and contribute to β-cell death. This defect is linked to genetic loci Idd5 and Idd3 (Hamilton-Williams et al., 2009; Martinez et al., 2005), with the later containing the genes for both IL-2 and IL-21. It is of interest, in this regard, that both IL-2 and IL-21 influence the proliferation and survival of CD8+ T cells (Allard et al., 2007; Kamimura et al., 2004; Ku et al., 2000; Moroz et al., 2004; Ostiguy et al., 2007; Smith, 1988).

At the time of initiating this study, it was suggested that IL-21 might play an important role in the pathogenesis of T1D. Il21 is located in the strongest non-MHC linked locus, Idd3, and in the previous chapters we established a genetic basis for increased IL-21 expression in NOD mice and that IL-21 receptiveness by CD8+ T cells was critical for the transfer of T1D. However, the timing of IL-21’s influence and the translation of these findings into a pre-clinical therapeutic model had not been assessed. As presented in this chapter, we approached these research questions by neutralising IL-21 with a therapeutic reagent, IL-21R/Fc. By using a timed ablation of IL-21 we could determine whether clinical neutralisation of IL-21 in diabetes would be feasible. As presented in this chapter, this treatment was assessed in concert with islet transplantation.

Transplantation of pancreatic islets has the potential to cure T1D. Similar to T1D, rejection of an islet allograft, under normal circumstances (without

127 immunosuppression) is T cell dependent (Castano and Eisenbarth, 1990; Ricordi and Strom, 2004). Allografts are tissues transplanted between genetically non-identical members of the same species. As the grafted cells display different major histocompatibility complex (MHC) molecules, the recipient immune system will recognise this tissue as foreign and mount an immune response to reject the graft (Ricordi and Strom, 2004; Rothstein and Sayegh, 2003). The foreign MHC proteins on allograft cells are recognised by T cells (Cote et al., 2001) and acute rejection occurs within days. The mechanisms underlying allograft rejection remain an active area of research focus, but it is known that CD4+ T cells activate both macrophages and CD8+ T cells, leading to a cell mediated attack on graft parenchyma and endothelium (El-Sawy et al., 2004; Lafferty and Cunningham, 1975).

The role of IL-21 has not been directly assessed in allograft rejection, yet several lines of evidence suggest it may play a role. For example, while NOD mice are normally resistant to the induction of peripheral tolerance by costimulation blockade, NODB6.Idd3 mice, possessing a lower expression of IL-21 than NOD mice, are amenable to this technique (Mangada et al., 2009; Pearson et al., 2004). Furthermore, it has been shown recently that the pathogenesis of CD4+ T cell mediated graft-versus-host disease (GVHD) was greatly dependent on IL-21 signalling. While the studies vary in the detail of suggested mechanism, both groups reported a reduction in IFNγ expressing T cells (Bucher et al., 2009; Oh et al., 2010).

To directly address the role of IL-21 in allograft rejection we utilised a model of pancreatic islet transplantation. This is a relevant model to T1D as a potential cure and allowed us to investigate mechanisms of graft rejection, which have relevance to transplantation as a whole. Pancreatic islets are comprised of several cell types, including alpha cells, beta cells, delta cells, pp cells, and epsilon cells (Brissova et al., 2005; Elayat et al., 1995). Due to the presence of insulin producing beta cells, islets transplanted under the kidney capsule of a diabetic mouse will quickly normalise blood glucose levels (BGL). By contrast, a return to hyperglycaemia indicates that the graft has been rejected.

128 Results within this chapter demonstrate the important role IL-21 plays in both T1D and transplantation. A timed depletion of IL-21 delayed and decreased diabetes incidence in NOD mice. Furthermore, by combining with islet transplantation, mice already diabetic were restored to normoglycemia. Given this striking modulation of tolerance mediated by CD8+ T cells, this study examined further the role IL-21 plays in allogeneic islet transplantation. The results demonstrate that IL-21 has an important role in both the autoimmune destruction of islet tissue and in the rejection of islet allografts.

129 5.2 Results

5.2.1 Pancreatic islet lesion is chronically dependent on IL-21

In chapter 3 we showed that NOD mice express higher levels of IL-21, but the same amount of IL-2, than NODB6.Idd3 mice (McGuire et al., 2009). Considering the lack of insulitis and diabetes incidence in NOD mice made genetically deficient for IL-21R, it is evident that IL-21 plays a crucial role in the development of T1D in NOD mice (Datta and Sarvetnick, 2008; Spolski et al., 2008; Sutherland et al., 2009). Although whole-body knockout mice are important in deciphering a gene’s role in a disease, it does not allow you to specifically address at what time its action is necessary. In order to address this, we took a therapeutic approach to neutralise IL-21 by administering a chimeric protein IL-21R/Fc. The IL-21R/Fc chimera works by forming a ligand-receptor complex with IL-21 reducing its bioavailability. This reagent has been shown previously to neutralise the effect of rIL-21 on an IL-21 dependent cell line in vitro (Young et al., 2007), and to induce improvement in the pathology of mouse models of rheumatoid arthritis (RA) and lupus (Herber et al., 2007; Young et al., 2007).

The IL-21R/Fc protein was produced and purified in our laboratory. The IL- 21R/Fc construct design followed that which has been published previously (Herber et al., 2007; Young et al., 2007). Briefly, we cloned IL-21R from mouse cDNA and amplified with a GSGS linker, in combination with mIgG2a Fc. The mIgG2a Fc portion contained mutations to minimise Fc binding and complement fixation, in order to limit antibody-dependent cell-mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) (Duncan and Winter, 1988; Duncan et al., 1988). Another fusion protein using these same Fc mutations, demonstrated negligible binding to the high affinity FcγRI, and was incapable of mediating complement-dependent lysis of target cells (Steurer et al., 1995).

The IL-21R protein was fused with the Fc portion in order to extend the serum half-life of the IL-21 neutralising reagent. By binding to IgG Fc portions, the MHC class I-related receptor, neonatal Fc receptor (FcRn) maintains IgG in

130 circulation (Ghetie et al., 1996; Israel et al., 1996; Junghans and Anderson, 1996). In FcRn-deficient mice, the half-life of a typical IgG is reduced from about 6-8 days to 1 day, which is the usual half-life of serum proteins that are not freely filtered by the kidneys (Roopenian and Akilesh, 2007). Mammalian CHO cells were used for IL- 21R/Fc production, in order to achieve glycosylation of the fusion protein. Following transfection, we selected the highest producing clones, thereby ensuring large quantities produced for experimentation. We used protein A affinity columns to purify the fusion protein, and confirmed negligible levels of endotoxin, making the IL-21R/Fc suitable for in vivo experiments.

It is known that infiltration of the NOD mouse pancreas occurs from about 4 weeks-of-age, whereby clinical diabetes manifests much later, from about 12- 14 weeks-of-age. We wanted to target two distinct time points in the diabetes disease process to address whether IL-21 was crucial early or whether it had a role in the transition to clinical diabetes. We administered 20 μg IL-21R/Fc to 7-week and 14- week-old mice over a period of two weeks and subsequently scored insulitis and diabetes incidence. Insulitis was scored by a standard assessment according to the degree of immune cell infiltration around individual islets. If the cellular infiltrate was peripheral to the islet, this was termed ‘peri-insulitis’. Once the infiltrate had invaded the islet, this was termed ‘insulitis’.

Interestingly, we found that the timing of IL-21 neutralisation was indeed important. As Figure 5.1A shows, in the 7-week-old group, one week after the end of the two-week treatment the islets were largely free from mononuclear cell infiltrate. However, this effect was not sustained, and by five weeks after the completion of treatment, mice treated with IL-21R/Fc exhibited peri-insulitis (Figure 5.1B). Despite this delay in insulitis, the immune system appeared to recover from this early IL-21 neutralisation, as diabetes incidence did not differ significantly from the control group (Figure 5.1C). However, treatment of NOD mice at 14 weeks-of-age yielded quite a different outcome. While we observed a similar reduction in insulitis one week after the completion of treatment, this result was much more striking as the age matched control mice exhibited severe insulitis in the majority of islets (Figure 5.1D). This result suggested that neutralising IL-21 was able to reverse insulitis

131 already present (Figure 5.1E). Furthermore, the same resolution of insulitis was evident whether IL-21 neutralisation was conducted with IL-21R/Fc or an IL-21 polyclonal antibody (Figure 5.1E), indicating that it was not an effect of using an Fc- reagent, and could be achieved with other IL-21 neutralising reagents. These treatments were conducted in comparison to a non-specific monoclonal Ig control (affinity purified, produced in house), in order to distinguish specific IL-21 neutralisation effects from antibody/Fc reagent effects. Importantly, neutralisation of IL-21 in the 14-week-old group also significantly delayed the onset of diabetes, with a reduction in diabetes incidence to 40%, compared with 90% of control mice (Figure 5.1F). These data demonstrate that ablation of IL-21 immediately prior to the onset of clinical diabetes yielded a sustained effect on the immune system. This suggested that IL-21 was important at a late pre-clinical stage.

132

Figure 5.1 IL-21 help is required to maintain pancreatic immune cell infiltrate Hematoxylin and eosin stained sections of paraffin embedded pancreata from NOD mice treated at 7-weeks-of-age with a total of 20 μg control antibody or IL-21R/Fc, given every other day for 11 days are shown at (A) 1 week after completion of treatment and (B) 5 weeks after completion of treatment, with (C) cumulative incidence of diabetes, where n = 7 mice/per group. Arrows indicate beginning and end of treatment period. (D) Sections from paraffin embedded pancreata from NOD mice treated at 14-weeks-of-age with a total of 20 μg control antibody or IL-21R/Fc, given every other day for 11 days are shown at 1 week after completion of treatment, with (E) insulitis indices from sections of pancreata showing the percent of islets exhibiting peri-insulitis or insulitis in 12-week and 17-week-old control mice, and 17-week-old mice treated with IL- 21R/Fc or IL-21 polyclonal antibody (1 week after completion of treatment) and 22-week-old mice treated with IL-21R/Fc (6 weeks after completion of treatment), n ≥ 220 islets from 10 mice per group. (F) Cumulative incidence of diabetes in NOD mice commencing treatment at 14 weeks of age, where n = 13 mice/per group. Arrows indicate beginning and end of treatment period.

Neutralisation of IL-21 had a greater effect on destructive insulitis than mild peri-insulitis. This raised the interesting possibility that IL-21 was influencing the B6.Idd3 transition of peri-insulitis to destructive insulitis. NOD mice contain the B6 allele and thus produce relatively less IL-21 than NOD mice and exhibit predominantly mild peri-insulitis (McGuire et al., 2009). To test whether the effects of IL-21 neutralisation were due to the over-production of IL-21 in the NOD mouse, B6.Idd3 we neutralised IL-21 in the NOD mouse. IL-21 neutralisation had little effect on

133 B6.Idd3 the mild form of peri-insulitis in NOD mice (Figure 5.2) indicating that it was the destructive inflammation in NOD mice that was more dependent upon IL-21.

Figure 5.2 IL-21R/Fc treatment shows minimal effect in NODB6.Idd3 mice Insulitis indices from sections of pancreata from IL-21R/Fc treated and control 14-week-old B6.Idd3 NOD mice 1 week after completion of treatment, n = 10 mice per group.

5.2.2 Neutralisation of IL-21 eliminates lymphocytes from the islet lesion

As described in section 5.2.1, neutralising IL-21 at a late preclinical stage appeared to reverse the severe insulitis seen in controls and markedly decreased diabetes incidence. We wanted to understand the mechanism behind the observed resolution of insulitis. Flow cytometric analyses of pancreas infiltrating lymphocytes allowed us to both numerate and phenotypically describe the populations of immune cells. By analysing the pancreatic infiltrate over the course of treatment, our aim was not only to identify infiltrating cells, but also to understand the sequence of events resulting from the neutralisation of IL-21 in 14 week-old mice. At an early time point (day 5 of treatment) there was an overall reduction in the lymphocyte infiltrate, with significantly less CD4+ and CD8+ T cells, and B cells (Figure 5.3A). Long after treatment was ceased (day 90 relative to start of treatment) there was a sustained reduction in CD8+ T cells and B cells, but not CD4+ T cells (Figure 5.3A). By contrast, the number of macrophages and dendritic cells were not altered when examined early in treatment (day 5) (Figure 5.3B).

134

Figure 5.3 IL-21 neutralisation reduces lymphocyte populations Absolute cell number of (A) CD4+ T cells, CD8+ T cells and B220+ cells in the pancreas measured by flow cytometry on days of treatment with IL-21R/Fc shown, and (B) CD11b+ CD11c- macrophages and CD11b+ CD11c+ dendritic cells in NOD pancreas, measured on day 5 of treatment with IL-21R/Fc. Data is presented as means + SEM, where n = 5–14 for each group, from four experiments.

As IL-21 neutralisation appeared to preferentially target lymphocytes, we wanted to examine whether there was a particular phenotype of the targeted cells. Given that IL-21 is a soluble costimulator of lymphocyte activation, as well as having a described role in lymphocyte proliferation, differentiation and survival (Leonard and Spolski, 2005; Parrish-Novak et al., 2000; Spolski and Leonard, 2008), we thought it would be pertinent to address the activation status of the pancreatic infiltrating lymphocytes following IL-21R/Fc treatment. To do this, we examined cell surface molecules (CD44 and CD69), which distinguish activated from naïve T cells. Whilst a role for B cells in T1D has been proposed (O'Neill et al., 2009; Wong et al., 2004), we focused on the T cell populations, as T1D is a T cell mediated disease (Castano and Eisenbarth, 1990). As shown in Table 5.1, following IL-21 neutralisation, the number of activated CD4+ and CD8+ T cells in the islet lesion were reduced. As an interesting parallel, this reduction in number of activated T cells in the pancreas was similar to the reduced fraction of activated T cells seen in the pancreas of NODB6.Idd3 mice compared to NOD mice (Figure 5.4).

135 Table 5.1 Activated lymphocytes following IL21R/Fc treatment

CD4+ T cells CD8+ T cells

CD69+ CD44+ CD69+ CD44+

% Number % Number % Number % Number

Control 22.1 37715 51.8 90100 24.8 23564 58.2 62250

(SEM) +1.1 +1916 +3.3 +5159 +1.7 +937 +4.1 +6029

Day 5 14.2 10682 41.2 30967 15.7 7879 45.6 19090

(SEM) +1.0 +800 +3.1 +2372 +1.6 +718 +4.7 +2934

Day 90 18.2 31000 51.8 88100 16.7 6709 47.7 19260

(SEM) +0.7 +1326 +8.2 +14061 +0.9 +465 +2.6 +6709

Percentage and absolute number of activated CD4+ and CD8+ T cell subsets in NOD pancreas, measured on day 5 and day 90 of treatment with IL-21R/Fc, where n = 5-9, from four experiments.

Figure 5.4 Reduced number of activated lymphocytes in NODB6.Idd3 mice Percentage of CD69+ (A) CD4+ and (B) CD8+ T cells measured in NOD and NODB6.Idd3 pancreas, where n = 3-10, from three experiments.

It is known that a number of T helper subsets, in addition to TFH cells (Linterman et al., 2010; Nurieva et al., 2008; Vogelzang et al., 2008) are dependent upon IL-21 for their generation and/or maintenance (Frohlich et al., 2007; Korn et al., 2007a; Nurieva et al., 2007). We wanted to address whether IL-21 neutralisation was affecting the presence of CD4+ T helper cells in the pancreatic infiltrate. Of particular interest were Th17 cells because it has been recently reported that IL-21 promotes the development of Th17 cells (Fantini et al., 2007; Korn et al., 2007a; Nurieva et al., 2007; Zhou et al., 2007). Additionally, Th17 cells have the potential

136 to be an important effector cell in T1D, as they support self-tissue destruction in a number of autoimmune models (Korn et al., 2007a).

We analysed the expression of IL-17, marking Th17 cells, by intracellular immunostaining. Whilst treatment with IL-21R/Fc revealed a significant reduction in IL-17 expressing CD4+ T cells, it was not to a greater degree than the overall reduction in activated CD4+ T cells (Table 5.1), and, therefore, did not suggest a specific effect on Th17 cells. Interestingly, we did not observe any modulation of the number of CD4+ Foxp3+ T regs in either the pancreatic lymph node or pancreas (Figure 5.5C and D). This indicated that the reversal of diabetes incidence with IL- 21R/Fc treatment was not due to an effect on Treg numbers.

Figure 5.5 IL-21 neutralisation modulates activated Th subsets but not T regs IL-17 expressing cells shown as (A) representative dot plots and (B) quantified in the pancreas of treated versus control mice on day 3 of treatment with IL-21R/Fc, as percentage of CD45+ cells, where n = 12 from five experiments. Absolute number of Foxp3+ CD25+ CD4+ T cells in (C) pancreatic lymph node on days of treatment with IL-21R/Fc shown, and in (D) pancreas on day 60 relative to start of treatment with IL-21R/Fc. Data is presented as means + SEM, where n = 5 from two experiments.

In chapter 4 we introduced a subset of IL-21 producing CD4+ T cells, which were found in the pancreas to coexpress CCR9, Tccr9 cells. We were interested to determine whether Tccr9 cells were modulated by IL-21 neutralisation. We have previously shown in immunisation protocols that IL-21 is important to drive the

137 generation and function of IL-21 producing TFH cells (Vogelzang et al., 2008). As such, we questioned whether this autocrine growth factor loop might also apply to our IL-21-producing Tccr9 cells. As shown in Figure 5.6A, when IL-21R/Fc treated NOD mice were examined on day 3 of treatment, there was a significant reduction in IL-21 expression as measured by real-time PCR. A similar reduction in protein levels was apparent when the percentage of CD4+ T cells producing IL-21 was examined by flow cytometry over the course of IL-21R/Fc treatment (Figure 5.6B). This decline in both mRNA and IL-21 producing cells was also evident in ‘non- progressors’, NOD mice that had not developed diabetes by 35-40-weeks-of-age when compared to control NOD mice (Figure 5.6A and B). In contrast, diabetic NOD mice showed an elevated percentage of IL-21+ CD4+ T cells in the pancreatic infiltrate when compared to control mice (Figure 5.6B). These results suggested that an autocrine negative feedback might offer an explanation as to why the relatively short neutralisation treatment regime could perpetuate a sustained effect. Given that the pancreatic infiltrate was dependent on IL-21, by depleting both circulating IL-21 and the cellular source of IL-21 the pancreatic infiltrate was not sustained.

Figure 5.6 Neutralising IL-21 has an effect on IL-21 production (A) IL-21 mRNA expression measured in pancreas of age-matched control and treated mice on day 3 of treatment with IL-21R/Fc, and NOD mice remaining diabetes free at 40 weeks, termed non-progressors, where n = 4–5 for each group, from two experiments. (B) IL-21 expressing cells shown as a percentage of CD4+ T cells, measured in pancreas of control mice and mice on days of treatment with IL-21R/Fc shown, also compared to NOD mice remaining diabetes free at 35 weeks, termed non-progressors, and diabetic NOD mice, aged 14-22 weeks, where n = 5–10 for each group, from four experiments.

Interestingly, measuring IL-21 transcript in secondary lymphoid organs, blood and the pancreas over the course of disease in the NOD mouse demonstrated that IL-21 was elevated compared with NODB6.Idd3 mice over the 18 weeks of our study period (Figure 5.7A-D). The increase in IL-21 in the blood and pancreas

138 corresponded with the age of heightened destruction of the islets and coincided with the onset of diabetes in our colony. Analyses of the increased expression of IL-21 mRNA in the blood demonstrated that high IL-21 expression was predictive of the subsequent development of clinical diabetes (Figure 5.7E).

Figure 5.7 IL-21 transcript can be used as a predictive marker (A) IL-21 mRNA measured by Real Time PCR in ex vivo splenocytes from NOD (n = 17) and NODB6.Idd3 (n = 12), in (B) pancreatic lymph node (n = 18 each genotype), (C) blood (n = 40 each genotype) and (D) pancreas (n = 16 each genotype) at ages shown. Data are presented as mean + SEM from 5-10 experiments. (E) IL-21 mRNA expression measured by real-time PCR in blood from 12 week old NOD and NODB6.Idd3 mice. The NOD cohort were monitored for diabetes onset until 40 weeks of age, and grouped into those that developed disease (progressor) or non- progressors.

While examining the fate of the modulated lymphocyte populations proved technically challenging, we did attempt to analyse whether there was an increased number of apoptotic cells by both flow cytometric Annexin-V staining and histology tunnel staining. There was a trend using both techniques towards an increase in apoptotic cells following IL-21R/Fc treatment (data not shown), but there was hesitation in drawing conclusions from these experiments. Firstly, it is well known that the clearance of apoptotic cells in vivo is a rapid process (Gregory and Devitt, 2004; Henson et al., 2001) and thus a true indication of the fraction of apoptotic cells may have been difficult to detect during the treatment regime. Secondly, the

139 enzymatic manipulation required to extract pancreatic-infiltrating lymphocytes may have influenced the viability of cells. As such, any readout of viability may be an accumulation of the enzymatic manipulation as well as any potential effect of the in vivo treatment.

5.2.3 Combination therapy with pancreatic islet transplantation

These data showed the merit of neutralising IL-21 during insulitis, prior to diabetes onset, resulting in a significant delay and reduction in disease incidence. However, to be of relevance to human patients with T1D, it would be beneficial to show that neutralising IL-21 could reverse diabetes. It is an unfortunate reality that unlike inbred strains of mice predisposed to become diabetic, one cannot predict with absolute certainty whether diabetes may develop in humans. A risk of diabetes susceptibility can be predicted by consideration of genetic factors such as MHC, with the human HLA-DQB1 allele demonstrating a particularly strong association with T1D predisposition (Nepom and Kwok, 1998). And as an early indicator of disease onset, autoantibodies to islet antigens are well documented (Wasserfall and Atkinson, 2006). However, these indicators do not consistently correlate (Atkinson and Eisenbarth, 2001). Therefore, translating our treatment schedule from pre- diabetic mice into humans at risk for T1D remains unlikely. A more realistic scenario would be to treat newly diabetic patients with a successful therapy that both addresses the autoimmunity and sustains the insulin levels required.

However, treatment of clinically diabetic NOD mice with IL-21R/Fc failed to reverse diabetes (Figure 5.8A). This may have reflected the fact that despite resolution of insulitis, the autoimmune attack that preceded IL-21 neutralisation would have already significantly depleted the β-cell mass that sustained insulin production. Given the slow rate of β-cell turnover and regeneration (Teta et al., 2005), it remained possible that an alternative source of insulin could be provided by transplanting pancreatic islets.

This next study investigated whether combining IL-21 neutralisation with pancreatic islet transplants would be a viable solution to treat diabetic mice. To examine this possibility, newly diabetic NOD mice (with two consecutive blood

140 glucose readings above 18 mmol/L) were treated with IL-21R/Fc (10 μg/IV) on days -1, 0 and every other day until day 12. Pancreatic islets from MHC-matched, lymphocyte deficient NOD/Scid mice were grafted under the kidney capsule of NOD mice (day 0). Three donor mice were used per recipient in order to transplant approximately 450 islets, a number which has been monitored for consistency between transplantation experimental cohorts. Blood glucose levels were monitored, with consecutive readings above 18 mmol/L indicative of graft destruction, and the recommencement of an autoimmune diabetic status. As shown in Figure 5.8B, in mice treated with IL-21R/Fc, destruction of the graft and subsequent diabetes status was delayed and reduced. The majority of treated mice maintained a stable normal range of BGL whilst undergoing treatment (Figure 5.8C) with 3/7 mice returning to hyperglycemia, compared to the entire untreated group with a MST of 16.1 days.

Figure 5.8 IL-21 neutralisation prolongs survival of autoimmune diabetic mice (A) Individual blood sugar readings are shown for a cohort of IL21R/Fc treated mice. (B) Percent diabetes-free NOD mice following syngeneic islet transplants with IL21R/Fc given. N = 10 for control NOD group, no treatment, MST 16.1 days. N = 7 for treated NOD group, of those 3 which returned to a diabetic state, MST was 31.1 days. (C) Individual blood sugar readings are shown for a cohort of untreated and IL21R/Fc treated transplant recipient mice. Treatment period is indicated on the graphs.

We were interested to address whether the graft was still necessary in long- term diabetes free IL-21R/Fc treated NOD mice, or whether the pancreas had recovered the ability to support the insulin requirements as has been shown previously (Chong et al., 2006; Ryu et al., 2001). We hypothesised that the surrogate source of insulin, the islet graft, was most important during the initial phase of IL- 21R/Fc treatment. However, once the clearance of pancreatic infiltrating immune cells was achieved with IL-21R/Fc treatment, it remained possible that the residual endogenous islets may have had time to recuperate in long-term survivors. We were able to test this hypothesis by removing the islet graft in long-term (100 days)

141 diabetes free IL-21R/Fc treated NOD mice and measuring the blood glucose. If the graft was still acting as the major insulin source we would have expected the blood glucose level to rise when the graft, and the accompanying kidney, were removed by nephrectomy. However, no considerable modulation of BGL was observed after the nephrectomy, and mice remained diabetes free for another 100 days. These data indicated that the remaining endogenous pancreatic islets in mice that had been clinically diabetic had regained functionality over the 100 days with the grafted islets and were subsequently capable of supporting the insulin requirements without the islet graft. In this regard, it is important to note that NOD mice deemed clinically diabetic by 2 consecutive BGL of 18 mmol/L do not spontaneously recover to normoglycemia nor do they recover with IL-21RFc treatment (as shown in Figure 5.8A). Therefore, both the islet graft plus IL-21RFc were required for the observed functional recovery of endogenous islets.

Histological analysis of islet grafts from IL-21R/Fc treated long-term survivors revealed healthy insulin producing grafts free from major immune cell infiltration (Figure 5.9A). Furthermore, the pancreas revealed islets that had immunostained for insulin and exhibited only mild peri-insulitis (Figure 5.9B). Despite the recovery of insulin production in the endogenous islets of long-term survivors, there was a noticeable reduction in the frequency of islet mass, enumerated in Figure 5.9C. This observation was consistent with the functional recovery of a significantly reduced β-cell mass in mice that were clinically diabetic.

Taken together, these findings show that IL-21R/Fc treatment was capable of inducing tolerance. Furthermore, these data demonstrate that combining islet transplantation (as a source of insulin) with specific immunomodulation of IL-21 delivered an effective cure to this model of T1D.

142

Figure 5.9 Histology of IL-21R/Fc treated syngeneic islet graft recipients show cleared infiltrate but reduced pancreatic islet mass Representative histological analyses of (A) a long-term surviving islet syngeneic graft from an IL-21R/Fc treated NOD mouse, with insulin staining in brown and (B) pancreas from the same mouse, an additional 100 days after graft removed, with insulin staining in brown. (C) Frequency of islet mass area in pancreas of long-term IL-21R/Fc treated NOD syngeneic graft recipients compared with 10-week-old non-immune B6, and pre-diabetic NOD mice. Enumerated from histological sections, with at least 50 fields scored per group.

5.2.4 Assessing the role of IL-21 in allograft survival

These exciting findings have potential application for human T1D patients, however this circumstance would have the additional challenge of allograft rejection, as, in humans, the HLA of the host and donor islet graft would not match. While there have been relative successes in applying islet transplantation in the clinic, a considerable challenge lies in the reliance of the graft recipient on life-long immunosuppression to avoid rejection (Stratta, 1999). Life-long immunosuppression puts the patient at risk of infectious and metabolic complications, malignancies, in addition to any drug-specific toxicity. Given this challenge, we thought it was appropriate to address the role of IL-21 in an islet allograft immune response. If we were able to show a pivotal role of IL-21 in this allograft system, perhaps clinical manipulation of IL-21 responsiveness could offer an alternative immunosuppressive therapy. That is, if a targeted manipulation of IL-21:IL-21R interactions was successful in abrogating allograft rejection, this may limit the broad-spectrum problems of immunosuppression.

To assess the influence of IL-21 on allograft survival a full mis-matched H-2d BALB/c islet allograft was transplanted into H-2b wild type (WT) C57BL/6 (B6) and

143 H-2b Il21r-/- B6 (N10) diabetic recipients. In this model of non-autoimmune diabetes, induction of diabetes was achieved by administering 180mg/kg of streptozotocin, a β-cell toxin. Mice were transplanted after two consecutive blood sugar readings above 18 mmol/L.

All B6 (H-2b) mice rejected their (H-2d) islet allograft with a MST of the graft found to be day 16.6 (n = 8). In comparison, 66% of Il21r-/- (H-2b) mice failed to acutely reject their H-2d islet allografts (Figure 5.10A). As indicated by the individual blood glucose readings (Figure 5.10B), the mice that survived long-term consistently maintained steady normoglycemic levels. This was important to note because stochastic blood glucose readings might suggest an effort by the immune system to reject the graft. Since this was not evident, it would suggest that the graft remained unchallenged by the immune system of the Il21r-/- mice.

Figure 5.10 Islet allografts exhibit prolonged survival in Il21r-/- mice (A) Percent islet graft survival in B6 and Il21r-/- mice following allogenic islet transplants (BALB/c donors). N = 8 for control NOD group, MST 16.6 days. N = 6 for Il21r-/- group. Of those 2 that had graft rejection, MST was 28.5 days. (B) Individual blood sugar readings are shown for a cohort of B6 and Il21r-/- mice.

To confirm that the islet allograft was responsible for the maintenance of euglycemia, the kidney bearing the islet allograft was removed at 100 days post- transplant. In all cases, euglycemia was promptly lost following nephrectomy (indicated by the arrow in Figure 5.11), proving that the islet allograft was functional and had been responsible for controlling blood sugars in these mice.

144

Figure 5.11 Il21r-/- mice exhibit prolonged stable blood glucose following contralateral kidney islet allograft. As indicated by the arrow, nephrectomies were performed on Il21r-/- mice, which survived long- term after receiving an islet allograft. After the removal of the engrafted kidney blood sugars sharply rose. On day 0 a subsequent islet allograft was transplanted on the contralateral kidney.

We next determined whether lacking IL-21 responsiveness and the subsequent failure of the immune system to reject the islet allograft could be explained by a problem in priming capacity. To test whether a secondary antigenic load would offer enough stimulation to overcome the necessity for IL-21:IL-21R interactions, we re-challenged nephrectomized mice with an additional H-2d BALB/c islet allograft on the remaining contralateral kidney. As shown in Figure 5.11 administering these secondary islet allografts stabilised the blood glucose levels to normoglycemia. Blood glucose monitoring showed that the graft remained unchallenged, surviving a further 100 days. This finding demonstrated that upon re- challenge, the immune system was incapable of responding to the graft, thus indicating that immunological tolerance had been achieved.

Histological analyses of the long-term surviving islet allografts in Il21r-/- mice revealed strong insulin production with mild mononuclear cell infiltrate peripheral to the graft (Figure 5.12A). In comparison, no insulin positive islets remained following islet allograft rejection in B6 mice, and in their place was extensive scar tissue (Figure 5.12B). Notably, the second graft on the contralateral kidney sustained the host long term and remained free from mononuclear cell infiltration (Figure 5.12C).

145

Figure 5.12 Long-term surviving graft in Il21r-/- mice are functional and free from immune cell infiltration Representative histological analyses of (A) a long-term surviving islet allograft from an Il21r-/- mouse, with insulin staining in brown and (B) scar tissue from a B6 mouse following graft rejection. (C) Histological analyses of long-term surviving second allograft on the contralateral kidney of Il21r-/- mouse, with insulin staining in brown.

5.2.5 CD8 T cell responsiveness is crucial to allograft rejection

Taken together, these results indicated that responsiveness to IL21 was crucial to successfully rejecting an islet allograft. We next wanted to identify which particular immune cell subsets required IL-21 responsiveness to reject a graft. The number and activation status of CD8+ T cells was not impaired in resting unchallenged Il21r-/- mice, as observed in our laboratory and others (Kasaian et al., 2002; Ozaki et al., 2002). However, IL-21 has a well-documented role in CD8+ T cell survival and effector function (Allard et al., 2007; Moroz et al., 2004; Ostiguy et al., 2007). In the absence of IL-21 responsiveness, CD8+ T cells become ‘exhausted’ in chronic viral infections (i.e. situations of high antigen exposure), exhibiting ‘impaired self-maintenance’ (Elsaesser, 2009; Frolich, 2009; Yi 2009).

CD8+ T cells have previously been shown to be critical for the rejection of pancreatic islet allografts (Desai et al., 1993; Yamamoto et al., 1990). Therefore we determined whether IL-21 responsiveness in this immune population alone was sufficient to induce allograft rejection. Il21r-/- mice were reconstituted with CD8+ T cells capable of responding to IL-21, and H-2d BALB/c islets were transplanted under the kidney capsule. For this analysis we utilised B6 MHC class II deficient mice as the source of CD8+ T cells. The deficiency of CD4+ T cells in these mice allowed us to exclude potential contaminating CD4+ T cells from the analyses. As is shown in (Figure 5.13) Il21r-/- mice that had received IL-21 responsive CD8+ T cells were capable of rapid islet allograft rejection. This indicated that restoring IL-21

146 responsiveness CD8+ T cells alone was sufficient to enable the immune system to function competently towards the allograft.

Figure 5.13 Restoring CD8 T cell responsiveness to IL-21 results in rapid islet allograft rejection (A) Percent islet graft survival in B6 and Il21r-/- mice reconstituted with WT CD8+ T cells on day -4 (+CD8 T cells), after allogenic islet transplants (day 0) (BALB/c donors). N = 3 for control B6 group, MST 16.7 days. N = 5 for Il21r-/- (+CD8 T cells) group, MST 10.0 days. (B) Individual blood sugar readings are shown for a cohort of B6 and Il21r-/- (+CD8 T cells) mice.

Studies are ongoing to examine a mechanism behind this recovery of rejection ability. The numbers and effector function of CD8+ T cells in Il21r-/- compared to B6 islet allograft recipients will be examined. If the CD8+ T cells were indeed ‘exhausted’ to antigen without IL-21, as seen in chronic vial infection, we would expect a significant depletion of graft specific CD8+ T cells in the draining LN. In an in vitro mixed lymphocyte reaction (MLR) and cytotoxic lymphocyte (CTL) assay we would assess whether Il21r-/- CD8+ T cells taken from BALB/c islet transplant recipients were still capable of responding to BALB/c antigen, as compared to a third party antigen (i.e. A/J splenocytes). Indeed, results in this chapter demonstrated an important dependence of CD8+ T cells on IL-21 for the rejection of islet allografts. Investigation into the mechanisms underlying this process may provide insight into how of the requirement of IL-21 by CD8+ T cells may manifest in other immunological challenges.

147 5.3 Discussion

Following the investigations in chapter 4, which characterised the IL-21 producing cells in NOD mice, we performed IL-21 neutralisation studies in order to confirm the important role IL-21 has in T1D. During the course of this thesis, it was published by others, that IL-21 plays a crucial role in the T1D pathogenesis of the NOD mouse (Datta and Sarvetnick, 2008; Spolski et al., 2008; Sutherland et al., 2009). These studies relied on whole body knockouts of the gene encoding IL-21R. By using a therapeutic approach to neutralise IL-21, the study presented in this chapter allowed us to address the importance of IL-21 at particular time points in the disease process, rather than inhibiting this interaction from birth. This approach has the additional advantages of avoiding both the potential developmental effects from the genetic deficiency of IL-21:IL-21R signalling and the possible effects of retained C57BL/6-derived resistance alleles on diabetes susceptibility in backcrossed mice. We found that although neutralisation of IL-21 in young mice was effective at clearing insulitis, following cessation of treatment, the immune infiltrate returned and disease incidence was not altered. Our findings indicated that IL-21 was always required for the maintenance of the islet infiltrate and was necessary at the late pre- clinical stage of disease.

The fusion protein, IL-21R/Fc was used to neutralise IL-21. Fusing IL-21R with the Fc fragment of a mouse IgG2a antibody allowed the IL-21R protein to utilise the same benefits as IgG antibodies. That is, through FcRn recognition of amino acid residues in the CH2-CH3 hinge region of IgG Fc fragments, antibodies are sustained in the serum for an extended period of time (Firan et al., 2001; Israel et al., 1995). Although a two-week restricted treatment regime was used in this study, future studies may focus on optimising the dose and length of treatment period required in order to achieve maximum reduction in diabetes incidence in pre-diabetic mice. The precise serum half-life has not been evaluated, a property that may prove helpful in order to determine an appropriate length of treatment, or the duration between doses required. A suitable approach to determine the serum half-life would be to radiolabel IL-21R/Fc and in a matter of hours post injection (0-144 hours assessed for similar reagents) assess blood serum samples for the remaining

148 radioactive signal, with data points plotted on an elimination curve. Radiolabelled Na 125I using the Iodo-Gen method (Fraker and Speck, 1978) mainly introduces 125I into the tyrosine residues throughout the length of the protein. This would allow the additional benefit of assessment of sera by SDS-PAGE, followed by autoradiography, in order to determine the molecular mass and homogeneity of the injected radioactive protein. If degradation of IL-21R/Fc was occurring whilst in the blood stream, this could be visualised using this method.

In an effort to explain the therapeutic effect of IL-21 neutralisation on insulitis, we analysed the islet infiltrate and observed an immediate reduction in the number of activated B, CD4+ T and CD8+ T lymphocytes, which were almost eliminated from the islet. The resulting islet infiltrate more closely resembled the less activated infiltrate in protected NODB6.Idd3 mice. Additionally, our results show that IL-21 transcript in the blood is a predictive marker for T1D incidence. This finding has important potential in human disease and future studies pursuing an equivalent measurement of IL-21 biological levels in humans are warranted. It would be interesting to assess whether this correlation held true for humans, assessing both a wider general population cohort and a cohort of people at higher risk, such as those who are first-degree relatives of people with T1D. Whilst no such studies have been done to date, an assessment of SNPs in Il21 and Il21r have shown association to T1D, in an additive manner (Asano et al., 2006; Asano et al., 2007). Additionally, associations of the IL-2/IL-21 locus with other autoimmune diseases have also been shown, including coeliac disease (Hunt et al., 2008; van Heel et al., 2007), SLE (Sawalha et al., 2008) and MS (Forte et al., 2006).

The broad effect of IL-21 neutralisation on lymphocytes in the islet lesion probably reflected the findings that IL-21 is produced by activated CD4+ T helper cells and, as well as acting in an autocrine fashion, provides soluble help by facilitating the activation and differentiation of B cells and CD8+ cytotoxic T lymphocytes (Ettinger et al., 2005; Good et al., 2006; Li et al., 2005; Ozaki et al., 2002; Smyth et al., 2006). Whilst the mechanism underlying the successful clearance

149 of immune infiltrate from pancreas islets in IL-21R/Fc treated NOD mice cannot be fully concluded from these studies, future work may help to confirm findings. One particular aspect worth investigating is the hypothesis that IL-21 neutralisation disrupts the expansion and survival of lymphocytes in the pancreas. Using a traceable dye, such as CFSE, or a congenic marker, would allow the detection of lymphocytes that have been isolated from NOD pancreas during adoptive transfer experiments. These cells could be transferred into NOD mice, either untreated or treated with IL-21R/Fc, to determine the influence of IL-21 on the survival and expansion of these cells into the pancreatic lesion. We would hypothesise that the transferred cells would be less readily detectable in the pancreas when transferred into IL-21R/Fc treated NOD mice.

Our findings demonstrate that IL-21 provides the momentum for the transition from an apparently inconsequential inflammation of the islets to a destructive insulitis responsible for β-cell death and clinical diabetes. The striking effect of IL-21 on the destructive transformation of the islet lesion may reflect its fundamental role as a soluble co-stimulator of lymphocyte activation. Studies collectively demonstrate that a variety of immunomodulatory reagents can protect the NOD mouse from diabetes. However, there are few examples of reagents that can reverse insulitis

(Ettinger et al., 2001; Lee et al., 2006b; Simon et al., 2008) and only one other reagent, namely anti-CD3 monoclonal antibody (Chatenoud et al., 1994), that has been shown to prevent the progress of T1D once blood glucose levels have begun to rise, leading to clinical trials for T1D (Isaacs, 2007). These influential studies place the blockade of IL-21:IL-21R interactions in an elite group of immunomoduatory agents in T1D. The ability of short-term blockade of a single cytokine at this late stage, to have such a profound effect on islet inflammation, is unprecedented and raises possibilities for intervention in T1D at a late preclinical stage and as studies presented here demonstrate, for the protection of transplanted islet tissue during recurrent autoimmunity.

150 Whilst IL-21 neutralisation by itself in newly diabetic NOD mice failed to reverse diabetes, we hypothesise that this was due to an insufficiency of β-cell mass. As such, we find that the combination of IL-21R/Fc treatment with syngeneic islet transplantation offered long-term protection from diabetes. Interestingly, a recent paper suggested that T cell-directed therapies in newly diabetic NOD mice might be successful in restoring a euglycemic state in the absence of islet transplantation, that is, only if the approach adequately addressed inflammation-induced insulin resistance (Koulmanda et al., 2007). The metabolic phenotype of insulin resistance has recently been described in diabetic NOD mice (Chaparro et al., 2006). Thus, it may prove interesting for future studies to test whether a combination of IL-21 neutralisation with treatment of insulin resistance could restore euglycemia in diabetic NOD mice, in the absence of islet transplantation. As inflammatory signals are known to disrupt insulin-stimulated tyrosyl-phosphorylation of the insulin receptor and other downstream signalling molecules necessary for insulin triggered signal transduction (Bruning et al., 1997), treating with a broad anti-inflammatory agent may counteract this process.

One key finding from these studies was that IL-21 responsiveness was required for CD8+ T cells in islet allograft destruction. This finding provides insight into the important clinical problem of organ allograft rejection, suggesting that there may be possible translation for IL-21 neutralisation in pancreatic islet transplantation for patients with T1D. Interestingly, elevated IL-21 and IL-21R mRNA have been observed in biopsies from cardiac allograft recipients, with the highest mRNA expression levels found in rejection specimens (Baan et al., 2007). This finding would suggest that biological activities of the IL-21 pathway are contributing to the graft rejection process.

It remains to be determined how IL-21 promotes destruction of islet allografts by CD8+ T cells. It is likely that ‘exhaustion’ of the graft specific CD8+ T cells occurs, by a similar mechanism to that observed in chronic viral infections (Elsaesser et al., 2009; Frohlich et al., 2009; Yi et al., 2009). This is the subject of ongoing studies. Interestingly, our finding of a role for IL-21 responsiveness in allograft

151 rejection is in line with recent studies, which found that loss of IL-21 signalling attenuated the pathogenesis of another allogeneic response, graft versus host disease (GVHD) (Bucher et al., 2009; Meguro et al., 2010; Oh et al., 2010). In this CD4+ T cell mediated allogeneic response, both investigating groups reported that loss of IL- 21 responsiveness might mediate pathogenesis through an observed reduction in IFNγ expressing T cells (Bucher et al., 2009; Oh et al., 2010).

An important aspect to consider in the induction of tolerance in islet allograft transplantation is the role of Tregs (Webster et al., 2009). Il21r-/- mice exhibit normal T reg function as measured by in vitro suppressor assay (Spolski et al., 2008), so it is unlikely that modulation of T reg functionality has a role in preventing islet allograft rejection in Il21r-/- mice. Additionally, other work in our laboratory has shown that there is no difference in proportion of FoxP3 expressing T reg cells in the Il21r-/- mice used in this study (Alexis Vogelzang, personal communication). However, it has been shown that FoxP3 expression can be enhanced in IL-21 deficiency, and IL- 21 may inhibit Treg suppressor function (Clough et al., 2008; Li and Yee, 2008; Nurieva et al., 2007; Piao et al., 2008). As such, future studies may be warranted to directly address the role of Tregs in the transplantation of Il21r-/- mice and, in particular, to determine whether Tregs can interrupt the IL-21-mediated expansion of CD8+ T cells.

We have shown in the studies presented in this chapter, that CD8+ T cell responsiveness to IL-21 restored the ability of the immune system to reject islet allografts. Whether other cells could compensate for the lack of IL-21 responsiveness of CD8+ T cells remains unknown. For instance, parallel transfers of IL-21R- sufficient CD4+ T cells into Il21r-/- mice could assess the potential role for IL-21- responsive CD4+ T cells in allograft rejection in future experiments. Additionally, the important role of IL-21 as a costimulator (Ettinger et al., 2005; Good et al., 2006; Li et al., 2005; Ozaki et al., 2002; Smyth et al., 2006), could be tested further in Il21-/- mice and would provide the opportunity to add rIL-21 or other costimulator alternatives to the system at graded time-points.

152 In this study, we demonstrate that neutralising IL-21 just prior to clinical diabetes reversed insulitis and reduced and delayed the incidence of diabetes. We hypothesise that the major action achieved by neutralising IL-21 was a reduction in activated lymphocytes, particularly an early and retained reduction in activated CD8+ T cells. By combining IL-21 neutralisation therapy with syngeneic islet transplantation, diabetes was alleviated. Similarly, mice deficient in IL-21 responsiveness showed an inability to reject islet allografts, critically through the action of CD8+ T cells.

153 6 General Discussion

6.1 Research outcomes

T1D is an autoimmune disease caused by specific destruction of the β-cells within the pancreatic islets of Langerhans, mediated primarily by self-reactive T cells. My study has been focused on understanding the vital role of IL-21 in this disease process. Several studies published during the course of this thesis reported that NOD mice made genetically deficient in the IL-21R are protected from diabetes (Datta and Sarvetnick, 2008; Spolski et al., 2008; Sutherland et al., 2009). However, the mechanism explaining the role of IL-21 in T1D remained unknown. Cytokine networks coordinate the responses of the adaptive immune system. In particular, they play a crucial role in controlling the differentiation of lymphocytes, and subsequent acquisition of dedicated effector functions. IL-21 is a member of the common γ- chain family of cytokines. Whilst the expression of IL-21 is highly restricted to CD4+ T cells and NK T cells (Coquet et al., 2007; Parrish-Novak et al., 2000), IL-21 can initiate responses in a diverse range of cells due to the wide spread expression of its unique receptor chain, IL-21Rα (Jin et al., 2004; Ozaki et al., 2000; Parrish- Novak et al., 2000).

The broad aim of this thesis was to examine the critical role of IL-21 in the pathogenesis of T1D. We addressed this objective by embarking on genetic and expression analyses of IL-21 compared to IL-2, phenotyping of IL-21 producing CD4+ T cells, and assessment of a therapeutic approach to target IL-21 in both autoimmune diabetes and islet transplantation. Transplant investigations were extended to assess the role of IL-21 responsiveness in islet allograft rejection. Collectively, these analyses demonstrated that IL-21 is produced in abundance in the pancreatic lesion by a previously undescribed population of CD4+ T helper (Th) cells that are distinguished by co-expression of the gut-homing chemokine receptor CCR9. The ultimate target of IL-21 was CD8+ T cells whose IL-21 responsiveness was necessary for the development of diabetes. Not only was IL-21 crucial for the

154 ability of CD8+ T cells to cause diabetes, but IL-21 also acted on CD8+ T cells to mediate islet allograft rejection.

This thesis set out to put into context the contribution of IL-21 to the development of T1D. Studies began by confirming the previous findings in our lab of elevated IL-21 levels in NOD mice. Indeed, we thoroughly explored what this observation meant on a per cell basis, and in a pyrosequencing analysis system. By crossing for 1 generation (F1) NOD and NODB6.Idd3 mice, each NOD.Idd3B6/NOD cell inherited a copy of both NOD and B6 Idd3 alleles from each parent. As a result, NOD.Idd3B6/NOD cells were exposed to the same availability of transcription factors and had an equal capacity to express both alleles. For thoroughness, and as appropriately required for a discussion of Idd3 diabetes susceptibility studies, this analysis was conducted in parallel to investigations of IL-2 expression. Utilising pyrosequencing assays, we showed that both intronic and exonic IL-21 NOD alleles were more active than B6. This finding equated to a similar mRNA decay profile of IL-21 alleles. Luciferase reporter constructs and EMSA were used to analyse the increased IL-21 transcript by the NOD allele. Superior transcription ability of the NOD IL-21 promoter was associated with improved Sp1 transcription factor binding.

Corresponding analyses of IL-2 revealed different findings. Indeed, we uncovered a disparity between the intronic IL-2 mRNA, which was dominated by the NOD allele, and exonic IL-2 mRNA, which demonstrated a similar abundance of both NOD and B6 alleles. Thus, the stronger initiation of transcription of NOD IL-2 mRNA relative to C57BL/6 IL-2 mRNA did not result in more exonic or total NOD IL-2 mRNA. This observation was explained by decreased stability of the NOD IL-2 allele relative to B6. To confirm this observation at a protein level, this study was the first to utilise the novel IL-2/S4B6 bioassay (Boyman et al., 2006a) to assess bioavailable levels of IL-2 in NOD and diabetes resistant strains. By measuring the proliferation of memory phenotype CD8+ T cells in NOD and NODB6.Idd3 mice we could demonstrate that they had comparable levels of IL-2. This finding was confirmed, in turn, by intracellular flow cytometric analysis and western blot IL-2 protein expression, which demonstrated equivalent amounts of IL-2 in CD4+ and CD8+ T cells from NOD and congenic-NODB6.Idd3 mice.

155

Intriguingly, wider analyses of IL-21 and IL-2 allele expression revealed that far from being a unique diabetes-associated phenomenon, other strains shared expression patterns similar to that of NOD mice. Indeed, of the common mouse strains assessed, there were two distinct expression pattern combinations of IL-21 and IL-2. Those of the Idd3 Allele ‘A’ group exhibited moderate expression of both cytokines, in a similar fashion to B6 mice. Those of the Idd3 Allele ‘B’ group, as with NOD mice, showed high expression of IL-21, and intronic IL-2. However, this was accompanied by an increased decay of IL-2 mRNA.

Having explored the expression of IL-21 in chapter 3, studies in chapter 4 uncovered an intriguing relationship between a gut homing chemokine receptor CCR9 and IL-21 producing cells in the islet lesion during the development of T1D. Indeed we found that CD4+ T cells expressing CCR9 were not only the principal source of IL-21 in the pancreatic islets, but also the salivary gland infiltrate. This finding suggested that these cells were inappropriately accumulating at the sites of chronic autoimmune inflammation in the NOD mouse.

As well as presenting as a formidable proportion of the mononuclear cells in the inflamed NOD pancreas, CCR9 expressing T helper cells were more prevalent in the peripheral blood of the majority of human patients with Sjögren’s syndrome. The expression of CCR9 prompted the investigation into expression of its ligand CCL25 in the pancreas. This study was the first to detect CCL25 protein in the pancreas, confirming previously published detection of CCL25 mRNA (Kutlu et al., 2009).

Characterisation of the CCR9+ IL-21-producing pancreatic Th subset (named Tccr9 for brevity) revealed a cytokine production profile that was largely restricted to IL-21. Additionally, Tccr9 cells expressed transcription factors that are important for the differentiation of TFH cells (Bauquet et al., 2009; Johnston et al., 2009; Linterman et al., 2009; Nurieva et al., 2009). Interestingly, the observed high Bcl6 expression corresponded with the restricted cytokine profile, as Bcl6 has been reported to repress both IFNγ and IL-17 expression during TFH cell differentiation

(Nurieva et al., 2009; Yu et al., 2009) as well as IL-4 expression in line with Th2

156 differentiation (Dent et al., 1997; Hartatik et al., 2001; Kusam et al., 2003).

Examination of TFH cell associated surface markers (Deenick et al., 2010; Johnston et al., 2009; King et al., 2008), distinguished Tccr9 cells from TFH cells. We could demonstrate that the pancreatic CCR9+ Th cells were functionally proficient at supporting antibody production by B cells in vitro. However, since diabetes in not an antibody mediated disease (Jaramillo et al., 1994) the significance of Tccr9 help to B cells for antibody production remains unknown (Schaerli et al., 2000).

Remarkably, we could show a direct reliance of CD8+ T cells on IL-21, in terms of survival, proliferation and during the adoptive transfer of T1D. We introduced the use of therapeutic neutralisation of IL-21 as an appropriate intervention in this disease model. A concept subsequently built on and explored in chapter 5. Overall, extensive phenotypic analysis of the IL-21 expressing CD4+ T cells in autoimmune NOD mice suggested that there may be important cross-talk between gastrointestinal homing, imparting organ specificity of the autoimmune attack in NOD mice.

In chapter 5 we focused on the therapeutic potential for modulating IL-21 signalling in T1D. IL-21 neutralisation just prior to diabetes onset demonstrated a sustained reduction in both insulitis and diabetes incidence in NOD mice. As such, IL-21 played a critical role in influencing the transition from peri-insulitis to destructive insulitis. As the modulation of IL-21 was for such a brief time period, this would suggest to us that the autoimmune inflammation is continually reliant on IL- 21. Flow cytometric analysis revealed that the neutralisation of IL-21 reduced activated lymphocytes in the islet lesion. Particularly, we found a sustained reduction in activated CD8+ T cells. This was in line with our findings in chapter 4, which showed a role for IL-21 in supporting the expansion and survival of memory phenotype CD8+ T cells. CD8+ T cells have a well-established role in both the early stage of disease, and in the final effector stage of diabetes, so an effect of IL-21 on this population was an important finding. Significantly, IL-21mRNA levels in the blood in the pre-diabetic stage of disease was a predictive marker for diabetes development in NOD mice. It would be fascinating to establish whether the same relationship occurs in human patients with T1D. Already, it has been found through

157 SNP linkage analysis, that IL-21 and IL-21R have associations with T1D (Asano et al., 2006; Asano et al., 2007)) as well as other autoimmune diseases including coeliac disease (Hunt et al., 2008; van Heel et al., 2007), SLE (Sawalha et al., 2008) and multiple sclerosis (Forte et al., 2006).

When IL-21 neutralisation was combined with syngeneic islet transplantation, newly diabetic NOD mice could be rescued from diabetes. This study was relevant to human patients with type-1 diabetes. We found that transplantation of pancreatic islets could effectively serve as a surrogate insulin source, while the immune system underwent immunomodulation of IL-21. Another consideration of islet transplantation to human T1D patients, is the challenge of allograft rejection. Given this challenge, we assessed the role of IL-21 in an islet allograft immune response. It was of interest to find in a published study that IL-21 transcript was associated with rejected cardio allograft specimens (Baan et al., 2007); supporting our findings that IL-21 plays a role in the rejection process. We found that the influence of IL-21 on a graft-mounted immune response was robust, since the absence of IL-21 signalling prevented islet allograft rejection. We specifically showed that IL-21 responsive CD8+ T cells were central to allograft rejection. These findings suggest that therapeutic manipulation of IL-21 may serve as a specific immunosuppressive agent during transplantation for patients with T1D.

158 6.2 Clinical Relevance

This PhD study has opened up new ways to think about intervening in the pathogenic process of T1D, and autoimmune diseases as a whole. We found that IL- 21 was critically required to cause diabetes, and was continually required to sustain the islet infiltrate. As introduced in chapter 1, autoimmunity can occur as a result of a breakdown in tolerance, resulting in the immune system targeting of self-antigens. In most individuals tolerance to self-antigens is maintained, as the prevalence of autoimmune disease is only 3-8% (Jacobson et al., 1997; Marrack et al., 2001). By understanding the mechanisms by which tolerance fails, and also analysing the behaviour of the resulting immune populations, we have the potential to treat autoimmunity. Studies within this thesis have highlighted a critical dependence of the autoimmune inflammation on IL-21. If we can harness the knowledge of IL-21 as a critical growth factor in T1D, particularly in light of its published role as a lymphocyte costimulator (Kasaian et al., 2002; Liu et al., 2007), effecting activation and differentiation, as well as its capacity as a prosurvival modulator (Elsaesser et al., 2009; Frohlich et al., 2009; Yi et al., 2009), the capacity to therapeutically manipulate IL-21 in autoimmune disease could prove very powerful. Caution would be necessary for the possible side effects of long-term IL-21 blockade. In particular, given the striking role of IL-21 in tumour immunity (Skak et al., 2008; Zeng et al., 2005), surveillance of malignancies would be necessary. It is also notable that long- term neutralisation of IL-21 may preface a greater susceptibility to allergic disease (Frohlich et al., 2007; Hiromura et al., 2007; Kishida et al., 2007; Ozaki et al., 2002).

Currently, the treatment of autoimmune diseases tends to be palliative or relies on a generalised anti-inflammatory and immunosuppressive approach. As such, they tend to be largely symptomatic and non-disease specific. They include suppression of T cell proliferation and activation (Bianco et al., 2009; Fernandez and Perl, 2009; La Cava, 2008; Ozawa et al., 2008), inhibiting inflammatory cytokine functions (Crispin and Tsokos, 2009; Waldner and Neurath, 2009; Youinou and Jamin, 2009), the inhibition of B cell functions and autoantibodies production (Taylor et al., 2009; Youinou and Jamin, 2009), depletion of B cells (Guzman Moreno, 2009), altering B cell signalling (Liu and Mohan, 2009) and pain management (Clauw and Witter,

159 2009). Targeting IL-21directly might offer a more focused approach, capable of inducing tolerance, with its potential lying in its specificity. Along similar lines, monoclonal antibodies specifically targeting the cytokine TNFα, infliximab (Remicade; Centocor), and adalimumab (Humira; Abbott), have been approved to treat several autoimmune diseases (Strand et al., 2007).

That is, not to say, that IL-21 may not already be targeted in some of these approaches. Indeed, it has been reported that the calcineurin inhibitors cyclosporine A (CsA) and tacrolimus (Tac), in addition to targeting the IL-2 pathway, also inhibit the TCR induced IL-21 gene expression in mice (Kim et al., 2005). Whether this relationship is the same in humans remains to be established. Modulation of IL-21 might target the cells critically reliant on it as a growth factor. It is interesting to note that a converse strategy, use of exogenous IL-21, has already been tested in clinical trials, for the restoration of IgG and IgA production in patients with common variable immunodeficiency and selective IgA deficiency (Borte et al., 2009).

The findings of chapter 5 showed that modulation of IL-21 at a late pre-clinical stage of diabetes could reduce insulitis and disease incidence. Taken in context of current treatment strategies, the successful intervention of diabetes at this late stage of disease is rare. Indeed, more that 200 different treatments can prevent T1D in NOD mice, when administered during a period of weaning, but fail to cure established disease (Shoda et al., 2005). Only CD3 directed monoclonal antibody treatment has been successfully shown to prevent the progress of T1D once blood glucose levels have begun to rise (Chatenoud et al., 1994). It is currently undergoing clinical trials for T1D treatment (Herold et al., 2002; Isaacs, 2007; Keymeulen et al., 2005). It remains unprecedented that neutralisation of a single cytokine at a late pre- clinical stage could so profoundly affect insulitis and diabetes.

In chapter 4, we uncovered the relationship between IL-21 production in the autoimmune lesions of NOD mice, and CCR9. CCR9 as a modulator of gut homing is known to the clinic already. Indeed, CCR9 has been studied in inflammatory disorders of the intestinal tract, including Crohn’s disease, coeliac disease and

160 Primary Sclerosing Cholangitis (Apostolaki et al., 2008; Eksteen et al., 2004; Koenecke and Forster, 2009; Rivera-Nieves et al., 2006; Saruta et al., 2007). It has been proposed as a means to intervene in human inflammatory bowel diseases, such as Crohn’s disease and ulcerative colitis, given its recognised roles in gut homeostasis and inflammation (Nishimura et al., 2009). In Crohn’s disease patients, it was found that CCR9 expression on memory CD4+ T cells were increased in the peripheral blood (Papadakis et al., 2001). As revealed in chapter 4, a similar observation was made in our cohort of Sjögren’s syndrome patients. Interestingly, it has been shown in animal models of Crohn’s disease, that use of neutralising antibodies to interfere with the CCR9/CCL25 axis has proved to be effective (Rivera- Nieves et al., 2006). Furthermore, the drug CCX282-B (Traficent-EN) has successfully passed through phase 2 clinical trial (study NCT00540657) for the treatment of Crohn’s disease, with the preclinical characterisation recently published (Walters et al., 2010). In the trials, they found that treatment of human Crohn’s disease with the orally active, selective and potent small molecule antagonist of human CCR9, CCX282 induced a clinical response, capable of maintaining clinical remission (Bekker et al., 2009). Given our findings of a specific role for CCR9 expressing CD4+ T cells in the NOD murine model for T1D, it would prove interesting to determine whether a similar CCR9 antagonist approach to treat autoimmune diabetes, or Sjögren’s syndrome for that matter, would prove efficacious. If CCR9 expression is important, at least in part, for the inappropriate accumulation of Tccr9 cells in the pancreas and salivary glands, blockade of CCR9 might mitigate the autoimmune disease process.

In chapter 5 we revealed that through islet transplantation, IL-21 neutralisation treatment could reverse diabetes. Furthermore, we demonstrated that there was a crucial role for IL-21 in allograft rejection. These findings present an advance in our approach to transplantation as a potential cure for T1D. Indeed, the challenges of islet transplantation as an effective solution to diabetes lies in three aspects, that is, for a desperate need to find an alternative to broad-spectrum immunosuppression, while preventing graft rejection, and recurrence of the underlying autoimmune destruction of the pancreatic islets (Ricordi and Strom, 2004; Stratta, 1999). Combining IL-21 modulation therapy with islet transplantation,

161 as investigated in chapter 5 appeared to address each of these concerns, and may offer a suitable means to successfully implement islet transplantation for the treatment of T1D.

162 6.3 Future Directions

Whilst the advances in knowledge from the studies presented in this thesis are great, results only suggest further work that may be important to explore. Results from chapter 3 surprisingly suggested that the expression of IL-21 and IL-2 alleles in NOD mice was far from unique. The implication of this finding warrants future examination. Furthermore, an investigation into a centralised locus regulatory control of Idd3 would prove interesting, as has been similarly approached by other groups for other loci, the Il4 Il13 locus (Loots et al., 2000) and the Il17 Il17f locus (Akimzhanov et al., 2007). These studies identified conserved noncoding elements, and examined the behaviour of chromatin remodelling at these sites following lymphocyte activation and differentiation (Lee et al., 2006a). Development of an IL- 21 reporter mouse (i.e. GFP expression under IL-21 promoter) would prove very informative to studies of the role of IL-21 in T1D, allowing us to live cell sort IL-21 producing cells specifically. A concerted investigation of CCL25 in relation to the inflammatory process of T1D is also justified. Finally, investigating the role of IL-21 in transplantation is only in its infancy. Critically, IL-21R/Fc treatment in allogeneic islet transplantation, rejection mechanistic studies and expansion to other models, such as skin grafts would further advance the results introduced in chapter 5.

Though clearly beyond the capacity of our current research facilities, it would be interesting to extend our work beyond murine studies of T1D and IL-21. Indeed caution must be taken when extrapolating results from mice to humans. Clearly, between the two species there are extensive genetic differences, which can effect how cells and their function participate in the pathogenesis of disease. As such, assessment of human relevant therapeutic interventions should at least be conducted in species more closely related than mice, such as monkeys. Indeed, studies published in preparation of an IL-21R antagonistic antibody for potential clinical development, revealed relevant similarities between the two species (Arai et al., 2010; Guo et al., 2010). They found comparable binding and signal transduction of their IL-21 antagonistic antibody (Guo et al., 2010), and also, that stimulation of whole blood samples with rIL-21 induced a similar set of genes in both humans and cynomolgus monkeys (Arai et al., 2010).

163 6.4 Concluding remarks

The work presented in this thesis has uncovered a fundamentally important role for IL-21 in T1D. Critically, we showed that T1D incidence correlates with the amount of IL-21, and not IL-2. IL-21 was found to be particularly prevalent in the inflamed lesions of the pancreas and salivary gland. Strikingly, these cells co-express CCR9, suggesting a role for mucosal homing in the autoimmune localisation. IL-21 was found to support the function of CD8+ T cells in their role in diabetes pathology, and allograft rejection. This data opens up new avenues of research in the T1D field, that is; through manipulation of IL-21, a suitable treatment for patients with T1D may be realised.

164 7 References

Abbas, A.K., Murphy, K.M., and Sher, A. (1996). Functional diversity of helper T lymphocytes. Nature 383, 787-793. Ahmed, R., and Gray, D. (1996). Immunological memory and protective immunity: understanding their relation. Science 272, 54-60. Akimzhanov, A.M., Yang, X.O., and Dong, C. (2007). Chromatin remodeling of interleukin-17 (IL-17)-IL-17F cytokine gene locus during inflammatory helper T cell differentiation. J Biol Chem 282, 5969-5972. Allard, E.L., Hardy, M.P., Leignadier, J., Marquis, M., Rooney, J., Lehoux, D., and Labrecque, N. (2007). Overexpression of IL-21 promotes massive CD8+ memory T cell accumulation. Eur J Immunol 37, 3069-3077. Allen, C.D., and Cyster, J.G. (2008). Follicular dendritic cell networks of primary follicles and germinal centers: phenotype and function. Semin Immunol 20, 14-25. Allen, C.D., Okada, T., and Cyster, J.G. (2007). Germinal-center organization and cellular dynamics. Immunity 27, 190-202. Allison, J., McClive, P., Oxbrow, L., Baxter, A., Morahan, G., and Miller, J.F. (1994). Genetic requirements for acceleration of diabetes in non-obese diabetic mice expressing interleukin-2 in islet beta-cells. Eur J Immunol 24, 2535-2541. Aloisi, F., and Pujol-Borrell, R. (2006). Lymphoid neogenesis in chronic inflammatory diseases. Nat Rev Immunol 6, 205-217. Alper, C.A., and Awdeh, Z. (2000). Incomplete penetrance of MHC susceptibility genes: prospective analysis of polygenic MHC-determined traits. Tissue Antigens 56, 199-206. Amsen, D., Antov, A., Jankovic, D., Sher, A., Radtke, F., Souabni, A., Busslinger, M., McCright, B., Gridley, T., and Flavell, R.A. (2007). Direct regulation of Gata3 expression determines the T helper differentiation potential of Notch. Immunity 27, 89-99. Anderson, M.S., and Bluestone, J.A. (2005). The NOD mouse: a model of immune dysregulation. Annu Rev Immunol 23, 447-485. Anderson, M.S., Venanzi, E.S., Klein, L., Chen, Z., Berzins, S.P., Turley, S.J., von Boehmer, H., Bronson, R., Dierich, A., Benoist, C., et al. (2002). Projection of an immunological self shadow within the thymus by the aire protein. Science 298, 1395-1401. Annacker, O., Coombes, J.L., Malmstrom, V., Uhlig, H.H., Bourne, T., Johansson- Lindbom, B., Agace, W.W., Parker, C.M., and Powrie, F. (2005). Essential role for CD103 in the T cell-mediated regulation of experimental colitis. J Exp Med 202, 1051-1061. Ansel, K.M., Djuretic, I., Tanasa, B., and Rao, A. (2006). Regulation of Th2 differentiation and Il4 locus accessibility. Annu Rev Immunol 24, 607-656. Ansel, K.M., McHeyzer-Williams, L.J., Ngo, V.N., McHeyzer-Williams, M.G., and Cyster, J.G. (1999). In vivo-activated CD4 T cells upregulate CXC chemokine

165 receptor 5 and reprogram their response to lymphoid chemokines. J Exp Med 190, 1123-1134. Apostolaki, M., Manoloukos, M., Roulis, M., Wurbel, M.A., Muller, W., Papadakis, K.A., Kontoyiannis, D.L., Malissen, B., and Kollias, G. (2008). Role of beta7 integrin and the chemokine/chemokine receptor pair CCL25/CCR9 in modeled TNF- dependent Crohn's disease. Gastroenterology 134, 2025-2035. Arai, M., Jain, S., Weaver, A.A., Hill, A.A., Guo, Y., Bree, A.G., Smith, M.F., Jr., Allen, S.W., LaVallie, E.R., Young, D., et al. (2010). Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood. J Transl Med 8, 51. Araki, R., Fujimori, A., Hamatani, K., Mita, K., Saito, T., Mori, M., Fukumura, R., Morimyo, M., Muto, M., Itoh, M., et al. (1997). Nonsense mutation at Tyr-4046 in the DNA-dependent protein kinase catalytic subunit of severe combined immune deficiency mice. Proc Natl Acad Sci U S A 94, 2438-2443. Asano, K., Ikegami, H., Fujisawa, T., Kawabata, Y., Noso, S., Hiromine, Y., and Ogihara, T. (2006). The gene for human IL-21 and genetic susceptibility to type 1 diabetes in the Japanese. Ann N Y Acad Sci 1079, 47-50. Asano, K., Ikegami, H., Fujisawa, T., Nishino, M., Nojima, K., Kawabata, Y., Noso, S., Hiromine, Y., Fukai, A., and Ogihara, T. (2007). Molecular scanning of interleukin-21 gene and genetic susceptibility to type 1 diabetes. Hum Immunol 68, 384-391. Asao, H., Okuyama, C., Kumaki, S., Ishii, N., Tsuchiya, S., Foster, D., and Sugamura, K. (2001). Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. J Immunol 167, 1-5. Atkinson, M.A., and Eisenbarth, G.S. (2001). Type 1 diabetes: new perspectives on disease pathogenesis and treatment. Lancet 358, 221-229. Aujla, S.J., and Kolls, J.K. (2009). IL-22: a critical mediator in mucosal host defense. J Mol Med 87, 451-454. Baan, C.C., Balk, A.H., Dijke, I.E., Korevaar, S.S., Peeters, A.M., de Kuiper, R.P., Klepper, M., Zondervan, P.E., Maat, L.A., and Weimar, W. (2007). Interleukin-21: an interleukin-2 dependent player in rejection processes. Transplantation 83, 1485- 1492. Bach, J.F. (2002). The effect of infections on susceptibility to autoimmune and allergic diseases. N Engl J Med 347, 911-920. Bach, J.F., and Mathis, D. (1997). The NOD mouse. Res Immunol 148, 285-286. Basten, A., and Silveira, P.A. (2010). B-cell tolerance: mechanisms and implications. Curr Opin Immunol. Bauquet, A.T., Jin, H., Paterson, A.M., Mitsdoerffer, M., Ho, I.C., Sharpe, A.H., and Kuchroo, V.K. (2009). The costimulatory molecule ICOS regulates the expression of c-Maf and IL-21 in the development of follicular T helper cells and TH-17 cells. Nat Immunol 10, 167-175.

166 Baxter, A.G., Kinder, S.J., Hammond, K.J., Scollay, R., and Godfrey, D.I. (1997). Association between alphabetaTCR+CD4-CD8- T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46, 572-582. Bekker, P., Keshav, S., Johnson, D., and Schall, T.J. (2009). PROTECT-1 Maintenance phase study results demonstrate efficacy of the intestine-specific chemokine receptor antagonist CCX282-B (Traficet-EN) in Crohn’s disease. Inflamm Bowel Dis 15, S11. Bendelac, A., Boitard, C., Bedossa, P., Bazin, H., Bach, J.F., and Carnaud, C. (1988). Adoptive T cell transfer of autoimmune nonobese diabetic mouse diabetes does not require recruitment of host B lymphocytes. J Immunol 141, 2625-2628. Bendelac, A., Bonneville, M., and Kearney, J.F. (2001). Autoreactivity by design: innate B and T lymphocytes. Nat Rev Immunol 1, 177-186. Bennett, C.L., and Ochs, H.D. (2001). IPEX is a unique X-linked syndrome characterized by immune dysfunction, polyendocrinopathy, enteropathy, and a variety of autoimmune phenomena. Curr Opin Pediatr 13, 533-538. Benson, M.J., Pino-Lagos, K., Rosemblatt, M., and Noelle, R.J. (2007). All-trans retinoic acid mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high levels of co-stimulation. J Exp Med 204, 1765-1774. Berek, C., Berger, A., and Apel, M. (1991). Maturation of the immune response in germinal centers. Cell 67, 1121-1129. Betterle, C., Zanette, F., Pedini, B., Presotto, F., Rapp, L.B., Monciotti, C.M., and Rigon, F. (1984). Clinical and subclinical organ-specific autoimmune manifestations in type 1 (insulin-dependent) diabetic patients and their first-degree relatives. Diabetologia 26, 431-436. Bianco, N.R., Kim, S.H., Ruffner, M.A., and Robbins, P.D. (2009). Therapeutic effect of exosomes from indoleamine 2,3-dioxygenase-positive dendritic cells in collagen-induced arthritis and delayed-type hypersensitivity disease models. Arthritis Rheum 60, 380-389. Blotnick, S., Peoples, G.E., Freeman, M.R., Eberlein, T.J., and Klagsbrun, M. (1994). T lymphocytes synthesize and export heparin-binding epidermal growth factor-like growth factor and basic fibroblast growth factor, mitogens for vascular cells and fibroblasts: differential production and release by CD4+ and CD8+ T cells. Proc Natl Acad Sci U S A 91, 2890-2894. Blunt, T., Gell, D., Fox, M., Taccioli, G.E., Lehmann, A.R., Jackson, S.P., and Jeggo, P.A. (1996). Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc Natl Acad Sci U S A 93, 10285-10290. Boise, L.H., Minn, A.J., Noel, P.J., June, C.H., Accavitti, M.A., Lindsten, T., and Thompson, C.B. (1995). CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity 3, 87-98. Borte, S., Pan-Hammarstrom, Q., Liu, C., Sack, U., Borte, M., Wagner, U., Graf, D., and Hammarstrom, L. (2009). Interleukin-21 restores immunoglobulin production ex vivo in patients with common variable immunodeficiency and selective IgA deficiency. Blood 114, 4089-4098.

167 Boulard, O., Fluteau, G., Eloy, L., Damotte, D., Bedossa, P., and Garchon, H.J. (2002). Genetic analysis of autoimmune sialadenitis in nonobese diabetic mice: a major susceptibility region on chromosome 1. J Immunol 168, 4192-4201. Boyman, O., Kovar, M., Rubinstein, M.P., Surh, C.D., and Sprent, J. (2006a). Selective stimulation of T cell subsets with antibody-cytokine immune complexes. Science 311, 1924-1927. Boyman, O., Surh, C.D., and Sprent, J. (2006b). Potential use of IL-2/anti-IL-2 antibody immune complexes for the treatment of cancer and autoimmune disease. Expert Opin Biol Ther 6, 1323-1331. Brand, O.J., Lowe, C.E., Heward, J.M., Franklyn, J.A., Cooper, J.D., Todd, J.A., and Gough, S.C. (2007). Association of the interleukin-2 receptor alpha (IL- 2Ralpha)/CD25 gene region with Graves' disease using a multilocus test and tag SNPs. Clin Endocrinol (Oxf) 66, 508-512. Brayer, J., Lowry, J., Cha, S., Robinson, C.P., Yamachika, S., Peck, A.B., and Humphreys-Beher, M.G. (2000). Alleles from chromosomes 1 and 3 of NOD mice combine to influence Sjogren's syndrome-like autoimmune exocrinopathy. J Rheumatol 27, 1896-1904. Breitfeld, D., Ohl, L., Kremmer, E., Ellwart, J., Sallusto, F., Lipp, M., and Forster, R. (2000). Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J Exp Med 192, 1545-1552. Bretscher, P., and Cohn, M. (1970). A theory of self-nonself discrimination. Science 169, 1042-1049. Bretscher, P.A. (1999). A two-step, two-signal model for the primary activation of precursor helper T cells. Proc Natl Acad Sci U S A 96, 185-190. Brissova, M., Fowler, M.J., Nicholson, W.E., Chu, A., Hirshberg, B., Harlan, D.M., and Powers, A.C. (2005). Assessment of human pancreatic islet architecture and composition by laser scanning confocal microscopy. J Histochem Cytochem 53, 1087-1097. Bruning, J.C., Winnay, J., Bonner-Weir, S., Taylor, S.I., Accili, D., and Kahn, C.R. (1997). Development of a novel polygenic model of NIDDM in mice heterozygous for IR and IRS-1 null alleles. Cell 88, 561-572. Brunkow, M.E., Jeffery, E.W., Hjerrild, K.A., Paeper, B., Clark, L.B., Yasayko, S.A., Wilkinson, J.E., Galas, D., Ziegler, S.F., and Ramsdell, F. (2001). Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27, 68-73. Bubier, J.A., Bennett, S.M., Sproule, T.J., Lyons, B.L., Olland, S., Young, D.A., and Roopenian, D.C. (2007). Treatment of BXSB-Yaa mice with IL-21R-Fc fusion protein minimally attenuates systemic lupus erythematosus. Ann N Y Acad Sci 1110, 590-601. Bubier, J.A., Sproule, T.J., Foreman, O., Spolski, R., Shaffer, D.J., Morse, H.C., 3rd, Leonard, W.J., and Roopenian, D.C. (2009). A critical role for IL-21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB-Yaa mice. Proc Natl Acad Sci U S A 106, 1518-1523.

168 Bucher, C., Koch, L., Vogtenhuber, C., Goren, E., Munger, M., Panoskaltsis-Mortari, A., Sivakumar, P., and Blazar, B.R. (2009). IL-21 blockade reduces graft-versus-host disease mortality by supporting inducible T regulatory cell generation. Blood 114, 5375-5384. Bufford, J.D., and Gern, J.E. (2005). The hygiene hypothesis revisited. Immunol Allergy Clin North Am 25, 247-262, v-vi. Burnet, M., and Holmes, M.C. (1965). Genetic investigations of autoimmune disease in mice. Nature 207, 368-371. Calabrese, G.C., Luczak, E.N., and Estela Roux, M. (2009). Importance of CCL25 in the attraction of T cells and the role of IL-7 on the signaling pathways in intestinal epithelial cells. Immunobiology. Campbell, D.J., and Butcher, E.C. (2002). Rapid acquisition of tissue-specific homing phenotypes by CD4(+) T cells activated in cutaneous or mucosal lymphoid tissues. J Exp Med 195, 135-141. Carpenter, A.C., and Bosselut, R. (2010). Decision checkpoints in the thymus. Nat Immunol 11, 666-673. Carter, R.H., and Myers, R. (2008). Germinal center structure and function: lessons from CD19. Semin Immunol 20, 43-48. Caruso, R., Botti, E., Sarra, M., Esposito, M., Stolfi, C., Diluvio, L., Giustizieri, M.L., Pacciani, V., Mazzotta, A., Campione, E., et al. (2009). Involvement of interleukin-21 in the epidermal hyperplasia of psoriasis. Nat Med 15, 1013-1015. Castano, L., and Eisenbarth, G.S. (1990). Type-I diabetes: a chronic autoimmune disease of human, mouse, and rat. Annu Rev Immunol 8, 647-679. Caudy, A.A., Reddy, S.T., Chatila, T., Atkinson, J.P., and Verbsky, J.W. (2007). CD25 deficiency causes an immune dysregulation, polyendocrinopathy, enteropathy, X-linked-like syndrome, and defective IL-10 expression from CD4 lymphocytes. J Allergy Clin Immunol 119, 482-487. Cha, S., Nagashima, H., Brown, V.B., Peck, A.B., and Humphreys-Beher, M.G. (2002a). Two NOD Idd-associated intervals contribute synergistically to the development of autoimmune exocrinopathy (Sjogren's syndrome) on a healthy murine background. Arthritis Rheum 46, 1390-1398. Cha, S., Nagashima, H., Peck, A.B., and Humphreys-Beher, M.G. (2002b). IDD3 and IDD5 alleles from nod mice mediate Sjogren's syndrome-like autoimmunity. Adv Exp Med Biol 506, 1035-1039. Chakraborty, A.K., and Das, J. (2010). Pairing computation with experimentation: a powerful coupling for understanding T cell signalling. Nat Rev Immunol 10, 59-71. Chan, T.D., Gatto, D., Wood, K., Camidge, T., Basten, A., and Brink, R. (2009). Antigen affinity controls rapid T-dependent antibody production by driving the expansion rather than the differentiation or extrafollicular migration of early plasmablasts. J Immunol 183, 3139-3149. Chaparro, R.J., Konigshofer, Y., Beilhack, G.F., Shizuru, J.A., McDevitt, H.O., and Chien, Y.H. (2006). Nonobese diabetic mice express aspects of both type 1 and type 2 diabetes. Proc Natl Acad Sci U S A 103, 12475-12480.

169 Chatenoud, L., Thervet, E., Primo, J., and Bach, J.F. (1994). Anti-CD3 antibody induces long-term remission of overt autoimmunity in nonobese diabetic mice. Proc Natl Acad Sci U S A 91, 123-127. Chen, G.J., and Forough, R. (2006). Fibroblast growth factors, fibroblast growth factor receptors, diseases, and drugs. Recent Pat Cardiovasc Drug Discov 1, 211-224. Chen, J.M., Ferec, C., and Cooper, D.N. (2006). A systematic analysis of disease- associated variants in the 3' regulatory regions of human protein-coding genes I: general principles and overview. Hum Genet 120, 1-21. Chen, Z., and O'Shea, J.J. (2008). Th17 cells: a new fate for differentiating helper T cells. Immunol Res 41, 87-102. Chesnut, K., She, J.X., Cheng, I., Muralidharan, K., and Wakeland, E.K. (1993). Characterizations of candidate genes for IDD susceptibility from the diabetes-prone NOD mouse strain. Mamm Genome 4, 549-554. Chi, A.W., Bell, J.J., Zlotoff, D.A., and Bhandoola, A. (2009). Untangling the T branch of the hematopoiesis tree. Curr Opin Immunol 21, 121-126. Cho, B.K., Wang, C., Sugawa, S., Eisen, H.N., and Chen, J. (1999). Functional differences between memory and naive CD8 T cells. Proc Natl Acad Sci U S A 96, 2976-2981. Cho, J.H., Boyman, O., Kim, H.O., Hahm, B., Rubinstein, M.P., Ramsey, C., Kim, D.M., Surh, C.D., and Sprent, J. (2007). An intense form of homeostatic proliferation of naive CD8+ cells driven by IL-2. J Exp Med 204, 1787-1801. Chong, A.S., Shen, J., Tao, J., Yin, D., Kuznetsov, A., Hara, M., and Philipson, L.H. (2006). Reversal of diabetes in non-obese diabetic mice without spleen cell-derived beta cell regeneration. Science 311, 1774-1775. Christianson, S.W., Shultz, L.D., and Leiter, E.H. (1993). Adoptive transfer of diabetes into immunodeficient NOD-scid/scid mice. Relative contributions of CD4+ and CD8+ T-cells from diabetic versus prediabetic NOD.NON-Thy-1a donors. Diabetes 42, 44-55. Chtanova, T., Tangye, S.G., Newton, R., Frank, N., Hodge, M.R., Rolph, M.S., and Mackay, C.R. (2004). T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J Immunol 173, 68-78. Chung, S.W., Kang, B.Y., and Kim, T.S. (2003). Inhibition of interleukin-4 production in CD4+ T cells by peroxisome proliferator-activated receptor-gamma (PPAR-gamma) ligands: involvement of physical association between PPAR-gamma and the nuclear factor of activated T cells transcription factor. Mol Pharmacol 64, 1169-1179. Clauw, D.J., and Witter, J. (2009). Pain and rheumatology: thinking outside the joint. Arthritis Rheum 60, 321-324. Clough, L.E., Wang, C.J., Schmidt, E.M., Booth, G., Hou, T.Z., Ryan, G.A., and Walker, L.S. (2008). Release from regulatory T cell-mediated suppression during the onset of tissue-specific autoimmunity is associated with elevated IL-21. J Immunol 180, 5393-5401.

170 Cohn, L., Elias, J.A., and Chupp, G.L. (2004). Asthma: mechanisms of disease persistence and progression. Annu Rev Immunol 22, 789-815. Cohn, M., Mitchison, N.A., Paul, W.E., Silverstein, A.M., Talmage, D.W., and Weigert, M. (2007). Reflections on the clonal-selection theory. Nat Rev Immunol 7, 823-830. Collins, A., Littman, D.R., and Taniuchi, I. (2009). RUNX proteins in transcription factor networks that regulate T-cell lineage choice. Nat Rev Immunol 9, 106-115. Comi, C., Leone, M., Bonissoni, S., DeFranco, S., Bottarel, F., Mezzatesta, C., Chiocchetti, A., Perla, F., Monaco, F., and Dianzani, U. (2000). Defective T cell fas function in patients with multiple sclerosis. Neurology 55, 921-927. Consortium, W.T.C.C. (2007). Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature 447, 661-678. Coombes, J.L., Siddiqui, K.R., Arancibia-Carcamo, C.V., Hall, J., Sun, C.M., Belkaid, Y., and Powrie, F. (2007). A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid- dependent mechanism. J Exp Med 204, 1757-1764. Coquerelle, C., and Moser, M. (2010). DC subsets in positive and negative regulation of immunity. Immunol Rev 234, 317-334. Coquet, J.M., Chakravarti, S., Kyparissoudis, K., McNab, F.W., Pitt, L.A., McKenzie, B.S., Berzins, S.P., Smyth, M.J., and Godfrey, D.I. (2008a). Diverse cytokine production by NKT cell subsets and identification of an IL-17-producing CD4-NK1.1- NKT cell population. Proc Natl Acad Sci U S A 105, 11287-11292. Coquet, J.M., Chakravarti, S., Smyth, M.J., and Godfrey, D.I. (2008b). Cutting edge: IL-21 is not essential for Th17 differentiation or experimental autoimmune encephalomyelitis. J Immunol 180, 7097-7101. Coquet, J.M., Kyparissoudis, K., Pellicci, D.G., Besra, G., Berzins, S.P., Smyth, M.J., and Godfrey, D.I. (2007). IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol 178, 2827-2834. Corbella, P., Moskophidis, D., Spanopoulou, E., Mamalaki, C., Tolaini, M., Itano, A., Lans, D., Baltimore, D., Robey, E., and Kioussis, D. (1994). Functional commitment to helper T cell lineage precedes positive selection and is independent of T cell receptor MHC specificity. Immunity 1, 269-276. Cote, I., Rogers, N.J., and Lechler, R.I. (2001). Allorecognition. Transfus Clin Biol 8, 318-323. Cottrez, F., and Groux, H. (2004). Specialization in tolerance: innate CD(4+)CD(25+) versus acquired TR1 and TH3 regulatory T cells. Transplantation 77, S12-15. Coyle, A.J., Lehar, S., Lloyd, C., Tian, J., Delaney, T., Manning, S., Nguyen, T., Burwell, T., Schneider, H., Gonzalo, J.A., et al. (2000). The CD28-related molecule ICOS is required for effective T cell-dependent immune responses. Immunity 13, 95- 105. Crispin, J.C., and Tsokos, G.C. (2009). Transcriptional regulation of IL-2 in health and autoimmunity. Autoimmun Rev 8, 190-195.

171 Croft, M., Bradley, L.M., and Swain, S.L. (1994). Naive versus memory CD4 T cell response to antigen. Memory cells are less dependent on accessory cell costimulation and can respond to many antigen-presenting cell types including resting B cells. J Immunol 152, 2675-2685. Cunningham, A.F., Fallon, P.G., Khan, M., Vacheron, S., Acha-Orbea, H., MacLennan, I.C., McKenzie, A.N., and Toellner, K.M. (2002). Th2 activities induced during virgin T cell priming in the absence of IL-4, IL-13, and B cells. J Immunol 169, 2900-2906. D'Alise, A.M., Auyeung, V., Feuerer, M., Nishio, J., Fontenot, J., Benoist, C., and Mathis, D. (2008). The defect in T-cell regulation in NOD mice is an effect on the T- cell effectors. Proc Natl Acad Sci U S A 105, 19857-19862. Datta, S., and Sarvetnick, N.E. (2008). IL-21 limits peripheral lymphocyte numbers through T cell homeostatic mechanisms. PLoS ONE 3, e3118. Davis, I.D., Skak, K., Smyth, M.J., Kristjansen, P.E., Miller, D.M., and Sivakumar, P.V. (2007). Interleukin-21 signaling: functions in cancer and autoimmunity. Clin Cancer Res 13, 6926-6932. De Block, C.E., De Leeuw, I.H., Vertommen, J.J., Rooman, R.P., Du Caju, M.V., Van Campenhout, C.M., Weyler, J.J., Winnock, F., Van Autreve, J., and Gorus, F.K. (2001). Beta-cell, thyroid, gastric, adrenal and coeliac autoimmunity and HLA-DQ types in type 1 diabetes. Clin Exp Immunol 126, 236-241. Deenick, E.K., Chan, A., Ma, C.S., Gatto, D., Schwartzberg, P.L., Brink, R., and Tangye, S.G. (2010). Follicular Helper T Cell Differentiation Requires Continuous Antigen Presentation that Is Independent of Unique B Cell Signaling. Immunity. DeFranco, S., Bonissoni, S., Cerutti, F., Bona, G., Bottarel, F., Cadario, F., Brusco, A., Loffredo, G., Rabbone, I., Corrias, A., et al. (2001). Defective function of Fas in patients with type 1 diabetes associated with other autoimmune diseases. Diabetes 50, 483-488. del Rio, R., Noubade, R., Subramanian, M., Saligrama, N., Diehl, S., Rincon, M., and Teuscher, C. (2008). SNPs upstream of the minimal promoter control IL-2 expression and are candidates for the autoimmune disease-susceptibility locus Aod2/Idd3/Eae3. Genes Immun 9, 115-121. Delves, P.J., and Roitt, I.M. (2000). The immune system. First of two parts. N Engl J Med 343, 37-49. Denny, P., Lord, C.J., Hill, N.J., Goy, J.V., Levy, E.R., Podolin, P.L., Peterson, L.B., Wicker, L.S., Todd, J.A., and Lyons, P.A. (1997). Mapping of the IDDM locus Idd3 to a 0.35-cM interval containing the interleukin-2 gene. Diabetes 46, 695-700. Dent, A.L., Shaffer, A.L., Yu, X., Allman, D., and Staudt, L.M. (1997). Control of inflammation, cytokine expression, and germinal center formation by BCL-6. Science 276, 589-592. Desai, N.M., Bassiri, H., Kim, J., Koller, B.H., Smithies, O., Barker, C.F., Naji, A., and Markmann, J.F. (1993). Islet allograft, islet xenograft, and skin allograft survival in CD8+ T lymphocyte-deficient mice. Transplantation 55, 718-722.

172 Dillon, S.R., and Fink, P.J. (1995). Thymic selection events mediated by the pre- TCR do not depend upon a limiting ligand. Int Immunol 7, 1363-1373. Djuretic, I.M., Levanon, D., Negreanu, V., Groner, Y., Rao, A., and Ansel, K.M. (2007). Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat Immunol 8, 145-153. Dolfi, D.V., Boesteanu, A.C., Petrovas, C., Xia, D., Butz, E.A., and Katsikis, P.D. (2008). Late signals from CD27 prevent Fas-dependent apoptosis of primary CD8+ T cells. J Immunol 180, 2912-2921. Dong, C., Juedes, A.E., Temann, U.A., Shresta, S., Allison, J.P., Ruddle, N.H., and Flavell, R.A. (2001). ICOS co-stimulatory receptor is essential for T-cell activation and function. Nature 409, 97-101. Duncan, A.R., and Winter, G. (1988). The binding site for C1q on IgG. Nature 332, 738-740. Duncan, A.R., Woof, J.M., Partridge, L.J., Burton, D.R., and Winter, G. (1988). Localization of the binding site for the human high-affinity Fc receptor on IgG. Nature 332, 563-564. Ebert, L.M., Horn, M.P., Lang, A.B., and Moser, B. (2004). B cells alter the phenotype and function of follicular-homing CXCR5+ T cells. Eur J Immunol 34, 3562-3571. Eksteen, B., Grant, A.J., Miles, A., Curbishley, S.M., Lalor, P.F., Hubscher, S.G., Briskin, M., Salmon, M., and Adams, D.H. (2004). Hepatic endothelial CCL25 mediates the recruitment of CCR9+ gut-homing lymphocytes to the liver in primary sclerosing cholangitis. J Exp Med 200, 1511-1517. El-Sawy, T., Miura, M., and Fairchild, R. (2004). Early T cell response to allografts occurring prior to alloantigen priming up-regulates innate-mediated inflammation and graft necrosis. Am J Pathol 165, 147-157. Elayat, A.A., el-Naggar, M.M., and Tahir, M. (1995). An immunocytochemical and morphometric study of the rat pancreatic islets. J Anat 186 ( Pt 3), 629-637. Elgueta, R., Benson, M.J., de Vries, V.C., Wasiuk, A., Guo, Y., and Noelle, R.J. (2009). Molecular mechanism and function of CD40/CD40L engagement in the immune system. Immunol Rev 229, 152-172. Elgueta, R., Sepulveda, F.E., Vilches, F., Vargas, L., Mora, J.R., Bono, M.R., and Rosemblatt, M. (2008). Imprinting of CCR9 on CD4 T cells requires IL-4 signaling on mesenteric lymph node dendritic cells. J Immunol 180, 6501-6507. Elliott, E.A., and Flavell, R.A. (1994). Transgenic mice expressing constitutive levels of IL-2 in islet beta cells develop diabetes. Int Immunol 6, 1629-1637. Elsaesser, H., Sauer, K., and Brooks, D.G. (2009). IL-21 is required to control chronic viral infection. Science 324, 1569-1572. Encinas, J.A., Lees, M.B., Sobel, R.A., Symonowicz, C., Greer, J.M., Shovlin, C.L., Weiner, H.L., Seidman, C.E., Seidman, J.G., and Kuchroo, V.K. (1996). Genetic analysis of susceptibility to experimental autoimmune encephalomyelitis in a cross between SJL/J and B10.S mice. J Immunol 157, 2186-2192.

173 Encinas, J.A., Wicker, L.S., Peterson, L.B., Mukasa, A., Teuscher, C., Sobel, R., Weiner, H.L., Seidman, C.E., Seidman, J.G., and Kuchroo, V.K. (1999). QTL influencing autoimmune diabetes and encephalomyelitis map to a 0.15-cM region containing Il2. Nat Genet 21, 158-160. Esteban, L.M., Tsoutsman, T., Jordan, M.A., Roach, D., Poulton, L.D., Brooks, A., Naidenko, O.V., Sidobre, S., Godfrey, D.I., and Baxter, A.G. (2003). Genetic control of NKT cell numbers maps to major diabetes and lupus loci. J Immunol 171, 2873- 2878. Ettinger, R., Munson, S.H., Chao, C.C., Vadeboncoeur, M., Toma, J., and McDevitt, H.O. (2001). A critical role for lymphotoxin-beta receptor in the development of diabetes in nonobese diabetic mice. J Exp Med 193, 1333-1340. Ettinger, R., Sims, G.P., Fairhurst, A.M., Robbins, R., da Silva, Y.S., Spolski, R., Leonard, W.J., and Lipsky, P.E. (2005). IL-21 induces differentiation of human naive and memory B cells into antibody-secreting plasma cells. J Immunol 175, 7867-7879. Falcone, M., Facciotti, F., Ghidoli, N., Monti, P., Olivieri, S., Zaccagnino, L., Bonifacio, E., Casorati, G., Sanvito, F., and Sarvetnick, N. (2004). Up-regulation of CD1d expression restores the immunoregulatory function of NKT cells and prevents autoimmune diabetes in nonobese diabetic mice. J Immunol 172, 5908-5916. Fantini, M.C., Rizzo, A., Fina, D., Caruso, R., Becker, C., Neurath, M.F., Macdonald, T.T., Pallone, F., and Monteleone, G. (2007). IL-21 regulates experimental colitis by modulating the balance between Treg and Th17 cells. Eur J Immunol 37, 3155-3163. Faveeuw, C., Gagnerault, M.C., and Lepault, F. (1995). Isolation of leukocytes infiltrating the islets of Langerhans of diabetes-prone mice for flow cytometric analysis. J Immunol Methods 187, 163-169. Fazilleau, N., McHeyzer-Williams, L.J., Rosen, H., and McHeyzer-Williams, M.G. (2009). The function of follicular helper T cells is regulated by the strength of T cell antigen receptor binding. Nat Immunol 10, 375-384. Fernandez, D., and Perl, A. (2009). Metabolic control of T cell activation and death in SLE. Autoimmun Rev 8, 184-189. Festen, E.A., Goyette, P., Scott, R., Annese, V., Zhernakova, A., Lian, J., Lefebvre, C., Brant, S.R., Cho, J.H., Silverberg, M.S., et al. (2009). Genetic variants in the region harbouring IL2/IL21 associated with ulcerative colitis. Gut 58, 799-804. Feuerer, M., Jiang, W., Holler, P.D., Satpathy, A., Campbell, C., Bogue, M., Mathis, D., and Benoist, C. (2007). Enhanced thymic selection of FoxP3+ regulatory T cells in the NOD mouse model of autoimmune diabetes. Proc Natl Acad Sci U S A 104, 18181-18186. Fina, D., Sarra, M., Caruso, R., Del Vecchio Blanco, G., Pallone, F., MacDonald, T.T., and Monteleone, G. (2008). Interleukin 21 contributes to the mucosal T helper cell type 1 response in coeliac disease. Gut 57, 887-892. Firan, M., Bawdon, R., Radu, C., Ober, R.J., Eaken, D., Antohe, F., Ghetie, V., and Ward, E.S. (2001). The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans. Int Immunol 13, 993-1002.

174 Fontenot, J.D., Rasmussen, J.P., Gavin, M.A., and Rudensky, A.Y. (2005). A function for interleukin 2 in Foxp3-expressing regulatory T cells. Nat Immunol 6, 1142-1151. Forte, G.I., Ragonese, P., Salemi, G., Scola, L., Candore, G., D'Amelio, M., Crivello, A., Di Benedetto, N., Nuzzo, D., Giacalone, A., et al. (2006). Search for genetic factors associated with susceptibility to multiple sclerosis. Ann N Y Acad Sci 1067, 264-269. Fraker, P.J., and Speck, J.C. (1978). Protein and cell membrane iodinations with a sparingly soluble chloroamide, 1,3,4,6-tetrachloro-3a,6a-diphenylglycoluril. Biochem Biophys Res Commun 80, 849–857. Frohlich, A., Kisielow, J., Schmitz, I., Freigang, S., Shamshiev, A.T., Weber, J., Marsland, B.J., Oxenius, A., and Kopf, M. (2009). IL-21R on T cells is critical for sustained functionality and control of chronic viral infection. Science 324, 1576- 1580. Frohlich, A., Marsland, B.J., Sonderegger, I., Kurrer, M., Hodge, M.R., Harris, N.L., and Kopf, M. (2007). IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo. Blood 109, 2023-2031. Garn, H., and Renz, H. (2007). Epidemiological and immunological evidence for the hygiene hypothesis. Immunobiology 212, 441-452. Gavet, O., Alvarez, C., Gaspar, P., and Bornens, M. (2003). Centrin4p, a novel mammalian centrin specifically expressed in ciliated cells. Mol Biol Cell 14, 1818- 1834. Germain, R.N. (2002). T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol 2, 309-322. Ghetie, V., Hubbard, J.G., Kim, J.K., Tsen, M.F., Lee, Y., and Ward, E.S. (1996). Abnormally short serum half-lives of IgG in beta 2-microglobulin-deficient mice. Eur J Immunol 26, 690-696. Ghosh, S., Palmer, S.M., Rodrigues, N.R., Cordell, H.J., Hearne, C.M., Cornall, R.J., Prins, J.B., McShane, P., Lathrop, G.M., Peterson, L.B., et al. (1993). Polygenic control of autoimmune diabetes in nonobese diabetic mice. Nat Genet 4, 404-409. Glas, J., Stallhofer, J., Ripke, S., Wetzke, M., Pfennig, S., Klein, W., Epplen, J.T., Griga, T., Schiemann, U., Lacher, M., et al. (2009). Novel genetic risk markers for ulcerative colitis in the IL2/IL21 region are in epistasis with IL23R and suggest a common genetic background for ulcerative colitis and celiac disease. Am J Gastroenterol 104, 1737-1744. Godfrey, D.I., Hammond, K.J., Poulton, L.D., Smyth, M.J., and Baxter, A.G. (2000). NKT cells: facts, functions and fallacies. Immunol Today 21, 573-583. Godfrey, D.I., Kinder, S.J., Silvera, P., and Baxter, A.G. (1997). Flow cytometric study of T cell development in NOD mice reveals a deficiency in alphabetaTCR+CDR-CD8- thymocytes. J Autoimmun 10, 279-285. Gombert, J.M., Herbelin, A., Tancrede-Bohin, E., Dy, M., Chatenoud, L., Carnaud, C., and Bach, J.F. (1996). Early defect of immunoregulatory T cells in autoimmune diabetes. C R Acad Sci III 319, 125-129.

175 Good, K.L., Bryant, V.L., and Tangye, S.G. (2006). Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL- 21. J Immunol 177, 5236-5247. Goodnow, C.C., Sprent, J., Fazekas de St Groth, B., and Vinuesa, C.G. (2005). Cellular and genetic mechanisms of self tolerance and autoimmunity. Nature 435, 590-597. Gospodarowicz, D., Ill, C.R., and Birdwell, C.R. (1977a). Effects of fibroblast and epidermal growth factors on ovarian cell proliferation in vitro. I. Characterization of the response of granulosa cells to FGF and EGF. Endocrinology 100, 1108-1120. Gospodarowicz, D., Ill, C.R., and Birdwell, C.R. (1977b). Effects of fibroblast and epidermal growth factors on ovarian cell proliferation in vitro. II. Proliferative response of luteal cells to FGF but not EGF. Endocrinology 100, 1121-1128. Gowans, J.L., and Knight, E.J. (1964). The Route of Re-Circulation of Lymphocytes in the Rat. Proc R Soc Lond B Biol Sci 159, 257-282. Green, E.A., and Flavell, R.A. (1999). The initiation of autoimmune diabetes. Curr Opin Immunol 11, 663-669. Greenwald, R.J., Freeman, G.J., and Sharpe, A.H. (2005). The B7 family revisited. Annu Rev Immunol 23, 515-548. Gregory, C.D., and Devitt, A. (2004). The macrophage and the apoptotic cell: an innate immune interaction viewed simplistically? Immunology 113, 1-14. Gunton, J.E., Kulkarni, R.N., Yim, S., Okada, T., Hawthorne, W.J., Tseng, Y.H., Roberson, R.S., Ricordi, C., O'Connell, P.J., Gonzalez, F.J., et al. (2005). Loss of ARNT/HIF1beta mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes. Cell 122, 337-349. Guo, Y., Hill, A.A., Ramsey, R.C., Immermann, F.W., Corcoran, C., Young, D., Lavallie, E.R., Ryan, M., Bechard, T., Pfeifer, R., et al. (2010). Assessing agonistic potential of a candidate therapeutic anti-IL21R antibody. J Transl Med 8, 50. Guzman Moreno, R. (2009). B-cell depletion in autoimmune diseases. Advances in autoimmunity. Autoimmun Rev 8, 585-590. Hamilton-Williams, E.E., Martinez, X., Clark, J., Howlett, S., Hunter, K.M., Rainbow, D.B., Wen, L., Shlomchik, M.J., Katz, J.D., Beilhack, G.F., et al. (2009). Expression of diabetes-associated genes by dendritic cells and CD4 T cells drives the loss of tolerance in nonobese diabetic mice. J Immunol 183, 1533-1541. Hanninen, A., Jaakkola, I., and Jalkanen, S. (1998). Mucosal addressin is required for the development of diabetes in nonobese diabetic mice. J Immunol 160, 6018- 6025. Hanninen, A., Taylor, C., Streeter, P.R., Stark, L.S., Sarte, J.M., Shizuru, J.A., Simell, O., and Michie, S.A. (1993). Vascular addressins are induced on islet vessels during insulitis in nonobese diabetic mice and are involved in lymphoid cell binding to islet endothelium. J Clin Invest 92, 2509-2515. Hans, W., Scholmerich, J., Gross, V., and Falk, W. (2000). Interleukin-12 induced interferon-gamma increases inflammation in acute dextran sulfate sodium induced colitis in mice. Eur Cytokine Netw 11, 67-74.

176 Hartatik, T., Okada, S., Okabe, S., Arima, M., Hatano, M., and Tokuhisa, T. (2001). Binding of BAZF and Bc16 to STAT6-binding DNA sequences. Biochem Biophys Res Commun 284, 26-32. Hawa, M.I., Beyan, H., Buckley, L.R., and Leslie, R.D. (2002). Impact of genetic and non-genetic factors in type 1 diabetes. Am J Med Genet 115, 8-17. Haynes, N.M. (2008). Follicular associated T cells and their B-cell helper qualities. Tissue Antigens 71, 97-104. Haynes, N.M., Allen, C.D., Lesley, R., Ansel, K.M., Killeen, N., and Cyster, J.G. (2007). Role of CXCR5 and CCR7 in follicular Th cell positioning and appearance of a programmed cell death gene-1high germinal center-associated subpopulation. J Immunol 179, 5099-5108. Heinzel, F.P., Sadick, M.D., Holaday, B.J., Coffman, R.L., and Locksley, R.M. (1989). Reciprocal expression of interferon gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for expansion of distinct helper T cell subsets. J Exp Med 169, 59-72. Hendriks, J., Gravestein, L.A., Tesselaar, K., van Lier, R.A., Schumacher, T.N., and Borst, J. (2000). CD27 is required for generation and long-term maintenance of T cell immunity. Nat Immunol 1, 433-440. Henson, P.M., Bratton, D.L., and Fadok, V.A. (2001). Apoptotic cell removal. Curr Biol 11, R795-805. Herber, D., Brown, T.P., Liang, S., Young, D.A., Collins, M., and Dunussi- Joannopoulos, K. (2007). IL-21 has a pathogenic role in a lupus-prone mouse model and its blockade with IL-21R.Fc reduces disease progression. J Immunol 178, 3822- 3830. Hermann-Kleiter, N., and Baier, G. (2010). NFAT pulls the strings during CD4+ T helper cell effector functions. Blood 115, 2989-2997. Herold, K.C., Hagopian, W., Auger, J.A., Poumian-Ruiz, E., Taylor, L., Donaldson, D., Gitelman, S.E., Harlan, D.M., Xu, D., Zivin, R.A., et al. (2002). Anti-CD3 monoclonal antibody in new-onset type 1 diabetes mellitus. N Engl J Med 346, 1692-1698. Hiromura, Y., Kishida, T., Nakano, H., Hama, T., Imanishi, J., Hisa, Y., and Mazda, O. (2007). IL-21 administration into the nostril alleviates murine allergic rhinitis. J Immunol 179, 7157-7165. Hirsch, R., Gress, R.E., Pluznik, D.H., Eckhaus, M., and Bluestone, J.A. (1989). Effects of in vivo administration of anti-CD3 monoclonal antibody on T cell function in mice. II. In vivo activation of T cells. J Immunol 142, 737-743. Hjelmstrom, P. (2001). Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J Leukoc Biol 69, 331-339. Horwitz, M.S., Bradley, L.M., Harbertson, J., Krahl, T., Lee, J., and Sarvetnick, N. (1998). Diabetes induced by Coxsackie virus: initiation by bystander damage and not molecular mimicry. Nat Med 4, 781-785.

177 Hosoe, N., Miura, S., Watanabe, C., Tsuzuki, Y., Hokari, R., Oyama, T., Fujiyama, Y., Nagata, H., and Ishii, H. (2004). Demonstration of functional role of TECK/CCL25 in T lymphocyte-endothelium interaction in inflamed and uninflamed intestinal mucosa. Am J Physiol Gastrointest Liver Physiol 286, G458-466. Hsieh, C.S., Zheng, Y., Liang, Y., Fontenot, J.D., and Rudensky, A.Y. (2006). An intersection between the self-reactive regulatory and nonregulatory T cell receptor repertoires. Nat Immunol 7, 401-410. Hsu, E. (2009). V(D)J recombination: of mice and sharks. Adv Exp Med Biol 650, 166-179. Huang, C.Y., Sleckman, B.P., and Kanagawa, O. (2005). Revision of T cell receptor {alpha} chain genes is required for normal T lymphocyte development. Proc Natl Acad Sci U S A 102, 14356-14361. Humphreys-Beher, M.G., and Peck, A.B. (1999). New concepts for the development of autoimmune exocrinopathy derived from studies with the NOD mouse model. Arch Oral Biol 44 Suppl 1, S21-25. Hunt, K.A., Zhernakova, A., Turner, G., Heap, G.A., Franke, L., Bruinenberg, M., Romanos, J., Dinesen, L.C., Ryan, A.W., Panesar, D., et al. (2008). Newly identified genetic risk variants for celiac disease related to the immune response. Nat Genet 40, 395-402. Iezzi, G., Karjalainen, K., and Lanzavecchia, A. (1998). The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8, 89-95. Ikegami, H., Fujisawa, T., Makino, S., and Ogihara, T. (2003). Congenic mapping and candidate sequencing of susceptibility genes for Type 1 diabetes in the NOD mouse. Ann N Y Acad Sci 1005, 196-204. Ikegami, H., Fujisawa, T., Sakamoto, T., Makino, S., and Ogihara, T. (2004). Idd1 and Idd3 are necessary but not sufficient for development of type 1 diabetes in NOD mouse. Diabetes Res Clin Pract 66 Suppl 1, S85-90. Isaacs, J.D. (2007). T cell immunomodulation--the Holy Grail of therapeutic tolerance. Curr Opin Pharmacol 7, 418-425. Israel, E.J., Patel, V.K., Taylor, S.F., Marshak-Rothstein, A., and Simister, N.E. (1995). Requirement for a beta 2-microglobulin-associated Fc receptor for acquisition of maternal IgG by fetal and neonatal mice. J Immunol 154, 6246-6251. Israel, E.J., Wilsker, D.F., Hayes, K.C., Schoenfeld, D., and Simister, N.E. (1996). Increased clearance of IgG in mice that lack beta 2-microglobulin: possible protective role of FcRn. Immunology 89, 573-578. Ivanov, II, Atarashi, K., Manel, N., Brodie, E.L., Shima, T., Karaoz, U., Wei, D., Goldfarb, K.C., Santee, C.A., Lynch, S.V., et al. (2009). Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139, 485-498. Ivanov, II, McKenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua, D.J., and Littman, D.R. (2006). The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126, 1121-1133.

178 Ivanov, II, Zhou, L., and Littman, D.R. (2007). Transcriptional regulation of Th17 cell differentiation. Semin Immunol 19, 409-417. Iwakoshi, N.N., Greiner, D.L., Rossini, A.A., and Mordes, J.P. (1999). Diabetes prone BB rats are severely deficient in natural killer T cells. Autoimmunity 31, 1-14. Jacobi, A.M., and Diamond, B. (2005). Balancing diversity and tolerance: lessons from patients with systemic lupus erythematosus. J Exp Med 202, 341-344. Jacobson, D.L., Gange, S.J., Rose, N.R., and Graham, N.M. (1997). Epidemiology and estimated population burden of selected autoimmune diseases in the United States. Clin Immunol Immunopathol 84, 223-243. Jaeger, C., Hatziagelaki, E., Petzoldt, R., and Bretzel, R.G. (2001). Comparative analysis of organ-specific autoantibodies and celiac disease--associated antibodies in type 1 diabetic patients, their first-degree relatives, and healthy control subjects. Diabetes Care 24, 27-32. Jansen, A., Voorbij, H.A., Jeucken, P.H., Bruining, G.J., Hooijkaas, H., and Drexhage, H.A. (1993). An immunohistochemical study on organized lymphoid cell infiltrates in fetal and neonatal pancreases. A comparison with similar infiltrates found in the pancreas of a diabetic infant. Autoimmunity 15, 31-38. Jaramillo, A., Gill, B.M., and Delovitch, T.L. (1994). Insulin dependent diabetes mellitus in the non-obese diabetic mouse: a disease mediated by T cell anergy? Life Sci 55, 1163-1177. Jin, H., Carrio, R., Yu, A., and Malek, T.R. (2004). Distinct activation signals determine whether IL-21 induces B cell costimulation, growth arrest, or Bim- dependent apoptosis. J Immunol 173, 657-665. Jin, H., and Malek, T.R. (2006). Redundant and unique regulation of activated mouse B lymphocytes by IL-4 and IL-21. J Leukoc Biol 80, 1416-1423. Johnston, R.J., Poholek, A.C., DiToro, D., Yusuf, I., Eto, D., Barnett, B., Dent, A.L., Craft, J., and Crotty, S. (2009). Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science 325, 1006-1010. Josefowicz, S.Z., and Rudensky, A. (2009). Control of regulatory T cell lineage commitment and maintenance. Immunity 30, 616-625. Jungel, A., Distler, J.H., Kurowska-Stolarska, M., Seemayer, C.A., Seibl, R., Forster, A., Michel, B.A., Gay, R.E., Emmrich, F., Gay, S., et al. (2004). Expression of interleukin-21 receptor, but not interleukin-21, in synovial fibroblasts and synovial macrophages of patients with rheumatoid arthritis. Arthritis Rheum 50, 1468-1476. Junghans, R.P., and Anderson, C.L. (1996). The protection receptor for IgG catabolism is the beta2-microglobulin-containing neonatal intestinal transport receptor. Proc Natl Acad Sci U S A 93, 5512-5516. Kaczynski, J., Cook, T., and Urrutia, R. (2003). Sp1- and Kruppel-like transcription factors. Genome Biol 4, 206. Kamanaka, M., Rainbow, D., Schuster-Gossler, K., Eynon, E.E., Chervonsky, A.V., Wicker, L.S., and Flavell, R.A. (2009). Amino acid polymorphisms altering the glycosylation of IL-2 do not protect from type 1 diabetes in the NOD mouse. Proc Natl Acad Sci U S A 106, 11236-11240.

179 Kamimura, D., Ueda, N., Sawa, Y., Hachida, S., Atsumi, T., Nakagawa, T., Sawa, S., Jin, G.H., Suzuki, H., Ishihara, K., et al. (2004). Evidence of a novel IL-2/15R beta- targeted cytokine involved in homeostatic proliferation of memory CD8+ T cells. J Immunol 173, 6041-6049. Kanagawa, O., Martin, S.M., Vaupel, B.A., Carrasco-Marin, E., and Unanue, E.R. (1998). Autoreactivity of T cells from nonobese diabetic mice: an I-Ag7-dependent reaction. Proc Natl Acad Sci U S A 95, 1721-1724. Kasaian, M.T., Whitters, M.J., Carter, L.L., Lowe, L.D., Jussif, J.M., Deng, B., Johnson, K.A., Witek, J.S., Senices, M., Konz, R.F., et al. (2002). IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Immunity 16, 559-569. Kay, N.E., Ackerman, S.K., and Douglas, S.D. (1979). Anatomy of the immune system. Semin Hematol 16, 252-282. Kelly, E., Won, A., Refaeli, Y., and Van Parijs, L. (2002). IL-2 and related cytokines can promote T cell survival by activating AKT. J Immunol 168, 597-603. Kendall, P.L., Yu, G., Woodward, E.J., and Thomas, J.W. (2007). Tertiary lymphoid structures in the pancreas promote selection of B lymphocytes in autoimmune diabetes. J Immunol 178, 5643-5651. Keymeulen, B., Vandemeulebroucke, E., Ziegler, A.G., Mathieu, C., Kaufman, L., Hale, G., Gorus, F., Goldman, M., Walter, M., Candon, S., et al. (2005). Insulin needs after CD3-antibody therapy in new-onset type 1 diabetes. N Engl J Med 352, 2598-2608. Khader, S.A., Gaffen, S.L., and Kolls, J.K. (2009). Th17 cells at the crossroads of innate and adaptive immunity against infectious diseases at the mucosa. Mucosal Immunol 2, 403-411. Killedar, S.J., Eckenrode, S.E., McIndoe, R.A., She, J.X., Nguyen, C.Q., Peck, A.B., and Cha, S. (2006). Early pathogenic events associated with Sjogren's syndrome (SjS)-like disease of the NOD mouse using microarray analysis. Lab Invest 86, 1243- 1260. Kim, B.O., Liu, Y., Zhou, B.Y., and He, J.J. (2004). Induction of C chemokine XCL1 (lymphotactin/single C motif-1 alpha/activation-induced, T cell-derived and chemokine-related cytokine) expression by HIV-1 Tat protein. J Immunol 172, 1888- 1895. Kim, H.P., Korn, L.L., Gamero, A.M., and Leonard, W.J. (2005). Calcium- dependent activation of interleukin-21 gene expression in T cells. J Biol Chem 280, 25291-25297. King, C. (2009). New insights into the differentiation and function of T follicular helper cells. Nat Rev Immunol 9, 757-766. King, C., Ilic, A., Koelsch, K., and Sarvetnick, N. (2004). Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell 117, 265-277. King, C., Tangye, S.G., and Mackay, C.R. (2008). T follicular helper (TFH) cells in normal and dysregulated immune responses. Annu Rev Immunol 26, 741-766.

180 Kishida, T., Hiromura, Y., Shin-Ya, M., Asada, H., Kuriyama, H., Sugai, M., Shimizu, A., Yokota, Y., Hama, T., Imanishi, J., et al. (2007). IL-21 induces inhibitor of differentiation 2 and leads to complete abrogation of anaphylaxis in mice. J Immunol 179, 8554-8561. Kishimoto, H., and Sprent, J. (2001). A defect in central tolerance in NOD mice. Nat Immunol 2, 1025-1031. Koenecke, C., and Forster, R. (2009). CCR9 and inflammatory bowel disease. Expert Opin Ther Targets 13, 297-306. Korn, T., Bettelli, E., Gao, W., Awasthi, A., Jager, A., Strom, T.B., Oukka, M., and Kuchroo, V.K. (2007a). IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature 448, 484-487. Korn, T., Oukka, M., Kuchroo, V., and Bettelli, E. (2007b). Th17 cells: effector T cells with inflammatory properties. Semin Immunol 19, 362-371. Koulmanda, M., Budo, E., Bonner-Weir, S., Qipo, A., Putheti, P., Degauque, N., Shi, H., Fan, Z., Flier, J.S., Auchincloss, H., Jr., et al. (2007). Modification of adverse inflammation is required to cure new-onset type 1 diabetic hosts. Proc Natl Acad Sci U S A 104, 13074-13079. Krangel, M.S. (2009). Mechanics of T cell receptor gene rearrangement. Curr Opin Immunol 21, 133-139. Kreuwel, H.T., Biggs, J.A., Pilip, I.M., Pamer, E.G., Lo, D., and Sherman, L.A. (2001). Defective CD8+ T cell peripheral tolerance in nonobese diabetic mice. J Immunol 167, 1112-1117. Ku, C.C., Murakami, M., Sakamoto, A., Kappler, J., and Marrack, P. (2000). Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science 288, 675- 678. Kubach, J., Becker, C., Schmitt, E., Steinbrink, K., Huter, E., Tuettenberg, A., and Jonuleit, H. (2005). Dendritic cells: sentinels of immunity and tolerance. Int J Hematol 81, 197-203. Kumar, D., Gemayel, N.S., Deapen, D., Kapadia, D., Yamashita, P.H., Lee, M., Dwyer, J.H., Roy-Burman, P., Bray, G.A., and Mack, T.M. (1993). North-American twins with IDDM. Genetic, etiological, and clinical significance of disease concordance according to age, zygosity, and the interval after diagnosis in first twin. Diabetes 42, 1351-1363. Kunkel, E.J., Campbell, D.J., and Butcher, E.C. (2003). Chemokines in lymphocyte trafficking and intestinal immunity. Microcirculation 10, 313-323. Kusam, S., Toney, L.M., Sato, H., and Dent, A.L. (2003). Inhibition of Th2 differentiation and GATA-3 expression by BCL-6. J Immunol 170, 2435-2441. Kutlu, B., Burdick, D., Baxter, D., Rasschaert, J., Flamez, D., Eizirik, D.L., Welsh, N., Goodman, N., and Hood, L. (2009). Detailed transcriptome atlas of the pancreatic beta cell. BMC Med Genomics 2, 3. La Cava, A. (2008). Tregs are regulated by cytokines: implications for autoimmunity. Autoimmun Rev 8, 83-87.

181 Lacorazza, H.D., and Nikolich-Zugich, J. (2004). Exclusion and inclusion of TCR alpha proteins during T cell development in TCR-transgenic and normal mice. J Immunol 173, 5591-5600. Lafferty, K.J., and Cunningham, A.J. (1975). A new analysis of allogeneic interactions. Aust J Exp Biol Med Sci 53, 27-42. Langrish, C.L., Chen, Y., Blumenschein, W.M., Mattson, J., Basham, B., Sedgwick, J.D., McClanahan, T., Kastelein, R.A., and Cua, D.J. (2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201, 233-240. Larsson, L., Rymo, L., and Berglundh, T. (2010). Sp1 binds to the G allele of the- 1087 polymorphism in the IL-10 promoter and promotes IL-10 mRNA transcription and protein production. Genes Immun 11, 181-187. Lee, G.R., Kim, S.T., Spilianakis, C.G., Fields, P.E., and Flavell, R.A. (2006a). T helper cell differentiation: regulation by cis elements and epigenetics. Immunity 24, 369-379. Lee, Y., Chin, R.K., Christiansen, P., Sun, Y., Tumanov, A.V., Wang, J., Chervonsky, A.V., and Fu, Y.X. (2006b). Recruitment and activation of naive T cells in the islets by lymphotoxin beta receptor-dependent tertiary lymphoid structure. Immunity 25, 499-509. Lenschow, D.J., Walunas, T.L., and Bluestone, J.A. (1996). CD28/B7 system of T cell costimulation. Annu Rev Immunol 14, 233-258. Leonard, W.J., and Spolski, R. (2005). Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol 5, 688-698. Leonard, W.J., Zeng, R., and Spolski, R. (2008). Interleukin 21: a cytokine/cytokine receptor system that has come of age. J Leukoc Biol 84, 348-356. Letourneau, S., Krieg, C., Pantaleo, G., and Boyman, O. (2009). IL-2- and CD25- dependent immunoregulatory mechanisms in the homeostasis of T-cell subsets. J Allergy Clin Immunol 123, 758-762. Li, J., Shen, W., Kong, K., and Liu, Z. (2006). Interleukin-21 induces T-cell activation and proinflammatory cytokine secretion in rheumatoid arthritis. Scand J Immunol 64, 515-522. Li, Q., Harju, S., and Peterson, K.R. (1999). Locus control regions: coming of age at a decade plus. Trends Genet 15, 403-408. Li, Y., Bleakley, M., and Yee, C. (2005). IL-21 influences the frequency, phenotype, and affinity of the antigen-specific CD8 T cell response. J Immunol 175, 2261-2269. Li, Y., and Yee, C. (2008). IL-21 mediated Foxp3 suppression leads to enhanced generation of antigen-specific CD8+ cytotoxic T lymphocytes. Blood 111, 229-235. Liblau, R.S., Singer, S.M., and McDevitt, H.O. (1995). Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol Today 16, 34-38. Linterman, M.A., Beaton, L., Yu, D., Ramiscal, R.R., Srivastava, M., Hogan, J.J., Verma, N.K., Smyth, M.J., Rigby, R.J., and Vinuesa, C.G. (2010). IL-21 acts directly on B cells to regulate Bcl-6 expression and germinal center responses. J Exp Med 207, 353-363.

182 Linterman, M.A., Rigby, R.J., Wong, R.K., Yu, D., Brink, R., Cannons, J.L., Schwartzberg, P.L., Cook, M.C., Walters, G.D., and Vinuesa, C.G. (2009). Follicular helper T cells are required for systemic autoimmunity. J Exp Med 206, 561-576. Linterman, M.A., and Vinuesa, C.G. (2010). Signals that influence T follicular helper cell differentiation and function. Semin Immunopathol 32, 183-196. Liston, A., Lesage, S., Gray, D.H., O'Reilly, L.A., Strasser, A., Fahrer, A.M., Boyd, R.L., Wilson, J., Baxter, A.G., Gallo, E.M., et al. (2004). Generalized resistance to thymic deletion in the NOD mouse; a polygenic trait characterized by defective induction of Bim. Immunity 21, 817-830. Liu, K., and Mohan, C. (2009). Altered B-cell signaling in lupus. Autoimmun Rev 8, 214-218. Liu, L., Xu, Y., Wang, J., and Li, H. (2009). Upregulated IL-21 and IL-21 receptor expression is involved in experimental autoimmune uveitis (EAU). Mol Vis 15, 2938-2944. Liu, S., Lizee, G., Lou, Y., Liu, C., Overwijk, W.W., Wang, G., and Hwu, P. (2007). IL-21 synergizes with IL-7 to augment expansion and anti-tumor function of cytotoxic T cells. Int Immunol 19, 1213-1221. Lohr, J., Knoechel, B., Nagabhushanam, V., and Abbas, A.K. (2005). T-cell tolerance and autoimmunity to systemic and tissue-restricted self-antigens. Immunol Rev 204, 116-127. Loots, G.G., Locksley, R.M., Blankespoor, C.M., Wang, Z.E., Miller, W., Rubin, E.M., and Frazer, K.A. (2000). Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons. Science 288, 136-140. Loots, G.G., and Ovcharenko, I. (2004). rVISTA 2.0: evolutionary analysis of transcription factor binding sites. Nucleic Acids Res 32, W217-221. Lord, C.J., Bohlander, S.K., Hopes, E.A., Montague, C.T., Hill, N.J., Prins, J.B., Renjilian, R.J., Peterson, L.B., Wicker, L.S., Todd, J.A., et al. (1995). Mapping the diabetes polygene Idd3 on mouse chromosome 3 by use of novel congenic strains. Mamm Genome 6, 563-570. Ludewig, B., Odermatt, B., Landmann, S., Hengartner, H., and Zinkernagel, R.M. (1998). Dendritic cells induce autoimmune diabetes and maintain disease via de novo formation of local lymphoid tissue. J Exp Med 188, 1493-1501. Luzina, I.G., Atamas, S.P., Storrer, C.E., daSilva, L.C., Kelsoe, G., Papadimitriou, J.C., and Handwerger, B.S. (2001). Spontaneous formation of germinal centers in autoimmune mice. J Leukoc Biol 70, 578-584. Lyons, P.A., Armitage, N., Argentina, F., Denny, P., Hill, N.J., Lord, C.J., Wilusz, M.B., Peterson, L.B., Wicker, L.S., and Todd, J.A. (2000). Congenic mapping of the type 1 diabetes locus, Idd3, to a 780-kb region of mouse chromosome 3: identification of a candidate segment of ancestral DNA by haplotype mapping. Genome Res 10, 446-453. Ma, H.L., Whitters, M.J., Konz, R.F., Senices, M., Young, D.A., Grusby, M.J., Collins, M., and Dunussi-Joannopoulos, K. (2003). IL-21 activates both innate and

183 adaptive immunity to generate potent antitumor responses that require perforin but are independent of IFN-gamma. J Immunol 171, 608-615. Maillard, I., Fang, T., and Pear, W.S. (2005). Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol 23, 945-974. Malek, T.R. (2008). The biology of interleukin-2. Annu Rev Immunol 26, 453-479. Manel, N., Unutmaz, D., and Littman, D.R. (2008). The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat Immunol 9, 641-649. Mangada, J., Pearson, T., Brehm, M.A., Wicker, L.S., Peterson, L.B., Shultz, L.D., Serreze, D.V., Rossini, A.A., and Greiner, D.L. (2009). Idd loci synergize to prolong islet allograft survival induced by costimulation blockade in NOD mice. Diabetes 58, 165-173. Manz, R.A., Arce, S., Cassese, G., Hauser, A.E., Hiepe, F., and Radbruch, A. (2002). Humoral immunity and long-lived plasma cells. Curr Opin Immunol 14, 517-521. Marcilla, M., and Lopez de Castro, J.A. (2008). Peptides: the cornerstone of HLA- B27 biology and pathogenetic role in spondyloarthritis. Tissue Antigens 71, 495-506. Marquez, A., Orozco, G., Martinez, A., Palomino-Morales, R., Fernandez-Arquero, M., Mendoza, J.L., Taxonera, C., Diaz-Rubio, M., Gomez-Garcia, M., Nieto, A., et al. (2009). Novel association of the interleukin 2-interleukin 21 region with inflammatory bowel disease. Am J Gastroenterol 104, 1968-1975. Marrack, P., Kappler, J., and Kotzin, B.L. (2001). Autoimmune disease: why and where it occurs. Nat Med 7, 899-905. Marsden, V.S., and Strasser, A. (2003). Control of apoptosis in the immune system: Bcl-2, BH3-only proteins and more. Annu Rev Immunol 21, 71-105. Martinez, X., Kreuwel, H.T., Redmond, W.L., Trenney, R., Hunter, K., Rosen, H., Sarvetnick, N., Wicker, L.S., and Sherman, L.A. (2005). CD8+ T cell tolerance in nonobese diabetic mice is restored by insulin-dependent diabetes resistance alleles. J Immunol 175, 1677-1685. Matechak, E.O., Killeen, N., Hedrick, S.M., and Fowlkes, B.J. (1996). MHC class II- specific T cells can develop in the CD8 lineage when CD4 is absent. Immunity 4, 337-347. Matesanz, F., Alcina, A., and Pellicer, A. (1993). Existence of at least five interleukin-2 molecules in different mouse strains. Immunogenetics 38, 300-303. Mattuzzi, S., Barbi, S., Carletto, A., Ravagnani, V., Moore, P.S., Bambara, L.M., and Scarpa, A. (2007). Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol 34, 997-1004. McGuire, H.M., Vogelzang, A., Hill, N., Flodstrom-Tullberg, M., Sprent, J., and King, C. (2009). Loss of parity between IL-2 and IL-21 in the NOD Idd3 locus. Proc Natl Acad Sci U S A 106, 19438-19443. Meguro, A., Ozaki, K., Oh, I., Hatanaka, K., Matsu, H., Tatara, R., Sato, K., Leonard, W.J., and Ozawa, K. (2010). IL-21 is critical for GVHD in a mouse model. Bone Marrow Transplant 45, 723-729.

184 Mehta, D.S., Wurster, A.L., Weinmann, A.S., and Grusby, M.J. (2005). NFATc2 and T-bet contribute to T-helper-cell-subset-specific regulation of IL-21 expression. Proc Natl Acad Sci U S A 102, 2016-2021. Mehta, D.S., Wurster, A.L., Whitters, M.J., Young, D.A., Collins, M., and Grusby, M.J. (2003). IL-21 induces the apoptosis of resting and activated primary B cells. J Immunol 170, 4111-4118. Mellanby, R.J., Thomas, D., Phillips, J.M., and Cooke, A. (2007). Diabetes in non- obese diabetic mice is not associated with quantitative changes in CD4+ CD25+ Foxp3+ regulatory T cells. Immunology 121, 15-28. Meresse, B., Verdier, J., and Cerf-Bensussan, N. (2008). The cytokine interleukin 21: a new player in coeliac disease? Gut 57, 879-881. Meuer, S.C., Hodgdon, J.C., Hussey, R.E., Protentis, J.P., Schlossman, S.F., and Reinherz, E.L. (1983). Antigen-like effects of monoclonal antibodies directed at receptors on human T cell clones. J Exp Med 158, 988-993. Mikuls, T.R., and Weaver, A.L. (2003). Lessons learned in the use of tumor necrosis factor-alpha inhibitors in the treatment of rheumatoid arthritis. Curr Rheumatol Rep 5, 270-277. Minami, Y., Kono, T., Miyazaki, T., and Taniguchi, T. (1993). The IL-2 receptor complex: its structure, function, and target genes. Annu Rev Immunol 11, 245-268. Mitchell, G.F., and Miller, J.F. (1968). Cell to cell interaction in the immune response. II. The source of hemolysin-forming cells in irradiated mice given bone marrow and thymus or thoracic duct lymphocytes. J Exp Med 128, 821-837. Monteleone, G., Pallone, F., and MacDonald, T.T. (2008). Interleukin-21: a critical regulator of the balance between effector and regulatory T-cell responses. Trends Immunol 29, 290-294. Mora, J.R., Bono, M.R., Manjunath, N., Weninger, W., Cavanagh, L.L., Rosemblatt, M., and Von Andrian, U.H. (2003). Selective imprinting of gut-homing T cells by Peyer's patch dendritic cells. Nature 424, 88-93. Morelli, A.E., Zahorchak, A.F., Larregina, A.T., Colvin, B.L., Logar, A.J., Takayama, T., Falo, L.D., and Thomson, A.W. (2001). Cytokine production by mouse myeloid dendritic cells in relation to differentiation and terminal maturation induced by lipopolysaccharide or CD40 ligation. Blood 98, 1512-1523. Moroz, A., Eppolito, C., Li, Q., Tao, J., Clegg, C.H., and Shrikant, P.A. (2004). IL- 21 enhances and sustains CD8+ T cell responses to achieve durable tumor immunity: comparative evaluation of IL-2, IL-15, and IL-21. J Immunol 173, 900-909. Mosmann, T.R., Cherwinski, H., Bond, M.W., Giedlin, M.A., and Coffman, R.L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol 136, 2348-2357. Naumov, Y.N., Bahjat, K.S., Gausling, R., Abraham, R., Exley, M.A., Koezuka, Y., Balk, S.B., Strominger, J.L., Clare-Salzer, M., and Wilson, S.B. (2001). Activation of CD1d-restricted T cells protects NOD mice from developing diabetes by regulating dendritic cell subsets. Proc Natl Acad Sci U S A 98, 13838-13843.

185 Nepom, G.T. (1998). Major histocompatibility complex-directed susceptibility to rheumatoid arthritis. Adv Immunol 68, 315-332. Nepom, G.T., and Kwok, W.W. (1998). Molecular basis for HLA-DQ associations with IDDM. Diabetes 47, 1177-1184. Nguyen, C., Singson, E., Kim, J.Y., Cornelius, J.G., Attia, R., Doyle, M.E., Bulosan, M., Cha, S., and Peck, A.B. (2006). Sjogren's syndrome-like disease of C57BL/6.NOD-Aec1 Aec2 mice: gender differences in keratoconjunctivitis sicca defined by a cross-over in the chromosome 3 Aec1 locus. Scand J Immunol 64, 295- 307. Nishimura, M., Kuboi, Y., Muramoto, K., Kawano, T., and Imai, T. (2009). Chemokines as novel therapeutic targets for inflammatory bowel disease. Ann N Y Acad Sci 1173, 350-356. Nossal, G.J. (1991). B-cell selection and tolerance. Curr Opin Immunol 3, 193-198. Nugent, M.A., and Iozzo, R.V. (2000). Fibroblast growth factor-2. Int J Biochem Cell Biol 32, 115-120. Nurieva, R., Yang, X.O., Martinez, G., Zhang, Y., Panopoulos, A.D., Ma, L., Schluns, K., Tian, Q., Watowich, S.S., Jetten, A.M., et al. (2007). Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature 448, 480-483. Nurieva, R.I., and Chung, Y. (2010). Understanding the development and function of T follicular helper cells. Cell Mol Immunol 7, 190-197. Nurieva, R.I., Chung, Y., Hwang, D., Yang, X.O., Kang, H.S., Ma, L., Wang, Y.H., Watowich, S.S., Jetten, A.M., Tian, Q., et al. (2008). Generation of T follicular helper cells is mediated by interleukin-21 but independent of T helper 1, 2, or 17 cell lineages. Immunity 29, 138-149. Nurieva, R.I., Chung, Y., Martinez, G.J., Yang, X.O., Tanaka, S., Matskevitch, T.D., Wang, Y.H., and Dong, C. (2009). Bcl6 mediates the development of T follicular helper cells. Science 325, 1001-1005. O'Garra, A., and Murphy, K. (1994). Role of cytokines in determining T-lymphocyte function. Curr Opin Immunol 6, 458-466. O'Neill, S.K., Liu, E., and Cambier, J.C. (2009). Change you can B(cell)eive in: recent progress confirms a critical role for B cells in type 1 diabetes. Curr Opin Endocrinol Diabetes Obes 16, 293-298. O'Shea, J.J., and Paul, W.E. (2010). Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells. Science 327, 1098-1102. Odegard, J.M., Marks, B.R., DiPlacido, L.D., Poholek, A.C., Kono, D.H., Dong, C., Flavell, R.A., and Craft, J. (2008). ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity. J Exp Med 205, 2873- 2886. Oettinger, M.A., Schatz, D.G., Gorka, C., and Baltimore, D. (1990). RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248, 1517-1523. Oh, I., Ozaki, K., Meguro, A., Hatanaka, K., Kadowaki, M., Matsu, H., Tatara, R., Sato, K., Iwakura, Y., Nakae, S., et al. (2010). Altered Effector CD4+ T Cell

186 Function in IL-21R-/- CD4+ T Cell-Mediated Graft-Versus-Host Disease. J Immunol 185, 1920-1926. Okada, T., and Cyster, J.G. (2006). B cell migration and interactions in the early phase of antibody responses. Curr Opin Immunol 18, 278-285. Okada, T., Miller, M.J., Parker, I., Krummel, M.F., Neighbors, M., Hartley, S.B., O'Garra, A., Cahalan, M.D., and Cyster, J.G. (2005). Antigen-engaged B cells undergo chemotaxis toward the T zone and form motile conjugates with helper T cells. PLoS Biol 3, e150. Osmond, D.G. (1991). Proliferation kinetics and the lifespan of B cells in central and peripheral lymphoid organs. Curr Opin Immunol 3, 179-185. Ostiguy, V., Allard, E.L., Marquis, M., Leignadier, J., and Labrecque, N. (2007). IL- 21 promotes T lymphocyte survival by activating the phosphatidylinositol-3 kinase signaling cascade. J Leukoc Biol 82, 645-656. Ovcharenko, I., Nobrega, M.A., Loots, G.G., and Stubbs, L. (2004). ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res 32, W280-286. Ozaki, K., Kikly, K., Michalovich, D., Young, P.R., and Leonard, W.J. (2000). Cloning of a type I cytokine receptor most related to the IL-2 receptor beta chain. Proc Natl Acad Sci U S A 97, 11439-11444. Ozaki, K., Spolski, R., Ettinger, R., Kim, H.P., Wang, G., Qi, C.F., Hwu, P., Shaffer, D.J., Akilesh, S., Roopenian, D.C., et al. (2004). Regulation of B cell differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1 and Bcl-6. J Immunol 173, 5361-5371. Ozaki, K., Spolski, R., Feng, C.G., Qi, C.F., Cheng, J., Sher, A., Morse, H.C., 3rd, Liu, C., Schwartzberg, P.L., and Leonard, W.J. (2002). A critical role for IL-21 in regulating immunoglobulin production. Science 298, 1630-1634. Ozawa, K., Sato, K., Oh, I., Ozaki, K., Uchibori, R., Obara, Y., Kikuchi, Y., Ito, T., Okada, T., Urabe, M., et al. (2008). Cell and gene therapy using mesenchymal stem cells (MSCs). J Autoimmun 30, 121-127. Pai, S.Y., Truitt, M.L., and Ho, I.C. (2004). GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells. Proc Natl Acad Sci U S A 101, 1993-1998. Palmer, E. (2003). Negative selection--clearing out the bad apples from the T-cell repertoire. Nat Rev Immunol 3, 383-391. Panum, P.L. (1847). Beobachtungen über das Maserncontagium. Virchows Archiv 1, 492-512. Papadakis, K.A., Landers, C., Prehn, J., Kouroumalis, E.A., Moreno, S.T., Gutierrez- Ramos, J.C., Hodge, M.R., and Targan, S.R. (2003). CC chemokine receptor 9 expression defines a subset of peripheral blood lymphocytes with mucosal T cell phenotype and Th1 or T-regulatory 1 cytokine profile. J Immunol 171, 159-165. Papadakis, K.A., Prehn, J., Moreno, S.T., Cheng, L., Kouroumalis, E.A., Deem, R., Breaverman, T., Ponath, P.D., Andrew, D.P., Green, P.H., et al. (2001). CCR9-

187 positive lymphocytes and thymus-expressed chemokine distinguish small bowel from colonic Crohn's disease. Gastroenterology 121, 246-254. Papadakis, K.A., Prehn, J., Nelson, V., Cheng, L., Binder, S.W., Ponath, P.D., Andrew, D.P., and Targan, S.R. (2000). The role of thymus-expressed chemokine and its receptor CCR9 on lymphocytes in the regional specialization of the mucosal immune system. J Immunol 165, 5069-5076. Paronen, J., Klemetti, P., Kantele, J.M., Savilahti, E., Perheentupa, J., Akerblom, H.K., and Vaarala, O. (1997). Glutamate decarboxylase-reactive peripheral blood lymphocytes from patients with IDDM express gut-specific homing receptor alpha4beta7-integrin. Diabetes 46, 583-588. Parrish-Novak, J., Dillon, S.R., Nelson, A., Hammond, A., Sprecher, C., Gross, J.A., Johnston, J., Madden, K., Xu, W., West, J., et al. (2000). Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408, 57-63. Paus, D., Phan, T.G., Chan, T.D., Gardam, S., Basten, A., and Brink, R. (2006). Antigen recognition strength regulates the choice between extrafollicular plasma cell and germinal center B cell differentiation. J Exp Med 203, 1081-1091. Pearson, T., Weiser, P., Markees, T.G., Serreze, D.V., Wicker, L.S., Peterson, L.B., Cumisky, A.M., Shultz, L.D., Mordes, J.P., Rossini, A.A., et al. (2004). Islet allograft survival induced by costimulation blockade in NOD mice is controlled by allelic variants of Idd3. Diabetes 53, 1972-1978. Peluso, I., Fantini, M.C., Fina, D., Caruso, R., Boirivant, M., MacDonald, T.T., Pallone, F., and Monteleone, G. (2007). IL-21 counteracts the regulatory T cell- mediated suppression of human CD4+ T lymphocytes. J Immunol 178, 732-739. Peng, Y., Kowalewski, R., Kim, S., and Elkon, K.B. (2005). The role of IgM antibodies in the recognition and clearance of apoptotic cells. Mol Immunol 42, 781- 787. Pepper, M., Linehan, J.L., Pagan, A.J., Zell, T., Dileepan, T., Cleary, P.P., and Jenkins, M.K. (2010). Different routes of bacterial infection induce long-lived TH1 memory cells and short-lived TH17 cells. Nat Immunol 11, 83-89. Pereira, J.P., Kelly, L.M., and Cyster, J.G. (2010). Finding the right niche: B-cell migration in the early phases of T-dependent antibody responses. Int Immunol 22, 413-419. Pesce, J., Kaviratne, M., Ramalingam, T.R., Thompson, R.W., Urban, J.F., Jr., Cheever, A.W., Young, D.A., Collins, M., Grusby, M.J., and Wynn, T.A. (2006). The IL-21 receptor augments Th2 effector function and alternative macrophage activation. J Clin Invest 116, 2044-2055. Philipsen, S., and Suske, G. (1999). A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res 27, 2991-3000. Phillips, J.M., Parish, N.M., Bland, C., Sawyer, Y., De La Pena, H., and Cooke, A. (2009). Type 1 Diabetes Development Requires Both CD4+ and CD8+ T cells and Can Be Reversed by Non-Depleting Antibodies Targeting Both T Cell Populations. Rev Diabet Stud 6, 97-103.

188 Piao, W.H., Jee, Y.H., Liu, R.L., Coons, S.W., Kala, M., Collins, M., Young, D.A., Campagnolo, D.I., Vollmer, T.L., Bai, X.F., et al. (2008). IL-21 modulates CD4+ CD25+ regulatory T-cell homeostasis in experimental autoimmune encephalomyelitis. Scand J Immunol 67, 37-46. Pillai, S., and Cariappa, A. (2009). The follicular versus marginal zone B lymphocyte cell fate decision. Nat Rev Immunol 9, 767-777. Podolin, P.L., Wilusz, M.B., Cubbon, R.M., Pajvani, U., Lord, C.J., Todd, J.A., Peterson, L.B., Wicker, L.S., and Lyons, P.A. (2000). Differential glycosylation of interleukin 2, the molecular basis for the NOD Idd3 type 1 diabetes gene? Cytokine 12, 477-482. Porritt, H.E., Rumfelt, L.L., Tabrizifard, S., Schmitt, T.M., Zuniga-Pflucker, J.C., and Petrie, H.T. (2004). Heterogeneity among DN1 prothymocytes reveals multiple progenitors with different capacities to generate T cell and non-T cell lineages. Immunity 20, 735-745. Pot, C., Jin, H., Awasthi, A., Liu, S.M., Lai, C.Y., Madan, R., Sharpe, A.H., Karp, C.L., Miaw, S.C., Ho, I.C., et al. (2009). Cutting edge: IL-27 induces the transcription factor c-Maf, cytokine IL-21, and the costimulatory receptor ICOS that coordinately act together to promote differentiation of IL-10-producing Tr1 cells. J Immunol 183, 797-801. Poulton, L.D., Smyth, M.J., Hawke, C.G., Silveira, P., Shepherd, D., Naidenko, O.V., Godfrey, D.I., and Baxter, A.G. (2001). Cytometric and functional analyses of NK and NKT cell deficiencies in NOD mice. Int Immunol 13, 887-896. Qi, H., Cannons, J.L., Klauschen, F., Schwartzberg, P.L., and Germain, R.N. (2008). SAP-controlled T-B cell interactions underlie germinal centre formation. Nature 455, 764-769. Radaev, S., and Sun, P. (2002). Recognition of immunoglobulins by Fcgamma receptors. Mol Immunol 38, 1073-1083. Rasheed, A.U., Rahn, H.P., Sallusto, F., Lipp, M., and Muller, G. (2006). Follicular B helper T cell activity is confined to CXCR5(hi)ICOS(hi) CD4 T cells and is independent of CD57 expression. Eur J Immunol 36, 1892-1903. Rees, W., Bender, J., Teague, T.K., Kedl, R.M., Crawford, F., Marrack, P., and Kappler, J. (1999). An inverse relationship between T cell receptor affinity and antigen dose during CD4(+) T cell responses in vivo and in vitro. Proc Natl Acad Sci U S A 96, 9781-9786. Reichardt, P., Dornbach, B., and Gunzer, M. (2010). APC, T cells, and the immune synapse. Curr Top Microbiol Immunol 340, 229-249. Reinhardt, R.L., Liang, H.E., and Locksley, R.M. (2009). Cytokine-secreting follicular T cells shape the antibody repertoire. Nat Immunol 10, 385-393. Remmers, E.F., Plenge, R.M., Lee, A.T., Graham, R.R., Hom, G., Behrens, T.W., de Bakker, P.I., Le, J.M., Lee, H.S., Batliwalla, F., et al. (2007). STAT4 and the risk of rheumatoid arthritis and systemic lupus erythematosus. N Engl J Med 357, 977-986. Rhodes, B., and Vyse, T.J. (2007). General aspects of the genetics of SLE. Autoimmunity 40, 550-559.

189 Ribatti, D. (2009). Sir Frank Macfarlane Burnet and the clonal selection theory of antibody formation. Clin Exp Med 9, 253-258. Richer, M.J., and Horwitz, M.S. (2008). Viral infections in the pathogenesis of autoimmune diseases: focus on type 1 diabetes. Front Biosci 13, 4241-4257. Ricordi, C., and Strom, T.B. (2004). Clinical islet transplantation: advances and immunological challenges. Nat Rev Immunol 4, 259-268. Rioux, J.D., and Abbas, A.K. (2005). Paths to understanding the genetic basis of autoimmune disease. Nature 435, 584-589. Rivera-Nieves, J., Ho, J., Bamias, G., Ivashkina, N., Ley, K., Oppermann, M., and Cominelli, F. (2006). Antibody blockade of CCL25/CCR9 ameliorates early but not late chronic murine ileitis. Gastroenterology 131, 1518-1529. Roh, T.Y., Cuddapah, S., and Zhao, K. (2005). Active chromatin domains are defined by acetylation islands revealed by genome-wide mapping. Genes Dev 19, 542-552. Rojas, R.E., Balaji, K.N., Subramanian, A., and Boom, W.H. (1999). Regulation of human CD4(+) alphabeta T-cell-receptor-positive (TCR(+)) and gammadelta TCR(+) T-cell responses to Mycobacterium tuberculosis by interleukin-10 and transforming growth factor beta. Infect Immun 67, 6461-6472. Ron, Y., and Sprent, J. (1987). T cell priming in vivo: a major role for B cells in presenting antigen to T cells in lymph nodes. J Immunol 138, 2848-2856. Roopenian, D.C., and Akilesh, S. (2007). FcRn: the neonatal Fc receptor comes of age. Nat Rev Immunol 7, 715-725. Roper, R.J., Ma, R.Z., Biggins, J.E., Butterfield, R.J., Michael, S.D., Tung, K.S., Doerge, R.W., and Teuscher, C. (2002). Interacting quantitative trait loci control loss of peripheral tolerance and susceptibility to autoimmune ovarian dysgenesis after day 3 thymectomy in mice. J Immunol 169, 1640-1646. Rothenberg, E.V., Moore, J.E., and Yui, M.A. (2008). Launching the T-cell-lineage developmental programme. Nat Rev Immunol 8, 9-21. Rothstein, D.M., and Sayegh, M.H. (2003). T-cell costimulatory pathways in allograft rejection and tolerance. Immunol Rev 196, 85-108. Rudd, C.E., Taylor, A., and Schneider, H. (2009). CD28 and CTLA-4 coreceptor expression and signal transduction. Immunol Rev 229, 12-26. Ryu, S., Kodama, S., Ryu, K., Schoenfeld, D.A., and Faustman, D.L. (2001). Reversal of established autoimmune diabetes by restoration of endogenous beta cell function. J Clin Invest 108, 63-72. Sabapathy, K., Hu, Y., Kallunki, T., Schreiber, M., David, J.P., Jochum, W., Wagner, E.F., and Karin, M. (1999). JNK2 is required for efficient T-cell activation and apoptosis but not for normal lymphocyte development. Curr Biol 9, 116-125. Sadlack, B., Merz, H., Schorle, H., Schimpl, A., Feller, A.C., and Horak, I. (1993). Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75, 253-261.

190 Sakaguchi, S. (2000). Regulatory T cells: key controllers of immunologic self- tolerance. Cell 101, 455-458. Sakaguchi, S. (2004). Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol 22, 531-562. Sallusto, F., Kremmer, E., Palermo, B., Hoy, A., Ponath, P., Qin, S., Forster, R., Lipp, M., and Lanzavecchia, A. (1999). Switch in chemokine receptor expression upon TCR stimulation reveals novel homing potential for recently activated T cells. Eur J Immunol 29, 2037-2045. Sallusto, F., and Lanzavecchia, A. (2009). Heterogeneity of CD4+ memory T cells: functional modules for tailored immunity. Eur J Immunol 39, 2076-2082. Saruta, M., Yu, Q.T., Avanesyan, A., Fleshner, P.R., Targan, S.R., and Papadakis, K.A. (2007). Phenotype and effector function of CC chemokine receptor 9- expressing lymphocytes in small intestinal Crohn's disease. J Immunol 178, 3293- 3300. Savilahti, E., Ormala, T., Saukkonen, T., Sandini-Pohjavuori, U., Kantele, J.M., Arato, A., Ilonen, J., and Akerblom, H.K. (1999). Jejuna of patients with insulin- dependent diabetes mellitus (IDDM) show signs of immune activation. Clin Exp Immunol 116, 70-77. Sawalha, A.H., Kaufman, K.M., Kelly, J.A., Adler, A.J., Aberle, T., Kilpatrick, J., Wakeland, E.K., Li, Q.Z., Wandstrat, A.E., Karp, D.R., et al. (2008). Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus. Ann Rheum Dis 67, 458-461. Schaerli, P., Willimann, K., Lang, A.B., Lipp, M., Loetscher, P., and Moser, B. (2000). CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J Exp Med 192, 1553-1562. Schoenborn, J.R., and Wilson, C.B. (2007). Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol 96, 41-101. Schubert, L.A., Jeffery, E., Zhang, Y., Ramsdell, F., and Ziegler, S.F. (2001). Scurfin (FOXP3) acts as a repressor of transcription and regulates T cell activation. J Biol Chem 276, 37672-37679. Schumacher, J.M., Lee, K., Edelhoff, S., and Braun, R.E. (1995). Distribution of Tenr, an RNA-binding protein, in a lattice-like network within the spermatid nucleus in the mouse. Biol Reprod 52, 1274-1283. Schwartz, R.H. (1992). Costimulation of T lymphocytes: the role of CD28, CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy. Cell 71, 1065-1068. Serreze, D.V., Chapman, H.D., Varnum, D.S., Hanson, M.S., Reifsnyder, P.C., Richard, S.D., Fleming, S.A., Leiter, E.H., and Shultz, L.D. (1996). B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new "speed congenic" stock of NOD.Ig mu null mice. J Exp Med 184, 2049-2053. Setoguchi, R., Hori, S., Takahashi, T., and Sakaguchi, S. (2005). Homeostatic maintenance of natural Foxp3(+) CD25(+) CD4(+) regulatory T cells by interleukin

191 (IL)-2 and induction of autoimmune disease by IL-2 neutralization. J Exp Med 201, 723-735. Shamim, E.A., and Miller, F.W. (2000). Familial autoimmunity and the idiopathic inflammatory myopathies. Curr Rheumatol Rep 2, 201-211. Shang, X.Z., Ma, K.Y., Radewonuk, J., Li, J., Song, X.Y., Griswold, D.E., Emmell, E., and Li, L. (2006). IgE isotype switch and IgE production are enhanced in IL-21- deficient but not IFN-gamma-deficient mice in a Th2-biased response. Cell Immunol 241, 66-74. Sharfe, N., Dadi, H.K., Shahar, M., and Roifman, C.M. (1997). Human immune disorder arising from mutation of the alpha chain of the interleukin-2 receptor. Proc Natl Acad Sci U S A 94, 3168-3171. Sharif, S., Arreaza, G.A., Zucker, P., Mi, Q.S., Sondhi, J., Naidenko, O.V., Kronenberg, M., Koezuka, Y., Delovitch, T.L., Gombert, J.M., et al. (2001). Activation of natural killer T cells by alpha-galactosylceramide treatment prevents the onset and recurrence of autoimmune Type 1 diabetes. Nat Med 7, 1057-1062. Shimokawa, N., Nishiyama, C., Hirota, T., Tamari, M., Hara, M., Ikeda, S., Okumura, K., and Ogawa, H. (2009). Functional analysis of a polymorphism in the promoter region of the IL-12/23p40 gene. Clin Exp Allergy 39, 228-235. Shiow, L.R., Rosen, D.B., Brdickova, N., Xu, Y., An, J., Lanier, L.L., Cyster, J.G., and Matloubian, M. (2006). CD69 acts downstream of interferon-alpha/beta to inhibit S1P1 and lymphocyte egress from lymphoid organs. Nature 440, 540-544. Shoda, L.K., Young, D.L., Ramanujan, S., Whiting, C.C., Atkinson, M.A., Bluestone, J.A., Eisenbarth, G.S., Mathis, D., Rossini, A.A., Campbell, S.E., et al. (2005). A comprehensive review of interventions in the NOD mouse and implications for translation. Immunity 23, 115-126. Silverstein, A.M. (2001). Autoimmunity versus horror autotoxicus: the struggle for recognition. Nat Immunol 2, 279-281. Simon, G., Parker, M., Ramiya, V., Wasserfall, C., Huang, Y., Bresson, D., Schwartz, R.F., Campbell-Thompson, M., Tenace, L., Brusko, T., et al. (2008). Murine antithymocyte globulin therapy alters disease progression in NOD mice by a time-dependent induction of immunoregulation. Diabetes 57, 405-414. Skak, K., Kragh, M., Hausman, D., Smyth, M.J., and Sivakumar, P.V. (2008). Interleukin 21: combination strategies for cancer therapy. Nat Rev Drug Discov 7, 231-240. Skoberne, M., Beignon, A.S., and Bhardwaj, N. (2004). Danger signals: a time and space continuum. Trends Mol Med 10, 251-257. Smink, L.J., Helton, E.M., Healy, B.C., Cavnor, C.C., Lam, A.C., Flamez, D., Burren, O.S., Wang, Y., Dolman, G.E., Burdick, D.B., et al. (2005). T1DBase, a community web-based resource for type 1 diabetes research. Nucleic Acids Res 33, D544-549. Smith, C.A., Williams, G.T., Kingston, R., Jenkinson, E.J., and Owen, J.J. (1989). Antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures. Nature 337, 181-184.

192 Smith, K.A. (1988). Interleukin-2: inception, impact, and implications. Science 240, 1169-1176. Smyth, M.J., Hayakawa, Y., Cretney, E., Zerafa, N., Sivakumar, P., Yagita, H., and Takeda, K. (2006). IL-21 enhances tumor-specific CTL induction by anti-DR5 antibody therapy. J Immunol 176, 6347-6355. Snapper, C.M., and Paul, W.E. (1987). Interferon-gamma and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236, 944-947. Sonderegger, I., Kisielow, J., Meier, R., King, C., and Kopf, M. (2008). IL-21 and IL-21R are not required for development of Th17 cells and autoimmunity in vivo. Eur J Immunol 38, 1833-1838. Spolski, R., Kashyap, M., Robinson, C., Yu, Z., and Leonard, W.J. (2008). IL-21 signaling is critical for the development of type I diabetes in the NOD mouse. Proc Natl Acad Sci U S A 105, 14028-14033. Spolski, R., and Leonard, W.J. (2008). Interleukin-21: basic biology and implications for cancer and autoimmunity. Annu Rev Immunol 26, 57-79. Stavnezer, J. (1996). Antibody class switching. Adv Immunol 61, 79-146. Stefanski, H.E., Jameson, S.C., and Hogquist, K.A. (2000). Positive selection is limited by available peptide-dependent MHC conformations. J Immunol 164, 3519- 3526. Steurer, W., Nickerson, P.W., Steele, A.W., Steiger, J., Zheng, X.X., and Strom, T.B. (1995). Ex vivo coating of islet cell allografts with murine CTLA4/Fc promotes graft tolerance. J Immunol 155, 1165-1174. Stoetzel, C., Muller, J., Laurier, V., Davis, E.E., Zaghloul, N.A., Vicaire, S., Jacquelin, C., Plewniak, F., Leitch, C.C., Sarda, P., et al. (2007). Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am J Hum Genet 80, 1-11. Strand, V., Kimberly, R., and Isaacs, J.D. (2007). Biologic therapies in rheumatology: lessons learned, future directions. Nat Rev Drug Discov 6, 75-92. Stratmann, T., Apostolopoulos, V., Mallet-Designe, V., Corper, A.L., Scott, C.A., Wilson, I.A., Kang, A.S., and Teyton, L. (2000). The I-Ag7 MHC class II molecule linked to murine diabetes is a promiscuous peptide binder. J Immunol 165, 3214- 3225. Stratta, R.J. (1999). Review of immunosuppressive usage in pancreas transplantation. Clin Transplant 13, 1-12. Strengell, M., Julkunen, I., and Matikainen, S. (2004). IFN-alpha regulates IL-21 and IL-21R expression in human NK and T cells. J Leukoc Biol 76, 416-422. Strengell, M., Sareneva, T., Foster, D., Julkunen, I., and Matikainen, S. (2002). IL-21 up-regulates the expression of genes associated with innate immunity and Th1 response. J Immunol 169, 3600-3605. Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Ben-Neriah, Y. (1994). JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77, 727-736.

193 Sundvall, M., Jirholt, J., Yang, H.T., Jansson, L., Engstrom, A., Pettersson, U., and Holmdahl, R. (1995). Identification of murine loci associated with susceptibility to chronic experimental autoimmune encephalomyelitis. Nat Genet 10, 313-317. Surh, C.D., and Sprent, J. (2002). Regulation of naive and memory T-cell homeostasis. Microbes Infect 4, 51-56. Surh, C.D., and Sprent, J. (2005). Regulation of mature T cell homeostasis. Semin Immunol 17, 183-191. Surh, C.D., and Sprent, J. (2008). Homeostasis of naive and memory T cells. Immunity 29, 848-862. Sutherland, A.P., Van Belle, T., Wurster, A.L., Suto, A., Michaud, M., Zhang, D., Grusby, M.J., and von Herrath, M. (2009). Interleukin-21 is required for the development of type 1 diabetes in NOD mice. Diabetes 58, 1144-1155. Suto, A., Nakajima, H., Hirose, K., Suzuki, K., Kagami, S., Seto, Y., Hoshimoto, A., Saito, Y., Foster, D.C., and Iwamoto, I. (2002). Interleukin 21 prevents antigen- induced IgE production by inhibiting germ line C(epsilon) transcription of IL-4- stimulated B cells. Blood 100, 4565-4573. Szabo, S.J., Kim, S.T., Costa, G.L., Zhang, X., Fathman, C.G., and Glimcher, L.H. (2000). A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100, 655-669. Szabo, S.J., Sullivan, B.M., Peng, S.L., and Glimcher, L.H. (2003). Molecular mechanisms regulating Th1 immune responses. Annu Rev Immunol 21, 713-758. Tafuri, A., Shahinian, A., Bladt, F., Yoshinaga, S.K., Jordana, M., Wakeham, A., Boucher, L.M., Bouchard, D., Chan, V.S., Duncan, G., et al. (2001). ICOS is essential for effective T-helper-cell responses. Nature 409, 105-109. Takeda, Y., Caudell, P., Grady, G., Wang, G., Suwa, A., Sharp, G.C., Dynan, W.S., and Hardin, J.A. (1999). Human RNA helicase A is a lupus autoantigen that is cleaved during apoptosis. J Immunol 163, 6269-6274. Tang, Q., Adams, J.Y., Penaranda, C., Melli, K., Piaggio, E., Sgouroudis, E., Piccirillo, C.A., Salomon, B.L., and Bluestone, J.A. (2008). Central role of defective interleukin-2 production in the triggering of islet autoimmune destruction. Immunity 28, 687-697. Tarlinton, D.M., and Smith, K.G. (2000). Dissecting affinity maturation: a model explaining selection of antibody-forming cells and memory B cells in the germinal centre. Immunol Today 21, 436-441. Taylor, S.R., Salama, A.D., Joshi, L., Pusey, C.D., and Lightman, S.L. (2009). Rituximab is effective in the treatment of refractory ophthalmic Wegener's granulomatosis. Arthritis Rheum 60, 1540-1547. Teta, M., Long, S.Y., Wartschow, L.M., Rankin, M.M., and Kushner, J.A. (2005). Very slow turnover of beta-cells in aged adult mice. Diabetes 54, 2557-2567. Teuscher, C., Wardell, B.B., Lunceford, J.K., Michael, S.D., and Tung, K.S. (1996). Aod2, the locus controlling development of atrophy in neonatal thymectomy-induced autoimmune ovarian dysgenesis, co-localizes with Il2, Fgfb, and Idd3. J Exp Med 183, 631-637.

194 Todd, J.A., Aitman, T.J., Cornall, R.J., Ghosh, S., Hall, J.R., Hearne, C.M., Knight, A.M., Love, J.M., McAleer, M.A., Prins, J.B., et al. (1991). Genetic analysis of autoimmune type 1 diabetes mellitus in mice. Nature 351, 542-547. Todd, J.A., Walker, N.M., Cooper, J.D., Smyth, D.J., Downes, K., Plagnol, V., Bailey, R., Nejentsev, S., Field, S.F., Payne, F., et al. (2007). Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes. Nat Genet 39, 857-864. Toellner, K.M., Luther, S.A., Sze, D.M., Choy, R.K., Taylor, D.R., MacLennan, I.C., and Acha-Orbea, H. (1998). T helper 1 (Th1) and Th2 characteristics start to develop during T cell priming and are associated with an immediate ability to induce immunoglobulin class switching. J Exp Med 187, 1193-1204. Ueda, H., Howson, J.M., Esposito, L., Heward, J., Snook, H., Chamberlain, G., Rainbow, D.B., Hunter, K.M., Smith, A.N., Di Genova, G., et al. (2003). Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature 423, 506-511. Uematsu, Y., Ryser, S., Dembic, Z., Borgulya, P., Krimpenfort, P., Berns, A., von Boehmer, H., and Steinmetz, M. (1988). In transgenic mice the introduced functional T cell receptor beta gene prevents expression of endogenous beta genes. Cell 52, 831-841. van Heel, D.A., Franke, L., Hunt, K.A., Gwilliam, R., Zhernakova, A., Inouye, M., Wapenaar, M.C., Barnardo, M.C., Bethel, G., Holmes, G.K., et al. (2007). A genome-wide association study for celiac disease identifies risk variants in the region harboring IL2 and IL21. Nat Genet 39, 827-829. Vignali, D.A., Collison, L.W., and Workman, C.J. (2008). How regulatory T cells work. Nat Rev Immunol 8, 523-532. Vinuesa, C.G., Cook, M.C., Angelucci, C., Athanasopoulos, V., Rui, L., Hill, K.M., Yu, D., Domaschenz, H., Whittle, B., Lambe, T., et al. (2005a). A RING-type ubiquitin ligase family member required to repress follicular helper T cells and autoimmunity. Nature 435, 452-458. Vinuesa, C.G., Sanz, I., and Cook, M.C. (2009). Dysregulation of germinal centres in autoimmune disease. Nat Rev Immunol 9, 845-857. Vinuesa, C.G., Sze, D.M., Cook, M.C., Toellner, K.M., Klaus, G.G., Ball, J., and MacLennan, I.C. (2003). Recirculating and germinal center B cells differentiate into cells responsive to polysaccharide antigens. Eur J Immunol 33, 297-305. Vinuesa, C.G., Tangye, S.G., Moser, B., and Mackay, C.R. (2005b). Follicular B helper T cells in antibody responses and autoimmunity. Nat Rev Immunol 5, 853- 865. Vitali, C., Bombardieri, S., Jonsson, R., Moutsopoulos, H.M., Alexander, E.L., Carsons, S.E., Daniels, T.E., Fox, P.C., Fox, R.I., Kassan, S.S., et al. (2002). Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Ann Rheum Dis 61, 554-558. Vogelzang, A., and King, C. (2008). The modulatory capacity of interleukin-21 in the pathogenesis of autoimmune disease. Front Biosci 13, 5304-5315.

195 Vogelzang, A., McGuire, H.M., Yu, D., Sprent, J., Mackay, C.R., and King, C. (2008). A fundamental role for interleukin-21 in the generation of T follicular helper cells. Immunity 29, 127-137. Vollmer, T.L., Liu, R., Price, M., Rhodes, S., La Cava, A., and Shi, F.D. (2005). Differential effects of IL-21 during initiation and progression of autoimmunity against neuroantigen. J Immunol 174, 2696-2701. von Boehmer, H., Teh, H.S., and Kisielow, P. (1989). The thymus selects the useful, neglects the useless and destroys the harmful. Immunol Today 10, 57-61. Wagner, D.H., Jr. (2007). Re-shaping the T cell repertoire: TCR editing and TCR revision for good and for bad. Clin Immunol 123, 1-6. Waldner, M.J., and Neurath, M.F. (2009). Gene Therapy Using IL 12 Family Members in Infection, Auto Immunity, and Cancer. Curr Gene Ther. Walker, L.S., and Abbas, A.K. (2002). The enemy within: keeping self-reactive T cells at bay in the periphery. Nat Rev Immunol 2, 11-19. Walters, M., Wang, Y., Lai, N., Baumgart, T., Zhao, B., Dairaghi, D.J., Bekker, P., Ertl, L.S., Penfold, M.E., Jaen, J.C., et al. (2010). Characterization of CCX282-B, an orally bioavailable antagonist of the CCR9 chemokine receptor, for the treatment of inflammatory bowel disease. J Pharmacol Exp Ther. Wang, F., Huang, C.Y., and Kanagawa, O. (1998). Rapid deletion of rearranged T cell antigen receptor (TCR) Valpha-Jalpha segment by secondary rearrangement in the thymus: role of continuous rearrangement of TCR alpha chain gene and positive selection in the T cell repertoire formation. Proc Natl Acad Sci U S A 95, 11834- 11839. Wang, L., and Bosselut, R. (2009). CD4-CD8 lineage differentiation: Thpok-ing into the nucleus. J Immunol 183, 2903-2910. Wang, X.F., Yuan, S.L., Jiang, L., Zhang, X.L., Li, S.F., Guo, Y., Wu, C.L., and Chen, J.J. (2007). [Changes of serum BAFF and IL-21 levels in patients with systemic lupus erythematosus and their clinical significance]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 23, 1041-1042. Wardemann, H., Yurasov, S., Schaefer, A., Young, J.W., Meffre, E., and Nussenzweig, M.C. (2003). Predominant autoantibody production by early human B cell precursors. Science 301, 1374-1377. Wasserfall, C.H., and Atkinson, M.A. (2006). Autoantibody markers for the diagnosis and prediction of type 1 diabetes. Autoimmun Rev 5, 424-428. Webb, S., and Sprent, J. (1987). Downregulation of T cell responses by antibodies to the T cell receptor. J Exp Med 165, 584-589. Webster, K.E., Walters, S., Kohler, R.E., Mrkvan, T., Boyman, O., Surh, C.D., Grey, S.T., and Sprent, J. (2009). In vivo expansion of T reg cells with IL-2-mAb complexes: induction of resistance to EAE and long-term acceptance of islet allografts without immunosuppression. J Exp Med 206, 751-760. Wei, G., Wei, L., Zhu, J., Zang, C., Hu-Li, J., Yao, Z., Cui, K., Kanno, Y., Roh, T.Y., Watford, W.T., et al. (2009). Global mapping of H3K4me3 and H3K27me3

196 reveals specificity and plasticity in lineage fate determination of differentiating CD4+ T cells. Immunity 30, 155-167. Wei, L., Laurence, A., Elias, K.M., and O'Shea, J.J. (2007). IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem 282, 34605-34610. White, L., Krishnan, S., Strbo, N., Liu, H., Kolber, M.A., Lichtenheld, M.G., Pahwa, R.N., and Pahwa, S. (2007). Differential effects of IL-21 and IL-15 on perforin expression, lysosomal degranulation, and proliferation in CD8 T cells of patients with human immunodeficiency virus-1 (HIV). Blood 109, 3873-3880. Whitmarsh, A.J., and Davis, R.J. (2004). Analyzing mitogen-activated protein kinase (MAPK) activities in T cells. Curr Protoc Immunol Chapter 11, Unit 11 18. Wicker, L.S., Clark, J., Fraser, H.I., Garner, V.E., Gonzalez-Munoz, A., Healy, B., Howlett, S., Hunter, K., Rainbow, D., Rosa, R.L., et al. (2005). Type 1 diabetes genes and pathways shared by humans and NOD mice. J Autoimmun 25 Suppl, 29- 33. Wicker, L.S., Todd, J.A., Prins, J.B., Podolin, P.L., Renjilian, R.J., and Peterson, L.B. (1994). Resistance alleles at two non-major histocompatibility complex-linked insulin-dependent diabetes loci on chromosome 3, Idd3 and Idd10, protect nonobese diabetic mice from diabetes. J Exp Med 180, 1705-1713. Willerford, D.M., Chen, J., Ferry, J.A., Davidson, L., Ma, A., and Alt, F.W. (1995). Interleukin-2 receptor alpha chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3, 521-530. Williams, L.M., and Rudensky, A.Y. (2007). Maintenance of the Foxp3-dependent developmental program in mature regulatory T cells requires continued expression of Foxp3. Nat Immunol 8, 277-284. Wilson, C.B., Rowell, E., and Sekimata, M. (2009). Epigenetic control of T-helper- cell differentiation. Nat Rev Immunol 9, 91-105. Wilson, S.B., Kent, S.C., Patton, K.T., Orban, T., Jackson, R.A., Exley, M., Porcelli, S., Schatz, D.A., Atkinson, M.A., Balk, S.P., et al. (1998). Extreme Th1 bias of invariant Valpha24JalphaQ T cells in type 1 diabetes. Nature 391, 177-181. Wong, F.S., Siew, L.K., and Wen, L. (2008). CD8+ T-cells and their interaction with other cells in damage to islet beta-cells. Biochem Soc Trans 36, 316-320. Wong, F.S., Wen, L., Tang, M., Ramanathan, M., Visintin, I., Daugherty, J., Hannum, L.G., Janeway, C.A., Jr., and Shlomchik, M.J. (2004). Investigation of the role of B-cells in type 1 diabetes in the NOD mouse. Diabetes 53, 2581-2587. Wong, P., and Pamer, E.G. (2003). CD8 T cell responses to infectious pathogens. Annu Rev Immunol 21, 29-70. Wu, Z., Kim, H.P., Xue, H.H., Liu, H., Zhao, K., and Leonard, W.J. (2005). Interleukin-21 receptor gene induction in human T cells is mediated by T-cell receptor-induced Sp1 activity. Mol Cell Biol 25, 9741-9752. Wurbel, M.A., Philippe, J.M., Nguyen, C., Victorero, G., Freeman, T., Wooding, P., Miazek, A., Mattei, M.G., Malissen, M., Jordan, B.R., et al. (2000). The chemokine TECK is expressed by thymic and intestinal epithelial cells and attracts double- and

197 single-positive thymocytes expressing the TECK receptor CCR9. Eur J Immunol 30, 262-271. Wurster, A.L., Rodgers, V.L., Satoskar, A.R., Whitters, M.J., Young, D.A., Collins, M., and Grusby, M.J. (2002). Interleukin 21 is a T helper (Th) cell 2 cytokine that specifically inhibits the differentiation of naive Th cells into interferon gamma- producing Th1 cells. J Exp Med 196, 969-977. Yamagata, T., Benoist, C., and Mathis, D. (2006). A shared gene-expression signature in innate-like lymphocytes. Immunol Rev 210, 52-66. Yamamoto, H., Monden, M., Kawai, M., Uenaka, A., Gotoh, M., Mori, T., Sakurai, M., Shiku, H., and Nakayama, E. (1990). The role of CD8+ and CD4+ cells in islet allograft rejection. Transplantation 50, 120-125. Yamamoto-Furusho, J.K., Miranda-Perez, E., Fonseca-Camarillo, G., Sanchez- Munoz, F., Barreto-Zuniga, R., and Dominguez-Lopez, A. (2009). Interleukin 21 expression is increased in rectal biopsies from patients with ulcerative colitis. Inflamm Bowel Dis. Yamanouchi, J., Rainbow, D., Serra, P., Howlett, S., Hunter, K., Garner, V.E., Gonzalez-Munoz, A., Clark, J., Veijola, R., Cubbon, R., et al. (2007). Interleukin-2 gene variation impairs regulatory T cell function and causes autoimmunity. Nat Genet 39, 329-337. Yang, X.D., Sytwu, H.K., McDevitt, H.O., and Michie, S.A. (1997). Involvement of beta 7 integrin and mucosal addressin cell adhesion molecule-1 (MAdCAM-1) in the development of diabetes in obese diabetic mice. Diabetes 46, 1542-1547. Yi, J.S., Du, M., and Zajac, A.J. (2009). A vital role for interleukin-21 in the control of a chronic viral infection. Science 324, 1572-1576. Yokosuka, T., and Saito, T. (2009). Dynamic regulation of T-cell costimulation through TCR-CD28 microclusters. Immunol Rev 229, 27-40. You, S., Alyanakian, M.A., Segovia, B., Damotte, D., Bluestone, J., Bach, J.F., and Chatenoud, L. (2008). Immunoregulatory pathways controlling progression of autoimmunity in NOD mice. Ann N Y Acad Sci 1150, 300-310. Youinou, P., and Jamin, C. (2009). The weight of interleukin-6 in B cell-related autoimmune disorders. J Autoimmun 32, 206-210. Young, D.A., Hegen, M., Ma, H.L., Whitters, M.J., Albert, L.M., Lowe, L., Senices, M., Wu, P.W., Sibley, B., Leathurby, Y., et al. (2007). Blockade of the interleukin- 21/interleukin-21 receptor pathway ameliorates disease in animal models of rheumatoid arthritis. Arthritis Rheum 56, 1152-1163. Yu, D., Rao, S., Tsai, L.M., Lee, S.K., He, Y., Sutcliffe, E.L., Srivastava, M., Linterman, M., Zheng, L., Simpson, N., et al. (2009). The Transcriptional Repressor Bcl-6 Directs T Follicular Helper Cell Lineage Commitment. Immunity. Zeng, R., Spolski, R., Casas, E., Zhu, W., Levy, D.E., and Leonard, W.J. (2007). The molecular basis of IL-21-mediated proliferation. Blood 109, 4135-4142. Zeng, R., Spolski, R., Finkelstein, S.E., Oh, S., Kovanen, P.E., Hinrichs, C.S., Pise- Masison, C.A., Radonovich, M.F., Brady, J.N., Restifo, N.P., et al. (2005). Synergy

198 of IL-21 and IL-15 in regulating CD8+ T cell expansion and function. J Exp Med 201, 139-148. Zerrahn, J., Held, W., and Raulet, D.H. (1997). The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell 88, 627-636. Zheng, S.G., Wang, J., Wang, P., Gray, J.D., and Horwitz, D.A. (2007). IL-2 is essential for TGF-beta to convert naive CD4+CD25- cells to CD25+Foxp3+ regulatory T cells and for expansion of these cells. J Immunol 178, 2018-2027. Zhernakova, A., Alizadeh, B.Z., Bevova, M., van Leeuwen, M.A., Coenen, M.J., Franke, B., Franke, L., Posthumus, M.D., van Heel, D.A., van der Steege, G., et al. (2007). Novel association in chromosome 4q27 region with rheumatoid arthritis and confirmation of type 1 diabetes point to a general risk locus for autoimmune diseases. Am J Hum Genet 81, 1284-1288. Zhou, L., Chong, M.M., and Littman, D.R. (2009). Plasticity of CD4+ T cell lineage differentiation. Immunity 30, 646-655. Zhou, L., Ivanov, II, Spolski, R., Min, R., Shenderov, K., Egawa, T., Levy, D.E., Leonard, W.J., and Littman, D.R. (2007). IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8, 967-974.

199 8 Appendices

8.1 Appendix 1

200

Figure 8.1 Sequence alignment of the IL-21 distal promoter for the NOD and B6 alleles. Sequences were aligned using the ClustalW Service at the European Bioinformatics Institute web server. Nucleotide numbers are assigned relative to the start of the previously reported IL-21 cDNA sequence (Kim et al., 2005). Asterisks indicate nucleotide identities.

201 8.2 Appendix 2

202 Figure 8.2 Map of the Idd3 region The locations of the genes in the interval (grey boxes), their direction of transcription (vertical arrows), and the locations of all CNSs (red horizontal arrows) are shown. Density of CNSs (between mouse and human) is indicated by the histogram (along left of figure), as number of CNSs per 100kb. CNSs that showed homology with human and 4 or 5 other mammals, and were greater than 600kb in length have been numbered (1-9), with length and identity between mouse and human indicated. Sequence comparison was performed using the Web-based rVista tool (Loots and Ovcharenko, 2004) utilising the ECR Browser (Ovcharenko et al., 2004).

203 8.3 Appendix 3: First Author Publication Arising From This Thesis

204