US 2007.0128662A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0128662 A1 Isacoff et al. (43) Pub. Date: Jun. 7, 2007

(54) PHOTOREACTIVE REGULATOR OF Publication Classification PROTEIN FUNCTION AND METHODS OF USE THEREOF (51) Int. Cl. GOIN 33/53 (2006.01) (76) Inventors: Ehud Y. Isacoff, Berkeley, CA (US); C07K I4/95 (2006.01) Richard H. Kramer, Oakland, CA C7H 2L/04 (2006.01) (US); Dirk Trauner, San Francisco, CA CI2P 2/06 (2006.01) (US); Matthew R. Banghart, Oakland, CI2N 15/74 (2006.01) CA (US); Matthew Volgraf, Oakland, CI2N I/2 (2006.01) CA (US); Pablo Ignacio Gorostiza A6II 38/16 (2006.01) Langa, Barcelona (ES) (52) U.S. Cl...... 435/7.1; 435/69.1; 435/252.3: 435/471; 530/350, 536/23.5; Correspondence Address: 514f12 BOZICEVIC, FIELD & FRANCIS LLP 1900 UNIVERSITY AVENUE SUTE 200 (57) ABSTRACT EAST PALO ALTO, CA 94.303 (US) The present invention provides a synthetic regulator of Appl. No.: 11/601,591 protein function, which regulator is a light-sensitive regu (21) lator. The present invention further provides a light-regu (22) Filed: Nov. 17, 2006 lated polypeptide that includes a subject synthetic regulator. Also provided are cells and membranes comprising a subject Related U.S. Application Data light-regulated polypeptide. The present invention further provides methods of modulating protein function, involving (60) Provisional application No. 60/737,935, filed on Nov. use of light. The present invention further provides methods 18, 2005. of identifying agents that modulate protein function. Patent Application Publication Jun. 7, 2007 Sheet 1 of 34 US 2007/O128662 A1

F.G. 1

a MAL-AZO-GRA

Patent Application Publication Jun. 7, 2007 Sheet 2 of 34 US 2007/0128662 A1

FIG 2

3. b 350

30 Ontrol Control Control 2 O Block UV Vis. eO 250 C S. g 200 C O 150

100 O 2 4 8 6 10 Time (min) C d 72 ZDZZZZZTAZZZZZ M 1000 200 ZZ Wis. Dark 800 OUV 150 ZVis. 2 2 OUV 9- 600 Soo E wa 95 400 50 O ( ) 200 O O O 2 4 6 8 10 2 14 16 O 50 100 150 200 250 300 Time (min) Time (s) Patent Application Publication Jun. 7, 2007 Sheet 3 of 34 US 2007/0128662 A1

3. b 500 360 340 380 400 420 500 0.25 100 0.20 tranS 3 a. 80 is 0.15 CC -S 9 60 3 0.10 40 -O s a 0.05 cis O 20

0.00 O 250 300 350 400 450 500 550 O 5 10 15 20 Wavelength (nm) Time (min) C d 1.0 1.O 2 30.85 0.85-Y s O O D S 0.6 06 P s W. Y cus E.N 0.4 0.4.S25 s O 5 E 5 s Z 0.0-0 0.0 O.O 0.2 0.4 0.6 0.8 10 320 360 400 440 480 520 560 600 Time (min) Wavelength (nm)

FIG. 3 Patent Application Publication Jun. 7, 2007 Sheet 4 of 34 US 2007/0128662 A1 3. I S&T DXX X& mV 500 390 nt nm. 10 S b

mV 50 mS

C 7 6 500 nm 9 5 O 390 nm s on 4 5 is 3 2S 2 Z

MAL-AZO-QA MAL-AZO-QA Shaker + Shaker

FIG. 4 Patent Application Publication Jun. 7, 2007 Sheet 5 of 34 US 2007/O128662 A1

FIG. 5A

Patent Application Publication Jun. 7, 2007 Sheet 6 of 34 US 2007/O128662 A1

-OOC1)-1 COO 2: (2S,4R)-4-allylglutamate

H O 6 H NH -OOc1N1 coo 3: Tether model

F.G. 6B AZObenzene Maleimide N O TranS y - C's,N Ki C 1N1as '''3 O H 4: MAG OOC COO 380m 500 nm Agonist

O N // O O N O H on Cis OOC HN *-n-so -OOc'NH; Patent Application Publication Jun. 7, 2007 Sheet 7 of 34 US 2007/O128662 A1

FIG. 6C

-OOc1N1 coo

Patent Application Publication Jun. 7, 2007 Sheet 8 of 34 US 2007/O128662 A1

O.J.'SDI

uluu9 Patent Application Publication Jun. 7, 2007 Sheet 9 of 34 US 2007/O128662 A1

H NH 1NH ''O Hera,b NSNs O 2 HN HN 5: Azodianiline 6 O l Ho' C de f-h o-cooh s o-cooE Hair o?-cooE -- H Boc BOC 7: L-Pyroglutamic acid 8 9 H N-N NC 5 H i-k H.N- N C 10 H o-cooE BOC H (ii, C NC5N ge O N HOOC1N1COOH 4: MAGHC Patent Application Publication Jun. 7, 2007 Sheet 10 of 34 US 2007/O128662 A1

FIG 9A glu 300 M

6OO 500 s 400 3OO

FIG. 9B

tether model (nM) glu 300 um 3 1 O.3 0.10.01

Patent Application Publication Jun. 7, 2007 Sheet 11 of 34 US 2007/O128662 A1

FIG 10

O gyu. NH ooc1\1COO nic Q H O 3: Tether model '''d) H NH 3 Patent Application Publication Jun. 7, 2007 Sheet 12 of 34 US 2007/O128662 A1

A 51.00 al 0.75 w UDs 0,50 2 0.25 600 E500 Sooo 400 300 400 SOO 600 3OO excitation wavelength (nm)

D 3S 1.00

s 0.75 E to so ge s N se

gas 9Sis via 2000 3oo Too r so" so excitation wavelength (nm) 05 - excitation wavelength (nm) Patent Application Publication Jun. 7, 2007 Sheet 13 of 34 US 2007/O128662 A1

FIG. 12

A

2ootooooooo time (min) B 200 pA 2 min Patent Application Publication Jun. 7, 2007 Sheet 14 of 34 US 2007/0128662 A1

FIG. 13

A B 500 nm. 380 nm O O. /1BDy O Glu O)."A G e C gluReimsoniii.

D glu glu 300M glu MAG 100nM glu 300uM + MAG 100nM 300uM R" 36M A \A".is 380/500nm - 380/500mm 10 min Patent Application Publication Jun. 7, 2007 Sheet 15 of 34 US 2007/O128662 A1 FIG. 14

300 uM glu

1 nA

1 OS 600 Patent Application Publication Jun. 7, 2007 Sheet 16 of 34 US 2007/0128662 A1 miOOZmioOLQmioO£

W uopenueouoso emoee

| XONG]

esuodsel empeau Patent Application Publication Jun. 7, 2007 Sheet 17 of 34 US 2007/0128662 A1 FIG. 16

&83§8. NZ MAG-1 MAG-2 photoswitch length

D

NYNY MAG-1 MAG-2 MAG-1 MAG-2 photoswitch length photoswitch length

Patent Application Publication Jun. 7, 2007 Sheet 18 of 34 US 2007/0128662 A1

H N1

-- N(4.

-/

O H Z

cºmºaegae, Z

k O o? Cy light-regulated polypeptide is present in a living cell in a multicellular organism. Orr, - 0111. The synthetic regulator is stably associated with the ligand-binding polypeptide or near a ligand binding site of su-O a ligand-binding polypeptide. For example, the synthetic CAQ regulator is stably associated with an amino acid side chain or other linkage group (e.g., a Sugar moiety, a high affinity moiety Such as biotin, etc.) in the ligand-binding polypeptide US 2007/0128662 A1 Jun. 7, 2007

Such that, in one configuration, the ligand binds to the ligand 0114 For example, in some embodiments, the ligand has binding site and effects a change in an activity of the a first probability of binding to the ligand site at a first polypeptide. In some embodiments, the synthetic regulator wavelength of light; the ligand has a second probability of is stably associated with a linkage group that is from about binding to the ligand binding site at a second wavelength of 1 A to about 50 A away from the ligand binding site, e.g., light; and the second probability is lower than the first the synthetic regulator is covalently linked to a site that is probability. In other embodiments, the ligand has a first from about 1 A to about 5 A, from about 5 A to about 7 A, probability of binding to the ligand site at a first wavelength from about 7 A to about 10 A, from about 10 A to about 15 of light; the ligand has a second probability of binding to the A, from about 15 A to about 20 A, from about 20 A to about ligand binding site at a second wavelength of light; and the 25 A, from about 25 A to about 30 A, from about 30 A to second probability is higher than the first probability. In about 35A, from about 35 A to about 40 A, from about 40 other embodiments, ligand has a first probability of binding A to about 45 A, or from about 45 A to about 50 A from the to the ligand site when exposed to light; the ligand has a ligand binding site. second probability of binding to the ligand binding site in the 0112 A change in the wavelength and/or intensity of light absence of light (e.g., in darkness); and the second prob (AW) to which the light-regulated polypeptide is exposed ability is lower than the first probability. In other embodi results in a change in ligand binding to a ligand-binding site ments, the ligand has a first probability of binding to the of the light-regulated polypeptide, e.g., results in a change in ligand site when exposed to light; the ligand has a second binding of the ligand portion of the synthetic regulated to the probability of binding to the ligand binding site in the ligand-binding site of the light-regulated polypeptide. A absence of light and the second probability is higher than the “change in the wavelength of light to which the light first probability. regulated polypeptide is exposed includes: 1) a change 0115 The local concentration of the ligand portion of the from w to w; 2) a change from w to w; 3) a change from synthetic regulator at the ligand binding site in a subject w to darkness (no light); and 4) a change from darkness to light-regulated polypeptide is high. For example, the local W. Repetitive changing from w to w, then from w to w. concentration of the ligand portion of the synthetic regulator and back, e.g., Switching from a first wavelength to a second at the ligand binding site in a Subject light-regulated wavelength, and back again repeatedly, is also contem polypeptide ranges from about 500 nM to about 50 nM, e.g., plated. Repetitive changing from light to darkness, from from about 500 nM to about 750 nM, from about 750 nM to darkness to light, etc., is also contemplated. about 1 mM, from about 1 mM to about 5 mM, from about 0113. In some embodiments, the change in wavelength 5 mM to about 10 mM, from about 10 mM to about 20 mM, (from w to w; from light to darkness; or from darkness to from about 20 mM to about 30 mM, or from about 30 mM light) results in a change in binding of the ligand to a to about 50 mM. ligand-binding site. As used herein, a “change in binding of a ligand to a ligand-binding site' includes increased binding Change in Wavelength Resulting in Binding of the Ligand to and decreased binding. As used herein, “increased binding the Ligand-Binding Site or Higher Affinity Ligand Binding includes one or more of an increased probability of binding to Ligand-Binding Site of the ligand to the ligand-binding site; an increased binding 0116. In some embodiments, a change in the wavelength affinity of the ligand for the ligand-binding site; an increased of light to which the light-regulated polypeptide is exposed local concentration of the ligand at the ligand-binding site; results in an increase in binding affinity of the ligand portion and an increased occupancy of the ligand in the ligand of a subject synthetic regulator for a ligand-binding site of binding site. As used herein, “decreased binding includes the light-regulated polypeptide. For example, in some one or more of: a decreased probability of binding of the embodiments, a change in wavelength of light to which the ligand to the ligand-binding site; a decreased binding affinity light-regulated polypeptide is exposed results in an at least of the ligand for the ligand-binding site; a decreased local about 10%, at least about 20%, at least about 30%, at least concentration of the ligand at the ligand-binding site; and a about 50%, at least about 75%, at least about 2-fold, at least decreased occupancy of the ligand in the ligand-binding site. about 5-fold, at least about 10-fold, at least about 25-fold, at As used herein, the term “change in wavelength' to which least about 50-fold, at least about 100-fold, at least about a synthetic regulator is exposed, or to which a ligand 250-fold, at least about 500-fold, at least about 10-fold, at binding polypeptide? synthetic light regulator complex is least about 5x10-fold, at least about 10-fold, at least about exposed, refers to a change in wavelength from w to w; a 5x10-fold, or greater, increase in binding affinity. change from light to darkness; or a change from darkness to light. An increase in binding includes an increase of from 0.117) Where the ligand is an agonist, the change in about 10% to about 50%, from about 50% to about 2-fold, wavelength will in some embodiments result in activation of from about 2-fold to about 5-fold, from about 5-fold to about the light-regulated polypeptide. Where the ligand is an 10-fold, from about 10-fold to about 50-fold, from about agonist, the change in wavelength will in some embodi 50-fold to about 10-fold, from about 10-fold to about ments result in desensitization of the light-regulated 10-fold, from about 10-fold to about 10-fold, from about polypeptide. Conversely, where the ligand is an antagonist, 10-fold to about 10-fold, or a greater than 10-fold the change in wavelength results in a block of activation of increase in binding. A decrease in binding includes a the light-regulated polypeptide, e.g., block of the ability to decrease of from about 5% to about 10% to about 20% to activate the light-regulated polypeptide with free agonist. about 30%, from about 30% to about 40%, from about 40% Where the ligand is a blocker (e.g., a pore blocker of an ion to about 50%, from about 50% to about 60%, from about channel, an active site blocker of an enzyme, or an interac 60% to about 70%, from about 70% to about 80%, from tion domain that binds to other biological macromolecules about 80% to about 90%, or from about 90% to 100% Such as polypeptides or nucleic acids), the change in wave decrease in binding. length results in block of polypeptide activity. US 2007/0128662 A1 Jun. 7, 2007

0118 Expressed another way, where the ligand is an site of the polypeptide. In other embodiments, the ligand agonist, and where a change in the wavelength of light to binding site is a pore of an ion channel. In other embodi which the light-regulated polypeptide is exposed results in a ments, the ligand binding site is an interaction motif or higher binding affinity of the ligand moiety of the synthetic domain through which the polypeptide interacts with other regulator to the ligand-binding site of the light-regulated molecules (e.g., polypeptides; nucleic acids). polypeptide, the change in wavelength results in transition from an inactive state to an active state, or to a desensitized Ligand-Binding Polypeptides state. Where the ligand is an antagonist, the change in 0123 Suitable ligand-binding polypeptides include any wavelength results in transition from a responsive state to an polypeptide having a ligand binding site. Suitable polypep unresponsive state. Where the ligand is a blocker, the change tides include, but are not limited to, enzymes; ion channels; in wavelength results in transition from an active state to an transporters; receptors; motor proteins; scaffolding proteins; inactive state. adaptors; membrane trafficking proteins; cytoskeleton pro Change in Wavelength Resulting in Removal of Ligand from teins; and transcription factors. Exemplary, non-limiting Ligand-Binding Site, or Reduced Binding Affinity ligand-binding polypeptides include ligand-gated ion chan nels, receptor tyrosine kinases, G-protein coupled receptors, 0119). In some embodiments, a change in the wavelength ion pumps; amino acid transporters; proteins involved in of light to which the light-regulated polypeptide is exposed secretion; and the like. In some embodiments, the ligand results in removal of the ligand portion of a Subject synthetic binding polypeptide is other than an acetylcholine receptor. regulator from a ligand-binding site of the light-regulated polypeptide, e.g., the ligand is not bound to the ligand 0.124 Enzymes include, but are not limited to, lipases: binding site. In some embodiments, a change in the wave synthases; epoxidases; phosphorylases; kinases; oxi length of light to which the light-regulated polypeptide is doreductases, e.g., oxidases, dehydrogenases, reductases, exposed results in reduced binding affinity of the ligand peroxidases, hydroxylases, and oxygenases; acylases; portion of a subject synthetic regulator for a ligand-binding hydrolases, e.g., esterases, phosphatases, glycosidases, pro site of the light-regulated polypeptide, e.g., the ligand has teases, and peptidases; lyases, e.g., decarboxylases, aldola reduced binding affinity for the ligand-binding site. For ses, and dehydratases; transferases, e.g., Sulfotransferases, example, in Some embodiments, a change in the wavelength aminotransferases, and transpeptidases; isomerases, e.g., of light to which the light-regulated polypeptide is exposed racemases, epimerases, cis-trans isomerases, intramolecular results in a reduction of binding affinity of at least about oxidoreductases, and intramolecular transferases; ligases, 10%, at least about 20%, at least about 25%, at least about e.g., DNA ligases, amino acid-RNA ligases, acid-thiol 30%, at least about 40%, at least about 50%, at least about ligases, amide synthetases, peptide synthetases, and cyclo 60%, at least about 70%, at least about 80%, at least about ligases; and the like. In some embodiments, the ligand 90%, at least about 95%, or more. binding protein is an enzyme chosen from lipases, esterases, proteases, glycosidases, glycosyltransferases, phosphatases, 0120 Where the ligand is an agonist, the change in kinases, mono- and dioxygenases, haloperoxidazes, lignin wavelength will in Some embodiments result in deactivation peroxidases, diarylpropane peroxidazes, epozide hydro of the light-regulated polypeptide. Where the ligand is an lazes, nitrile hydratases, nitrilases, transaminases, amidases, agonist, the change in wavelength will in Some embodi acylases, helicases, topoisomerases, polymerases, and Syn ments result in recovery from desensitization of the light regulated polypeptide. Conversely, where the ligand is an thetases. antagonist, the change in wavelength results in activation of 0.125 Ion channels include, but are not limited to, cation the light-regulated polypeptide, or results in removal of a channels; sodium ion channels; potassium ion channels blocker from the light-regulated polypeptide. Where the (where potassium channels include, e.g., a KV1 potassium ligand is a blocker (e.g., a pore blocker of an ion channel, an channel; a KV2 potassium channel; a KV3 potassium chan active site blocker of an enzyme, or an interaction domain nel; a Kv4 potassium channel; an HCN potassium channel, that binds to other biological macromolecules Such as e.g., HCN1, HCN2; a HERG potassium channel; an EAG polypeptides or nucleic acids), the change in wavelength potassium channel; calcium ion channels; chloride ion chan results in relief of a block in polypeptide activity and permits nels; cyclic nucleotide-gated channels; 2-transmembrane the polypeptide to function normally. domain channels, including channels selective for potas 0121 Expressed another way, where the ligand is an sium, and less selective cation channels; water and glycerol agonist, and where a change in the wavelength of light to channels; proton channels; and the like. In some embodi which the light-regulated polypeptide is exposed results in ments, a cation channel is a Voltage-gated cation channel, removal (or non-binding) of the ligand moiety of the Syn e.g., a Voltage-gated Sodium channel (e.g., Nav), a Voltage thetic regulator from the ligand-binding site of the light gated calcium channel (e.g., Cav), a Voltage-gated potassium regulated polypeptide, the change in wavelength results in channel (e.g., KV), or a proton channel (HV). In some embodiments, an ion channel is an inward rectifier potas transition from an active state to an inactive state, or from a sium channel (e.g., a member of the Kir family). In some desensitized state to a responsive state. Where the ligand is embodiments, the ion channel is a ligand-gated ion channel. an antagonist, the change in wavelength results in transition A variety of ligand-gated ion channels are known in the art. from an unresponsive state to a responsive state. Where the Suitable ion channels include pentameric receptors, e.g., ligand is a blocker, the change in wavelength results in nicotinic acetylcholine receptors; gamma aminobutyric acid transition from an inactive state to an active state. (GABA) receptors; glycine receptors; and 5-hydrox 0122) In some embodiments, the polypeptide is an ytryptamine(5-HT) receptors. Other ligand-gated ion chan enzyme, and the ligand binding site is a catalytic active site. nels include a PtXr channer, a glycine receptor (GlyR), In other embodiments, the ligand binding site is an allosteric ASIC, etc. Suitable ion channels also include tetrameric US 2007/0128662 A1 Jun. 7, 2007 receptors, e.g., glutamate receptors, including N-methyl-D- corresponding wild-type or naturally-occurring polypeptide aspartate (NMDA) receptors, non-NMDA receptors, by one to 15 amino acids, e.g., where the amino acid C.-amino-3-hydroxy-5-methylisoxazole-4-propionic acid sequence has been altered to include an amino acid that (AMPA) receptors, an inotropic glutamate receptor (e.g., provides for attachment to the binding moiety of the linker iGluR6), and kainate (KA) receptors; purinergic receptors, domain of the synthetic regulator. e.g., P1 receptors. P2 receptors; and the like. For a descrip tion of various potassium channels, see, e.g., Doyle et al. 0.130. In some embodiments, the ligand-binding protein (1998) Science 280:69-77) and references cited therein. In comprises one or more amino acid Substitutions and/or Some embodiments, an ion channel is a G protein-coupled insertions and/or deletions compared to the amino acid receptor (GPCR), e.g., a muscarinic GPCR, a dopaminergic sequence of a naturally-occurring polypeptide. In some of GPCR, a serotonergic GPCR, an adrenergic GPCR, an these embodiments, the ligand-binding protein is a variant opiate GPCR, a glutamate GPCR, a cannabanoid GPCR, a ligand-binding protein that comprises one or more amino peptidergic GPCR, an olfactory GPCR, a gustatory GPCR, acid Substitutions, compared to a naturally-occurring pro tein, Such that the variant ligand-binding protein comprises etc. a moiety for stable association of synthetic regulator. For 0126 Transcription factors include, but are not limited to, example, in some embodiments, an amino acid in a ligand ligand-binding proteins that control transcription and that binding protein is Substituted with a cysteine, and the are inducible by the ligand. Such proteins include, but are synthetic regulator is covalently linked to the cysteine not limited to, an ecdysone receptor (see, e.g., Koelle et al. residue. Cell 67:59 (1991); Christianson and Kafatos, Biochem. Biophys. Res. Comm. 193: 1318 (1993); Henrich et al., 0.131. In some embodiments, the ligand-binding protein Nucleic Acids Res. 18:4143 (1990); and U.S. Pat. No. is a fusion protein, where the fusion protein includes the 6,958,236); a retinoic acid receptor; a glucocorticoid recep ligand-binding protein fused in-frame to a heterologous tor (see, e.g., Picard et al. (1988) Cell 54: 1073-1080); a protein, e.g., a protein other than the ligand-binding protein, tetracycline-transactivator protein (tTA) or a tet repressor where the heterologous protein is also referred to as a (tetR) protein of the tetracycline repressor/activator system “fusion partner.” In some embodiments, the fusion partner is (see, e.g., WO 94/29442: WO 96/40892; and WO linked to the ligand-binding protein at the N-terminus of the 96/01313). Suitable transcription factors also include pro ligand-binding protein. In other embodiments, the fusion teins that enhance or repress transcription in a manner partner is linked at the C-terminus of the ligand-binding regulated by binding to other proteins or small ligands, e.g., protein. In other embodiments, the fusion partner is internal CREB, and helix-loop-helix proteins. to the ligand-binding protein. 0127 Receptors include, but are not limited to, G-protein 0.132 Suitable fusion partners include, but are not limited coupled receptors, e.g., opioid receptors (e.g., Ö-opioid to, epitope tags; Solubilization domains; polypeptides that receptors, u-opioid receptors, K-opioid receptors), peptide provide for insertion into a biological membrane; polypep hormone receptors, neurotransmitter receptors, odorant tides that provide for uptake into a cell, e.g., polypeptides receptors, nicotinic acetylcholine receptors, a dopamine that provide for uptake into the cytoplasm or into an intra receptor, a muscarinic receptor, a serotonin receptor, and the cellular compartment; polypeptides that selectively bind to like. native proteins, including at essential protein interaction interfaces; polypeptides that provide for subcellular local 0128. Also suitable is the ligand-binding domain of any ization; polypeptides that provide a detectable signal (e.g., of the aforementioned proteins. For example, in some fluorescent proteins; chromogenic proteins; enzymes that embodiments, a Subject light-regulated polypeptide com generate luminescent, fluorescent, or chromogenic products; prises the ligand-binding domain of a ligand-binding and the like). polypeptide; and a subject synthetic regulator in stable association with the ligand-binding domain. In some 0.133 Suitable fusion partners include, but are not limited embodiments, the ligand-binding polypeptide comprises the to, luciferase (e.g., firefly luciferase and derivatives thereof; ligand-binding domain of a ligand-binding protein, fused to Renilla luciferase and derivatives thereof); B-galactosidase; a heterologous protein. In some embodiments, the ligand chloramphenicol acetyl transferase; glutathione S trans binding polypeptide is an isolated ligand-binding domain of ferase; a green fluorescent protein (GFP), including, but not a ligand-binding protein, e.g., lacking any other domains limited to, a GFP derived from Aequoria victoria or a that may be present in the native polypeptide, such as derivative thereof, a number of which are commercially regulatory domains, transmembrane domains, and the like. available; a GFP from a species such as Renilla reniformis, Renilla mulleri, or Ptilosarcus guernyi, as described in, e.g., 0129. In some embodiments, the ligand-binding protein WO 99/49019 and Peelle et al. (2001) J Protein Chem. is a wild-type polypeptide, e.g., the polypeptide has a 20:507-519; any of a variety of fluorescent and colored wild-type or natives amino acid sequence, e.g., an amino proteins from Anthozoan species, as described in, e.g., Matz acid sequence that has not been altered by recombinant et al. (1999) Nature Biotechnol. 17:969-973, U.S. Patent methods. In other embodiments, the ligand-binding protein Publication No. 2002/0197676, or U.S. Patent Publication is a recombinant polypeptide. In some embodiments, the No. 2005/0032085; a red fluorescent protein; a yellow ligand-binding protein is a synthetic polypeptide. Recombi fluorescent protein; a Lumio TM tag (e.g., a peptide of the nant polypeptides include variant polypeptides that have sequence Cys-Cys-Xaa-Xaa-Cys-Cys, where Xaa is any been engineered such that the amino acid sequence differs amino acid other than cysteine, e.g., where Xaa-Xaa is from a wild-type or naturally-occurring polypeptide. Variant Pro-Gly, which peptide is specifically bound by a fluorescein polypeptides include polypeptides comprising an amino acid derivative having two As(III) substituents, e.g., 4',5'-bis(1, sequence that differs from the amino acid sequence of a 3.2-dithioarsolan-2-yl)fluorescein; see, e.g., Griflin et al. US 2007/0128662 A1 Jun. 7, 2007

(1998) Science 281:269; Griffin et al. (2000) Methods Enzy where the synthetic regulator comprises a linker domain mol. 327:565; and Adams et al. (2002) J. Am. Chem. Soc. comprising a reactive electrophilic moiety, and where, after 124:6063); and the like. binding of the ligand to the ligand-binding site, the reactive electrophilic moiety binds to an amino acid side chain of the Compositions polypeptide, thereby conferring light regulation on the 0134) The present invention further provides composi polypeptide. Such that a light-regulated polypeptide is gen tions comprising a Subject light-regulated polypeptide. erated. Compositions comprising a Subject light-regulated polypep Cells tide will in many embodiments include one or more of a salt, e.g., NaCl, MgCl, KCl, MgSO, etc.; a buffering agent, 0.138. The present invention further provides a cell com e.g., a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-(2- prising a subject light-regulated polypeptide. A subject cell ethanesulfonic acid) (HEPES), 2-(N-Morpholino)ethane finds use in a variety of applications, e.g., Screening appli sulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid cations, such as identification of agents that modulate the sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid activity of a polypeptide; and research applications such as (MOPS), N-tris Hydroxymethylmethyl-3-aminopropane examination of a metabolic pathway, or other physiological Sulfonic acid (TAPS), etc.; a solubilizing agent; a detergent, event. Where the cell is used in a screening assay, the cell e.g., a non-ionic detergent such as Tween-20, etc.; a protease can be referred to as a “test cell.” inhibitor; and the like. 0.139. In some embodiments, the cell is a eukaryotic cell Methods of Generating a Light-Regulated Polypeptide in in vitro cell culture, and is grown as an adherent mono layer, or in Suspension. In other embodiments, the cell is a 0135) In some embodiments, a light-regulated polypep eukaryotic cell and is part of a tissue or organ, either in vivo tide is generated by reacting a ligand-binding polypeptide or in vitro. In other embodiments, the cell is a eukaryotic cell with a subject synthetic regulator in a cell-free in vitro and is part of a living multicellular organism, e.g., a proto reaction. In other embodiments, a light-regulated polypep Zoan, an amphibian, a reptile, a plant, an avian organism, a tide is generated by affinity labeling a ligand-binding mammal, a fungus, an algae, a yeast, a marine microorgan polypeptide with a subject synthetic regulator, where the ism, a marine invertebrate, an arthropod, an isopod, an ligand-binding polypeptide is a wild-type, native, or endog insect, an arachnid, etc. In other embodiments, the cell is a enous polypeptide. In some embodiments, the ligand-bind prokaryotic cell. ing polypeptide is associated with a living cell (in vitro or in vivo), the cell that comprises the ligand-binding polypeptide 0140. In other embodiments, the cell is a member of is contacted with the synthetic regulator, where the synthetic archaea, e.g., an archaebacterium. Archaebacteria include a regulator binds to the ligand-binding polypeptide. methanogen, an extreme halophile, an extreme thermophile, and the like. Suitable archaebacteria include, but are not 0136. In some embodiments, the amino acid sequence of limited to, any member of the groups Crenarchaeota (e.g., a polypeptide is modified to include an attachment amino Sulfolobus solfataricus, Defulfitrococcus mobilis, Pyrodic acid at or near the ligand-binding site, where the attachment tium occultum, Thermofilum pendens, Thermoproteus amino acid provides an attachment site for the binding tenax), Euryarchaeota (e.g., Thermococcus celer; Methano moiety of the ligand domain of the synthetic regulator. For coccus thermolithotrophicus, Methanococcus jannaschii, example, a single amino acid Substitution is carried out to Methanobacterium thermoautotrophicum, Methanobacte introduce a cysteine residue into a polypeptide, where the rium formicicum, Methanothermus fervidus, Archaeoglobus introduced cysteine residue provides a site for attachment of fiulgidus, Thermoplasma acidophilum, Haloferax volcanni, a synthetic regulator, e.g., where the linker domain includes Methanosarcina barkeri, Methanosaeta concilli, Methano a maleimide moiety. spririllum hungatei, Methanomicrobium mobile), and Korar 0137 As noted above, in some embodiments, a light chaeota. regulated polypeptide is generated by reacting a ligand 0.141. In some embodiments, the cell is of a particular binding polypeptide with a Subject synthetic regulator, tissue or cell type. For example, where the organism is a where the ligand portion of the synthetic regulator binds to plant, the cell is part of the xylem, the phloem, the cambium a ligand-binding site of the ligand-binding polypeptide, and layer, leaves, roots, etc. Where the organism is an animal, the the binding moiety of the linker domain is thus favored to cell will in some embodiments be from a particular tissue form a stable association with any of a number of different (e.g., lung, liver, heart, kidney, brain, spleen, skin, fetal amino acid residues near the ligand binding site. This tissue, etc.), or a particular cell type (e.g., neuronal cells, method is referred to as “affinity labeling.” This method is epithelial cells, endothelial cells, astrocytes, macrophages, suitable for labeling isolated polypeptides in vitro; and is also suitable for labeling a polypeptide present in a living glial cells, islet cells, T lymphocytes, B lymphocytes, etc.). cell, either in vitro or in vivo. For example, this method is 0142. A subject cell is in many embodiments a unicellular Suitable for labeling an endogenous polypeptide present in a organism, or is grown in culture as a single cell Suspension, living cell, either in vitro or in vivo. Thus, the present or as monolayer. In some embodiments, a Subject cell is a invention provides a method of conferring light regulation eukaryotic cell. Suitable eukaryotic cells include, but are not on a polypeptide (e.g., a recombinant polypeptide, an endog limited to, yeast cells, insect cells, plant cells, fungal cells, enous polypeptide, a native polypeptide, a wild-type mammalian cells, and algal cells. Suitable eukaryotic host polypeptide), the method generally involving contacting a cells include, but are not limited to, Pichia pastoris, Pichia polypeptide comprising a ligand binding site with a subject finlandica, Pichia trehalophila, Pichia koclamae, Pichia synthetic regulator, where the ligand moiety of the synthetic membranaefaciens, Pichia opuntiae, Pichia thermotolerans, regulator binds to the ligand-binding site of the polypeptide, Pichia salictaria, Pichia guercuum, Pichia piperi, Pichia US 2007/0128662 A1 Jun. 7, 2007

stiptis, Pichia methanolica, Pichia sp., Saccharomyces cer thermophile, and the like. Suitable archaebacteria include, evisiae, Saccharomyces sp., Hansenula polymorpha, but are not limited to, any member of the groups Crenar Kluyveromyces sp., Kluyveromyces lactis, Candida albi chaeota (e.g., Sulfolobus solfataricus, Defulfurococcus cans, Aspergillus nidulans, Aspergillus niger; Aspergillus mobilis, Pyrodictium occultum, Thermofilum pendens, Ther Oryzae, Trichoderma reesei, Chrysosporium lucknowense, moproteus tenax), Euryarchaeota (e.g., Thermococcus celer, Fusarium sp., Fusarium gramineum, Fusarium venematum, Methanococcus thermolithotrophicus, Methanococcus ian Neurospora crassa, Chlamydomonas reinhardtii, and the naschii, Methanobacterium thermoautotrophicum, Metha like. nobacterium formicicum, Methanothermus fervidus, Archaeoglobus filgidus, Thermoplasma acidophilum, 0143 Suitable mammalian cells include primary cells Haloferax volcanni, Methanosarcina barkeri, Methanosaeta and immortalized cell lines. Suitable mammalian cell lines concilli, Methanospririllum hungatei, Methanomicrobium include human cell lines, non-human primate cell lines, mobile), and Korarchaeota. Suitable eubacteria include, but rodent (e.g., mouse, rat) cell lines, and the like. Suitable are not limited to, any member of Hydrogenobacteria, mammalian cell lines include, but are not limited to, HeLa Thermotogales, Green nonsulfphur bacteria, Denococcus cells (e.g., American Type Culture Collection (ATCC) No. Group, Cyanobacteria, Purple bacteria, Planctomyces, Spi CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, rochetes, Green Sulphur bacteria, Cytophagas, and Gram CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero positive bacteria (e.g., Mycobacterium sp., Micrococcus sp., cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 Streptomyces sp., Lactobacillus sp., Helicobacterium sp., cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells Clostridium sp., Mycoplasma sp., Bacillus sp., etc.). (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RAT1 cells, mouse L cells (ATCC No. CCLI.3), 0147 Suitable prokaryotic cells include, but are not lim human embryonic kidney (HEK) cells (ATCC No. ited to, any of a variety of laboratory strains of Escherichia CRL1573), HLHepG2 cells, and the like. coli, Lactobacillus sp., Salmonella sp., Shigella sp., and the like. See, e.g., Carrier et al. (1992) J. Immunol. 148: 1176 0144. In some embodiments, the cell is a neuronal cell or 1181; U.S. Pat. No. 6,447,784; and Sizemore et al. (1995) a neuronal-like cell. The cells can be of human, non-human Science 270:299-302. Examples of Salmonella strains which primate, mouse, or rat origin, or derived from a mammal can be employed in the present invention include, but are not other than a human, non-human primate, rat, or mouse. In limited to, Salmonella typhi and S. typhimurium. Suitable Some embodiments, the neuronal cell is a primary cell Shigella strains include, but are not limited to, Shigella isolated from an animal. In some embodiments, the neuronal flexneri, Shigella sonnei, and Shigella disenteriae. Typically, cell or neuronal-liked cell is an immortalized cell line. the laboratory strain is one that is non-pathogenic. Non Suitable cell lines include, but are not limited to, a human limiting examples of other suitable bacteria include, but are glioma cell line, e.g., SVGp12 (ATCC CRL-8621), CCF not limited to, Bacillus subtilis, Pseudomonas pudita, STTG1 (ATCCCRL-1718), SW 1088 (ATCC HTB-12), SW Pseudomonas aeruginosa, Pseudomonas mevalonii, Rhodo 1783 (ATCC HTB-13), LLN-18 (ATCC CRL-2610), bacter sphaeroides, Rhodobacter capsulatus, Rhodospiril LNZTA3WT4 (ATCCCRL-11543), LNZTA3 WT11 (ATCC lum rubrum, Rhodococcus sp., and the like. In some embodi CRL-1544), U-138 MG (ATCC HTB-16), U-87 MG (ATCC ments, the cell is Escherichia coli. HTB-14), H4 (ATCC HTB-148), and LN-229 (ATCC CRL 2611); a human medulloblastoma-derived cell line, e.g., Membranes D342 Med (ATCC HTB-187), Daoy (ATCC HTB-186), 0.148. The present invention further provides a membrane D283 Med (ATCC HTB-185); a human tumor-derived neu comprising a subject light-regulated polypeptide. In some ronal-like cell, e.g., PFSK-1 (ATCC CRL-2060), SK-N-DZ embodiments, the membrane is a biological membrane (e.g., (ATCCCRL-2149), SK-N-AS (ATCC CRL-2137), SK-N-FI a lipid bilayer Surrounding a biological compartment such as (ATCC CRL-2142), IMR-32 (ATCC CCL-127), etc.; a mouse neuronal cell line, e.g., BC3H1 (ATCC CRL-1443), a cell, including artificial cells, or a membrane vesicle or EOC1 (ATCC CRL-2467), C8-D30 (ATCC CRL-2534), sheet). In some embodiments, the membrane is part of a C8-S (ATCC CRL-2535), Neuro-2a (ATCC CCL-131), living cell, as described above. In other embodiments, the NB41A3 (ATCC CCL-147), SW10 (ATCC CRL-2766), membrane is an artificial (synthetic) membrane, e.g., a NG108-15 (ATCC HB-12317): a rat neuronal cell line, e.g., planar membrane, a liposome, etc. PC-12 (ATCCCRL-1721), CTX TNA2 (ATCCCRL-2006), 0149. In some embodiments, the artificial membrane is a C6 (ATCCCCL-107), F98 (ATCCCRL-2397), RG2 (ATCC lipid bilayer. In other embodiments, the artificial membrane CRL-2433), B35 (ATCC CRL-2754), R3 (ATCC CRL is a lipid monolayer. In some embodiments, the artificial 2764), SCP (ATCC CRL-1700), OA1 (ATCC CRL-6538). membrane is part of a liposome. Liposomes include unila 0145. In other embodiments, the host cell is a plant cell. mellar vesicles composed of a single membrane or lipid Plant cells include cells of monocotyledons (“monocots”) bilayer, and multilamellar vesicles (MLVs) composed of and dicotyledons ("dicots). Guidance with respect to plant many concentric membranes (or lipid bilayers). tissue culture may be found in, for example: Plant Cell and 0.150 Artificial membranes, and methods of making Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer Aca same, have been described in the art. See, e.g., U.S. Pat. No. demic Publishers; and in: Plant Cell Culture Protocols 6,861,260; Kansy et al. (1998) J. Med. Chem. 41(7): 1007 (Methods in Molecular Biology 111), 1999, Hall Eds, 10; and Yang et al. (1996) Advanced Drug Delivery Reviews Humana Press. 23:229-256. 0146 Suitable prokaryotic cells include bacteria (e.g., 0151. A subject artificial membrane will in some embodi Eubacteria) and archaebacteria. Suitable archaebacteria ments, include one or more phospholipids. In some embodi include a methanogen, an extreme halophile, an extreme ments, the artificial membrane comprises a mixture of US 2007/0128662 A1 Jun. 7, 2007 phospholipids containing saturated or unsaturated mono or change from darkness to w. The synthetic regulator/ disubstituted fatty acids and a combination thereof. These polypeptide complex is also referred to as a “light-regulated phospholipids are in Some embodiments selected from dio polypeptide. In some embodiments, the synthetic regulator/ leoylphosphatidylcholine, dioleoylphosphatidylserine, dio polypeptide complex is generated by affinity labeling, as leoylphosphatidylethanolamine, dioleoylphosphatidylglyc described above. erol, dioleoylphosphatidic acid, palmitoyloleoylphosphatidylcholine, palmitoyloleoylphos 0154) In some embodiments, the ligand-binding polypep phatidylserine, palmitoyloleoylphosphatidylethanolamine, tide or the light-regulated polypeptide is present in a cell palmitoyloleoylphophatidylglycerol, palmitoyloleoylphos free in vitro system, e.g., the ligand-binding polypeptide or phatidic acid, palmitelaidoyloleoylphosphatidylcholine, the light-regulated polypeptide is not associated with a cell. palmitelaidoyloleoylphosphatidylserine, palmitelaidoylo In other embodiments, the ligand-binding polypeptide or the leoylphosphatidylethanolamine, palmitelaidoyloleoylphos light-regulated polypeptide is associated with a cell, e.g., the phatidylglycerol, palmitelaidoyloleoylphosphatidic acid, ligand-binding polypeptide or the light-regulated polypep myristoleoyloleoylphosphatidylcholine, myristoleoylo tide is integrated into a cell membrane in a cell, the ligand leoylphosphatidylserine, myristoleoyloleoylphosphati binding polypeptide or the light-regulated polypeptide is in dylethanoamine, myristoleoyloleoylphosphatidylglycerol, the cytosol of a cell, the ligand-binding polypeptide or the myristoleoyloleoylphosphatidic acid, dilinoleoylphosphati light-regulated polypeptide is in an intracellular organelle, dylcholine, dilinoleoylphosphatidylserine, dilinoleoylphos etc. In other embodiments, the ligand-binding polypeptide or phatidylethanolamine, dilinoleoylphosphatidylglycerol, the light-regulated polypeptide is in a synthetic membrane, dilinoleoylphosphatidic acid, palmiticlinoleoylphosphati e.g., in a planar synthetic membrane, in a liposome, in a dylcholine, palmiticlinoleoylphosphatidylserine, palmiticli membrane of an artificial cell, etc. In some embodiments, noleoylphosphatidylethanolamine, palmiticlinoleoylphos the cell-associated ligand-binding polypeptide or the cell phatidylglycerol, and palmiticlinoleoylphosphatidic acid. associated light-regulated polypeptide is in a cell in vitro, Suitable phospholipids also include the monoacylated e.g., in a cell in a monolayer, in a cell in Suspension, in an derivatives of phosphatidylcholine (lysophophatidylidyl in vitro tissue, etc. In other embodiments, the cell-associated choline), phosphatidylserine (lysophosphatidylserine), ligand-binding polypeptide or the cell-associated light-regu phosphatidylethanolamine (lysophosphatidylethanolamine), lated polypeptide is in a cell in Vivo, e.g., in a cell of an phophatidylglycerol (lysophosphatidylglycerol) and phos organism, e.g., a living organism. phatidic acid (lysophosphatidic acid). The monoacyl chain in such lysophosphatidyl derivatives will in some embodi O155 In some embodiments, the change in wavelength ments be palimtoyl, oleoyl, palmitoleoyl, linoleoyl myris (from w to w; from light to darkness; or from darkness to toyl or myristoleoyl. light) results in a change in binding of the ligand to a ligand-binding site. As used herein, a “change in binding of Methods of Modulating Protein Activity a ligand to a ligand-binding site' includes increased binding 0152 The present invention provides methods of modu and decreased binding. As used herein, “increased binding lating protein activity. In certain aspects, the present inven includes one or more of an increased probability of binding tion provides methods of modulating activity of a subject of the ligand to the ligand-binding site; an increased binding light-regulated polypeptide, where the method generally affinity of the ligand for the ligand-binding site; an increased involves changing the wavelength of light to which the local concentration of the ligand at the ligand-binding site; light-regulated polypeptide is exposed. In certain aspects, and an increased occupancy of the ligand in the ligand the present invention provides methods of modulating activ binding site. As used herein, “decreased binding includes ity of a ligand-binding polypeptide, where the method one or more of: a decreased probability of binding of the generally involves: a) contacting the ligand-binding ligand to the ligand-binding site; a decreased binding affinity polypeptide with a subject synthetic regulator, where the of the ligand for the ligand-binding site; a decreased local synthetic regulator binds to the ligand-binding polypeptide concentration of the ligand at the ligand-binding site; and a by affinity labeling, thereby generating a light-regulated decreased occupancy of the ligand in the ligand-binding site. As used herein, the term “change in wavelength' to which polypeptide; and b) changing the wavelength of light to a synthetic regulator is exposed, or to which a ligand which the light-regulated polypeptide is exposed. binding polypeptide? synthetic light regulator complex is 0153. As noted above, a “change in the wavelength of exposed, refers to a change in wavelength from w to w; a light to which the light-regulated polypeptide is exposed change from light to darkness; or a change from darkness to includes: 1) a change from w to w; 2) a change from w to light. An increase in binding includes an increase of from w; 3) a change from w to darkness (no light); and 4) a about 10% to about 50%, from about 50% to about 2-fold, change from darkness to w. In certain aspects, the present from about 2-fold to about 5-fold, from about 5-fold to about invention provides methods of modulating activity of a 10-fold, from about 10-fold to about 50-fold, from about native (wild-type) polypeptide, where the method generally 50-fold to about 10-fold, from about 10-fold to about involves: a) contacting a polypeptide with a Subject Syn 10-fold, from about 10-fold to about 10-fold, from about thetic regulator, where the Subject synthetic regulator binds 10-fold to about 10-fold, or a greater than 10-fold to the polypeptide, forming a synthetic regulator/polypep increase in binding. A decrease in binding includes a tide complex; and b) changing the wavelength of light to decrease of from about 5% to about 10% to about 20% to which the synthetic regulator/polypeptide complex is about 30%, from about 30% to about 40%, from about 40% exposed. As noted above, a "change in the wavelength of to about 50%, from about 50% to about 60%, from about light to which the light-regulated polypeptide is exposed 60% to about 70%, from about 70% to about 80%, from includes: 1) a change from w to w; 2) a change from w to about 80% to about 90%, or from about 90% to 100% w; 3) a change from w to darkness (no light); and 4) a decrease in binding. US 2007/0128662 A1 Jun. 7, 2007

0156 For example, in some embodiments, the ligand has polypeptide is Subsequently exposed to light of a second a first probability of binding to the ligand site at a first wavelength (W), where exposure to light of the second wavelength of light; the ligand has a second probability of wavelength results in removal of the ligand from the ligand binding to the ligand binding site at a second wavelength of binding site (or reduced binding affinity of the ligand for the light; and the second probability is lower than the first ligand-binding site). This change in wavelength from a first probability. In other embodiments, the ligand has a first wavelength to a second wavelength (Aw) can be repeated probability of binding to the ligand site at a first wavelength numerous times, such that the light is Switched back and of light; the ligand has a second probability of binding to the forth between W and W. Switching between W and W. ligand binding site at a second wavelength of light; and the results in Switching or transition from a ligand-bound State second probability is higher than the first probability. In to a ligand-unbound state. other embodiments, ligand has a first probability of binding 0.161 In some embodiments, the light-regulated polypep to the ligand site when exposed to light; the ligand has a tide is exposed to light of a first wavelength, where exposure second probability of binding to the ligand binding site in the to light of the first wavelength (W) results in binding of the absence of light (e.g., in darkness); and the second prob ligand to the ligand-binding site (or increased binding affin ability is lower than the first probability. In other embodi ity of the ligand for the ligand-binding site); and the light is ments, the ligand has a first probability of binding to the Subsequently turned off, e.g., the polypeptide is in darkness, ligand site when exposed to light; the ligand has a second where keeping the polypeptide in darkness results in probability of binding to the ligand binding site in the removal of the ligand from the ligand-binding site (or absence of lightl and the second probability is higher than reduced binding affinity of the ligand for the ligand-binding the first probability. site). This change from w to darkness can be reversed, e.g., 0157. A change in wavelength can result in a change in from darkness to w; and repeated any number of times, as activity of the light-regulated protein. “Activity” will described above. In other embodiments, a Subject polypep depend, in part, on the ligand-binding polypeptide, and can tide is exposed to light of a first wavelength, where exposure include enzymatic activity (for enzymes); activity of an ion to light of the first wavelength (0) results in lack of binding channel; activity of a receptor in transmitting a signal; etc. of the ligand to the ligand-binding site (or reduced binding affinity of the ligand for the ligand-binding site); and the 0158. In some embodiments, the change in wavelength light is Subsequently turned off, e.g., the polypeptide is in results in binding of the ligand to the ligand-binding site of darkness, where keeping the polypeptide in darkness results the light-regulated polypeptide. In some embodiments, the in binding of the ligand to the ligand-binding site (or change in wavelength results in increased binding affinity of increased binding affinity of the ligand for the ligand the ligand to the ligand-binding site for the light-regulated binding site). This change from w to darkness can be polypeptide. In these embodiments, where the ligand is an reversed, e.g., from darkness to w; and repeated any number agonist, and the change results in activation of said light of times, as described above. regulated polypeptide; and where the ligand is an antagonist, the change results in block of activation of the light 0162. As noted above, the change in wavelength can be regulated polypeptide; and where the ligand is an active site repeated any number of times, e.g., from w to and from or pore blocker, the change results in inhibition of the W to w; or from w to darkness and from darkness to w. light-regulated polypeptide; and where the ligand is a Thus, a subject method provides for inducing a transition or blocker of a site of interaction with other macromolecules, Switch from a ligand-bound state of a protein to a ligand the change interferes with that interaction. In some embodi unbound State of the light-regulated protein, or from a high ments, prolonged binding of an agonist to the ligand-binding affinity state to a low affinity state. Depending on whether site results in desensitization or inactivation of the light the ligand is an agonist or an antagonist, the protein will in regulated polypeptide. In other embodiments, binding of an Some embodiments be Switched from an active state to an antagonist blocks activation of the light-regulated polypep inactive (or deactivated) state, or from an inactive (or tide. deactivated) state to an active state. 0.163 The wavelength of light to which the light-regu 0159. In other embodiments, the change in wavelength lated polypeptide is exposed ranges from 10 m to about 1 results in lack of binding of the ligand to the ligand-binding m, e.g., from about 10 m to about 107 m, from about 107 site, e.g., removal of the ligand from the ligand-binding site m to about 10 m, from about 10 m to about 10 m, from of the light-regulated polypeptide. In other embodiments, about 10 m to about 10° m, or from about 10° m to about the change in wavelength results in reduced binding affinity 1 m. "Light,” as used herein, refers to electromagnetic of the ligand for the ligand-binding site, e.g., reduced radiation, including, but not limited to, ultraviolet light, binding affinity of ligand for the ligand-binding site of the visible light, infrared, and microwave. light-regulated polypeptide. In these embodiments, where the ligand is an antagonist, the change results in activation 0164. The wavelength of light to which the light-regu of said light-regulated polypeptide; and where the ligand is lated polypeptide is exposed ranges in some embodiments an agonist, the change results in deactivation of light from about 200 nm to about 800 nm, e.g., from about 200 nm regulated polypeptide, or recovery from desensitization or to about 250 nm, from about 250 nm to about 300 nm, from inactivation. about 300 nm to about 350 nm, from about 350 nm to about 400 um, from about 400 rum to about 450 nm, from about 0160 In some embodiments, the light-regulated polypep 450 nm to about 500 nm, from about 500 nm to about 550 tide is exposed to light of a first wavelength, where exposure nm, from about 550 nm to about 600 nm, from about 600 nm. to light of the first wavelength (W) results in binding of the to about 650 nm, from about 650 nm to about 700 nm, from ligand to the ligand-binding site (or increased binding affin about 700 nm to about 750 nm, or from about 750 nm to ity of the ligand for the ligand-binding site); and the about 800 nm, or greater than 800 nm. US 2007/0128662 A1 Jun. 7, 2007

0165. In other embodiments, the wavelength of light to ms, from about 100 ms to about 500 ms, from about 500 ms which the light-regulated polypeptide is exposed ranges to about 1 second, from about 1 second to about 5 seconds, from about 800 nm to about 2500 nm, e.g., from about 800 from about 5 seconds to about 10 seconds, from about 10 nm to about 900 nm, from about 900 nm to about 1000 nm, seconds to about 15 seconds, from about 15 seconds to about from about 1000 nm to about 1200 nm, from about 1200 nm. 30 seconds, from about 30 seconds to about 45 seconds, or to about 1400 nm, from about 1400 nm to about 1600 nm, from about 45 seconds to about 60 seconds, or more than 60 from about 1600 nm to about 1800 nm, from about 1800 nm. seconds. In some embodiments, the duration of exposure of to about 2000 nm, from about 2000 nm to about 2250 nm, the light-regulated polypeptide to light varies from about 60 or from about 2250 nm to about 2500 nm. In other embodi seconds to about 10 hours, e.g., from about 60 seconds to ments, the wavelength of light to which the light-regulated about 15 minutes, from about 15 minutes to about 30 polypeptide is exposed ranges from about 2 nm to about 200 minutes, from about 30 minutes to about 60 minutes, from nm, e.g., from about 2 nm to about 5 nm, from about 5 nm about 60 minutes to about 1 hour, from about 1 hour to about to about 10 nm, from about 10 nm to about 25 nm, from 4 hours, from about 4 hours to about 6 hours, from about 6 about 25 nm to about 50 nm, from about 50 nm to about 75 hours to about 8 hours, or from about 8 hours to about 10 nm, from about 100 nm, from about 100 nm to about 150 hours, or longer. nm, or from about 150 nm to about 200 nm. 0170 The duration of binding of the ligand portion of the 0166 The difference between the first wavelength and the synthetic regulator to the ligand-binding site can vary from second wavelength can range from about 10 nm to about 800 less than one second to days. For example, in some embodi nm or more, e.g., from about 10 nm to about 25 nm, from ments, the duration of binding of the ligand portion of the about 25 nm to about 50 nm, from about 50 nm to about 100 synthetic regulator to the ligand-binding site varies from nm, from about 100 nm to about 200 nm, from about 200 nm. about 0.5 second to about 1 second, from about 1 second to to about 250 nm, from about 250 nm to about 500 nm, or about 5 seconds, from about 5 seconds to about 15 seconds, from about 500 nm to about 800 nm. Of course, where the from about 15 seconds to about 30 seconds, from about 30 light-regulated polypeptide is Switched from darkness to seconds to about 60 seconds, from about 1 minute to about light, the difference in wavelength is from essentially Zero to 5 minutes, from about 5 minutes to about 15 minutes, from a second wavelength. about 15 minutes to about 30 minutes, or from about 30 minutes to about 60 minutes. In other embodiments, the (0167] The intensity of the light can vary from about 1 duration of binding of the ligand portion of the synthetic W/m to about 50 W/m, e.g., from about 1 W/m to about 5 W/m, from about 5 W/m to about 10 W/m, from about regulator to the ligand-binding site varies from about 60 10 W/m, from about 10 W/m to about 15 W/m, from minutes to about 2 hours, from about 2 hours to about 4 about 15 W/m to about 20 W/m, from about 20 W/m to hours, from about 4 hours to about 8 hours, from about 8 about 30 W/m, from about 30 W/m to about 40 W/m, or hours to about 12 hours, from about 12 hours to about 18 from about 40 W/m to about 50 W/m. The intensity of the hours, from about 18 hours to about 24 hours, from about 24 light can vary from about 1 W/cm to about 100 W/cm, hours to about 36 hours, from about 36 hours to about 48 e.g., from about 1 W/cm to about 5 uW/cm, from about hours, from about 48 hours to about 60 hours, from about 60 5 uW/cm to about 10 W/cm, from about 10 W/cm to hours to about 72 hours, from about 3 days to about 4 days, about 20 W/cm, from about 20 W/cm to about 25 from about 4 days to about 5 days, or from about 5 days to uW/cm, from about 25 W/cm to about 50 W/cm, from about 7 days, or longer. about 50 W/cm to about 75 W/cm, or from about 75 Modulating Activity of a Second, Non-Light-Regulated uW/cm to about 100 W/cm. In some embodiments, the Polypeptide intensity of light varies from about 1 W/mm to about 1 0171 In some embodiments, modulating the activity of a W/mm, e.g., from about 1 W/mm to about 50 uW/mm. light-regulated polypeptide results in modulating the activity from about 50 W/mm to about 100 W/mm. from about of a polypeptide other than the light-regulated polypeptide. 100 uW/mm to about 500 uW/mm, from about 500 Thus, in other aspects, the present invention provides meth uW/mm to about 1 mW/mm, from about 1 mW/mm to ods of modulating activity of a polypeptide whose activity is about 250 mW/mm. from about 250 mW/mm to about 500 modulated by modulating the activity of a light-regulated mW/mm, or from about 500 mW/mm to about 1 W/mm. polypeptide. In some aspects, the present invention provides 0168 In some embodiments, the light-regulated polypep methods of modulating the activity of a non light-regulated tide is regulated using Sound, instead of electromagnetic polypeptide in a cell. The methods generally involve modu (EM) radiation (light). For example, in some embodiments, lating an activity of a light-regulated polypeptide in the cell, the light-regulated polypeptide is regulated using ultrasound where modulation of the activity of the light-regulated to effect a change from a first isomeric form to a second polypeptide in the cell modulates the activity of the non isomeric form. light-regulated polypeptide. 0169. The duration of exposure of the light-regulated 0172 A non-light-regulated polypeptide whose activity is protein to light can vary from about 1 usecond (LLS) to about modulated by modulating the activity of a light-regulated 60 seconds (s) or more, e.g., from about 1 us to about 5 us, polypeptide includes a polypeptide whose activity is modu from about 5 us to about 10 us, from about 10 us to about lated by a change in Voltage of a biological membrane, a 25us, from about 25 us to about 50 us, from about 50 us to polypeptide whose activity is modulated by depolarization about 100 us, from about 100 us to about 250 us, from about of a biological membrane; a polypeptide whose activity is 250 us to about 500 us, from about 500 us to about 1 modulated by a change in intracellular concentration of an millisecond (ms), from about 1 ms to about 10 ms, from ion (e.g., a monovalent or divalention, e.g., a monovalent or about 10 ms to about 50 ms, from about 50 ms to about 100 divalent cation); a polypeptide whose activity is modulated US 2007/0128662 A1 Jun. 7, 2007 by phosphorylation; and the like. As one non-limiting result in opening or closing of the ion channel, thereby example, a light-regulated polypeptide comprises a altering ion concentration in cells in a manner that alters glutamate receptor (ligand-gated ion channel) as the ligand their activity (e.g., hormone or neurotransmitter secretion) binding polypeptide, where the light-regulated polypeptide or state (e.g., transcriptional or translational or metabolic is in the plasma membrane of a cell. Light activation of the state) or electrical firing, etc. light-regulated glutamate receptor in the cell opens the channel, resulting in influx of ion and depolarization of the Screening Methods plasma membrane. Depolarization of the plasma membrane 0177. The present invention provides methods of identi activates a Voltage-gated ion channel. Such as a calcium fying an agent that modulates a function (e.g., an activity) of channel. Activation of the calcium channels is readily a polypeptide. The methods generally involve contacting a detected by Standard methods, e.g., use of an indicator dye, light-regulated polypeptide with a test agent; and determin etc.). As another non-limiting example, the light-regulated ing the effect, if any, of the test agent on the activity of the polypeptide comprises a GPCR as the ligand-binding light-regulated polypeptide (or on the activity of a polypep polypeptide. Activation of the light-regulated GPCR acti tide that is regulated by the light-regulated polypeptide). The Vates an ion channel or an enzyme. Activation of the ion effect, if any, of the test agent on the activity of the channel or enzyme is readily detected using standard meth light-regulated polypeptide is determined by exposing the ods, e.g., use of an indicator dye for the permeating ion, or light-regulated polypeptide to light of a first wavelength. In a calorimetric, fluorimetric, or luminescence assay for the the absence of the test agent, exposure of the light-regulated product of the enzyme. As another non-limiting example, the polypeptide to light of a first wavelength induces a transition light-regulated polypeptide comprises a receptor tyrosine from a ligand-unbound state to a ligand-bound state. In the kinase (RTK); and activation of the light-regulated RTK presence of a test agent that affects binding of the ligand to results in phosphorylation of a downstream protein, e.g., a the ligand-binding site, the transition from the ligand-un transcription factor. Activation of the transcription factor is bound state to a ligand-bound state is inhibited. readily detected by, e.g., detecting a transcript. As another non-limiting example, the light-regulated polypeptide com 0.178 In some embodiments, the light-regulated polypep tide is in vitro in Solution (e.g., free of cells or membranes); prises an opioid receptor. Modulation of the opioid receptor and the assay is carried out in vitro. In other embodiments, by exposure to light (or removal of light) can modulate a the light-regulated polypeptide is in a membrane (e.g., a potassium ion channel; and modulation of a potassium ion synthetic membrane) in the absence of a living cell (e.g., in channel is readily detected using standard methods, e.g., use a cell-free system); and the assay is carried out in vitro. In of a dye for potassium ions. other embodiments, the light-regulated polypeptide is in a Utility cell, e.g., a living cell in vitro or in vivo; and in some embodiments, the assay is carried out in vitro, and in other 0173 A subject synthetic regulator, a subject light-regu embodiments, the assay is carried out in vivo. lated polypeptide, a Subject cell, and a subject method of modulating protein function, are useful in a wide variety of 0179. In some aspects, the present invention provides research applications, pharmaceutical applications, screen methods for identifying an agent that modulates a function ing assays, therapeutic applications, and the like. (e.g., an activity) of a non-light-regulated polypeptide in the same solution, membrane, or cell, where the activity of the Research Applications non-light-regulated polypeptide is modulated by modulating 0.174. In some embodiments, a subject synthetic regulator the activity of a light-regulated polypeptide. The methods or a subject light-regulated polypeptide, is useful in studies generally involve contacting a light-regulated polypeptide of cell function, in studies of physiology of whole organ (where the light-regulated polypeptide is in a solution, isms, and the like. In some aspects, a subject synthetic membrane, or cell) with a test agent; and determining the regulator or a Subject light-regulated polypeptide finds use in effect, if any, of the test agent on the activity of the controlling gene expression. non-light-regulated polypeptide (where the non-light regu lated polypeptide is in the same solution, membrane, or cell 0175 For example, a subject synthetic regulator will in as the light-regulated polypeptide), where the activity of the Some embodiments include a ligand that binds to the ligand non-light-regulated polypeptide is modulated by changing binding site of a transcriptional regulator protein. A tran the wavelength of light to which the cell is exposed. Whether Scriptional regulator protein that includes such a synthetic the activity of the non-light regulated polypeptide is modu regulator in stable association with the protein will be light lated is determined using an assay appropriate to the activity regulated, e.g., will be a light-regulated transcription factor. of the non-light-regulated polypeptide. For example, where Thus, gene expression can be controlled by changing the the non-light-regulated polypeptide is a calcium channel, a wavelength of light to which the light-regulated transcrip calcium-sensitive dye, Such as a Fura-2 dye, will in some tion factor is exposed. embodiments be used to detect an effect of the test agent on 0176). In physiological studies, changing light exposure the activity of the calcium channel. For example, where the of a tissue, organ, or whole organism (or a part of a whole non-light-regulated polypeptide is a sodium channel, a organism) that includes a light-regulated protein provides a Sodium-sensitive dye Such as Sodium-binding benzofuran method of regulating a function in the tissue, organ, or whole isophthalate (SBFI) will in some embodiments be used to organism. For example, where the light-regulated protein detect an effect of the test agent on the activity of the sodium comprises a ligand-binding protein that is a ligand-gated ion channel. channel, and the synthetic regulator comprises the ligand for 0180. In some embodiments, the light-regulated polypep the ligand-gated ion channel, changing the wavelength of tide is in a cell (e.g., is integrated into the plasma membrane, light to which the light-regulated protein is exposed will is in the cytosol of the cell, is in a Subcellular organelle, is US 2007/0128662 A1 Jun. 7, 2007

in the nucleus of the cell, or is integrated into a membrane that provides for the requisite binding or other activity. of a subcellular organelle). In these embodiments, the cell Incubations are performed at any suitable temperature, typi comprising the light-regulated polypeptide is a “test cell.” cally between 4° C. and 40° C. Incubation periods are The methods generally involve contacting the test cell with selected for optimum activity, but may also be optimized to a test agent; and determining the effect, if any, of the test facilitate rapid high-throughput Screening. Typically agent on the activity of the light-regulated polypeptide. between 0.1 hour and 1 hour will be sufficient. 0181. In some embodiments, the test agent is one that 0186 The screening methods may be designed a number inhibits induction of a transition from a first, ligand-bound of different ways, where a variety of assay configurations state to a second, ligand-unbound state. For example, in and protocols may be employed, as are known in the art. The Some embodiments, a test agent of interest is one that above components of the method may be combined at inhibits induction of a transition from a first, ligand-unbound substantially the same time or at different times. In some state to a second, ligand-bound state by at least about 5%, at embodiments, a subject method will include one or more least about 10%, at least about 15%, at least about 20%, at washing steps. least about 25%, at least about 30%, at least about 40%, at 0187. In some embodiments, the ligand-binding, light least about 50%, at least about 60%, at least about 70%, or regulated polypeptide is assayed in a membrane-free, cell at least about 80%, or more, compared to the induction in the free assay. In other embodiments, the ligand-binding, light absence of the test agent. regulated polypeptide is integrated into an artificial mem 0182. The terms “candidate agent,”“test agent,”“agent, brane. In other embodiments, the ligand-binding, light regu 'substance,” and “compound are used interchangeably lated polypeptide is integrated into a biological membrane. herein. Candidate agents encompass numerous chemical In other embodiments, the ligand-binding, light regulated is classes, typically synthetic, semi-synthetic, or naturally in a living cell, e.g., in the cytosol, in the nucleus, in an occurring inorganic or organic molecules. Candidate agents intracellular organelle, in the plasma membrane, or in an include those found in large libraries of synthetic or natural intracellular membrane of the cell. compounds. For example, synthetic compound libraries are commercially available from Maybridge Chemical Co. (Tre 0188 Biological cells which are suitable for use in a villet, Cornwall, UK), ComGenex (South San Francisco, Subject screening assay include, but are not limited to, Calif.), and MicroSource (New Milford, Conn.). A rare primary cultures of mammalian cells, transgenic (non-hu chemical library is available from Aldrich (Milwaukee, man) organisms and mammalian tissue. Cells in screening Wis.). Alternatively, libraries of natural compounds in the assays may be dissociated either immediately or after pri form of bacterial, fungal, plant and animal extracts are mary culture. Cell types include, but are not limited to white available from Pan Labs (Bothell, Wash.) or are readily blood cells (e.g. leukocytes), hepatocytes, pancreatic beta producible. cells, neurons, Smooth muscle cells, intestinal epithelial cells, cardiac myocytes, glial cells, and the like. 0183 Candidate agents may be small organic or inor ganic compounds having a molecular weight of more than 0189 Biological cells which are suitable for use in a 50 and less than about 2,500 daltons. Candidate agents may Subject screening assay include cultured cell lines (e.g., comprise functional groups necessary for structural interac immortalized cell lines). Representative suitable cultured tion with proteins, particularly hydrogen bonding, and may cell lines derived from humans and other mammals include, include at least an amine, carbonyl, hydroxyl or carboxyl but are not limited to, HeLa cells (e.g., American Type group, and may contain at least two of the functional Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., chemical groups. The candidate agents may comprise cycli ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., cal carbon or heterocyclic structures and/or aromatic or ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., polyaromatic structures substituted with one or more of the ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC above functional groups. Candidate agents are also found No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, among biomolecules including peptides, saccharides, fatty COS-7 cells (ATCC No. CRL1651), RAT1 cells, mouse L acids, steroids, purines, pyrimidines, derivatives, structural cells (ATCC No. CCLI.3), human embryonic kidney (HEK) analogs or combinations thereof. cells (ATCC No. CRL1573), HLHepG2 cells, and the like. 0184 Assays of the invention include controls, where 0190. In some embodiments, the cell is a neuronal cell or Suitable controls include a sample (e.g., a sample comprising a neuronal-like cell. The cells can be of human, non-human a subject polypeptide in the absence of the test agent). primate, mouse, or rat origin, or derived from a mammal Generally a plurality of assay mixtures is run in parallel with other than a human, non-human primate, rat, or mouse. different agent concentrations to obtain a differential Suitable cell lines include, but are not limited to, a human response to the various concentrations. Typically, one of glioma cell line, e.g., SVGp12 (ATCC CRL-8621), CCF these concentrations serves as a negative control, i.e. at Zero STTG1 (ATCCCRL-1718), SW 1088 (ATCC HTB-12), SW concentration or below the level of detection. 1783 (ATCC HTB-13), LLN-18 (ATCC CRL-2610), LNZTA3WT4 (ATCCCRL-11543), LNZTA3 WT11 (ATCC 0185. A variety of other reagents may be included in the CRL-11544), U-138 MG (ATCC HTB-16), U-87 MG screening assay. These include reagents like salts, neutral (ATCC HTB-14), H4 (ATCC HTB-148), and LN-229 proteins, e.g. albumin, detergents, etc. that are used to (ATCC CRL-2611); a human medulloblastoma-derived cell facilitate optimal protein-protein binding and/or reduce non line, e.g., D342 Med (ATCC HTB-187), Daoy (ATCC specific or background interactions. Reagents that improve HTB-186), D283 Med (ATCC HTB-185); a human tumor the efficiency of the assay, such as protease inhibitors, derived neuronal-like cell, e.g., PFSK-1 (ATCC CRL-2060), nuclease inhibitors, anti-microbial agents, etc. may be used. SK-N-DZ (ATCCCRL-2149), SK-N-AS (ATCC CRL The components of the assay mixture are added in any order 2137), SK-N-FI (ATCC CRL-2142), IMR-32 (ATCCCCL US 2007/0128662 A1 Jun. 7, 2007 20

127), etc.; a mouse neuronal cell line, e.g., BC3H1 (ATCC 5F. Fura-FF, BTC, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, CRL-1443), EOC1 (ATCC CRL-2467), C8-D30 (ATCC fluo-3, rhod-2, fura-4F, fura-5F, fura-6F, fluo-4, fluo-5F. CRL-2534), C8-S (ATCC CRL-2535), Neuro-2a (ATCC fluo-5N, Oregon Green 488 BAPTA, Calcium Green, Cal CCL-131), NB41A3 (ATCC CCL-147), SW10 (ATCC cein, Fura-C18, Calcium Green-C18, Calcium Orange, Cal CRL-2766), NG108-15 (ATCC HB-12317): a rat neuronal cium Crimson, Calcium Green-5N, Magnesium Green, cell line, e.g., PC-12 (ATCC CRL-1721), CTX TNA2 Oregon Green 488 BAPTA-1, Oregon Green 488 BAPTA-2, (ATCC CRL-2006), C6 (ATCC CCL-107), F98 (ATCC X-rhod-1, Fura Red, Rhod-5F. Rhod-5N, X-Rhod-5N, Mag CRL-2397), RG2 (ATCC CRL-2433), B35 (ATCC CRL Rhod-2, Mag-X-Rhod-1, Fluo-5N, Fluo-5F. Fluo-4FF, Mag 2754), R3 (ATCC CRL-2764), SCP (ATCC CRL-1700), Fluo-4, Aequorin, dextran conjugates or any other deriva OA1 (ATCC CRL-6538). tives of any of these dyes, and others (see, e.g., the catalog 0191 In some embodiments, the readout for an effect on or Internet site for Molecular Probes, Eugene, see, also, the activity of the ligand-binding, light regulated polypep Nuccitelli, ed., Methods in Cell Biology, Volume 40 : A tide is a direct measure of the activity of the ligand-binding, Practical Guide to the Study of Calcium in Living Cells, light regulated polypeptide. A direct effect on the ligand Academic Press (1994); Lambert, ed., Calcium Signaling binding, light regulated polypeptide is detected using an Protocols (Methods in Molecular Biology Volume 114), assay appropriate to the particular protein. For example, Humana Press (1999); W. T. Mason, ed., Fluorescent and where the ligand-binding, light regulated is an enzyme, any Luminescent Probes for Biological Activity. A Practical of a variety of assays can be used to detect enzymatic Guide to Technology for Ouantitative Real-Time Analysis, activity, and therefore to detect an effect of the test agent on Second Ed, Academic Press (1999); Calcium Signaling enzymatic activity. As another example, where the ligand Protocols (Methods in Molecular Biology), 2005, D. G. binding, light regulated polypeptide is an ion channel, the Lamber, ed., Humana Press.). effect, if any, of the test agent on the activity of the ion 0196. In particular embodiments of interest, a subject channel is in Some embodiments detected by detecting a screening method is useful for identifying agents that reduce change in the intracellular concentration of an ion. A change or relieve pain, e.g., agents that bind an opioid receptor, in the intracellular concentration of an ion can be detected where the screening method involves detecting an effect, if using an indicator appropriate to the ion whose influx is any, of the test agent on the activity of a potassium channel controlled by the channel. For example, where the ion or calcium channel that is regulated by the opioid receptor. channel is a potassium ion channel, a potassium-detecting In other embodiments, a Subject screening method is useful dye is used; where the ion channel is a calcium ion channel, for identifying agents that are selective for a particular a calcium-detecting dye is used; etc. receptor type or Subtype, where the screening method 0192 In other embodiments, the readout for an effect on involves determining the effect of the agent on a first subtype the activity of the ligand-binding, light regulated polypep and a second Subtype, where an effect on the first Subtype, tide is an effect on a second polypeptide whose activity is and a reduced effect (or substantially no effect) on the affected by the ligand-binding, light regulated polypeptide. second subtype indicates selectivity of the test agent for the For example, where the ligand-binding, light regulated first subtype. polypeptide is an ion channel that controls influx of potas Therapeutic Applications sium into the cell, where an influx of potassium into the cell generates a Voltage across the membrane, the effect of a test 0.197 A subject synthetic regulator of protein function is agent on activity of the ligand-binding, light regulated Suitable for use in a variety of therapeutic applications, polypeptide can be detected by detecting a Voltage generated which are also provided. In some embodiments, a subject across the membrane. In some embodiments, where the synthetic regulator of protein function is useful in restoring ligand-binding, light regulated polypeptide is an ion channel light sensitivity to a retina that has reduced light sensitivity. that controls influx of potassium into the cell, the ion In other embodiments, a Subject synthetic regulator of channel controls opening of a calcium channel. In these protein function is useful as a local anesthetic. In other embodiments, a calcium-sensitive dye is used to detect an embodiments, a subject synthetic regulator is useful as an effect of the test agent on the activity of the ligand-binding, anti-convulsant, e.g., in the treatment of epilepsy. light regulated ion channel. Restoring Light Sensitivity to a Retina 0193 Suitable voltage-sensitive dyes include, but are not limited to, merocyanine-oxazolone dyes (e.g., NK2367); 0198 The present invention provides a method for restor merocyanine-rhodanine dyes (e.g., NK2495, NK2761, ing light sensitivity to a retina, or conferring light sensitivity NK2776, NK3224, and NK3225); oxonol dyes (e.g., to a cell in the eye, the method generally involving admin RH155, RH479, RH482, RH1691, RH1692, and RH1838); istering to an individual in need thereof an effective amount styryl dyes (e.g., RH237, RH414, RH421, RH437, RH461, of a Subject synthetic regulator of protein function locally, RH795, JPW 1063, JPW3028, di-4-ANEPPS, di-9- e.g., in or around the eye. ANEPPS, di-2-ANEPEQ, di-12-ANEPEQ, di-8-ANEPPQ, 0199 A subject synthetic regulator that is suitable for this and di-12-ANEPPQ); and the like. application comprises a ligand that confers light sensitivity on one or more cells in the eye, e.g., retinal pigment 0194 Suitable intracellular K" ion-detecting dyes epithelial cells; and cells disposed in the neurosensory include, but are not limited to, K'-binding benzofuran retina, for example, photoreceptor cells and Mueller cells. A isophthalate and the like. pharmaceutical composition comprising a subject synthetic 0195 Suitable intracellular Ca" ion-detecting dyes regulator is administered in or around the eye; the synthetic include, but are not limited to, fura-2, bis-fura 2, indo-1, regulator attaches to a protein in a cell in the eye, and confers Quin-2, Quin-2 AM, Benzothiaza-1, Benzothiaza-2, indo light sensitivity to the cell. Suitable pharmaceutical compo US 2007/0128662 A1 Jun. 7, 2007

sitions are described in detail below. For example, the recessive); Congenital amaurosis (autosomal recessive); synthetic regulator can confer light sensitivity on a retinal Cone or cone-rod dystrophy (autosomal dominant and ganglion. X-linked forms); Congenital stationary night blindness 0200) A pharmaceutical composition comprising a sub (autosomal dominant, autosomal recessive and X-linked ject synthetic regulator that confers light sensitivity on a cell forms); Macular degeneration (autosomal dominant and can be delivered to the eye through a variety of routes. A autosomal recessive forms); Optic atrophy, autosomal domi Subject pharmaceutical composition may be delivered nant and X-linked forms); Retinitis pigmentosa (autosomal intraocularly, by topical application to the eye or by dominant, autosomal recessive and X-linked forms); Syn intraocular injection into, for example the vitreous or Sub dromic or systemic retinopathy (autosomal dominant, auto retinal (interphotoreceptor) space. Alternatively, a subject Somal recessive and X-linked forms); and Usher syndrome pharmaceutical composition may be delivered locally by (autosomal recessive). insertion or injection into the tissue surrounding the eye. A Local Anesthetic Subject pharmaceutical composition may be delivered sys 0205 The present invention provides a method of reduc temically through an oral route or by Subcutaneous, intra ing or preventing pain in an individual, the method generally venous or intramuscular injection. Alternatively, a subject involving: a) administering to an individual in need thereof pharmaceutical composition may be delivered by means of an effective amount of a subject synthetic regulator of a catheter or by means of an implant, wherein Such an protein function, where the synthetic regulator of protein implant is made of a porous, non-porous or gelatinous function comprises a ligand that blocks a pain response or a material, including membranes such as Silastic membranes pain signal, where the synthetic regulator binds to receptor or fibers, biodegradable polymers, or proteinaceous mate or a channel, forming complex between the synthetic regu rial. A Subject pharmaceutical composition can be adminis lator and the receptor or channel.; and b) exposing the tered prior to the onset of the condition, to prevent its receptor/regulator complex or channel/regulatory complex occurrence, for example, during Surgery on the eye, or to a wavelength of light that provides for binding of the immediately after the onset of the pathological condition or ligand to the receptor or channel. For example, in some during the occurrence of an acute or protracted condition. embodiments, the protein is a cation channel, and the 0201 The effects of therapy for an ocular disorder as synthetic regulator binds to the cation channel, forming a described herein can be assessed in a variety of ways, using cation channel/regulator complex, where the channel/regu methods known in the art. For example, the subjects vision lator complex is exposed to a wavelength of light that can be tested according to conventional methods. Such provides for blocking of the channel, e.g., a Na" channel, an conventional methods include, but are not necessarily lim N-type Ca" channel, etc. ited to, electroretinogram (ERG), focal ERG, tests for visual 0206. An “effective amount of a subject synthetic regu fields, tests for visual acuity, ocular coherence tomography lator is an amount that is effective to reduce pain by at least (OCT), Fundus photography, Visual Evoked Potentials 30%, 40%, 60%, 70%, 80%, 90% or 100% for a period of (VEP) and Pupillometry. In general, the invention provides time of from about 15 minutes to 5 days, e.g., from about 15 for maintenance of a Subject's vision (e.g., prevention or minutes to about 30 minutes, from about 30 minutes to about inhibition of vision loss of further vision loss due to pho 60 minutes, from about 1 hour to about 4 hours, from about toreceptor degeneration), slows progression of vision loss, 4 hours to about 8 hours, from about 8 hours to about 16 or in Some embodiments, provides for improved vision hours, from about 16 hours to about 24 hours, from about 24 relative to the subjects vision prior to therapy. hours to about 36 hours, from about 36 hours to about 48 0202) Exemplary conditions of particular interest which hours, from about 48 hours to about 3 days, or from about are amenable to treatment according to the methods of the 3 days to about 5 days. The effectiveness of a subject invention include, but are not necessarily limited to, diabetic synthetic regulator in treating nociceptive pain can be deter retinopathy, age-related macular degeneration (AMD or mined by observing one or more clinical symptoms or ARMD) (wet form); dry AMD: retinopathy of prematurity; physiological indicators associated with nociceptive pain. retinitis pigmentosa (RP); diabetic retinopathy; and glau coma, including open-angle glaucoma (e.g., primary open 0207. In these embodiments, a suitable synthetic regula angle glaucoma), angle-closure glaucoma, and secondary tor includes one that comprises, as a ligand, an opioid analgesic. Suitable ligands include, but are not limited to, glaucomas (e.g., pigmentary glaucoma, pseudoexfoliative morphine, oxycodone, fentanyl, pentazocine, hydromor glaucoma, and glaucomas resulting from trauma and inflam phone, meperidine, methadone, levorphanol, oxymorphone, matory diseases). levallorphan, codeine, dihydrocodeine, hydrocodone, pro 0203 Further exemplary conditions amenable to treat poxyphene, nalmefene, nalorphine, naloxone, naltrexone, ment according to the invention include, but are not neces buprenorphine, butorphanol, nalbuphine, and pentazocine. sarily limited to, retinal detachment, age-related or other In other embodiments, a suitable synthetic regulator com maculopathies, photic retinopathies, Surgery-induced retino prises a ligand moiety selected from lidocaine, novocaine, pathies, toxic retinopathies, retinopathy of prematurity, ret Xylocaine, lignocaine, novocaine, carbocaine, etidocaine, inopathies due to trauma or penetrating lesions of the eye, tetracaine, procaine, prontocaine, prilocaine, bupivacaine, inherited retinal degenerations, Surgery-induced retinopa cinchocaine, mepivacaine, quinidine, flecainide, procaine, thies, toxic retinopathies, retinopathies due to trauma or N-2'-(aminosulfonyl)biphenyl-4-yl)methyl-N'-(2,2'- penetrating lesions of the eye. bithien-5-ylmethyl)succinamide (BPBTS), QX-314, sax 0204 Specific exemplary inherited conditions of interest itoxin, tetrodotoxin, and a type III conotoxin. for treatment according to the invention include, but are not 0208. The present invention provides pharmaceutical necessarily limited to, Bardet-Biedl syndrome (autosomal compositions comprising a subject synthetic regulator. In US 2007/0128662 A1 Jun. 7, 2007 22

Some embodiments, the pharmaceutical composition is Suit ceutical composition disclosed in the present specification, able for administering to an individual in need of a local provided that the resulting preparation is pharmaceutically anesthetic. Individuals in need of a local anesthetic include acceptable. Such buffers include, without limitation, acetate an individual who is about to undergo a Surgical procedure, buffers, citrate buffers, phosphate buffers, neutral buffered and an individual who has undergone a Surgical procedure saline, phosphate buffered saline and borate buffers. It is within the last 5 minutes to within the last 72 hours. understood that acids or bases can be used to adjust the pH Individuals in need of a local anesthetic further include of a composition as needed. Pharmaceutically acceptable individuals having a wound, e.g., a Superficial wound. antioxidants include, without limitation, Sodium met 0209. A pharmaceutical composition comprising a sub abisulfite, sodium thiosulfate, acetylcysteine, butylated ject synthetic regulator may be administered to a patient hydroxyanisole and butylated hydroxytoluene. Useful pre alone, or in combination with other Supplementary active servatives include, without limitation, benzalkonium chlo agents. The pharmaceutical compositions may be manufac ride, chlorobutanol, thimerosal, phenylmercuric acetate, tured using any of a variety of processes, including, without phenylmercuric nitrate and a stabilized oxy chloro compo limitation, conventional mixing, dissolving, granulating, sition, for example, PURITETM. Tonicity adjustors suitable dragee-making, levigating, emulsifying, encapsulating, for inclusion in a Subject pharmaceutical composition include, without limitation, salts such as, e.g., Sodium chlo entrapping, and lyophilizing. The pharmaceutical composi ride, potassium chloride, mannitol or glycerin and other tion can take any of a variety of forms including, without pharmaceutically acceptable tonicity adjustor. It is under limitation, a sterile Solution, Suspension, emulsion, lyophi stood that these and other substances known in the art of lisate, tablet, pill, pellet, capsule, powder, syrup, elixir or any pharmacology can be included in a subject pharmaceutical other dosage form Suitable for administration. composition. 0210 A pharmaceutical composition comprising a sub 0212 Some examples of materials which can serve as ject synthetic regulator can optionally include a pharmaceu pharmaceutically-acceptable carriers include: (1) Sugars, tically acceptable carrier(s) that facilitate processing of an Such as lactose, glucose and Sucrose; (2) starches, such as active ingredient into pharmaceutically acceptable compo corn starch and potato starch; (3) cellulose, and its deriva sitions. As used herein, the term “pharmacologically accept tives, such as Sodium carboxymethyl cellulose, ethyl cellu able carrier refers to any carrier that has substantially no lose and cellulose acetate; (4) powdered tragacanth; (5) long term or permanent detrimental effect when adminis malt, (6) gelatin; (7) talc.; (8) excipients, such as cocoa butter tered and encompasses terms such as “pharmacologically and suppository waxes; (9) oils, such as peanut oil, cotton acceptable vehicle, stabilizer, diluent, auxiliary or excipi seed oil, safflower oil, Sesame oil, olive oil, corn oil and ent.” Such a carrier generally is mixed with an active Soybean oil: (10) glycols, such as propylene glycol; (11) compound, or permitted to dilute or enclose the active polyols, such as glycerin, Sorbitol, mannitol, and polyeth compound and can be a solid, semi-solid, or liquid agent. It ylene glycol; (12Y esters, such as ethyl oleate and ethyl is understood that the active ingredients can be soluble or laurate; (13) agar, (14) buffering agents, such as magnesium can be delivered as a suspension in the desired carrier or hydroxide and aluminum hydroxide; (15) alginic acid, (16) diluent. Any of a variety of pharmaceutically acceptable pyrogen-free water, (17) isotonic Saline; (18) Ringer's solu carriers can be used including, without limitation, aqueous tion; (19) ethyl alcohol; (20) pH buffered solutions; (21) media Such as, e.g., distilled, deionized water, saline; Sol polyesters, polycarbonates and/or polyanhydrides; and (22) vents; dispersion media; coatings; antibacterial and antifun other non-toxic compatible Substances employed in phar gal agents; isotonic and absorption delaying agents; or any maceutical formulations. other inactive ingredient. Selection of a pharmacologically 0213 Routes of administration suitable for the methods acceptable carrier can depend on the mode of administration. of the invention include both systemic and local adminis Except insofar as any pharmacologically acceptable carrier tration. In some embodiments, a Subject pharmaceutical is incompatible with the active ingredient, its use in phar composition comprising a subject synthetic regulator is maceutically acceptable compositions is contemplated. administered locally. As non-limiting examples, a pharma Non-limiting examples of specific uses of Such pharmaceu ceutical composition useful for treating nociceptive pain can tical carriers can be found in “Pharmaceutical Dosage Forms be administered orally; by Subcutaneous pump; by dermal and Drug Delivery Systems' (Howard C. Ansel et al., eds., patch; by intravenous, Subcutaneous or intramuscular injec Lippincott Williams & Wilkins Publishers, 7" ed. 1999); tion; by topical drops, creams, gels, sprays, or ointments; as “Remington: The Science and Practice of Pharmacy” an implanted or injected extended release formulation; as a (Alfonso R. Gennaro ed., Lippincott, Williams & Wilkins, bioerodable or non-bioerodable delivery system; by subcu 20 2000); “Goodman & Gilman's The Pharmacological taneous minipump or other implanted device; by intrathecal Basis of Therapeutics' Joel G. Hardman et al., eds., pump or injection; or by epidural injection. In some embodi McGraw-Hill Professional, 10. Sup.thed. 2001); and “Hand ments, a Subject pharmaceutical composition comprising a book of Pharmaceutical Excipients” (Raymond C. Rowe et Subject synthetic regulator is administered Sublingually. In al., APhA Publications, 4 edition 2003). Some embodiments, a Subject pharmaceutical composition 0211) A subject pharmaceutical composition can option comprising a Subject synthetic regulator is administered ally include, without limitation, other pharmaceutically topically to gum tissue. In some embodiments, a subject acceptable components, including, without limitation, buff pharmaceutical composition comprising a subject synthetic ers, preservatives, tonicity adjusters, salts, antioxidants, regulator is injected into gum tissue. In some embodiments, physiological Substances, pharmacological Substances, a subject pharmaceutical composition comprising a subject bulking agents, emulsifying agents, wetting agents, Sweet synthetic regulator is administered topically to the skin. In ening or flavoring agents, and the like. Various buffers and Some embodiments, a Subject pharmaceutical composition means for adjusting pH can be used to prepare a pharma comprising a subject synthetic regulator is administered at or US 2007/0128662 A1 Jun. 7, 2007

near a site of a Surgical incision. In some embodiments, a agents, tonicity adjusting agents, stabilizers, wetting agents Subject pharmaceutical composition comprising a subject and the like, are readily available to the public synthetic regulator is administered intramuscularly at the site of a Surgical incision. For example, in some embodi 0219. In the subject methods, a subject synthetic regula ments, a Subject pharmaceutical composition comprising a tor may be administered to the host using any convenient Subject synthetic regulator is administered at a Surgical site, means capable of resulting in the desired reduction in and before the Surgical wound is closed, the synthetic disease condition or symptom. Thus, a Subject synthetic regulator/target protein complex is exposed to light of a regulator can be incorporated into a variety of formulations wavelength that induces binding of the ligand to the protein. for therapeutic administration. More particularly, a subject In some embodiments, a Subject pharmaceutical composi synthetic regulator can be formulated into pharmaceutical tion is administered (e.g., injected) at or near a nerve. Thus, compositions by combination with appropriate pharmaceu in some embodiments, a Subject pharmaceutical composi tically acceptable carriers or diluents, and may be formu tion is formulated for injection at or near a nerve. For lated into preparations in Solid, semi-solid, liquid or gaseous example, for oral Surgery, a Subject pharmaceutical compo forms, such as tablets, capsules, powders, granules, oint ments, Solutions, Suppositories, injections, inhalants and sition is injected at or near a nerve in gum tissue. aerosols. 0214. In some embodiments, a subject pharmaceutical composition comprising a Subject synthetic regulator is 0220 A subject synthetic regulator can be used alone or administered just before Surgery, e.g., from about 1 minute in combination with appropriate additives to make tablets, to about 2 hours before Surgery, e.g., from about 1 minute to powders, granules or capsules, for example, with conven about 5 minutes, from about 5 minutes to about 15 minutes tional additives, such as lactose, mannitol, corn Starch or from about 15 minutes to about 30 minutes, from about 30 potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with 0215. A subject synthetic regulator comprising a ligand disintegrators, such as corn starch, potato starch or sodium that provides for pain prevention is suitable for preventing or carboxymethylcellulose; with lubricants, such as talc or reducing pain in an individual in need thereof. Individuals in magnesium Stearate; and if desired, with diluents, buffering need of treatment with a Subject synthetic regulator com agents, moistening agents, preservatives and flavoring prising a ligand that provides for pain prevention include agents. Such preparations can be used for oral administra individuals who are about to undergo Surgery, e.g., individu tion. als who are scheduled to undergo a Surgical procedure in the next 5 minutes to 72 hours; individuals who are undergoing 0221) A subject synthetic regulator can be formulated a Surgical procedure; and individuals who have undergone a into preparations for injection by dissolving, Suspending or Surgical procedure within the previous 5 minutes to 1 hour. emulsifying them in an aqueous or nonaqueous solvent, such Thus, individuals suffering from post-operative pain are as Vegetable or other similar oils, synthetic aliphatic acid Suitable for treatment. A subject synthetic regulator com glycerides, esters of higher aliphatic acids or propylene prising a ligand that provides for pain prevention is also glycol; and if desired, with conventional additives such as Suitable for preventing or reducing pain in an individual solubilizers, isotonic agents, Suspending agents, emulsifying having a wound, e.g., a Superficial wound. agents, stabilizers and preservatives. Formulations Suitable for injection can be administered by an intravitreal, intraocu Anti-Convulsant Applications lar, intramuscular, Subcutaneous, Sublingual, or other route 0216) In some embodiments, a subject synthetic regulator of administration, e.g., injection into the gum tissue or other comprises, as a ligand, a ligand for a sodium channel, a oral tissue. Such formulations are also suitable for topical potassium channel, or a GABA receptor, where the ligand administration. functions as an anti-convulsant. In some embodiments, the 0222. A subject synthetic regulator can be utilized in synthetic regulator is administered in a pharmaceutical com aerosol formulation to be administered via inhalation. A position, as described Supra and infra. Subject synthetic regulator can be formulated into pressur Pharmaceutical Compositions ized acceptable propellants such as dichlorodifluo 0217. A subject synthetic regulator can be formulated romethane, propane, nitrogen and the like. with one or more pharmaceutically acceptable excipients. A 0223 Furthermore, a subject synthetic regulator can be wide variety of pharmaceutically acceptable excipients are made into Suppositories by mixing with a variety of bases known in the art and need not be discussed in detail herein. Such as emulsifying bases or water-soluble bases. A subject Pharmaceutically acceptable excipients have been amply synthetic regulator can be administered rectally via a Sup described in a variety of publications, including, for pository. The Suppository can include vehicles Such as cocoa example, A. Gennaro (2000) “Remington: The Science and butter, carbowaxes and polyethylene glycols, which melt at Practice of Pharmacy,” 20th edition, Lippincott, Williams, & body temperature, yet are solidified at room temperature. Wilkins; Pharmaceutical Dosage Forms and Drug Delivery 0224 Unit dosage forms for oral or rectal administration Systems (1999) H. C. Ansel et al., eds., 7" ed., Lippincott, Such as syrups, elixirs, and Suspensions may be provided Williams, & Wilkins; and Handbook of Pharmaceutical wherein each dosage unit, for example, teaspoonful, table Excipients (2000) A. H. Kibbe et al., eds., 3" ed. Amer. spoonful, tablet or Suppository, contains a predetermined Pharmaceutical Assoc. amount of the composition containing one or more inhibi 0218. The pharmaceutically acceptable excipients, such tors. Similarly, unit dosage forms for injection or intrave as vehicles, adjuvants, carriers or diluents, are readily avail nous administration may comprise a subject synthetic regu able to the public. Moreover, pharmaceutically acceptable lator in a composition as a solution in Sterile water, normal auxiliary Substances, such as pH adjusting and buffering saline or another pharmaceutically acceptable carrier. US 2007/0128662 A1 Jun. 7, 2007 24

0225. The term “unit dosage form,” as used herein, refers Nos. 4,350,155; 5,443,450; 5,814,019; 5,976,109; 6,017, to physically discrete units suitable as unitary dosages for 328; 6,171,276; 6,241,704; 6,464,687; 6,475,180; and human and animal Subjects, each unit containing a prede 6.512.954. A further exemplary device that can be adapted termined quantity of a Subject synthetic regulator calculated for the present invention is the Synchromed infusion pump in an amount sufficient to produce the desired effect in (Medtronic). association with a pharmaceutically acceptable diluent, car rier or vehicle. The specifications for a subject synthetic 0232 Suitable excipient vehicles are, for example, water, regulator depend on the particular compound employed and saline, dextrose, glycerol, ethanol, or the like, and combi nations thereof. In addition, if desired, the vehicle may the effect to be achieved, and the pharmacodynamics asso contain minor amounts of auxiliary Substances such as ciated with each compound in the host. wetting or emulsifying agents or pH buffering agents. Actual 0226. A subject synthetic regulator can be administered methods of preparing Such dosage forms are known, or will as injectables. Injectable compositions are prepared as liquid be apparent, to those skilled in the art. See, e.g., Reming Solutions or Suspensions; solid forms suitable for solution in, ton's Pharmaceutical Sciences, Mack Publishing Company, or Suspension in, liquid vehicles prior to injection may also Easton, Pa., 17th edition, 1985. The composition or formu be prepared. The preparation may also be emulsified or the lation to be administered will, in any event, contain a active ingredient encapsulated in liposome vehicles. quantity of the synthetic regulator adequate to achieve the desired state in the subject being treated. 0227. In some embodiments, a subject synthetic regulator is delivered by a continuous delivery system. The term 0233. The pharmaceutically acceptable excipients, such “continuous delivery system’ is used interchangeably herein as vehicles, adjuvants, carriers or diluents, are readily avail with “controlled delivery system” and encompasses continu able to the public. Moreover, pharmaceutically acceptable ous (e.g., controlled) delivery devices (e.g., pumps) in auxiliary Substances, such as pH adjusting and buffering combination with catheters, injection devices, and the like, agents, tonicity adjusting agents, stabilizers, wetting agents a wide variety of which are known in the art. and the like, are readily available to the public. 0228 Mechanical or electromechanical infusion pumps Ophthalmic Formulations can also be suitable for use with the present invention. 0234. In some embodiments, a subject pharmaceutical Examples of such devices include those described in, for composition comprises a Subject synthetic regulator formu example, U.S. Pat. Nos. 4,692,147; 4,360,019; 4.487,603; lated for ophthalmic application. For ophthalmic applica 4,360,019; 4,725,852; 5,820,589; 5,643,207; 6,198,966; and tion, Solutions or medicaments are often prepared using a the like. In general, delivery of a subject synthetic regulator physiological saline Solution as a major vehicle. Ophthalmic can be accomplished using any of a variety of refillable, solutions should be maintained at a comfortable pH with an pump systems. Pumps provide consistent, controlled release appropriate buffer system. The formulations may also con over time. In some embodiments, the agent is in a liquid tain conventional, pharmaceutically acceptable preserva formulation in a drug-impermeable reservoir, and is deliv tives, stabilizers and Surfactants. ered in a continuous fashion to the individual. 0235 Preservatives that may be used in a subject phar 0229. In one embodiment, the drug delivery system is an maceutical composition include, but are not limited to, at least partially implantable device. The implantable device benzalkonium chloride, chlorobutanol, thimerosal, phe can be implanted at any Suitable implantation site using nylmercuric acetate and phenylmercuric nitrate. A useful methods and devices well known in the art. An implantation surfactant is, for example, Tween 80. Likewise, various site is a site within the body of a subject at which a drug useful vehicles may be used in the ophthalmic preparations delivery device is introduced and positioned. Implantation of the present invention. These vehicles include, but are not sites include, but are not necessarily limited to a Subdermal, limited to, polyvinyl alcohol, povidone, hydroxypropyl Subcutaneous, intramuscular, or other Suitable site within a methyl cellulose, poloxamers, carboxymethyl cellulose, Subject’s body. Subcutaneous implantation sites are used in hydroxyethyl cellulose and purified water. Some embodiments because of convenience in implantation and removal of the drug delivery device. 0236 Tonicity adjustors may be added as needed or convenient. They include, but are not limited to, salts, 0230. In some embodiments, the drug delivery device is particularly Sodium chloride, potassium chloride, mannitol an implantable device. The drug delivery device can be and glycerin, or any other Suitable ophthalmically accept implanted at any Suitable implantation site using methods able tonicity adjustor. and devices well known in the art. As noted infra, an 0237 Various buffers and means for adjusting pH may be implantation site is a site within the body of a subject at used so long as the resulting preparation is ophthalmically which a drug delivery device is introduced and positioned. acceptable. Accordingly, buffers include acetate buffers, Implantation sites include, but are not necessarily limited to citrate buffers, phosphate buffers and borate buffers. Acids or a Subdermal, Subcutaneous, intramuscular, or other Suitable bases may be used to adjust the pH of these formulations as site within a subject’s body. needed. 0231. In some embodiments, a subject synthetic regulator is delivered using an implantable drug delivery system, e.g., 0238 An ophthalmically acceptable antioxidant for use a system that is programmable to provide for administration in the present invention includes, but is not limited to, of the agent. Exemplary programmable, implantable sys Sodium metabisulfite, sodium thiosulfate, acetylcysteine, tems include implantable infusion pumps. Exemplary butylated hydroxyanisole and butylated hydroxytoluene. implantable infusion pumps, or devices useful in connection 0239). Other excipient components which can be included with such pumps, are described in, for example, U.S. Pat. in the ophthalmic preparations are chelating agents. A useful US 2007/0128662 A1 Jun. 7, 2007 chelating agent is edetate disodium (ethylenediamine tet intratracheal, Subcutaneous, intradermal, topical application, raacetate disodium. EDTA-disodium), although other intravenous, rectal, nasal, oral, and other enteral and chelating agents may also be used in place or in conjunction parenteral routes of administration. Routes of administration with it. may be combined, if desired, or adjusted depending upon the Dosages agent and/or the desired effect. The Subject synthetic regu lator can be administered in a single dose or in multiple 0240. In general, a subject synthetic regulator is admin doses. istered in an amount of from about 10 ng to about 10 mg per dose, e.g., from about 10 ng to about 20 ng, from about 20 0246 A subject synthetic regulator can be administered ng to about 25 ng, from about 25 ng to about 50 ng, from to a host using any available conventional methods and about 50 ng to about 75 mg, from about 75 ng to about 100 routes Suitable for delivery of conventional drugs, including ng, from about 100 ng to about 125 ng, from about 125 ng systemic or localized routes. In general, routes of adminis to about 150 ng, from about 150 ng to about 175 ng, from tration contemplated by the invention include, but are not about 175 ng to about 200 ng, from about 200 ng to about necessarily limited to, enteral, parenteral, topical, intraor 225 ng, from about 225 ng to about 250 ng, from about 250 bital, and intravitreous routes. ng to about 300 ng, from about 300 ng to about 350 ng, from 0247 Parenteral routes of administration other than inha about 350 ng to about 400 ng, from about 400 ng to about lation administration include, but are not necessarily limited 450 ng, from about 450 ng to about 500 ng, from about 500 to, topical, transdermal, Subcutaneous, intramuscular, ng to about 750 ng, from about 750 ng to about 1 mg, from intraorbital, intracapsular, intraspinal, intrasternal, and intra about 1 mg to about 5 mg. or from about 5 mg to about 10 venous routes, i.e., any route of administration other than mg per dose. In some embodiments, the amount of a subject through the alimentary canal. Parenteral administration can synthetic regulator per dose is determined on a per body be carried to effect systemic or local delivery of the subject weight basis. synthetic regulator. Where systemic delivery is desired, 0241 Those of skill will readily appreciate that dose administration typically involves invasive or systemically levels can vary as a function of the specific compound, the absorbed topical or mucosal administration of pharmaceu severity of the symptoms and the susceptibility of the tical preparations. subject to side effects. Preferred dosages for a given com 0248. A subject synthetic regulator can also be delivered pound are readily determinable by those of skill in the art by to the subject by enteral administration. Enteral routes of a variety of means. administration include, but are not necessarily limited to, 0242. In some embodiments, multiple doses of a subject oral and rectal (e.g., using a Suppository) delivery. synthetic regulator are administered. The frequency of administration of a Subject synthetic regulator can vary 0249 Methods of administration of the subject synthetic depending on any of a variety of factors, e.g., severity of the regulator through the skin or mucosa include, but are not symptoms, etc. For example, in some embodiments, a Sub necessarily limited to, topical application of a Suitable ject synthetic regulator is administered once per month, pharmaceutical preparation, transdermal transmission, twice per month, three times per month, every other week injection and epidermal administration. For transdermal (qow), once per week (qw), twice per week (biw), three transmission, absorption promoters or iontophoresis are times per week (tiw), four times per week, five times per Suitable methods. Iontophoretic transmission may be accom week, six times per week, every other day (qod), daily (qd), plished using commercially available “patches' which twice a day (qid), or three times a day (tid). As discussed deliver their product continuously via electric pulses through above, in Some embodiments, a Subject synthetic regulator is unbroken skin for periods of several days or more. administered continuously. Kits 0243 The duration of administration of a subject syn 0250 Also provided are kits that find use in practicing the thetic regulator, e.g., the period of time over which a subject Subject methods, as described above. For example, in some synthetic regulator is administer, can vary, depending on any embodiments, kits for practicing the Subject methods of a variety of factors, e.g., patient response, etc. For include at least a synthetic regulator, as described above. In example, a Subject synthetic regulator can be administered other embodiments, kits for practicing the Subject methods over a period of time ranging from about one day to about include at least a light-regulated polypeptide as described one week, from about two weeks to about four weeks, from above. In some embodiments, a Subject kit includes a about one month to about two months, from about two polypeptide and a Subject synthetic regulator. In other months to about four months, from about four months to embodiments, a Subject kit includes a polypeptide with a about six months, from about six months to about eight Subject synthetic regulator in stable association with the months, from about eight months to about 1 year, from about polypeptide. In other embodiments, kits for practicing the 1 year to about 2 years, or from about 2 years to about 4 subject methods include at least a test cell as described years, or more. above, or elements for constructing the same, e.g., expres Routes of Administration sion vectors, etc. In some embodiments, a Subject kit includes a cell (e.g., a eukaryotic cell or a prokaryotic cell), 0244. A subject synthetic regulator is administered to an where the cell produces a protein to be controlled, directly individual using any available method and route suitable for or indirectly, by a Subject synthetic regulator, and a subject drug delivery, including in vivo and ex vivo methods, as well synthetic regulator. Furthermore, additional reagents that are as systemic and localized routes of administration. required or desired in the protocol to be practiced with the 0245 Conventional and pharmaceutically acceptable kit components may be present, which additional reagents routes of administration include intranasal, intramuscular, include, but are not limited to: aqueous media, culture US 2007/0128662 A1 Jun. 7, 2007 26 media, and the like. The kits may also include reference or interest are the devices described in U.S. Pat. Nos. 6,468,736 control elements, e.g., that provide calibration signals or and 5,989,835. A feature of the HT devices of the present values for use in assessing the observed signal generated by invention is that they include in at least one fluid contain an assay performed with the kit components. The kit com ment element containing a test polypeptide, a test cell, or a ponents may be present in separate containers, or one or test membrane as described above. more of the components may be present in the same con tainer, where the containers may be storage containers EXAMPLES and/or containers that are employed during the assay for which the kit is designed. 0254 The following examples are put forth so as to provide those of ordinary skill in the art with a complete 0251. In addition to the above components, the subject disclosure and description of how to make and use the kits may further include instructions for practicing the present invention, and are not intended to limit the scope of Subject methods. These instructions may be present in the what the inventors regard as their invention nor are they Subject kits in a variety of forms, one or more of which may intended to represent that the experiments below are all or be present in the kit. One form in which these instructions the only experiments performed. Efforts have been made to may be present is as printed information on a Suitable ensure accuracy with respect to numbers used (e.g. amounts, medium or Substrate, e.g., a piece or pieces of paper on temperature, etc.) but some experimental errors and devia which the information is printed, in the packaging of the kit, tions should be accounted for. Unless indicated otherwise, in a package insert, etc. Yet another means would be a parts are parts by weight, molecular weight is weight aver computer readable medium, e.g., diskette, digital versatile age molecular weight, temperature is in degrees Celsius, and disc, compact disk, etc., on which the information has been pressure is at or near atmospheric. Standard abbreviations recorded. Yet another means that may be present is a website may be used, e.g., bp, base pair(s): kb, kilobase(s); pl. address which may be used via the internet to access the picoliter(s); S or sec, second(s); min, minute(s); h or hr, information at a removed site. Any convenient means may hour(s); aa, amino acid(s): kb, kilobase(s); bp, base pair(s): be present in the kits. nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperito Systems neal(ly); s.c., Subcutaneous(ly); and the like. 0252 Also provided are systems that find use in practic Example 1 ing the Subject methods, as described above. For example, in some embodiments, systems for practicing the subject meth Light-Activated Ion Channel ods include at least synthetic regulator as described above. In other embodiments, systems for practicing the Subject Methods methods include at least a light-regulated polypeptide as described above. In other embodiments, systems for prac Synthesis of MAL-AZO-QA ticing the Subject methods include at least a test cell as 0255 MAL-AZO-QA was synthesized in a two-step cou described above. Furthermore, additional reagents that are pling procedure from the commercially available 4,4'-aZo required or desired in the protocol to be practiced with the dianiline and the respective acid chlorides of the maleimide system components may be present, which additional and quaternary ammonium components. reagents include, but are not limited to: aqueous mediums, culture mediums, and the like. The systems may also include Patch Recordings from Oocytes reference or control elements, e.g., that provide calibration 0256 Xenopus oocytes were injected with 12.5-100 lug of signals or values for use in assessing the observed signal mRNA encoding Shaker H4, with the following mutations: generated by an assay performed with the system compo A6-46, E422C, T449V. We found that the effects of light on nents. The systems generally also include one or more channel activity were largest for the TEAbinding site mutant candidate agents. T449V as compared to the wild-type channel (T449) and two other mutants (T449Y. T449F). Devitillenized oocytes Devices were recorded from 2-10 days post-injection using standard 0253 Also provided are high throughput (HT) devices patch-clamp methods. For outside-out patches, glass patch that find use in practicing the Subject methods, particularly pipettes (2-4 MS2) were filled with a solution containing (in HT embodiments thereof. The high throughput devices may mM) 100 KC1, 10 HEPES, 0.1 CaCl, 0.5 MgCl, and 10 have any convenient configuration, and generally include a EGTA, while the bath contained 10 KC1, 90 NaCl, 10 plurality of two or more fluid containment elements in which HEPES, 0.1 CaCl, 0.5 MgCl, and 10 EGTA. For inside-out assays can take place, agent administration elements and patches, patch pipettes and bath both contained 100 KCl, 10 signal detection elements. For example, representative HT HEPES, 0.1 CaCl, 0.5 MgCl, and 10 EGTA. The pH of all devices of the subject invention include a plate or substrate solutions was 7.1. Solid MAL-AZO-QA was dissolved as a having a plurality of fluid-containing wells, reagent-adding concentrated stock solution in DMSO and stored at -20°C. equipment responsive to a computer for adding reagent, e.g., until the day of use. Stocks were diluted into oocyte bath candidate agent, to the wells, measurement equipment for solution to final concentrations of 10 uM or 100 uM. The measuring at least one attribute of the sample or cells concentration of DMSO in the bath did not exceed 0.1%. contained by the wells (e.g., for phenotype evaluation), a Pulse protocols and measurements were performed with light source for providing light of different wavelengths to pCLAMP software, a DigiData 1200 series interface, and a the contents of the wells, and moving equipment which is PC-505 amplifier (Warner Instruments). Samples were taken responsive to the computer for aligning one of the wells first at 10 kHz and the data was filtered at 1 kHz. Patches were with the reagent-adding component, then with the measure held at -90 mV, pulsed to -100 mV for 60 msec to monitor ment device. See, e.g., U.S. Pat. No. 6,127,133. Also of leak, and pulsed to -20 mV for 30-100 msec at 1 Hz to elicit US 2007/0128662 A1 Jun. 7, 2007 27

Shaker currents. The peak of the Shaker currents was Neuron 8, 483-491 (1992). Amino acid E422 is estimated to measured to minimize the contribution of slow inactivation. be 15-18 A from the TEA binding site. Blaustein, et al. Patches with a leak conductance>100 pS were not included Nature Struct. Biol. 7, 309-311 (2000); Doyle, et al. Science in analysis. 280, 69-77 (1998); Jiang, et al. Nature 423, 33-41 (2003). Tethering of a series of QA-containing compounds to posi 0257 Illumination of patches was achieved with a TILL tion 422 shows that the degree of block is critically depen Photonics Polychrome II monochrometer (Applied Scien dent on tether length, with a 5A difference in length making tific Instrumentation, Inc.) containing a 75 watt Xenon short the difference between effective and ineffective block. arc lamp with an output of 250-690 nm, a quartz, fiber optic Blaustein et al. (2000) supra. This information was used in cable, and an epi-fluorescence condenser with an achromatic designing and synthesizing a photoSwitchable blocker that lens. Discrete wavelengths of light (+/-10 nm) were focused can be tethered onto the outside of modified Shaker chan on patches through a quartz coverslip with a Fluor 20X, 0.5 nels. The molecule, MAL-AZO-QA, consists of a maleim NA objective lens (Nikon). Output intensity was measured ide (MAL), for cysteine tethering; a QA group, to block the for wavelengths between 300 and 600 nm. The measured channel; and an AZO group in between (FIG. 1a). Previous output intensities for wavelengths between 340-600 nm studies show that the rigid AZO moiety shortens by ~7 A ranged from 0.324e-8 to 6.23e-8 W/cm. Differences in light when photoisomerized from the trans to the cis configura intensities at different wavelengths were taken into account tion. Knoll, H. Photoisomerism of Azobenzenes. in CRC when determining action spectra for channel block and Handbook of Organic Photochemistry and Photobiology, unblock. 2 ed. (eds. Horspool, W. & Lenci, F.) 89.1-89.16 (CRC Recordings from Hippocamal Neurons Press, Boca Raton, Fla., 2004). It was reasoned that coupling 0258 Primary dissociated hippocampal cultures were MAL-AZO-QA to a cysteine introduced at residue 422 prepared from E18-19 Sprague-Dewey rat embryos and (mutant E422C) would block channels when the compound grown on glass cover slips in serum-containing media and is in the long trans form, whereas photoconversion to the cis incubated in 7% CO, in air at 37° C. Cells were co configuration would make the tether too short to permit transfected with GFP along with the modified Shaker chan block (FIG. 1b). Hence, the tethering of MAL-AZO-QA to nel described above with additional L366A and V454L Shaker should introduce a new extracellular gate that can be mutations. Transfections with Lipofectamine 2000i were opened and closed with appropriate wavelengths of light. performed at 12-14 DIV. About 10% of the cultured neurons 0260 FIGS. 1A and 1B Photoisomerization of MAL appeared GFP-positive at 2-3 days after transfection. Cov AZO-QA gates ionic currents through modified Shaker erslips containing the neurons were treated at 37° C. for 15 channels. (1a) The rigid core of MAL-AZO-QA (between min with 300 uMMAL-AZO-QA in an extracellular record the C. carbons flanking the AZO moiety) changes by 7 A ing solution containing (in mM) 135 NaCl, 5 KC1, 1.2 upon photoisomerization. (1b) MAL-AZO-QA blocks ion MgCl, 5 HEPES, 2.5 CaCl, and 10 glucose at pH 7.4. flow in the trans configuration but is too short to block Patch pipettes (7-10 MS2) were filled with 10 NaCl, 135 effectively after photoisomerization to the cis configuration. K-gluconate, 10 HEPES, 2 MgCl, 2 Mg-ATP, and 1 EGTA Diagram shows a model of the inner helices of the Shaker K' at pH 7.4. After washout of MAL-AZO-QA with extracel channel, derived from the crystal structure of the bacterial lular solution, membrane potential was recorded at room K" channel MthK', with the dimensions of MAL-AZO-QA temperature under whole-cell current clamp with an AXO drawn to scale. PATCH 200A amplifier (Axon Instruments) and filtered at 10 kHz. Initial recordings were made at resting potential to 0261) The effects of MAL-AZO-QA were tested on evaluate the effects of light on spontaneous activity. In Shaker channels expressed in Xenopus oocytes. To observe experiments where we wanted to quantify the effect of light the time course of channel modification, MAL-AZO-QA on firing (e.g. FIG. 4b), cultures were treated with CNOX (1 was applied onto the extracellular Surface of the channels in uM) and bicuculline (10 uM) to silence synaptic activity. outside-out membrane patches. MAZ-AZO-QA application Baseline currents were adjusted to set the membrane poten reduced the voltage-gated Shaker current by >60% over 4 tial at -50 mV before depolarizing current steps ranging min (FIG. 2a), but the limited survival time of excised from 0.01-0.03 na were applied to evoke action potentials. patches made it difficult to assess the full magnitude of Cells were irradiated with a Lambda-LS illuminator con block. Channel block developed slowly and persisted after taining a 125 watt Xenon arc lamp (Sutter Instruments washout (FIG. 2b), consistent with covalent attachment to Company), equipped with narrow bandpass (+/-10 nm) the channels. Subsequent exposure to ultraviolet light partly filters through a Fluor 20X, 0.5 NA objective lens (Nikon). relieved channel block and exposure to visible light restored Variability among data is expressed as mean +/-SEM, unless block. In contrast, light had no effect on channels in patches noted otherwise. that had not been treated with MAL-AZO-QA. 0262 To achieve more complete block of the channels, Results intact oocytes were treated with a higher concentration of 0259. As a starting point for engineering a light-activated MAL-AZO-QA for 30 min and then recorded from inside channel, the Shaker K channel was used because of the out patches (FIG. 2c). In this situation, ultraviolet light availability of structural and molecular information. Sig unblocked as much as 1 na of current, visible light re worth, F. Quart. Rev. Biophys. 27, 1-40 (1993); Laine, et al. blocked the channels almost completely, and both effects FEBS Lett. 564, 257-263 (2004). Voltage-gated K" channels, nearly reached steady-state within 5 Sec under standard including Shaker, are blocked by the binding of quaternary epifluorescence illumination. With steady ultraviolet illumi ammonium (QA) ions, such as tetraethylammonium (TEA), nation, the channels remained unblocked. However, in the to a site in the pore-lining domain. MacKinnon & Yellen, dark unblocked channels slowly (>5 min) returned to the Science 250, 276-279 (1990); Heginbotham, MacKinnon, blocked state (FIG. 2D), consistent with thermal relaxation US 2007/0128662 A1 Jun. 7, 2007 28 of the AZO moiety to the more stable trans configuration in 0266 To determine the complementary action spectrum the absence of light. Knoll, H. Photoisomerism of Azoben for channel re-block, patches were exposed to 380 nm for 1 Zenes. in CRC Handbook of Organic Photochemistry and min to maximize occupancy of the cis State. Subsequent Photobiology, 2" ed. (eds. Horspool, W. & Lenci, F) exposure to discrete wavelengths between 420 and 600 nm 89.1-89.16 (CRC Press, Boca Raton, Fla., 2004). Current caused re-block of the channels at different rates (FIG. 3c). block in the dark followed a bi-exponential time course, In this case, rate of re-block is the most relevant parameter, Suggesting that a second process was involved. This may be since many wavelengths will eventually result in complete a decrease in slow inactivation as the channels become block. Thus we measured the degree of block at a fixed time (0.2 min) for each wavelength. The broad peak of this action re-blocked by QA. Choi, et al. Proc. Natl. Acad. Sci. USA spectrum (FIG. 3d) suggests that wavelengths from 460 to 88, 5092-5095 (1991). 500 nm cause the fastest re-block of channels. 0263 FIGS. 2A-D. Photocontrol of MAL-AZO-QA 0267 FIGS. 3 A-D. Absorbance and action spectra of modified Shaker channels in Xenopus oocytes. (a) Raw MAL-AZO-QA. (a) The UV/VIS spectrum of a MAL-AZO Shaker K' current traces recorded from an outside-out patch QA-glutathione adduct (10 uM) in oocyte bath solution. To before and after treatment with MAL-AZO-QA. Scale bars: maximize the trans and cis isomers, the solution was 100 pA (vertical) and 50 msec (horizontal). The top trace in exposed to visible and ultraviolet light, respectively, for 3 each panel shows the current before MAL-AZO-QA appli minutes. To generate the adduct, MAL-AZO-QA (1 M) was cation. Bottom traces represent current after 4 min applica treated with reduced glutathione (1.5 M) in for 12 hrs at 21° tion of 10 uM MAL-AZO-QA and 2 min washout (left C. (b) Unblock of Shaker channels at different wavelengths. panel), after 1 min exposure to ultraviolet (380 nm) light Currents are from an inside-out patch alternately exposed to (middle panel), and after 1 min exposure to visible (500 nm) various wavelengths between 300-480 nm to unblock the light (right panel). The patch was held at -90 mV and channels, and 500 nm light to re-block the channels. (c) currents were elicited by 100 msec steps to -20 mV at 1 Hz. Re-block of Shaker channels at different wavelengths. The (b) K' current amplitudes from the same outside-out patch timecourse of block at various wavelengths of visible light. during perfusion with MAL-AZO-QA, during washout, and Each trial is preceded by 1 min irradiation at 380 nm to during alternating illumination with 380 and 500 nm light. unblock the channels. Traces are Superimposed for compari (C) Inside-out patch from an oocyte treated with 100 uM son. Normalized current amplitudes were measured at 0.2 MAL-AZO-QA for 30 min. The patch shows a large Shaker min after onset of block. (D) Action spectra for unblock (left current in 380 nm light and almost complete block in 500 nm. curve) and block (right curve) of Shaker K channels (n=3-8 light. Pulse protocol same as above, except pulse duration patches for each wavelength). Unblock (left axis): Current was 30 msec. (D) Current block in dark follows a biexpo unblocked at each wavelength divided by current at 380 nm. nential timecourse with t=0.49 min and t=4.79 min. Currents were compared within each patch. Block (right 0264. Which wavelengths are best for opening and clos axis): Fraction of normalized current blocked at 0.2 min ing MAL-AZO-QA-modified channels? To address this after illumination with visible light (n=2-7 patches for each question, the absorbance spectra of MAL-AZO-QA was wavelength). measured in solution as a glutathione adduct (FIG. 3a). The 0268. It was determined whether light-activated channels trans configuration of MAL-AZO-QA exhibits a large absor could be used to control neuronal excitability. First, the bance peak at 360 nm and small shoulder at ~440 nm, as Voltage-dependence of the channel was modified, so that the reported previously for other AZO derivatives. Knoll, supra. photoSwitch is the primary regulator of gating. Normally, Maximal photoisomerization to the cis configuration con Shaker K channels make only a minor contribution to the siderably decreased the 360 nm peak and slightly increased membrane conductance at typical resting potentials (-40 to absorbance between 440 and 540 nm. Although the spectra -70 mV). The channels also display voltage-dependent indicate the wavelengths of maximum absorbance for the inactivation, further limiting their contribution. Mutations trans and cis isomers, the spectral overlap between isomers were therefore introduced to eliminate rapid inactivation Suggests that these may not be the optimal wavelengths for (A6-46; Hoshi, et al. Science 250, 533-538 (1990)), reduce maximal photoconversion. In addition, coupling of MAL slow inactivation (T449V: Lopez-Barneo,et al. Receptors AZO-QA to the channel protein could affect the absorbance Channels 1, 61-71 (1993)), and shift voltage-dependent spectra. The optimal wavelengths were determined empiri activation to hyperpolarized potentials (L366A, Lopez, et al. cally by measuring the action spectrum of each isomer (FIG. Neuron 7, 327-336 (1991)), as confirmed by expression in oocytes. Expression of voltage-gated K' channels with these modifications should result in a high resting K" conductance 0265. To determine the wavelength that results in maxi and silencing of spontaneous activity. mal recovery of K currents, inside-out patches were ini tially exposed to long wavelength light (500 nm) from a 0269. This multiply-mutated Shaker channel was Xenon lamp for at least 1 minto maximize occupancy of the expressed in cultured hippocampal neurons, which were blocked state. The patch was then irradiated with a discrete subsequently treated with MAL-AZO-QA for 15 min in the wavelength between 300-480 nm for 1 min, and the peak dark, followed by thorough washout. Current clamp record current at steady-state was measured to determine the degree ings from transfected pyramidal cells, identified by co of unblock (FIG. 3b). The resulting action spectrum shows expression of GFP showed that exposure to 390 nm light that 380 nm is most effective in unblocking MAL-AZO silenced spontaneous action potentials within 3 Sec and QA-modified Shaker channels (FIG. 3d. The action spec exposure to 500 nm light restored activity also within trum for channel unblock should reflect the steady-state ratio seconds (FIG. 4a). Similar results were obtained in 5 cells. of trans and cis isomers (the photostationary State) at each Activity could also be restored simply by leaving neurons in wavelength. the dark after silencing, but the onset was slow (>30 sec), in US 2007/0128662 A1 Jun. 7, 2007 29 accord with the slow re-block of ionic current observed in glutamate, kainate, AMPA or domoic acid) have been solved oocyte patches in the dark. Hence a 5 sec pulse of 390 nm by X-ray crystallography'''. These structures provide a light should produce relatively sustained silencing. Pro vivid picture of how the LBD closes when the agonist binds. longed depolarizing current steps caused repetitive firing in 500 nm light (FIG. 4b, left). In contrast, in 390 nm light the 0273. The approach to engineering LiGluR was to site same steps elicited rapidly accommodating responses (usu specifically attach a tethered analogue of glutamate contain ally a single action potential, even with depolarization well ing a photoisomerizable azobenzene moiety to a “lip' of the above threshold) (FIG. 4b, right). On average, 390 nm light LBD clamshell (FIG. 5c). In one state of the azobenzene, the decreased the number of action potentials elicited by a LBD would not bind the tethered agonist and therefore depolarizing step by 79% (n=4) (FIG. 4c). remain open. Only after isomerization would the tether 0270 Light had no effect on MAL-AZO-QA-treated neu present the agonist to the binding site and thus effect closure. rons that expressed GFP without the multiply-mutated Overall, the reversible switching of an azobenzene would Shaker channels (n=4), nor on channel-transfected neurons allosterically trigger the opening and closing of the entire without MAL-AZO-QA treatment (n=5). Hence, it seems ion channel, mediated by the clamshell-like movement of that native K channels are not Susceptible to light-regulated the LBD. block by tethered MAL-AZO-QA, even though many of these channels can be blocked by TEA. The observation that 0274 FIGS. 5A-C Design of an allosteric photoswitch. only Shaker-transfected neurons are light sensitive Suggests (a) An agonist (orange) is tethered to a LBD through an that MAL-AZO-QA selectively attaches to the introduced optical switch (red) via linkers (black). In one state of the cysteine, which is facilitated by the high effective local Switch, the ligand cannot reach the binding pocket, whereas concentration of the cysteine-reactive maleimide when the in the other state the ligand docks and stabilizes the activated quaternary ammonium binds to the pore. Blaustein, J. Gen. (closed) conformation of the LB.D. (b) Schematic represen Physiol. 120, 203-216 (2002). Non-selective attachment of tation of the operating mode of iGluRs. Binding of an MAL-AZO-QA to extracellular cysteines on other mem agonist (orange) stabilizes the activated (closed) conforma brane proteins may have no detectable effects on cellular tion of the LBD and allosterically opens the pore, allowing electrophysiology, since other channels and receptors are flow of Na", Ca" and K". NBD=N-terminal domain. TMD= unlikely to have a TEA-binding site positioned at the appro transmembrane domain. (c) The principle of LiGluR. priate distance from a modifiable cysteine. Reversible optical switching of a tethered agonist on the 0271 FIGS. 4A-C. Expression of light-activated chan LBD opens and closes the pore. nels confers light-sensitivity on hippocampal pyramidal neurons. (a) Spontaneous action potentials are silenced and Methods revived by exposure to 390 and 500 nm light respectively. Synthetic Protocols. The neuron, transfected with the multiply-mutated Shaker channel, was treated for 15 min with MAL-AZO-QA before General Information recording. The frequency of spontaneous synaptic potentials generated by untransfected neurons is not affected by light. 0275 All non-aqueous reactions were performed using (b) Depolarizing current steps elicit repetitive firing in 500 flame- or oven-dried glassware under an atmosphere of dry nm light (left) but only single action potentials in 390 nm nitrogen. Commercial reagents were used as received. Non light (right). Neurons were held under current clamp at -55 aqueous reagents were transferred under nitrogen with a mV and depolarized up to ~-15 mV. (c) Summary of Syringe or cannula. Solutions were concentrated in vacuo on repetitive firing data. Number of spikes resulting from a a Buchi rotary evaporator. Diisopropylethylamine (DIPEA) suprathreshold depolarization to -15 mV is significantly was distilled from calcium hydride prior to use. Tetrahydro modulated by light in the multiply mutated Shaker-trans furan (THF) and methylene chloride (CHCl) were passed fected neurons treated with MAL-AZO-QA (*: p<0.01). through a column of activated alumina under N-pressure Neurons expressing the channel without MAL-AZO-QA prior to use. N,N-Dimethyl formamide (DMF) was degassed with a stream of N, dried over molecular sieves, and used treatment, or treated with MAL-AZO-QA without channel without further purification. Chromatographic purification expression, were unaffected by light. of products was accomplished using flash column chroma tography on ICN 6032-64 mesh silica gel 63 (normal phase) Example 2 or Waters Preparative C18 125 A 55-105 um silica gel Light-Regulated Ionotropic Glutamate Receptor (reversed phase), as indicated. Thin layer chromatography (TLC) was performed on EM Reagents 0.25 mm silica gel (iGluR) 60-Fs plates. Visualization of the developed chromato 0272. The iGluR family members mediate the major gram was performed using fluorescence quenching, excitatory currents in the central nervous system. Structur KMnO4, ceric ammonium molybdate (CAM), or iodine ally, they are tetrameric protein assemblies whose Subunits stains. IR spectra were measured with a Genesis FT-IR consist of an extracellular N-terminal domain (NTD), an spectrometer by thin film or Avatar 370 FT-IR by attenuated extracellular ligand binding domain (LBD), and a trans total reflectance accessory. Optical rotations were measured membrane domain (TMD) that forms the pore (FIG. 5b). using a Perkin-Elmer 241 Polarimeter at 25°C. and 589 nm. The LBD closes like a clamshell as it binds the agonist H and 'C NMR spectra were recorded in deuterated glutamate. This reversible binding and closure is allosteri solvents on Bruker AVB-400, AVQ-400, or DRX-500 spec cally coupled, in an as yet unknown way, to the opening of trometers and calibrated to the residual solvent peak. Mul the pore. The detailed structures of the LBD of several tiplicities are abbreviated as follows: S=singlet, d=doublet, iGluRs in their apo state or in complex with agonists (e.g. t=triplet, q=quartet, m=multiplet, app=apparent, br=broad. US 2007/0128662 A1 Jun. 7, 2007 30

123.3, 83.8, 61.8, 57.0, 40.6, 32.8, 28.1, 27.8, 20.7, 14.1; LRMS (ESI) Calc for CHNO, (M-H): 340.1. Found: 340.1. NH see ref. 1

S1 HO H N 9, EDCL, HOBt, DIPEA HP O

S2 O N COEt Boc Saturated carboxylic acid 9

1) 1M LiOH Orr HO/THF 0277 To a solution of S4 (80.0 mg 0.234 mmol) in 2) HC/EtOAc MeOH (10.0 mL) was added Pd/C (25 mg, 0.023 mmol). -- The resulting suspension was stirred at room temperature under a hydrogen atmosphere for 12 h. The suspension was COOEt then filtered through celite and concentrated to yield 9 (78 S3 mg, 97%) as a tan oil. Data for 9: R? 0.15 (5:4 hexanes: E tOAc with 1% AcOH); oil--18.9 (c 1.0, in CHCl); IR: 2980, 2936, 1787, 1742, 1719 cm; H NMR (CDC1, 400 l MHz) & 4.55 (d. 1H, J=9 Hz), 4.24 (q, 2H, J=7 Hz), 2.61 (m, N 1H), 2.38 (m. 2H), 2.24 (m. 1H), 1.95 (m. 2H), 1.68 (m. 2H), r 1.48 (s, 9H), 1.42 (m, 1H), 1.28 (t, 3H, J=7 Hz); 'C NMR (CDC1, 100 MHz) & 178.7, 174.7, 1712, 149.4, 83.5, 61.7, 57.1, 41.4, 33.6, 29.7, 28.4, 27.8, 21.9, 14.1: LRMS (ESI) Hooc1N1 NcooH Calc for CHNO, (M-H): 342.2. Found: 342.2.

Amide S3

l

H O

O-> N B OC COEt Boc Unsaturated carboxylic acid S4 0278) To a solution of S2 (83.7 mg, 0.316 mmol). 1-Hy droxy-benzotriazole hydrate (HOBt) (64.3 mg, 0.475 mmol), DIPEA (441 uL, 2.53 mmol), and N-Ethyl-N'-(3- 0276 A solution of 2 (321 mg, 1.07 mmol) and freshly dimethyldiaminopropyl)-carbodiimide HCl (EDCI) (79.0 distilled acrylic acid (231 mg, 3.21 mmol) in CH2Cl (5.0 mg, 0.412 mmol) in CHCl (12.0 mL) was added a solution mL) was added directly to solid Grubbs' 2" generation of 9 (130 mg, 0.380 mmol) in CHCl (5.0 mL). The mixture catalyst (43 mg, 0.025 mmol). The mixture was heated to was stirred at room temperature for 12 h. The mixture was reflux for 12 h. The reaction mixture was then concentrated diluted with CHCl (60 mL) and washed with a saturated and purified by normal phase chromatography (8.5:1.5 NaHCO, solution (2x100 mL) and brine (2x100 mL). The CHC1:EtOAc with 1% AcOH) to yield S4 (317 mg.92%) organic layer was dried over Na2SO4 filtered, and concen as a tan oil. Data for S4: R? 0.15 (5:4 hexanes: EtOAc with trated. Purification by normal phase chromatography (95.5 1% AcOH); ot--21.8 (c 1.0, in CHCl); IR: 2981, 2937, CHC1:MeOH) gave S3 (97 mg, 65%) as a white solid. 1788, 1742, 1717, 1653 cm; H NMR (CDC1,400 MHz) Data for S3: R 0.29 (95.5 CHC1: MeOH); mp57-59° C.; & 6.98 (m, 1H), 5.90 (d. 1H, J=15 Hz), 4.57 (d. 1H, J=9 Hz), ol--14.4 (c 1.0, in CHCl); IR: 3324, 2980, 2936, 2359, 4.24 (q, 2H, J=7 Hz), 2.82 (m, 2H), 2.34 (m. 1H), 2.25 (m, 2251, 1784, 1744, 1716, 1653, 1601, 1547 cm; H NMR 1H), 1.97 (m, 1H), 1.51 (s, 9H), 1.27 (t, 3H, J-7 Hz); 'C (CDC1,500 MHz) 88.83 (s, 1H), 7.50 (d. 2H, J=8 Hz), 7.28 NMR (CDC1, 100 MHz) & 173.4, 1710, 149.2, 147.2, (t, 2H, J=8 Hz), 7.06 (t, 2H, J=7 Hz), 4.87 (d. 1H, 9 Hz), 4.20 US 2007/0128662 A1 Jun. 7, 2007

(q, 2H, J=7 Hz), 4.08 (t, 2H, J=5 Hz), 2.59 (m. 1H), 2.31 (m, Hz), 3.88 (s. 2H), 1.46 (s, 9H); 'C NMR (DMSO-d. 125 2H), 2.18 (m. 1H), 1.89 (m, 2H), 1.70 (m, 2H), 1.44 (s, 9H), MHz) & 168.5, 156.0, 1524, 148.0, 142.8, 140.2, 124.8, 1.39 (m, 1H), 1.26 (t, 3H, J=7 Hz); 'C NMR (CDC1, 125 122.5, 119.3, 113.4, 78.1, 43.9, 28.2; HRMS (FAB) Calc for MHz) & 175.3, 173.7, 1712, 167.5, 149.3, 137.8, 128.9, CHNO (MH): 370.187915. Found: 370.187140. 124.3, 120.0, 83.7, 61.7, 57.2, 44.4, 41.4, 35.7, 29.7, 28.3, 27.8, 22.8, 14.2; HRMS (FAB) Calc for CHNO, (M)": 475.231851. Found: 475.232400. H N r NH2 Tether model 3 N O

H N HN 1sH Glycine-amide 6 O NHHCI 0281) To a solution of S5 (565 mg, 1.53 mmol) in a 9:1 Hoc1N1 Ncon mixture of CH2Cl:MeCH (50 mL) was added trifluoroace tic acid (50 mL). The mixture was stirred for 4 hat room temperature, concentrated, and triturated with diethyl ether 0279) To a solution of S3 (96.0 mg, 0.200 mmol) in THF (2x100 mL) to yield 6(695 mg.98%) as a purple solid. Data (2.0 mL) was added a 1.0 M aqueous solution of LiOH (2.0 for 6: mp-180° C. dec; UV (MeOH): 394 nmi; IR: mL). The mixture was stirred at 0° C. for 1 h and then 2879, 2637, 1673, 1621, 1601, 1542, 1502 cm; H NMR acidified to pH 2 with a 1.0 M HCl solution and extracted (MeOH-d 400 MHz) & 7.81 (d. 2H, J=9 Hz), 7.73 (m, 4H), with EtOAc (3x20 mL). The combined organic layers were 6.84 (d. 2H, J=9 Hz), 3.89 (s. 2H); 'C NMR (DMSO-d dried over NaSO filtered, and concentrated to give an oily 125 MHz) & 165.6, 150.4, 149.5, 147.3, 140.9, 126.1, 124.1, residue that was reacted with a saturated HCl solution in 121.1, 117.5, 42.3; HRMS (FAB) Calc for CHNO EtOAc for 2 hat room temperature. The resulting white solid (MH)": 270.135485. Found: 270.135930. was triturated with ethyl ether (3x20 mL) to yield 3 (68.5 mg, 85%). Data for 3: mp 154-156°C.: CF-11.4 (c 0.7. O in HO): IR: 2933, 1709, 1598, 1544 cm; H NMR (DO, H 500 MHz) & 7.30 (m, 4H), 7.13 (m. 1H), 3.92 (s. 2H), 3.87 N (m. 1H), 2.58 (m. 1H), 2.26 (m. 2H), 2.21 (m. 1H), 1.85 (m, H 1H), 1.55 (m, 4H); 'C NMR (DMSO-d. 125 MHz) & Ns N O rO 175.6, 172.4, 170.8, 167.9, 139.0, 128.7, 123.1, 119.1, 50.8, 42.7, 40.4, 35.0, 34.2, 31.2, 22.5; LRMS (ESI) Calc for HN1 C.H.N.O. (M-H)–: 364.2. Found: 364.1. O COEt OC Pyroglutamate S6 H N 1st 0282) To a solution of 6 (180 mg, 0.387 mmol), HOBt N O (78.6 mg, 0.581 mmol), DIPEA (269 uL, 1.55 mmol), and EDCI (96.4 mg. 0.503 mmol) in CHCl (20 mL) was added a solution of 9 (159 mg, 0.465 mmol) in CHCl (5.0 mL). HN The mixture was stirred at room temperature for 12 h. The N-Boc-glycine-amide S5 mixture was diluted with CHCl (250 mL) and washed with a saturated NaHCO solution (2x200 mL) and brine (2x200 mL). The organic layer was dried over NaSO, filtered, and 0280. To a solution of azodianiline 5 (750 mg, 3.50 concentrated. Purification by normal phase chromatography (97.395:5 CHC1:MeOH) gave S6 (223 mg, 97%) as an mmol), HOBt (135 mg, 5.25 mmol), DIPEA (2.40 mL, 14.0 orange solid. Data for S6: R? 0.32 (95.5 CHC1: MeOH): mmol), and EDCI (872 mg, 4.55 mmol) in CHCl (100 mL) mp 115-117° C.: C--9.8 (c 1.0, in CH,Cl); UV was added a solution of Boc-Gly-OH (674.0 mg, 3.85 mmol) (CHC1): 382 nmi; IR: 3358, 2361, 1781, 1741, 1697, 1651, in CHCl (20 mL). The mixture was stirred at room 1598, 1540 cm; H NMR (CDC1, 400 MHz) & 8.97 (s, temperature for 12 h. The mixture was diluted with CHC1. 1H), 7.80 (d. 2H, J=9 Hz), 7.76 (d. 2H, J=9 Hz), 7.66 (d. 2H, (400 mL) and washed with a saturated NaHCO, solution J=9 Hz), 7.03 (m. 1H), 6.72 (d. 2H, J=9 Hz), 4.52 (dd. 1H, (2x400 mL) and brine (2x400 mL). The organic layer was J=9 Hz), 4.21 (q, 2H, J=7 Hz), 4.12 (m, 2H), 4.07 (s-br, 2H), dried over NaSO, filtered, and concentrated. Purification 2.67 (m. 1H), 2.33 (s. 2H), 2.26 (m, 1H), 1.94 (m, 2H), 1.74 by normal phase chromatography (dry loaded, 10:07:3 (m, 3H), 1.46 (s, 9H), 1.27 (t, 3H, J=7 Hz); 'C CHCl:EtOAc) gave S5 (581 mg, 66%) as an orange solid. NMR(CDC1, 100 MHz)ö 175.6, 173.7, 1711, 167.6, 149.6, Data for S5: R 0.21 (95.5 CHC1: MeOH), mp 184-185° 149.2, 145.2, 139.3, 124.8, 123.1, 119.9, 114.5, 83.7, 61.7, C.; UV (MeOH): 391 mm; IR: 3306, 2424, 1705, 1673, 57.2, 44.3, 41.3, 35.6, 29.7, 28.1, 27.7, 22.7, 14.1; HRMS 1602, 1531, 1501 cm': "H NMR (MeOH-d 400 MHz) & (FAB) Calc for CH-NO, (M)": 594.280198. Found: 7.75 (d. 2H, J=9 Hz), 7.68 (d, 4H, J=9 Hz), 6.72 (d. 2H, J=9 59428O490. US 2007/0128662 A1 Jun. 7, 2007 32

r N O O

N H O N COEt B O C Amine 10

0283) To a solution of Fmoc-Gly-OH (600 mg, 2.02 4.24 (m, 2H), 4.03 (s. 2H), 3.85 (s. 2H), 2.64 (m, 1H), 2.34 mmol) and oxalyl chloride (1.2 mL of 2.0 M solution in (m. 2H), 2.28 (m. 1H), 2.08 (m. 1H), 1.89 (m, 1H), 1.72 (m, THF, 2.4 mmol) in CHCl2 (6.0 mL) was added one drop of 2H), 1.47 (s, 9H), 1.42 (m, 1H), 1.29 (t, 3H, J=7 Hz); 'C DMF. After stirring for 1 hat room temperature the mixture NMR (MeOH-d. 100 MHz)& 178.0, 176.5, 173.2, 170.1, was concentrated. The resulting acid chloride was redis 169.5, 1510, 150.6, 150.3, 142.6, 1419, 124.8, 124.7, solved in THF (11.0 mL) and added via cannula to a solution 121.3, 121.1, 84.9, 63.0, 59.0, 45.9, 44.3, 42.8, 36.6, 31.1, of S6 (400 mg, 0.672 mmol), DIPEA (586 uL, 3.36 mmol), 29.2, 28.3, 24.1, 14.7; HRMS (FAB) Calc for CHNO and 4-(Dimethylamino)-pyridine (DMAP) (8.2 mg, 0.067 (M)": 651.301662. Found: 651.304080.

O

INulls N H Amino acid S7

mmol) in THF (26.0 mL). After stirring 10 min at 0°C., the 0284) To a solution of 10 (180 mg, 0.276 mmol) in THF mixture was warmed to room temperature and stirred an (10.0 mL) at 0°C. was added 1.0 M LiOH (10.0 mL). After additional 3 h. The mixture was then diluted with CHCl stirring for 1 h, the mixture was acidified to pH 2 with 1 M (150 mL) and washed with a saturated solution of NaHCO HCl, THF was removed in vacuo, and the mixture was (2x150 mL) and brine (2x150 mL). The organic layer was purified by reversed phase chromatography (5:04:1 0.1% dried over NaSO, filtered, and concentrated. Purification by normal phase chromatography (90:10:0.6:0.6 formic acid in HO:MeCN) to yield S7 (143 mg, 80%) as a CH.Cl:MeoH:AcOH:HO) gave the Fmoc-glycine adduct yellow solid. Data for S7: mp>230° C. dec; C=-15.9 (c as an orange Solid that was Sufficiently pure for further 0.1, in DMSO); UV (DMSO): 379 mm; IR: 2981, 1690, reaction. To a solution of this compound in DMF (20.0 mL) 1660, 1595, 1546, 1500 cm; H NMR (MeOH-d 500 was added piperidine (200 uL 2.02 mmol). After stirring for MHz) & 7.87 (n, 4H), 7.76 (m, 4H), 4.07 (m, 1H), 4.03 (d. 6 h at room temperature, the mixture was concentrated and purified by reversed phase chromatography (4:1 2:3 0.1% 2H, J=5 Hz), 3.88 (s. 2H), 2.55 (m, 1H), 2.32 (m, 2H), 2.20 formic acid in HO:MeCN) to yield 10 (186 mg, 43%) as an (m. 1H), 1.70 (m, 4H), 1.59 (m. 1H), 1.42 (s.9H); C NMR orange solid. Data for 10: mp>210°C. dec; C=-15.5 (c (DMSO-d. 125 MHz) & 176.4, 1742, 172.5, 168.5, 163.8, 0.3, in MeOH), UV max (MeOH): 365 nmi; IR: 3280,2981, 155.4, 147.8, 147.6, 141.7, 141.2, 123.5, 123.4, 119.3, 79.2, 1781, 1690, 1593, 1546 cm; H NMR (MeOH-d 500 77.9, 52.5, 44.0, 42.9, 41.6, 35.0, 32.0, 28.2, 23.0; LRMS MHz) & 7.88 (m, 4H), 7.76 (m, 4H), 4.63 (d. 1H, J=9 Hz), (ESI) Calc for C.H.N.O. (M-H): 640.3. Found: 640.2. US 2007/0128662 A1 Jun. 7, 2007 33

N O W O N NHBoc Nulls N Hoc1N1 Noon

Maleimide S8

0285) To a solution of S7 (53 mg, 0.082 mmol) in a 10.39 (s, 1H), 8.23 (m, 1H), 7.84 (d. 4H, J=8 Hz), 7.79 (d. saturated solution of NaHCO (3.5 mL) was added finely 2H, J=9 Hz), 7.76 (d. 2H, J=9 Hz), 7.16 (s. 2H), 4.32 (s. 2H), ground N-methoxycarbonylmaleimide (105 mg. 0.677 3.91 (d. 2H, J=6 Hz), 3.81 (m, 1H), 2.89 (m, 1H), 2.16 (m, mmol) under vigorous stirring. After 30 min at 0°C., the 2H), 2.13 (m, 1H), 2.77 (m, 1H), 1.53 (m, 4H); 'C NMR mixture was diluted with THF (3.5 mL) and warmed to room (DMSO-d. 125 MHz) & 175.5, 1724, 170.9, 170.7, 168.4, temperature. After 1 h, the mixture was acidified to pH 1-2 165.3, 147.8, 147.6, 1417, 141.1, 135.0, 123.5, 123.4, with an aqueous solution of 1.0 MHSO and extracted with 119.4, 119.3, 64.9, 50.8, 42.7, 34.9, 31.7, 31.2, 22.4, 15.2: EtOAc (2x20 mL). The combined organic layers were dried HRMS (ESI)"Calc for CHNO (MH)": 622.2262. over NaSO filtered, and concentrated. Purification by Found: 622.2268. normal phase chromatography (90:10:0.6:0.6 CHC1:MeOH:AcOH:HO) gave S8 (42 mg, 71%) as a Site Directed Mutagenesis yellow solid. Data for S8: R? 0.20 (90:10:0.6:0.6 0287 Cysteine point mutations were introduced to the CHC1:MeOH:AcOH:HO); mp-230° C. dec; C)=-14.0 iGluR6 DNA, containing Q at the position 621 RNA editing (c 0.1, in MeOH); UV ) (MeOH): 365 nmi; IR: 3249, site' using the QuikChange site-directed mutagenesis kit 3186, 2928, 1753, 1708, 1687, 1651, 1520 cm; H NMR (Stratagene). The following PCR profile was used: one cycle (DMSO-d 500 MHz) & 10.61 (s, 1H), 10.31 (s, 1H), 8.19 (95° C. for 30s); 20 cycles (95°C. for 30s, 55° C. for 1 min, (m. 1H), 7.84 (d, 4H, J=9 Hz), 7.79 (d. 2H, J=9 Hz), 7.75 (d. 68°C. for 12 min). The forward and reverse oligonucleotide 2H, J=9 Hz), 7.16 (s. 2H), 7.10 (d. 2H, J=8 Hz), 4.32 (s. 2H), sequences designed for the L439C mutant were: 5'-GAT 3.82 (m. 1H), 3.64 (s. 2H), 2.35 (m, 1H), 2.15 (m, 2H), 1.93 TGTTACCACCATTTGCGAAGAACCGTATGTTCTG-3' (m. 1H), 1.59 (m. 1H), 1.49 (m, 3H), 1.42 (m. 1H), 1.36 (s. (SEQ ID NO:1); and 5'-CAGAACATACGGTTCTTCG 9H); 'CNMR (DMSO-d. 125 MHz) & 176.1, 1742, 172.5, CAAAATGGTGGTAACAATC-3' (SEQ ID NO:2). 170.7, 168.4, 166.6, 155.7, 147.9, 147.6, 1417, 141.1, Cell Culture and Transfection 135.0, 123.5, 123.4, 119.5, 119.3, 78.0, 52.4, 42.8, 41.4, 40.5, 45.0, 32.8, 32.1, 28.2, 22.9; LRMS (ESI) Calc for 0288 HEK293 cells were plated at approximately 3x10° C.H.N.O. (M-H): 720.3. Found: 720.3. cells/ml on poly-L-lysine-coated glass coverslips (Deutsche

N Y Sai Y N O N S. r O tO NHHCI W Nulls N HOC 1n 1\ CO2H

MAG 4

0286 To a flask containing solid S8 (38 mg, 0.053 mmol) Spiegelglas, Carolina Biological) and maintained in DMEM was added a saturated HCl solution in EtOAc (25.0 mL). with 5% fetal bovine serum, 0.2 mg/ml streptomycin, and After stirring at room temperature for 2 h, the resulting 200 U/ml penicillin at 37° C. Cells were transiently trans purple solid was triturated with ethyl ether (2x40 mL) to fected with various plasmids using lipofectamine 2000 yield 4 (30 mg, 87%). Data for 4: mp>230° C. dec; C=- (Invitrogen). The amount of total transfected iGluR6 DNA 19.5 (c. 0.7, in DMSO); UV (10% DMSO in HO): 363 and EYFP fusion DNA per well was fixed at 4 Lig and 200 nm, IR: 3279, 3052, 2935, 2362, 1922, 1709, 1598, 1538 ng, respectively. All recordings were carried out 36 to 48 h. cm'; H NMR (DMSO-d 500 MHz) & 10.70 (s, 1H), after transfection. US 2007/0128662 A1 Jun. 7, 2007 34

Attachment of MAG 0294 FIGS. 6A-D. Structures and fit of photoswitched agonist and iGluR6 LBD. (a) Chemical structure of the 0289 To conjugate MAG to cysteine mutants of iGluR6, iGluR6 agonists (2S,4R)-4-methyl glutamate 1, (2S,4R)-4- the compound was diluted to 10-100 uM (final concentration allyl glutamate 2 and tether model 3. (b) Structure of MAG 0.5-5% DMSO) in the HEK cell control solution and the 4 in its trans state (dark and 500 nm) and cis state (380 nm). cells were incubated in the dark for 15-30 min. (c) View looking into the “mouth” of iGluR6 LBD in complex with 1 (PDB ID 1 SD3) (10). Residues on clamshell Calcium Imaging “lips' that were individually mutated to cysteine are high 0290 –Cells were washed in PBS and loaded with 5uM lighted in yellow. Position 439 is shown in red. The methyl FURA-2-AM (Molecular Probes) for 30 min. Changes of group of 1 can be seen in blue at the bottom of the “exit Ca2+, in individual cells were measured as intracellular channel. (d) Docking model of MAG in the cis state Fura2 fluorescence intensity using mercury arc lamp illu attached at L439C (yellow) and bound to the activated mination and alternating excitation with band pass filters of (closed) conformation of the LBD. 350 nm and 380 nm during 66 ms at 5-20s intervals and 0295) To assay LBD activation, the calcium permeability detecting emission at 510 nm'. Fluorescence was moni of iGluR6' was utilized. The iGluR6 was expressed in tored on an inverted microscope system (Nikon). Images HEK293 cells, loaded the cells with the fluorescent calcium were captured with a CCD camera using the Imaging indicator FURA-2-AM', and the cells were exposed to Workbench software, which was also used to irradiate the various concentrations of agonist 2, or of the tether model 3. cells at 380 and 500 nm during 1-2 min in order to produce to quantify receptor activation (FIGS. 7A-E). Tether model photoisomerization of MAG. Measurements were per 3 evoked large responses (FIG.7b). Allyl glutamate 2 had an formed in a control solution (in mM): 135 NaCl, 5.4 KCl, ECso of 18 LM, while model 3 showed an ECso of 180 uM 0.9 MgCl, 1.8 CaCl, 10 HEPES, 10 glucose, and pH 7.6, (FIG. 7d). The maximal response of tether model 3 was containing 300 mg/l concanavalin A type IV (Sigma) to similar to that evoked by saturating glutamate, but ~30% block desensitization'. L-Glutamate was applied as lower than that of the agonist 2 (FIG. 7d), indicating that the reported in text and figures. The results are representative side chain may interfere with clamshell closure to a minor data from multiple cells in at least two independent cultures. degree. These results suggest that tethering a glutamate Whole-Cell Patch Clamping analogue is possible while maintaining effective agonism. The loss in apparent affinity due to the side chain of model 0291 Patch clamp recordings were carried out using an 3 should be compensated for by the high effective local Axopatch 200A amplifier in the whole cell mode. Cell concentration of a tethered ligand on its short leash. voltage was held at -60 mV. Pipettes had resistances 4-8 0296 FIGS. 7A-E Calcium imaging of iGluR6 activity. MS2 and were filled with a solution containing (in mM): 145 (a) Superimposed bright field (grey) and EYFP (green) CsC1, 5 EGTA, 0.5 CaCl, 1.0 MgCl, 10 HEPES, pH7.2. images of HEK293 cells co-transfected with iGluR6 and Illumination was applied using a TILL Photonics Poly EYFP. (b) Calcium image (350/380 nm) of FURA-2-AM chrome II monochromator through a 60x/1.2W objective loaded cells during perfusion of 300 uM glutamate. Red and (power output: 12.4 W/m irradiance; 500 nm as measured blue corresponds to high and low Ca" concentration, with a Newport optical power meter). Data was recorded respectively. (c) Simultaneous Ca" concentration traces with pClamp software, which was also used to control the from individual cells in response to indicated concentrations monochromator. of the tether model 3. (d) Dose-response curves from Ca" Results traces as in panel C. Higher concentrations of 3 activate iGluR6 at similar levels to saturating (1 mM) glutamate, to 0292. The design of a tethered agonist was based on which responses are normalized. Tether model 3 has an extensive structure-activity relationship analyses that have EC50 of 180 uM, compared to the higher affinity molecule been performed on iGluRagonists''' and, importantly, on 2 on which it was based, which has an EC50 of 18 uM. (e) the X-ray structure of the LBD of iGluR6 in complex with MAG 4 confers light sensitivity on iGluR6-L439C express the agonist (2S,4R)-4-methyl glutamate (1) (FIG. 6c)'. ing cells (reversible increases in Ca" at 380 nm and From this structure, it can be seen that the ligand-bound decreases at 500 nm) but not on wildtype iGluR6 (WT). form of the clamshell, although closed, features a narrow Agonism by free MAG is transient and reverses upon “exit channel.” It was believed that the exit channel would washout for both iGluR6-L439C and WT. IGluR6-L439C enable a tether appended to an agonist to protrude and reach retains ability to be activated by free glutamate after MAG an attachment site at the surface of the protein, while still 4 conjugation. Note that Ca" concentration is not measured permitting the clamshell to close over the agonist and during irradiation at 380 or 500 nm, or during conjugation. activate. 0297. After evaluation of the stereochemistry and syn 0293) To explore the feasibility of this idea, a “tether thetic accessibility of several candidates, attention was model, termed MV-2-025 (3) (FIG. 6a), was synthesized. focused on the tethered agonist compound designated MAG This compound is in essence an alkylated version of (4) (FIG. 6b). This compound features a cysteine reactive glutamate and resembles the known iGluR6 agonist (2S, maleimide (M), an azobenzene photoswitch (A), and a 4R)-4-allylglutamate (2) (FIG. 6a)''. The allyl side chain of glutamate head-group (G). Since the iGluR X-ray structure, this compound was extended to include a moiety that on which the design was based, only provides a Snapshot of mimics half of an azobenzene. This partial tether should, in a flexible protein, a certain amount of conformational flex principle, be long enough to project out of the exit channel ibility was also built into MAG 4 by adding to the linker and thus serve as a reasonable basis for determining if a freely rotatable bonds. The UV-VIS spectra of the cis- and full-length azobenzene tether would impede LBD activation. trans-isomers of soluble MAG 4 are typical of azobenzenes. US 2007/0128662 A1 Jun. 7, 2007

MAG 4 was prepared by multi-step synthesis, featuring a 0301 Importantly, the photocurrents were fully revers Grubbs olefin metathesis, several amide couplings and an ible and highly reproducible. Repeated switching between intricate sequence of protective group manipulations as 380 and 500 nm evoked responses of similar amplitude over shown in Scheme 1, depicted in FIG. 8. The tether model 3 a period of more than 30 minutes, consistent with the was prepared along similar lines. resistance of azobenzenes to bleaching and demonstrating that the system is robust. Even with weak illumination from 0298. In parallel to the synthetic work described herein, a standard fluorescence lamp, attenuated by passage through a series of single cysteine mutants of iGluR6 was prepared a monochromator and fiber guide, the receptor turned on and by site-directed mutagenesis. The positions were chosen to off rapidly (Teso =115+3 ms and r off-500 nm=92.3+0.3 form a perimeter around the exit channel, close to where the ms; meant-SEM, N=3) at a power of 12.4 W/m (irradiance maleimide end of the tether was predicted to stick out (FIG. at 500 nm). 6c). Ca" imaging was used to search for cysteine mutants 0302) LiGluR can be turned on and off with light, but also that would provide optical activation after covalent attach preserves the ability to be activated by freely diffusible ment of MAG 4. Although Ca" imaging has slow kinetics glutamate (FIGS. 9A, 9B). The currents generated by irra and illumination at wavelengths that are absorbed by diation are smaller than currents evoked by saturating (300 aZobenzene, this assay enabled rapid testing of attachment uM) glutamate and by saturating (21 mM) tether model 3. positions. Three were found that demonstrated clear This could be due to incomplete labeling, however, we responses to light in which Ca"-concentration increased at consider that unlikely since increased exposure (in either 380 nm and declined back to basal levels at 500 nm. Of the concentration or time) to MAG 4 during the conjugation three, the version of the receptor with a cysteine at 439 period did not change the size of the optical response. (iGluR-L439C) had the largest responses (FIG. 7e). Because Alternatively, MAG 4 may only permit partial closure of the the rise in free cytoplasmic Ca" concentration depends not LBD. Incomplete closure of the ligand-binding domain has only on influx through iGluRs, but also on Ca" buffering been previously linked to partial agonism in the related and pumping, we turned for further characterization to iGluR2 channel'. whole cell patch clamping to directly measure the kinetics of channel gating and to obtain quantitative measures of acti 0303 FIGS. 9A and 9B Whole-cell patch-clamp current Vation efficiency. recordings from HEK293 cells expressing iGluR6-L439C after conjugation of MAG 4. (a) Inward currents (downward 0299 FIG. 8. Scheme 1 Total Synthesis of MAG 4. deflections, carried mainly by Na' influx) in response to Reagents and conditions: (a) Boc-Gly-OH, EDC, HOBt, glutamate are preserved in LiGluR. Irradiation with short DIPEA (66%); (b) TFA, CHC1 (98%); (c) see ref. 15; (d) wavelengths of light (280 to 480 nm, in 20 nm increments) Acrylic Acid, 5% Grubbs' 2" generation catalyst (92%); (e) shows maximal activation at 380 nm. Irradiation with long H. Pd/C, MeOH (97%); (f) 6, EDCI, HOBt, DIPEA (97%); wavelengths of light (400 to 600 nm, in 20 nm increments) (g) Fmoc-Gly-OH, (COCl), DMF: (h) Piperidine, DMF shows maximal deactivation at 500 nm. Alternation between (43%, over two steps): (i) 1.0 M LiOH HO/THF, 0° C. 380 and 500 nm illumination evokes highly reproducible (80%): 0) N-Methoxycarbonylmaleimide, NaHCO, THF/ responses. HO (71%); (k) HCl sat’d EtOAc (87%). Boc, t-butoxycar bonyl: CHCl, dichloromethane; (COCl), oxalyl chloride; 0304 (b) Patch-clamp traces comparing responses of DIPEA, diisopropylethylamine; DMF, N,N-dimethylforma LiGluR to Saturating glutamate, optical Switching and the mide: EDCI, N-ethyl-N'-(3-dimethyldiaminopropyl)-carbo titration of the tether model 3. Saturating responses elicited diimide HCl, EtOAc, ethyl acetate; Fmoc, 9-fluorenylme by 3 are slightly higher than by 380 nm irradiation, sug hoxycarbonyl: Gly, glycine: HOBt, 1-hydroxybenzotriazole gesting geometric constraints that prevent the LBD from hydrate; MeOH, methanol; Pd/C, palladium on carbon; TFA, fully closing on MAG. trifluoroacetic acid; THF, tetrahydrofuran. 0305) The efficient activation of iGluR6-L439C by MAG 0300. As shown in FIGS. 9A and 9B, iGluR-L439C 4 can be explained by a model that shows cis-MAG docked conjugated with MAG 4 (LiGluR) can be activated both by into the glutamate-binding site of the closed (activated) free glutamate and by illumination. The photostationary conformation of the LBD (FIG. 6d). It is apparent that the cis/trans ratio of azobenzenes depends on the wavelength, linker between the glutamate head-group and the azoben with maximum cis-state occupancy typically observed at Zene moiety can comfortably protrude through the exit ~380 nm and maximum trans-state occupancy observed at channel, with the azobenzene almost completely exposed to ~500 nm''. The conjugate was illuminated at 500 nm (to solvent. favor the inactive trans form) and illumination at wave lengths that ranged from 280 to 460 nm (to photoisomerize REFERENCES to the active cis form) was tested. The shortest test wave lengths evoked no response, the intermediate wavelengths 0306 1. Feringa, B. L. Ed. Molecular Switches. (Wiley evoked Substantial inward currents, and the longer wave VCH, Weinheim, Germany, 2001). lengths had smaller responses. The largest current was at 380 0307 2. Goeldner, M. & Givens, R. Dynamic Studies in nm, agreeing with peak photoisomerization of free azoben Biology. (Wiley-VCH. Weinheim, Germany, 2005). Zene to the cis form. To examine the opposite transition, the receptor was maximally activated with 380 nm illumination 0308) 3. Lester, H. A., Krouse, M. E., Nass, M. M., and tested wavelengths between 400 and 600 nm. Receptors Wassermann, N. H. & Erlanger, B. F. Covalently bound were most efficiently turned off at 500 nm, agreeing with the photoisomerizable agonist—Comparison with reversibly peak photoisomerization of free azobenzene to the trans bound agonists at electrophorus electroplaques. J. Gen. form. Physiol. 75, 207-232 (1980). US 2007/0128662 A1 Jun. 7, 2007 36

0309 4. Kocer, A., Walko, M., Meijberg, W. & Feringa, 0324) 19. Knoll, H. in CRC Handbook of Organ ic B. L. A light-actuated nanovalve derived from a channel Photochemistry and Photobiology Horspool, W., & Lenci, protein. Science 309, 755-758 (2005). F. Eds. 89, 1-89 (CRC Press, Boca Raton, Fla., 2004). 0310) 5. Banghart, M., Borges, K., Isacoff, E., Trauner, D. 0325 20. Jin, R. S., Banke, T. G., Mayer, M. L., Trayne & Kramer, R. H. Light-activated ion channels for remote lis, S. F. & Gouaux, E. Structural basis for partial agonist control of neuronal firing. Nature Neurosci. 7, 1381-1386 action at ionotropic glutamate receptors. Nature Neurosci. (2004). 6, 803-810 (2003). 0311) 6. Paas, Y. The macro- and microarchitectures of 0326) 21. Kercher, M. A., Lu, P. & Lewis, M. Lac the ligand-binding domain of glutamate receptors. Trends repressor operator complex. Curr. Opin. Struct. Biol. 7, Neurosci. 21, 117-125 (1998). 76-85 (1997). 0312 7. Dingledine, R., Borges, K., Bowie, D. & Trayne 0327. 22. Kunishima, N. et al. Structural basis of lis, S. F. The glutamate receptor ion channels. Pharmacol. glutamate recognition by a dimeric metabotropic Rev. 51, 7-61 (1999). glutamate receptor. Nature 407,971-977 (2000). 0313 8. Pin, J. P. Galvez, T. & Prezeau, L. Evolution, 0328 23. Furukawa, H. & Gouaux, E. Mechanisms of structure, and activation mechanism of family 3/CG activation, inhibition and specificity: crystal structures of protein-coupled receptors. Pharmacol. Ther. 98, 325-354 the NMDA receptor NR1 ligand-binding core. EMBO.J. (2003). 22, 2873-2885 (2003). 0314) 9. Kandel, E. R., Schwartz, J. H., & Jessell, T. M., 0329 24. Chen, X. et al. Structural identification of a Eds. Principles of Neural Science. (McGraw-Hill, N.Y., bacterial quorum-sensing signal containing boron. Nature ed. 4, 2000). 415, 545-549 (2002). 0315) 10. Erreger, K., Chen, P.E., Wyllie, D. J. A., & 0330 25. Bayley, H. & Jayasinghe, L. Functional engi Traynelis, S. F. Glutamate receptor gating. Crit. Rev. neered channels and pores. Mol. Membr. Biol. 21, 209 Neurobiol. 16, 187 (2004). 220 (2004). 0316 11. Armstrong, N. & Gouaux, E. Mechanisms for 0331, 26. Dwyer, M. A. & Hellinga, H. W. Periplasmic activation and antagonism of an AMPA-Sensitive binding proteins: a versatile Superfamily for protein engi glutamate receptor: Crystal structures of the GluR2 ligand neering. Curr: Opin. Struct. Biol. 14, 495-504 (2004). binding core. Neuron 28, 165-181 (2000). 0332) 27. Willner, I. & Willner, B. Molecular and bio 0317) 12. Mayer, M. L. Crystal structures of the GluRs molecular optoelectronics. Pure Appl. Chem. 73,535-542 and GluR6 ligand binding cores: Molecular mechanisms (2001). underlying kainate receptor selectivity. Neuron 45, 539 0333). 28. Balzani, A. C. V.,. & Venturi, M. Molecular 552 (2005). Devices and Machines: A Journey Into the Nanoworld 0318 13. Nanao, M. H., Green, T., Stern-Bach, Y., Hei (Wiley-VCH. Weinheim, Germany, 2003). nemann, S. F. & Choe, S. Structure of the kainate receptor 0334 29. Wilding, T. J. & Huettner, J. E. Activation and Subunit GluR6 agonist-binding domain complexed with desensitization of hippocampal kainate receptors. J. Neu domoic acid. Proc. of the Natl. Acad. Sci. USA 102, rosci. 17, 2713-2721 (1997). 1708-1713 (2005). 0335) 30. Partin, K. M., Patneau, D. K., Winters, C. A., 0319. 14. Johansen, T. N. Greenwood, J. R. Frydenvang, Mayer, M. L. & Buonanno, A. Selective Modulation of K., Madsen, U. & Krogsgaard-Larsen, P. Stereostructure Desensitization at AMPA Versus Kainate Receptors by activity studies on agonists, at the AMPA and kainate Cyclothiazide and Concanavalin-A. Neuron 11, 1069 Subtypes of ionotropic glutamate receptors. Chirality 15, 1082 (1993). 167-179 (2003). 0320 15. Pedregal, C. et al. 4-alkyl- and 4-cinnamyl Example 3 glutamic acid analogues are potent GluR5 kainate recep Light-Controlled Ionotropic Glutamate Receptor; tor agonists. J Med. Chem. 43, 1958-1968 (2000). Affinity Labeling 0321) 16. Ezquerra, J. et al. Stereoselective Reactions of 0336. The analysis of cell signaling requires the rapid and Lithium Enolates Derived from N-Boc Protected Pyro selective manipulation of protein function. Such control has glutamic Esters. Tetrahedron 49, 8665-8678 (1993). been elusive because high ligand specificity usually derives 0322 17. Kohler, M., Burnashev, N., Sakmann, B. & from high affinity, yielding slow unbinding kinetics. More Seeburg, P. H. Determinants of Ca2+ Permeability in Both over, drug action is difficult to control spatially. Photo Tm1 and Tm2 of High-Affinity Kainate Receptor Chan switches were synthesized that covalently modify target nels—Diversity by Rina Editing. Neuron 10, 491-500 proteins and reversibly present and withdraw a ligand from its binding site due to photoisomerization of an azobenzene (1993). linker. The properties of a glutamate photoSwitch that con 0323, 18. Grynkiewicz, G., Poenie, M. & Tsien, R. Y. A trols an ion channel in cells are described here. Affinity New Generation of Ca-2+ Indicators with Greatly labeling and geometric constraints ensure that the photo Improved Fluorescence Properties. J. Biol. Chem. 260, Switch controls only the targeted channel. PhotoSwitching to 3440-3450 (1985). the activating state places a tethered glutamate at a high US 2007/0128662 A1 Jun. 7, 2007 37

(millimolar) effective local concentration near the binding was distilled from calcium hydride prior to use. Tetrahydro site. The fraction of active channels can be set in an analog furan (THF) and methylene chloride (CHCl) were passed manner by altering the photostationary state with different through a column of activated alumina under N2-pressure wavelengths. The bi-stable photoswitch can be turned on prior to use. N,N-Dimethyl formamide (DMF) was degassed with millisecond long pulses at one wavelength, remain on with a stream of N, dried over molecular sieves, and used in the dark for minutes, and turned off with millisecond long without further purification. Chromatographic purification pulses at the other wavelength, yielding Sustained activation of products was accomplished using flash column chroma with minimal irradiation. The system provides rapid, revers tography on ICN 6032-64 mesh silica gel 63 (normal phase) ible remote control of protein function that is selective or Waters Preparative C18 125 A 55-105 um silica gel without orthogonal chemistry. (reversed phase), as indicated. Thin layer chromatography (TLC) was performed on EM Reagents 0.25 mm silica gel Methods 60-Fs plates. Visualization of the developed chromato Synthesis of iGluR6 Tethered Agonist MAG-2. gram was performed using fluorescence quenching, KMnO, ceric ammonium molybdate (CAM), or iodine 0337 MAG-2 was synthesized using chemistry similar to stains. IR spectra were measured with a Genesis FT-IR that previously described for MAG-1 (See Example 2 for spectrometer by thin film or Avatar 370 FT-IR by attenuated synthesis of MAG-1.). total reflectance accessory. Optical rotations were measured 0338 All non-aqueous reactions were performed using using a Perkin-Elmer 241 Polarimeter at 25°C. and 589 nm. flame- or oven-dried glassware under an atmosphere of dry H and 'C NMR spectra were recorded in deuterated nitrogen. Commercial reagents were used as received. Non solvents on Bruker AVB-400, AVQ-400, or DRX-500 spec aqueous reagents were transferred under nitrogen with a trometers and calibrated to the residual solvent peak. Mul Syringe or cannula. Solutions were concentrated in vacuo on tiplicities are abbreviated as follows: S=singlet, d=doublet, a Buchi rotary evaporator. Diisopropylethylamine (DIPEA) t=triplet, q=quartet, m=multiplet, app=apparent, br=broad.

Scheme 1: Synthesis of MAG 2 HN

N Boc-Gly-OH, EDCI, 2 HOBt, DIPEA (58%)

NH2

HN

N 2 O TFA, CH2Cl2 H (98%) N NH 1sms O 4

O

HO

HN - a O N COOEt 2N Boc N O 7 H EDCL, HOBt N DIPEA N NH (33%) US 2007/0128662 A1 Jun. 7, 2007

-continued HN

12 N N2 O O

N N lu N 1) Fmoc-Gly-OH H H (COCI), DMF O 2) Piperidine, DMF (64%) - S. Boc 6

H try N O 2 N

N2 O O N O N ulu N 1M LiOH H H H2O/THF O --- (63%) - S. Boc 8

H O N n-n O O 4N O O N-4 OMe --- NH O NH r NH HO/THFNaHCO O (43%) E NHBoc Hooc1N1 Noooh 9

O H 1. N N O 2 N O N O O HCFEtOAC

N --- N (73%) H H O NHBoc Hooc1N1 Ncoon 10 US 2007/0128662 A1 Jun. 7, 2007 39

-continued O 1 N O O 4N O O

N --- N H 1s O NHHC Hooc1N1)-coon 10

N-Boc-glycine-amide 4 HN

4N O N runs O

0339. To a solution of azodianiline (2.00 g, 9.4 mmol), 1-Hydrozy-benzotriazole hydrate (HOBt) (1.91 g, 14.1 mmol), Diisopropylamine (DIPEA) (6.54 mL, 37.6 mmol), HN and N-Ethyl-N'-(3-dimethyldiaminopropyl)-carbodiimide HCl (EDCI) (2.34g, 12.2 mmol) in CHCl (260 mL) was C s? N O added a solution of Boc-Gly-Gly-OH (2.39 g, 10.3 mmol) in H CHCl (50 mL). The mixture was stirred at room tempera lu ture for 12 h. The mixture was diluted with CHC1 (500 NH 1st, mL) and washed with a saturated NaHCO solution (2x500 O mL) and brine (2x500 mL). The organic layer was dried over Glycine-amide 5 NaSO, filtered, and concentrated. Purification by normal phase chromatography (dry loaded, 10:0 20:1 CHCl:Mec)H) gave 4 (878 mg, 58% based on recovered 0340. To a solution of 4 (1.00 g, 1.53 mmol) in a 5:1 aZodianiline) as an orange solid. Data for 4: R? 0.28 (95:5 mixture of CH2Cl:MeCH (90 mL) was added trifluoroace CHC1: MeOH); mp 190-192° C.; UV u (MeOH): 394 tic acid (90 mL). The mixture was stirred for 4 hat room nm, IR: 3397, 3365, 3273, 1712, 1703, 1651, 1598, 1613, temperature, concentrated, and triturated with diethyl ether 1550 cm; H NMR (DMSO-de, 400 MHz) & 10.09 (s, 1H), (2x100 mL) to yield 5 (1.01 g, 98%) as a purple solid. Data 8.20 (m, 1H), 7.72 (m, 4H), 7.61 (d. 2H, J=9 Hz), 7.08 (m, for 5: mp 174-175° C.; UV (MeOH): 394 nmi; IR: 3269, 1H), 6.65 (d. 2H, J=9 Hz), 6.02 (s. 2H), 3.92 (d. 2H, J=6 Hz), 3080, 1666, 1599, 1575, 1540, 1506 cm; H NMR 3.60 (d. 2H, J=6 Hz), 1.38 (s, 9H); 'C NMR (DMSO-d (MeOH-d 500 MHz) & 7.83 (m, 4H), 7.75 (d. 2H, J=9 Hz), 125 MHz) & 173.3, 169.7, 158.8, 153.3, 150.7, 145.7, 1407, 7.12 (d. 2H, J=7 Hz), 4.13 (s. 2H), 3.80 (s. 2H); 'C NMR 126.0, 123.7, 1214, 115.2, 81.0, 45.0, 44.0, 28.7; HRMS (DMSO-d. 125 MHz) & 169.4, 169.1, 149.7, 14.8.7, 141.8, (FAB) Calc for CHNO (M)": 427.209379 Found: 126.2, 124.1, 121.2, 119.7, 43.9, 41.5; HRMS (FAB) Calc 427.21032O. for CHNO (MH)": 327.156949. Found: 327.156620. US 2007/0128662 A1 Jun. 7, 2007 40

H2N, 2 O --- N r N

O COEt B O C Pyroglutamate 6

0341) To a solution of 5 (913 mg, 2.07 mmol), HOBt (421 DMF. After stirring for 1 hat room temperature the mixture mg, 3.11 mmol), DIPEA (1.44 mL, 8.29 mmol), and EDCI was concentrated. The resulting acid chloride was redis (517 mg, 2.69 mmol) in CHCl (100 mL) was added a solved in THF (3.0 mL) and added via cannula to a solution solution of 7 (854 mg, 2.49 mmol) in CHCl (25 mL). The of 6 (81.7 mg, 0.125 mmol), DIPEA (109 uL, 0.625 mmol), mixture was stirred at room temperature for 12 h. The and 4-(Dimethylamino)-pyridine (DMAP) (1.5 mg, 0.013 mixture was diluted with CHCl (300 mL) and washed with mmol) in THF (7.0 mL). After stirring 10 min at 0°C., the a saturated NaHCO solution (2x300 mL) and brine (2x300 mixture was warmed to room temperature and stirred an mL). The organic layer was dried over NaSO, filtered, and additional 3 h. The mixture was then diluted with CHCl concentrated. Purification by normal phase chromatography (100 mL) and washed with a saturated solution of NaHCO (95:590:10 CHC1:MeOH) gave 6 (442 mg, 33%) as an (2x100 mL) and brine (2x100 mL). The organic layer was orange solid. Data for 6: R? 0.29 (95.5 CHCl: MeOH); imp dried over NaSO, filtered, and concentrated. Purification 124-126° C.: C=-54.0 (c 0.1, in MeOH); UV by normal phase chromatography (90:10:0.6:0.6 (MeOH): 394 mm; IR: 3356, 2980, 2922, 2844, 1652, 1597, CHCl:MeoH:AcOH:HO) gave the Fmoc-glycine adduct 1558 cm; H NMR (MeOH-d 400 MHz) & 7.76 (s, 4H), as an orange Solid that was sufficiently pure for further 7.69 (d. 2H, J=9 Hz), 6.73 (d. 2H, J=9 Hz), 4.55 (d. 1H, J= 10 reaction. To a solution of this compound in DMF (8.0 mL) Hz), 4.19 (m, 2H), 4.05 (m, 2H), 3.89 (m, 2H), 2.60 (m, 1H), was added piperidine (100 uL, 1.01 mmol). After stirring for 2.33 (m, 2H), 2.19 (m, 1H), 2.00 (m, 1H), 1.85 (m. 1H), 1.70 6 h at room temperature, the mixture was concentrated and (m. 2H), 1.44 (s.9H), 1.40 (m. 1H), 1.24 (t,3H, J=7 Hz); 'C purified by normal phase chromatography (90:10:0.6:0.6 NMR (MeOH-d. 100 MHz) & 178.0, 176.6, 173.1, 172.6, 80:20:3:3 CHC1:MeOH:AcOH:HO) to yield 8 (56.8 mg, 169.8, 153.4, 150.8, 150.7, 145.7, 140.9, 126.2, 124.0, 64%) as an orange solid. Data for 8: mp>200° C. dec; 121.5, 115.3, 84.8, 63.0, 58.8, 44.3, 42.7, 36.4, 30.9, 29.0, C=-24.0 (c 0.1, in DMSO); UV (MeOH): 378 nm: 28.2, 23.9, 14.7; HRMS (FAB) Calc for CHNO IR: 3281, 2981, 1780, 1741, 1595, 1541 cm; H NMR (MH)": 651.301662. Found: 651.300110. (MeOH-d 500 MHz) & 7.85 (m, 6H), 7.77 (d. 2H, J=9 Hz),

COEt B O C Amine 8

0342. To a solution of Fmoc-Gly-OH (74.5 mg, 0.250 4.56 (d. 1H, J=9 Hz), 4.20 (m, 2H), 4.06 (s. 2H), 3.90 (s, mmol) and oxalyl chloride (150 uL of 2.0 M solution in THF, 2H), 3.84 (s. 2H), 2.60 (m, "H), 2.33 (m, 2H), 2.20 (m. 1H), 0.300 mmol) in CHCl (2.0 mL) was added one drop of 2.02 (m. 1H), 1.76 (m, 1H), 1.71 (m, 2H), 1.44 (s, 9H), 1.43 US 2007/0128662 A1 Jun. 7, 2007 41

(m. 1H), 1.25 (t, 3H, J=7 Hz); 'C NMR (DMSO-d. 100 0344) To a solution of 9 (36 mg, 0.052 mmol) in a MHz) & 174.7, 172.7, 172.5, 1714, 169.7, 168.2, 148.8, saturated solution of NaHCO (2.5 mL) was added finely 147.7, 147.6, 1416, 141.5, 123.4, 123.3, 119.4, 119.2, 82.3, ground N-methoxycarbonylmaleimide (36 mg, 0.232 mmol) 61.2, 56.7, 45.6, 42.9, 42.3, 40.8, 34.9, 29.5, 27.5, 22.5, 22.3, under vigorous stirring. After 30 min at 0°C., the mixture 14.0; HRMS (FAB) Calc for C.H.N.O. (M)": was diluted with THF (2.5 mL) and warmed to room 709.330951. Found: 709.33218O. temperature. After 1 h, the mixture was acidified to pH 1-2

H N HN ~ O 2 N CluuN r N

Amino acid 9

0343) To a solution of 8 (152 mg, 0.214 mmol) in THF with an aqueous solution of 1.0 MHSO and extracted with (8.0 mL) at 0° C. was added 1.0 M LiOH (8.0 mL). After EtOAc (2x25 mL). The combined organic layers were dried stirring for 1 h, the mixture was acidified to pH 2 with 1 M over NaSO, filtered, and concentrated. Purification by HCl, THF was removed in vacuo, and the mixture was normal phase chromatography (86:14:1.5:1.5 purified by reversed phase chromatography (5:04:1 0.1% CHC1:MeOH:AcOH:HO) gave 10 (17.1 mg, 43%) as a formic acid in HO:MeCN) to yield 9 (95.1 mg, 63%) as a yellow solid. Data for 10: R? 0.27 (86:14:1.5:1.5 yellow solid. Data for 9: mp>230° C. dec; C=-20.0 (c CHC1:MeOH:AcOH:HO); mp>230° C. dec; C)=-17.0 0.1, in DMSO); UV % max (DMSO): 378 mm; IR: 3285, (c 0.1, in MeOH); UV (MeOH): 377 nmi; IR: 3298, 3070, 2933, 1666, 1598, 1538, 1501 cm; H NMR 3088, 2931, 1705, 1683, 1538 cm; H NMR (DMSO-d (DMSO-d 400 MHz) & 10.21 (s, 1H), 8.37 (m. 1H), 8.22 400 MHz) & 10.66 (s, 1H), 10.21 (s, 1H), 8.36 (t, 1H, J=6 (m. 2H), 7.84 (m, 8H), 7.55 (m. 1H), 6.88 (m, 1H), 6.81 (m, Hz), 8.23 (t, 1H, J=6 Hz), 7.84 (m, 6H), 7.75 (d. 2H, J=9 1H), 3.92 (m, 2H), 3.76 (m, 1H), 3.72 (m, 2H), 3.55 (s. 2H), Hz), 7.15 (s. 2H), 4.32 (s. 2H), 3.92 (d. 2H, J=4 Hz), 3.78 2.35 (m. 1H), 2.14 (m, 2H), 1.91 (m, 1H), 1.58 (m. 1H), 1.48 (m. 1H), 3.73 (d. 2H, J=5 Hz), 2.37 (m, 1H), 2.14 (m, 2H), (m, 4H), 1.35 (s, 9H); 'C NMR (DMSO-d. 100 MHz) & 1.92 (m, 1H), 1.48 (m, 5H), 1.35 (s, 9H); 'C NMR 176.4, 176.4, 174.2, 172.8, 169.7, 169.3, 168.2, 155.5, 147.8, 174.3, 172.7, 1707, 169.6, 168.2, 165.3, 155.5, 1479, 147.7, 1416, 1412, 123.5, 123.4, 119.4, 77.9, 52.5, 43.6, 147.7, 1415, 1410, 135.0, 123.5, 119.4, 119.3, 77.9, 52.5, 42.9, 42.3, 41.6, 35.0, 33.3, 32.0, 28.2, 22.8: LRMS (ESI) 42.9, 42.2, 41.6, 40.5, 35.0, 33.3, 32.0, 28.2, 22.8: LRMS Calc for C.H.N.O. (M-H): 697.3. Found: 697.2. (ESI) Calc for C.H. N.O. (M-H): 777.3. Found: 777.2.

O Cluu N r N

Maleimide 10 US 2007/0128662 A1 Jun. 7, 2007 42

\ r 2 N ON YaNYS Y 1 N r N NHHCI Hoc1N1 Nco. MAG 2

0345 To a flask containing solid 10 (29 mg, 0.038 mmol) online) was studied by H NMR, with in situ irradiation of was added a saturated HCl solution in EtOAc (17.0 mL). sample using a Polychrom V system monochromator (Till After stirring at room temperature for 2 h, the resulting Photonics) containing a 150 W Xenon short arc lamp with purple solid was triturated with ethyl ether (2x60 mL) to an output range of 320-680 nm (29). The half-power band yield 2 (19.7 mg, 73%). Data for 2: mp-230° C. dec: width was 14 nm. A 500 ul aliquot of a 100 uM sample in C=-12.0 (c 0.1, in DMSO); UV (10% DMSO in DO was prepared in a screw-capped 528-TR-7 NMR tube HO): 364 nmi; IR: 3298, 3087, 2930, 1706, 1683, 1652, (Wilmad). A FT-600-UMT fiber optic cable (NA 0.39) 1539 cm; H NMR (DMSO-d 500 MHz) & 10.70 (s, 1H), (Thorlabs) was coupled at one end to the monochromator 10.25 (s, 1H), 8.28 (m, 4H), 8.21 (m. 1H), 7.84 (m, 6H), 7.76 using a custom fitting and the other end inserted into the (d. 2H, J=9 Hz), 7.16 (s. 2H), 4.32 (s. 2H), 3.93 (d. 2H, J=6 NMR tube a few millimeters above the solution. Each Hz), 3.79 (m, 1H), 3.74 (d. 2H, J=6 Hz), 2.57 (m, 1H), 2.17 sample was irradiated at the desired wavelength for 30 (m. 2H), 2.12 (m. 1H), 1.75 (m. 1H), 1.52 (m, 4H); 'C minutes to reach the photostationary state and 480 scans NMR (DMSO-d. 125 MHz) & 175.6, 172.5, 170.9, 1707, were required to obtain reasonable signal-to-noise ratios. 169.9, 168.2, 165.4, 147.8, 147.7, 1416, 141.1, 135.0, The output from the fiber optic cable between 340-480 nm 123.5, 119.4, 119.3, 64.9, 50.8, 42.8, 42.1, 34.9, 31.7, 31.2, ranged from 0.3-9.0 uW/cm. Data were processed by 22.3, 15.2; HRMS (ESI)+ Calc for CHNO (M)": isolating aromatic cis-trans "H signals and summing their 678.23979. Found: 678.23954. integrals to 1.0. All data were obtained in triplicate and

O H S N

HO /N/ -> O 2 N O --- Ol N r N s H Hooc1N1 Ncoon BME-MAG Conjugate 9

0346) To a solution of 2 (2.3 mg, 3.5 umol) dissolved in averaged. This analysis will be detailed further in a future a saturated solution of NaHCO, (200 uL) at room tempera paper by Banghart, M. R. et al. (in preparation). ture was added fME (20 uL). After stirring for 1 h, the mixture was concentrated and was purified by reversed Introduction of Cysteine Residues in the Glutamate Binding phase chromatography (10:07:3H2O:MeCN) to yield 11 as Domain of iCluR6. a yellow solid. Data for 11: LRMS (ESI) Calc for CHNOS (M-H): 698.2. Found: 698.1. 0348 Cysteine point mutations were introduced to the iGluR6 DNA, containing Q at the position 621 RNA editing Photostationary State Determination by NMR site (30) using the QuickChange site-directed mutagenesis 0347 Cis-trans photoisomerization of MAG-1 conju kit (Stratagene). The following PCR profile was used: one gated with B-mercaptoethanol (see Supplementary Methods cycle (95° C. for 30s); 20 cycles (95° C. for 30s, 55° C. for US 2007/0128662 A1 Jun. 7, 2007

1 min, 68° C. for 12 min). The forward and reverse oligo 4 mM DNQX. For each DNQX concentration, relative nucleotide sequences designed for the L439C mutant were response to 380 nm was calculated as I (380 nm, DNQX)/ I(380 nm, control), and relative response to 500 nm was calculated as I(500 nm, DNQX)/I(380 nm, control). (SEQ ID NO: 1) Glutamate was added as indicated in the figures. Illumina 5'-GATTGTTACCACCATTTGCGAAGAACCGTATGTTCTG-3"; tion was applied using a TILL Photonics Polychrome II and monochromator through a 60x/1.2W objective (power out (SEQ ID NO: 2) put: 12.4 W/m irradiance; 500 nm as measured with a 5'-CAGAACATACGGTTCTTCGCAAAATGGTGGTAACAATC-3'. Newport optical power meter). Data was recorded with pClamp software, which was also used to automatically Cell Culture and Transfection control the monochromator by means of sequencing keys. 0349 HEK293 cells were plated at approximately 3x10° Results cells/ml on poly-L-lysine-coated glass coverslips (Deutsche Spiegelglas, Carolina Biological) and maintained in DMEM Modular Photoswitchable Tethered Ligands with 5% fetal bovine serum, 0.2 mg/ml streptomycin, and 0353. The photoswitchable tethered ligand was designed 200 U/ml penicillin at 37° C. Cells were transiently trans to possess a maleimide for conjugation to a cysteine residue fected with various plasmids using lipofectamine 2000 on the exterior of the LBD, a glutamate analog, and an (Invitrogen). The amount of total transfected iGluR6 DNA azobenzene linker in between enabling reversible state and EYFP fusion DNA per 2 ml well was fixed at 4 ug and dependent control over the reach of the glutamate analog 200 ng, respectively. All recordings were carried out 36 to 48 (Example 2). The glutamate analog was chosen based on h after transfection. previously established structure-activity relationships of the Conjugation of MAG Compounds. selective iGluR agonists (2S,4R)-4-allyl-glutamate (LY310214) and (2S,4R)-4-methyl-glutamate (SYM 2081) 0350. To conjugate MAG-1 and MAG-2 to iGluR6 (15, 16, 17), and on our novel iGluR6 agonist, termed the L439C, the compounds were diluted in the HEK cell control “tether model” (3; FIG. 10b) (Example 2). The modularity solution to 100 nM -200 uM from concentrated stock of the design allows for the introduction of additional solutions in DMSO (final DMSO concentration being 0.1% glycine units in the tether with minimal synthetic invest at most). These solutions were irradiated for 1 hour with 365 ment. Initial studies were based upon models of docking nm light using a handheld UV lamp (UVP model UVGL-25 MAG-1 in the iGluR6-MeGlu crystal structure (16), while (multiband 254 mm/365 nm), Upland Calif.). the exact tether length required for optimal activation Calcium Imaging remained unknown. Following the synthesis of MAG-1, the elongated MAG-2 was synthesized using chemistry analo 0351 Cells were washed in PBS and loaded with 5 uM gous to that described in Example 2. Different length MAGs Fura-2-AM (Molecular Probes) for 30 min. Changes of allow for the study of tether length dependence on channel Ca2+, in individual cells were measured as intracellular activation and agonist binding using readily accessible and Fura2 fluorescence intensity using mercury arc lamp illu minimally disruptive amino acid building blocks. The Suc mination and alternating excitation with band pass filters of cess of the MAG design, and the ease with which it can be 350 nm and 380 nm during 66 ms at 5-20s intervals and modified, opens the possibility of replacement of the detecting emission at 510 nm (31). Fluorescence was moni glutamate moiety for other iGluRagonists or antagonists, or tored on an inverted microscope system (Nikon). Images application to other similarly functioning allosteric proteins were captured with a CCD camera using the Imaging with well defined ligand binding modes. Workbench software, which was also used to irradiate the cells at 380 and 500 nm during 1-2 min in order to produce 0354 FIGS. 10A and 10B. Modular photoswitchable photoisomerization of MAG. Measurements were per tethered ligands. (A) The light-gated glutamate receptor formed in a control solution containing (in mM): 135 NaCl, operates by reversibly binding of the photoswitchable ago 5.4 KC1, 0.9 MgCl, 1.8 CaCl, 10 glucose and 10 HEPES nist MAG (Example 2) which is attached covalently to a at pH 7.6. Cells were preincubated for 10 min in control cysteine introduced in the ligand binding domain of the solution containing 300 mg/l Concanavalin A type IV receptor. The ribbon structure of apo-iGluR2 (Protein Data (Sigma) in order to block desensitization (32. 33). Bank accession code 1 FTO) (18) is shown on the left, L-Glutamate was applied as reported in text and figures. The together with the ball-and-stick structure of MAG in the results are representative data from multiple cells in at least extended (trans) and unbound conformation. Under 380 nm two independent cultures. illumination MAG-1 can activate the receptor as is shown on the right with cis-MAG-1 docked on the structure of iGluR6 Whole-Cell Patch Clamping in complex with (2S,4R)-4-methyl glutamate (Protein Data 0352 Patch clamp recordings were carried out using an Bank accession code 1FTO) (19). Photoswitching is revers Axopatch 200A amplifier in the whole cell mode. Cell ible with 500 nm illumination. (B) The structure of MAG-1 voltage was held at -60 mV. Pipettes had resistances 4-8 (Example 2) can be elongated by introducing an additional MS2 and were filled with a solution containing (in mM): 145 glycine unit (MAG-2). Compound 3 is a non-photoSwitch CsC1, 5 EGTA, 0.5 CaCl, 1.0 MgCl, and 10 HEPES at able MAG-1 analog and an iGluR6 agonist termed the pH7.2. The extracellular solution and concanavalin prein “tether model. cubation were as in calcium imaging experiments. Blocking Photostationary State Determination by NMR experiments were carried out with DNQX disodium salt (Tocris) diluting a 4 mM stock solution in the extracellular 0355. In the thermally relaxed state, azobenzene exists solution, up to 100 nM. Leak was subtracted under 500 nm, almost entirely in the trans configuration (20). Upon illumi US 2007/0128662 A1 Jun. 7, 2007 44 nation, a mixture is generated, with a fraction of the azoben between 460 nm and 560 nm. (E) Wavelength dependence of Zene in the cis configuration and the rest in trans. The photoSwitch rate. Time constants TN and Tor from fits of balance between cis and trans (the photostationary state) traces in (b) are represented as switch rates (1?t). depends on the wavelength. The cis population is maximally populated in the near UV, and trans population is maximally Thermal Relaxation of MAG populated in the visible range of the light spectrum. Usually 0358 Experimentally, it may be advantageous to control absorbance is used to determine the fraction of azobenzene channel opening without continuous irradiation. In Such in the two states. This requires determination of the UV and situations, a single activating pulse of UV light would be visible spectra of the two isomers, which partially overlap. used to initiate activation for extended periods of time Here we used a novel approach of NMR spectroscopy to (minutes). As such, the MAGs were designed with a 4,4'- distinguish between the two isomers. NMR was used to aZodianiline scaffold modified with amide linkages to the determine the ratio of cis- to trans MAG-1 conjugated to glutamate and maleimide moeities of the molecule. These B-mercaptoethanol between 340 and 500 nm, at 20 nm amide-based azobenzene cores are known to possess half increments (FIG. 11a). Optimal wavelengths for cis and lives of minutes for the rate of thermal relaxation from the trans populations were found to be 380 and 500 nm, respec cis-state to the lower energy trans-state in the dark (21). tively. At 380 nm 93.0+0.6% of MAG-1 is in the cis-state 0359 The rate of thermal relaxation in the dark of free and at 500 nm 83.0-0.6% of MAG-1 is in the trans-State. MAG-1 from cis to trans was measure; a half-life of Spectral Sensitivity of Photoresponse Produces an Analog 17.65+0.03 min was obtained (FIG. 12a). The spontaneous Output deactivation in the dark of iCluR6-L439C channels that 0356. In order to quantify the relationship between the were conjugated with MAG-1 was examined. Following photostationary state of MAG-1 in solution and after con activation with a 5 s pulse of illumination at 380 nm, there jugation to iGluR6-L439C, the current amplitude and was a 25% decrease in channel current after ten minutes in Switching kinetics were measured as a function of wave the dark (FIG. 12b), agreeing closely with the observed length. Activation was examined by stepping wavelengths half-life of MAG-1 in solution. Similar observations were from maximal steady-state deactivation (500 nm) to a series made on iGluR6-L439C channels that were conjugated with of shorter wavelengths. The step duration was selected to be MAG-2. The significance of persistent channel activity in 10 s, long enough for currents to reach steady state. Deac the dark after a brief pulse of illumination is that long-lasting tivation was examined by starting at the wavelength of currents can be maintained in absence of irradiation, thus maximal steady-state activation (380 nm) and stepping to reducing photo-bleaching of the azobenzene, photo-damage longer wavelengths (FIG. 11b). The activation and deacti to the protein and photo-toxicity to cells. Vation components were each well fit with a single expo 0360 FIGS. 12A and 12B. Thermal relaxation of MAG. nential (FIG. 11c). The activation spectrum is centered at (A) Rate of thermal relaxation in the dark of free MAG-1 380 nm (FIG. 11d “On”), and falls off steeply at higher and from cis to trans, measured by absorbance at 360 nm. Traces lower wavelengths. The deactivation spectrum is broader are exponential and display a half-life of 17.65+0.03 min. and is centered at ~500 nm (FIG. 11d “Off”), with wave (B) Spontaneous rate of deactivation of iGluR6-L439C lengths between 460 and 560 nm yielding maximal deacti conjugated to MAG-1, after activation with a 5s pulse at 380 vation. The NMR-based determination of the photostation nm. The current decreases 25% after 10 min. ary states of MAG-1 in Solution, over the wavelength range MAG Conjugation to iGluR6-L439C Occurs by Affinity of 320-500 nm, closely match the action spectrum of chan Labeling nel activation when MAG-1 is conjugated to the channel protein (FIG. 11a). Furthermore, the on and off rates were 0361. In our first study (14), a model of MAG-1 in the fastest at wavelengths between 380 nm and 500 nm (FIG. cis-state was docked onto the crystal structure of iGluR6 in 11e). complex with (2S,4R)-4-methyl-glutamate. When the 0357 FIGS. 11A-E. Photostationary state determination glutamate moiety was fit in the agonist binding site, the by NMR and spectral sensitivity of photoresponses. (A) maleimide end of MAG-1 was able to reach amino acid 439, Fraction of MAG-1 in the cis form determined from NMR where the introduced cysteine permits conjugation and spectroscopy. Maximal wavelengths for cis and trans popu yields a light-gated channel (Example 2) (FIG. 10a). This lations are 380 and 500 nm respectively. (B) Wavelength provided a vivid picture of the photoactivated state, and dependence of photoresponses of iGluR6-L439C conjugated raised the question of whether occupancy of the binding site to MAG-1, measured by whole-cell patch clamp. The cur by MAG-1 would enhance the conjugation efficiency of the rent vs. time traces and corresponding wavelength step maleimide to the cysteine at position 439 by affinity label protocol used to record action spectra are indicated. The first ing. Affinity labeling has been observed in a variety of set of steps (activation spectrum) start at the wavelength of systems (22), including in the conjugation of tethered block maximal deactivation (500 nm) and span UV illuminations ers to the Shaker K channel (23), which served as a basis of increasing wavelength. The second set of steps (deacti for the development of the photoswitchable SPARK channel Vation spectrum) start at the wavelength of maximal acti (13). Vation (380 nm) and span visible illuminations of increasing 0362. In order to investigate the nature of MAG conju wavelength. (C) Each temporal trace can be fitted with a gation, affinity labeling was interfered with in two ways. In single exponential function whose amplitude and time con a first experiment, it was asked whether labeling could be stant is used to build the action spectra. (D) The activation hindered by using visible light to favor the trans-state of spectrum (“ON”) is centered on 380 nm and falls off rather MAG-1 conformation, which is expected to extend the steeply at higher and lower wavelengths. The deactivation maleimide away from cysteine 439 when bound (FIG.13a). spectrum (“OFF) is wider, with maximal amplitude The efficiency of MAG-1 conjugation from the amplitude of US 2007/0128662 A1 Jun. 7, 2007 photo-responses was evaluated using calcium imaging to binding sites. With complete conjugation, and under optimal detect the activation of the calcium permeant iGluR6 chan excitation at 380 nm illumination to maximize the activating nels, as described in Example 2. Incubation with 100 nM state, each molecule of MAG will spend -93% of its time in MAG-1 under 380 nm light (favoring the cis-state) produced the cis-state. This means that in the tetrameric channel, four larger Subsequent photo-responses than did incubation under LBDs will be activated at the same time 75% (0.93) of the 500 nm light (favoring the trans-state) (FIG. 13c). This is time. Although liganding of only a fraction of a channels consistent with state-dependent conjugation, which is LBDs still generates some current in iGluRs (24, 25) our expected to better position the maleimide near the engi results suggest that at the higher concentration we are close neered cysteine when MAG-1 is bound and is in the cis to full labeling and that MAG-1 conjugated to iGluR6 State. L439C functions as an agonist that is similar in potency to 0363. In a second experiment, affinity labeling was inter glutamate. fered with by occupying the ligand binding site with Satu MAG Functions as a Full Agonist rating free glutamate during the incubation period (FIG. 13b). Incubation was carried under 380 nm light to favor the 0368. It was asked whether, when attached to the channel, cis-state, as shown above. Incubation of iGluR6-L439C with MAG-1 operates as a full agonist. The “tether model” was 100 nM MAG-1 in the absence of free glutamate for 15 min developed (3; FIG. 10b) on which MAG is based to be a full produced significantly larger Subsequent photo-responses agonist, i.e. to be as effective at activating channels as than did incubation in the presence of 300 uM glutamate glutamate itself (Volgraf et al., 2006). When partial agonists (FIG. 13d). The disruption of affinity labeling in the pres bind they allow only partial closure of the LBD and thus ence of glutamate is consistent with competition between the only partial channel activation (26). It was asked whether the glutamate end of MAG and free glutamate for the ligand MAG linker between the maleimide and the glutamate would be constrained in Such a way when the maleimide is binding site. conjugated to the introduced cysteine that it would partially 0364 Together these experiments demonstrate that at low obstruct closure of the LBD. In the presence of 300 LM concentrations MAG conjugation operates by affinity label glutamate, photoSwitching to cis-MAG-1 will compete with ing. The ability to control photoswitch attachment under UV glutamate for the binding site and replace Some of the free light opens the possibility of selective labeling only in glutamate with MAG-1. If MAG-1 were a partial agonist illuminated regions of a sample. this would reduce the current (i.e. act as a partial antagonist). 0365 FIGS. 13 A-D. MAG-1 conjugation to iGluR6 0369. This prediction was tested and found that iGluR6 L439C occurs by affinity labeling. MAG-1 conjugation at L439C conjugated with 100 uMMAG-1 for 15 minutes (i.e. 100 nM can be interfered by two means: (A) favoring the expected to yield Substantial, but likely incomplete conju trans-configuration with 500 nm illumination, which orients gation, see above) did not show a sign of partial antagonism. the maleimide away from cysteine 439 when the glutamate Rather than decrease currents, photo-activation (isomeriza is bound at the binding site, and (B) occupying the binding tion to cis at 380 nm) of iGluR6-L439C-MAG-1 in the site with free glutamate, thus preventing docking of MAG-1. presence of glutamate slightly increased the current (FIG. (C) Photoresponses obtained by calcium imaging after 14). This observation argues that MAG-1 is actually a MAG-1 conjugation under the conditions shown in (A). slightly better agonist than glutamate. Weak responses are obtained after MAG-1 conjugation at 100 nM under visible illumination (MAG-1 in trans, male 0370 FIG. 14. MAG functions as a full agonist. Patch imide away from cysteine 439), but a substantial increase in clamp trace showing responses to 380 nm illumination that photoresponses is observed after conjugation under UV are lower than glutamate 300 LM responses. When photo (MAG in cis; maleimide near cysteine 439). (D) Weak responses are elicited during glutamate perfusion, they result responses are obtained after MAG-1 conjugation at 100 nM in a slight current increase rather than a decrease, indicating in the presence of 300 LM glutamate (ligand binding pocket that when MAG displaces glutamate it acts as a full and not occupied), but are substantially increased after MAG-1 partial agonist. conjugation at 100 nM in the absence of glutamate. High Effective Local Concentration of MAGs Concentration Dependence of MAG Conjugation 0371. It was shown in Example 2 that agonist 3, a MAG 0366 Previous work had demonstrated that the photo analogue lacking a maleimide and full-length azobenzene, currents of iGluR6-L439C conjugated to MAG-1 are smaller has an ECso of 180 uM for activating iGluR6. Although than the currents induced by saturating glutamate (300 uM). compound 3 possesses a relatively weak affinity, the local It was asked whether the partial activation by iGluR6 concentration of the glutamate end of cis-MAG-1 when L439C-MAG-1 is due to incomplete MAG conjugation. conjugated to iGluR6-L439C is expected to be very high Using whole-cell patch clamping labeled channels were based on its short tether. tested with MAG-1 for 1 hour under 380 nm illumination, 0372 To test this idea, the effective concentration of the using concentrations of 0.1, 10, and 200 uM, with the final glutamate end of MAG-1 was estimated using the competi concentration being the solubility limit of MAG-1. The tive antagonist DNQX (27). DNQX inhibits iGluR activa average photo-current increased with increasing concentra tion by occupying the glutamate binding site and stabilizing tion. Relative to the currents evoked by Saturating glutamate, an open conformation of the LBD (FIG. 15a) (28). The the optical activation of iGluR6-L439C-MAG-1 at 380 nm. ability of DNQX to competitively inhibit the responses of produced currents of 21+8%, 54+20%, and 71+19% at 0.1, iGluR6-L439C to light-activation with MAG-1, and to per 10, and 200 uM, respectively. fusion with compound 3 or glutamate, was examined. 0367. It was considered what these values would mean DNQX inhibited the response to MAG-1 at 380 nm illumi for the activation of a tetrameric protein, with four ligand nation in a concentration dependent manner and was com US 2007/0128662 A1 Jun. 7, 2007 46 pletely reversible upon washout (FIG. 15b). The inhibition sponse at 380 nm was 43+12% that of the current evoked by curve had a 50% inhibition (ICs) of the cis-state light saturating glutamate, slightly lower than what was measured response at 220+65 uM DNQX (FIG. 15c). Even at the for iGluR6-L439C-MAG-1 (FIG. 16b). Competition studies DNQX solubility limit of 4 mM the block of the photo on iGluR6-L439C-MAG-2 using DNQX yielded an ICso current was incomplete. under 380 illumination of 80+20 uM, indicating an effective 0373 To calculate the local concentration of the concentration that was ~3-fold lower than that observed for glutamate end of MAG-1 DNQX competition versus com MAG-1. Consistent with the lower effective concentration pound 3, the closest soluble MAG analogue, was examined. of MAG-2 in the cis-state, the basal activation was lower The concentration dependence of DNQX inhibition was than for MAG-1 (FIG. 6c) and high concentrations of measured using two known concentrations of the tether DNQX completely blocked the photo-current at 380 nm for model (3 mM and 10 mM, the latter being the solubility iGluR6-L439C-MAG-2, even though block was only partial limit) in order to extrapolate effective MAG concentrations for MAG-1 (FIG. 16d). from their DNQX ICs. At 3 mM and 10 mM concentrations 0377 FIGS. 16A-D. Tether length dependence on chan of compound 3 DNQXICs values of 39-15uM and 202+26 nel activation. (A) DNQX titrations of iGluR6-L439C con uM, respectively, were obtained (FIG. 15c). Thus, inhibition jugated to MAG-1 (UVO, Viso) and MAG-2 (UVA, vis by DNQX reveals that in the cis-state the glutamate moiety A). (B) Amplitude of MAG-1 and MAG-2 photoresponses of MAG-1 has an effective concentration of 12.5 mM (FIG. after conjugation at 10 uM for 1 h, compared to 300 LM 15d). Such a high effective concentration (50-fold greater glutamate responses. (C) Basal activation of iGluR6-L439C than the ECso of compound 3) suggests that the photo conjugated to MAG-1 and MAG-2. (D) Residual photore Switched tethered ligand functions as designed on the chan sponse for MAG-1 and MAG-2 after 4 mM DNQX. nel, generating a very high effective local concentration in the cis-state. REFERENCES 0374. The antagonist competition experiment revealed 0378 1. Yuste R (2005) Nat Methods 2:902-904. the existence of a basal current of ~20% at 500 nm that was blocked by DNQX. The ICso value of block of this basal 0379 2. Rougvie A E (2001) Nat Rey Genetics 2:690 current by DNQX was quantified, and found to be 7+2 uM 701. (FIG. 15c). This value indicates an effective glutamate 0380) 3. Gurney A M (1994) in Microelectrode tech concentration of 0.5 mM, that is ~30-fold lower than what niques, The Plymouth workshop handbook (2nd. edition) we measured at 380 nm (FIG. 12d), supporting the model ed Ogden D C (Company of Biologists, Cambridge, UK). that light turns the channel on and off because photoisomer ization of the azobenzene repositions MAG-1 and changes 0381. 4. Lechner HA, Lein E S & Callaway E M (2002) its ability to bind in the glutamate binding pocket. J Neurosci 22:5287-5290. Erratum in: J Neurosci 22:1a (2002). 0375 FIGS. 15A-D. Effective local concentration of MAG-1 is ~12 mM. (A) The competitive antagonist DNQX 0382 5. Callaway E M (2005) Trends Neurosci 28:196 inhibits iGluR activation by occupying the glutamate bind 2O1. ing site without allowing clamshell closure. (B) Patch clamp 0383 6. Lima S Q & Miesenbock G (2005) Cell 121:141 current traces of iGluR6-L439C conjugated to MAG-1 show 152. responses to perfusion of glutamate 300 uM and to illumi nation. The corresponding wavelength-time traces are 0384 7. Erlanson D A, Braisted A C, Raphael D R, shown below. Perfusion of DNQX partially inhibits photo Randal M, Stroud, RM, Gordon E M & Wells J A (2000) responses to 380 nm illumination and reveals a basal acti Proc Natl AcadSci USA 97:9367-9372. vation under 500 nm illumination. Inhibition by DNQX is 0385) 8. Kocer A, Walko M, Meijberg W & Feringa B L reversible upon washout after each DNQX perfusion. (C) (2005) Science 309:755-758. Quantification of DNQX inhibition of photoresponses and comparison to its effect on compound 3. Current under 380 0386 9. Bose M. Groff D, Xie J, Brustad E & Schultz P nm light. (O) is inhibited by DNQX to 36% of total G (2006) JAm ChemSoc. 128:388-389. photoresponse (ICs=220 uM DNQX) and the current under 0387 10. Flint DG, Kumita J. R. Smart O S & Woolley 500 nm (o) is completely blocked, which reveals a basal activation ~20% of total photoresponse, ICs=7 uMDNQX. GA (2002) Chem Biol 9:391-397. For comparison, DNQX blocks responses to 10 mM tether 0388 11. Guerrero L, Smart O S, Woolley G A & model 3 (, ICs=202 uM DNQX) and 3 mM tether model Allemann R K (2005) JAm ChemSoc. 127:15624-15629. 3 (D, IC=39 uM DNQX). (D) Determination of the effective concentration of MAG-1 as a function of the 0389) 12. Lester H A, Krouse M. E., Nass M M, Wasser DNQXICs values. The ICs values for DNQX/tether model mann N H & Erlanger B F (1980) J Gen Physiol 75:207 3 are used to calibrate the local concentration axis assuming 232. a linear relationship (straight line), and yield 12.5 mM and 0390 13. Banghart M. Borges K, Isacoff E, Trauner D & 0.5 mM for MAG-1 under UV and visible respectively. Kramer R H (2004) Nat Neurosci 7:1381-1386. Tether Length Dependence on Channel Activation 0391) 14. Volgraf M, Gorostiza P. Numano R. Kramer R 0376 The dependence of light-gating on tether length H, Isacoff E Y & Trauner D (2006) Nat Chem Biol was investigated using an elongated tethered ligand, MAG-2 2:47-52 (FIG. 16a). It was found that for iGluR6-L439C conjugated 0392 15. Pedregal C. Collado I, Escribano. A, Ezquerra to MAG-2 at 10 uM for 1 h the amplitude of the photore J. Dominguez, C. Mateo A I, Rubio A, Baker S R. US 2007/0128662 A1 Jun. 7, 2007 47

Goldsworthy J. Kambo R K, Ballyk B. A. Hoo K & MEM supplemented with 5% fetal bovine serum, B27 Bleakman D (2000) J Med Chem 43:1958-1968. (Invitrogen), glutamine and serum extender (BD Bio Sciences). Animal care and experimental protocols were 0393 16. Mayer M. L., Ghosal A, Dolman N P & Jane D approved by the UC Berkeley Animal Care and Use Com E (2006) J Neurosci 26:2852-2861. mittee. Recordings were performed 9-16 days after plating. 0394) 17. Donevan SD, Beg A. Gunther J M & Twyman The Shaker construct also contains an N-terminal deletion RE (1998) J Pharmacol Exp. Ther 285:539-545. (A6-46) to minimize fast inactivation. 0395. 18. Armstrong N & Gouaux E (2000) Neuron 0413 Brain Slice Preparation. Parasagittal cerebellar 28:165-181. slices were prepared using standard techniques approved by the UCLA Animal Care Committee. The cerebellum was 0396) 19. Mayer M L (2005) Neuron 45:539-552. removed from the cranium of a 14-20 day old Sprague 0397) 20. Woolley GA(2005) Acc Chem Res 38:486-493. Dawley rat, mounted on an agar Support and sectioned 0398) 21. Pozhidaeva N. Cormier M. E. Chaudhari A & parasagitally using a vibrotome (Leica VT-1000) while Woolley G A (2004) Bioconjug Chem 15:1297-1303. submerged in cold (<4° C.) artificial cerebrospinal fluid (aCSF) containing in mM: 119 NaCl, 26 NaHCO, 11 0399. 22. Chen G, Heim A. Riether D, Yee D, Milgrom glucose, 2.5 KC1, 2.5 CaCl, 1.3 MgCl, and 1 NaH2PO and Y. Gawinowicz MA & Sames D (2003) J Am Chem Soc saturated with 95% O and 5% CO. Following sectioning, 125:8130-8133. the 300 uM slices were stored in 35° C. aCSF for 30 minutes 0400 23. Blaustein R O (2002) J Gen Physiol 120:203 and brought to room temperature for Subsequent electro 216. physiological experiments. 04.01 24. Rosenmund C, Stern-Bach Y & Stevens C F 0414 PAL attachment. HEK293 and hippocampal cells (1998) Science 280:1596-1599. were rinsed in extracellular solution containing in mM: 138 NaCl, 1.5 KC1, 1.2 MgCl, 2.5 CaCl, 5 HEPES, 10 glucose 0402. 25. Popescup G, Robert A. Howe J R & Auerbach A and incubated at 37° C. in the dark with 200-250 uM PAL (2004) Nature 430:790-793. for 15 minutes. For slices, AAQ was diluted to 200 uM in 0403. 26. Jin R, Banke TG, Mayer M L Traynelis SF & aCSF and treatment was performed in the dark at room Gouaux E (2003) Nat Neurosci 6:803-810. temperature for 10 minutes. 0404 27. Honoré T, Davies S N, Dreier J. Fletcher E J, 0415 Live/Dead assay. After PAL treatment, hippocam Jacobsen P. Lodge D & Nielsen F E (1988) Science pal neurons were processed for the live dead assay (Molecu 241:701-703. lar Probes) according to the manufacturers instructions. Cells were counted in 4-8 fields for each treatment condi 04.05) 28. Sun Y. Olson R, Horning M, Armstrong N, tion. Mayer M & Gouaux E (2002) Nature 417:245-253. 0416 Electrophysiological recording. Recordings from 0406. 29. Tait KM, Parkinson JA, Bates S. P. Ebenezer HEK293 and hippocampal neurons were made in the whole W J & Jones AC (2003) Photochem Photobiol 154: 179 cell patch clamp configuration using a PC-501A amplifier 188. (Warner Instruments). Pulse protocols and measurements 04.07 30. Kohler M, Burnashev N., Sakmann B & See were carried out with pCLAMP and a Digidata 1322 inter burg PH (1993) Neuron 10:491-500. face (AXon Instruments). For Voltage-clamp experiment, cells were held at -70 mV. Data was recorded at 20 kHz and 0408. 31. Grynkiewicz G, Poenie M & Tsien R Y (1985) filtered at 2 kHz. Recording pipettes with 2.5-4 MS2 resis J Biol Chen 260:3440-3450. tance were filled with intracellular Solution containing in 04.09 32. Wilding T J & Huettner J E (1997) J Neurosci mM: 10 NaCl, 135 K-gluconate, 10 HEPES, 2 MgCl, 2 17:2713-2721 MgATP, 1 EGTA, pH 7.4. 0410) 33. Partin KM, Patneau DK, Winters CA, Mayer 0417 For cerebellar slices, neuronal cell bodies were M L & Buonanno A (1993) Neuron 11:1069-1082. visualized using an upright microscope with a 40x water immersion lens and equipped with an infrared-DIC enhance Example 4 ment. Loose-patch extracellular recordings were performed using an AXopatch 200B amplifier (AXon Instruments). Photoswitchable Affinity Labels (PAL) Control Electrophysiological recordings were filtered at 1 KHZ and Neuronal Firing of Endogenous Ion Channels digitized at 2-4 KHZ. Pipettes were typically 1.4-2.0 MS2 for recordings from PNs and 3.0-3.5 MS2 for interneurons and Methods filled with aGSF. For PN recordings, 6,7-dinitroquinoxaline 0411 Cell culture and transfection. HEK293 cells were 2.3-1H.4H)-dione (DNQX) and gabazine were added when grown in DMEM containing 5% fetal bovine serum, at 37° indicated at 20 uM and 10 uM respectively. Recordings from C., 7% CO. For electrophysiology, cells were plated at B/S cells were made in the presence of DNQX, gabazine and 12x10 cells/cm on poly-L-lysine coated coverslips and 5 uM RS-3-2-carboxypiperazin-4-yl)-propyl-1-phospho transfected using the calcium phosphate method. Recordings nic acid (CPP). All recordings were performed at room were performed 24-36 hours after transfection. temperature. 0412 Hippocampal neurons were prepared from neonatal 0418 Illumination was provided using a xenon lamp Sprague-Dawley rats according to standard procedures (Sutter Instruments) with narrow band pass filters (380 BP10 (Goslin) and grown on poly-L-lysine coated coverslips in for UV and 500 BP5 for visible light respectively). Excita US 2007/0128662 A1 Jun. 7, 2007 48 tion filters were changed using a lambda 10-2 filter changer retracting the QA and allowing ion conduction. (c) PALS are (Sutter Instruments) controlled via pCLAMP software. identical to MAO except that they contain promiscuous electrophilic groups (red): acrylamide for AAQ, chloroac 0419 Percent photoswitching was defined as the differ etamide for CAQ and epoxide for EAQ. (d) After the QA ence between current in UV and visible light divided by binds to the pore, PALs react with nucleophiles endogenous current in UV. All data shown in bar graphs are to K" channels allowing regulation of native K channels averagesistandard error of the mean. with light. Results PAL Imparts Light-Sensitivity on K Channels 0420. The PAL approach. The photoswitch used in 0424 The feasibility of the PAL approach was assessed, SPARK channels is a derivative of the photoisomerizable using heterologously-expressed Shaker K channels as a test molecule azobenzene (AZO) (FIG. 17a). Connected to the system. Addition of AAO to a Shaker channel that has a AZO on one end is a cysteine-reactive maleimide (MAL) cysteine-substitution (E422C) imparts light-sensitivity on group, which allows attachment to a specific cysteine that the channel, just like MAQ (FIG. 18a). However, AAQ was introduced into an extracellular site on the Shaker imparts light-sensitivity to a similar extent on a Shaker protein, and on the other end a quaternary ammonium (QA) channel that does not have the cysteine substitution (E422; group, which can block the pore of K channels. The FIG.2b) and indeed, can confer light-sensitivity on a Shaker photoswitch molecule (MAL-AZO-QA, or for simplicity channel that is completely devoid of extracellular cysteines. “MAQ) is designed so that the QA can reach the pore and The fraction of current that could be photoswitched was block ion conduction when the AZO is in its elongated trans 39+1% for E422C and 48+2% for E422 channels (FIG. 18c), form, but not in its bent cis form (FIG. 17b). Exposure to not significantly different from one another (n=6; pa0.3: 360-400 nm light photoisomerizes the AZO from trans to Student's t-test). EAQ and CAQ also conferred light-sensi cis, unblocking the channel, whereas long wavelength light tivity onto wild-type Shaker K channels. Hence PALs can (450-520 nm) restores the blocked state by accelerating the find an attachment site at an appropriate distance from the reverse cis to trans conversion. pore. Such that light-elicited changes in photoSwitch length 0421. The PAL molecules that were designed for native can allow or disallow block by the QA group. K" channels are similar to MAO, with one important dif 0425 To better understand how PAL imparts light-sen ference. Instead of maleimide, which is commonly used as sitivity on Shaker K channels, it was attempted to identify a cysteine-modifying reagent, PALS contain an electrophilic the primary covalent attachment site relevant for light group that was presumed would be more promiscuous’ dependent block and unblock. The structure of the conserved (FIG. 17c), potentially reacting with a variety of nucleo extracellular portion of a Voltage-gated K' channel protein philic amino acids. The following sequence of events when (Long et al., 2005) suggests that Shaker possesses at least 9 a PAL encounters a QA-sensitive K channel (FIG. 17d) was accessible nucleophilic amino acid side chains that lie within envisioned. First, the QA binds to the pore, slowing its 20 A of the QA binding site. Mutagenesis of each of these departure from the vicinity of the channel. This increases the sites Suggests that no individual one is essential for PAL to local effective concentration of the reactive electrophilic confer light sensitivity (Banghart et al., Submitted). moiety, promoting covalent attachment to the channel pro tein, if it happens to possess a nucleophilic amino acid side 0426 If PALs are promiscuous in reacting with Shaker, chain at an appropriate distance from the QA binding site (20 perhaps they can also react with other types of K channels A away). Hence, the labeling of native channels by the that possess a QA binding site. This possibility was tested by photoSwitch is promoted by the ligand binding interaction, expressing homomeric versions of Kv1.2, Kv1.4, Kv2.1, as in classical affinity labeling (Johnson and Cantor, 1977; Kv3.1, Kv3.3, Kv4.2, and BKC channels in HEK cells (FIG. Chowdry and Westheimer, 1979). In contrast to SPARK 18d). Whole-cell patch clamp recordings show that treat channels, where two components need to be added to cells ment with AAQ imparted light-sensitivity on all of these (i.e. the Shaker channel gene and the MAQ photoswitch), channels, but some were more sensitive than others. Hence this is a one-component system, where only PAL is required. light turned on and off 80% of the current through Kv1.4 and 0422 PALs were synthesized with several different reac Kv4.2 channels, but only regulated ~45% of the current tive electrophiles, including epoxide, chloroacetamide, and through BKC. channels. acrylamide (FIG. 17c). The epoxide PAL (EAQ) was toxic 0427 FIGS. 18A-D. Photocontrol of wild-type K chan to cultured neurons (see below). The chloroacetamide PAL nels. (a) AAQ photosensitizes Shaker channels that contain (CAQ) was less water-soluble than the acrylamide PAL an engineered cysteine (E422C). Current was elicited by (AAQ). Therefore, unless noted otherwise, AAQ was used stepping from -70 to +30 mV for 200 m.sec. Visible light for the experiments described in this example. (green) blocks current through the channels whereas UV light (purple) leads to unblock. (b) AAQ photosensitizes 0423 FIG. 17A-D. The PAL approach to generating wild-type Shaker (E422). (c) Average percent photoswitch light-regulated ion channels. (a) The photoswitch MAL ing is similar for Shaker with or without the engineered AZO-QA (MAQ) consists of photoisomerizable azobenzene cysteine (n=6, p20.3). (d) AAQ sensitizes a variety of (AZO) flanked by a quaternary ammonium (QA) group and Voltage-gated channels to light (n=6 for each channel). PALS a cysteine-specific maleimide (MAL) reactive group. (b) impart light-sensitivity on ion channels in cultured hippoc MAQ reacts with K channels that contain a genetically engineered cysteine located 20 A away from the pore ampal neurons allowing photocontrol of ionic current. In visible light 0428. It was next tested whether PALs could impart (green), the photoSwitch is extended, blocking ion conduc light-sensitivity onto endogenous K' channels in neurons. tion. In UV light (purple), AZO isomerizes to its cis form FIG. 19a shows steady-state I-V curves from a hippocampal US 2007/0128662 A1 Jun. 7, 2007 49 neuron in culture, treated with 200 uMAAQ in the dark for treatment time, and was not used further in our studies. In 15 min before recording. With this treatment, PAL should be contrast, AAO and CAQ treatment resulted in the death of in the extended trans configuration, and native channels ~10% of neurons in 15 min, only slightly greater than blocked by PAL should unblock upon photoisomerization to following treatment with vehicle alone (DMSO; ~5% in 60 the cis configuration. Consistent with this, exposure to 380 min). Even with a treatment duration that was 4 times nm light increased the Voltage-gated outward current and greater than needed to modify K" channels (60 min), AAQ 500 nm light reversed the effect. Voltage-gated outward and CAQ resulted in loss of only ~15% of neurons. Addi current was photoSwitched to a similar extent in neurons tional experiments suggest that AAQ injection into the vitreous humor of the rat eye has no detectable deleterious treated with 200 uM CAQ (not shown). In contrast, MAQ effects on retinal neurons. Hence at least for these cells and failed to impart light sensitivity on outward current in given our treatment conditions, AAO is not toxic to neurons untransfected neurons that express only their native ion in vitro or in vivo. channels (FIG. 19b). The percent of the outward current that could be photoswitched was 63+8% (n=12) and 2+5% (n=6) 0435 FIG. 21. Neuronal survival after PAL treatment. for AAQ- and MAQ-treated cells, respectively. Hippocampal neurons in culture were incubated with PAL for the indicated time and processed for a Live/Dead assay. 0429. Although PALs confer light-sensitivity on many Only EAQ resulted in substantial toxicity. K" channels, it was expected that other types of channels will be unaffected. External QA is often used to help PAL Imparts Light-Sensitivity on Neurons in Cerebellar selectively remove K currents and reveal unaltered voltage Slices. gated Na+ and Ca" currents in neurons. Voltage-clamp 0436. It was next tested whether PAL can regulate activ recordings with Cs" in the patch pipette indicate that the ity of freshly obtained neurons in a neural circuit, using transient inward current does not become light-sensitive parasagittal cerebellar slices obtained from young rats (P14 after treatment with PAL. Moreover, under current clamp, 20). After pre-treating the slice with 200 uM PAL for 10 neither the rising phase nor the peak amplitude of action minutes, a loose patch configuration was used to obtain potentials is affected by light. extracellular recordings from cerebellar neurons (FIG. 22a). 0430 FIGS. 19A-C. Photocontrol of K" current in cul Unlike whole-cell recording, this configuration leaves the tured hippocampal neurons. intracellular milieu intact and minimally perturbs neuronal activity, providing a rigorous test of the effectiveness of the 0431 (a) Steady-state I-V curves for an AAQ-treated PAL technique under physiological conditions. It was found neuron illuminated with UV (purple) or visible (green) light. that full-field illumination of the slice with 360 nm light Illumination with visible light blocks much of the outward increased firing frequency by 42+12% (n=5) in Purkinje current. (b) MAQ with its cysteine-specific reactive group neurons, and illumination with 500 nm light restored the does not sensitize native neuronal channels to light. (c) initial firing rate (FIG. 6b). PAL-mediated sensitization to Average percent photoSwitching of outward current in neu light was consistently observed in every spontaneously rons treated with AAQ (n=12) and MAQ (n=6). firing neuron tested. PALs Enable Optical Control of Action Potential Firing in 0437. In principle, the observed change in Purkinje cell Cultured Hippocampal Neurons. firing could result from a change in excitatory synaptic input, a change in inhibitory synaptic input, or a change in 0432 PAL treatment confers light-dependence on action the intrinsic properties (i.e. Voltage-gated ion channels) of potential firing. Under current clamp conditions, 380 nm the Purkinje cell itself. There may also be a combination of light turns off firing and 500 nm light promotes firing in the above effects. To distinguish between these possibilities, neurons. The effects of light can be quite dramatic (FIG. the slice was incubated in pharmacological agents that block 20a), with neurons photoswitched between a rapid firing excitatory or inhibitory synaptic transmission. Addition of mode (10 Hz) to complete quiescence within milliseconds of the AMPA-receptor antagonist DNQX failed to block light switching to 380 nm light and back to repetitive firing with triggered changes in activity (FIG. 22b). However, subse 500 nm light. Indeed, brief (100 msec) flashes of 500 nm quent addition of gabazine, a selective GABAA receptor light could be used to elicit action potentials on a one-to-one antagonist, prevented illumination from altering the firing basis (FIG. 20b). rate, consistent with light regulating the firing of inhibitory 0433 FIGS. 20A and 20B. Regulation of action potential neurons. Gabazine increased the basal firing rate of Purkinje firing with light. (a) Current clamp recording of a neuron cells up to ~15 Hz, and it was considered that the blockade treated with AAQ. Depolarizing current was injected to of the light response might be due to gabazine-induced induce continuous action potential firing in visible light saturation of Purkinje cell firing rather than regulation of (green). Illumination with UV light (purple) rapidly Sup inhibitory neuronal firing. However, Purkinje cells can fire presses action potential firing. High frequency firing at rates up to 40-80 Hz (Hausser and Clark, 1997). More resumes upon illumination with visible light. (b) One-to-one over, extracellular recordings from basket cells, the primary action potential firing upon exposure to short pulses of source of inhibition to Purkinje neurons (REF), showed that visible light. 500 nm light enhanced firing frequency by 324+160% (n=6), even in the presence of a cocktail of neurotransmitter 0434 PAL-modified K' channels are blocked either in antagonists that block AMPA, NMDA, and GABAA recep the dark or in visible light keeping the membrane potential tors (FIG.22c). Taken together, these results indicate that the tonically depolarized, which might be harmful to neurons. In effects of light on Purkinje cell firing are mediated by addition, the reactive electrophile of PAL compounds might inhibitory basket/stellate cells, which are preferentially sen have deleterious effects on cells. To quantify the possible sitive to PAL. toxicity of PALs, we used a fluorescent Live/Dead Assay (FIG. 21). Cultured hippocampal neurons were first incu 0438 FIGS. 22A-C. Photocontrol of action potential fir bated for 15 or 60 min with 200 uM of EAQ, AAQ, or CAQ. ing in cerebellar slices. (a) Simplified circuit diagram of the EAQ was highly toxic to neurons, even with a brief (15 min) cerebellum. + and - indicate excitatory and inhibitory Syn US 2007/0128662 A1 Jun. 7, 2007 50 apses. Abbreviations: granule cells, G; parallel fibers, pf iGluR6(L439C) DNA and EYFP DNA per 2 ml well was mossy fibers, mf; climbing fibers, cf. Recordings were fixed at 4 Lig and 200 ng, respectively. All recordings were obtained from Purkinje neurons (PN) and interneurons (bas carried out 36 to 48 hours after transfection. ket/stellate cells; B/S). (b) Extracellular loose patch record ing from a PN. UV light increased the frequency of action 0448 Postnatal rat hippocampal neurons (P0-P5) were potentials in the PN. DNQX, which blocks excitatory syn transfected by the calcium phosphate method and recordings apses, failed to block the effect of light. Subsequent block of were carried out within 1-8 days post transfection. Neurons inhibitory synapses with gabazine abolished photocontrol, for patch-clamp experiments were transfected with either a Suggesting that PN photosensitivity is indirect and mediated fusion construct of GFP and iGluR6(439C) or co-transfected by inhibitory neurons. (c) Extracellular loose-patch record with iGluR6(L439C):YFP at a 3:1 ratio; for calcium imaging ing from a B/S cell. AAQ renders B/S cells directly photo experiments they Were co-transfected with sensitive. Photosensitivity remains after blocking excitatory iGluR6(L439C):DsRed at 3:1 ratio. and inhibitory synapses with DNQX, gabazine, and CPP (an Conjugation of MAG Compounds. NMDA receptor antagonist). UV light inhibits and 500 nm 0449) To conjugate MAG to iGluR6(L439C), the com light restores B/S cell firing. Light had no effect on untreated pound was diluted to 10 uM in the control solution cells. (described below) from 1 mM stock solution in DMSO. The 0439 Banghart, M., Borges, K., Isacoff, E., Trauner, D. & cells were incubated in the dark for 10-15 minutes. To Kramer, R. H. (2004). Light-activated ion channels for conjugate MAG to iGluR6(L439C) in hippocampal neurons remote control of neuronal firing. Nat Neurosci 7, 1381-6. for patch-clamping experiments, the compound was diluted to 10 uM in a solution containing (in mM): 150 NMDG REFERENCES HCl, 3 KC1, 0.5 CaCl, 5 MgCl, 10 Hepes, and 5 glucose 0440 BiA, Cui J, MaYP. Olshevskaya E, Pu M, Dizhoor at pH 7.4. A M, Pan Z H. Ectopic expression of a microbial-type Calcium Imaging and Spatially Selective Photoswitching rhodopsin restores visual responses in mice with photo 0450 Imaging experiments were carried out on a Zeiss receptor degeneration. Neuron. 2006 Apr. 6:50(1):23-33. 510 META laser Scanning microscope equipped with an 0441 Boyden E. S. Zhang F. Bamberg E. Nagel G, Enterprise laser (Coherent) having 351 nm and 364 nm lines, Deisseroth K. Millisecond-timescale, genetically targeted and a 488 nm laser. The objective was a Zeiss Plan Neofluar optical control of neural activity. 25x/0.80 Imm DIC (440542), and the dichroic mirror HFT UV/488/543/633 (both for 488 mm/364 nm photoswitching 0442 Nat Neurosci. 2005 September;8(9): 1263-8. and Fluo-4 imaging). Measurements with HEK cells were 0443 Kramer, R. H., Chambers, J. J., and Trauner, D. performed in a control solution containing (in mM): 135 (2005). Photochemical tools for remote control of ion NaCl, 5.4 KC1, 0.9 MgCl, 1.8 CaCl and 10 Hepes at pH channels in excitable cells. Nature Chemical Biology 7.6. The control solution for hippocampal neurons was (in 1:360-365 mM): 115 NaCl, 2.8 KCl, 1.0 MgCl, 1.0 CaCl, 10 glucose and 10 Hepes at pH 7.3. L-Glutamate and kainate were 0444 Nagel G, Brauner M, Liewald J. F. Adeishvili N, applied as reported in the text and figures. Intracellular Bamberg E. Gottschalk A. Light activation of channel calcium was imaged with the Fluo-4 indicator (Molecular rhodopsin-2 in excitable cells of Caenorhabditis elegans Probes, Invitrogen) excited at 488 nm and 4% laser power, triggers rapid behavioral responses. Curr Biol. 2005 Dec. and measuring emission between 495 nm and 527 um using 20; 15(24):2279-84. the META detector. Cells were conjugated during 10 min utes in 10 uMMAG in 0.3 mg/ml Concanavalin A type VI 0445 Shoham S. O'Connor DH, Sarkisov D V. Wang S (Sigma), rinsed, and incubated in 10 MFluo-4 in the dark S. (2005). Rapid neurotransmitter uncaging in spatially for 1 hour. The experiments were then carried out within 1 defined patterns. Nat. Methods. 2:837-43. hour, to minimize Fluo-4 washout. Region-selective photo Switching was obtained by alternating irradiation between Example 5 364 nm (3 iterations at 90% power) and 488 nm (3 iterations at 90% power) in selected regions, using built-in software Remote Control of Neuronal Activity with a intended for photobleaching experiments. The laser scan Light-Gated Glutamate Receptor ning microscope software was LSM 510 META version 3.2 Methods SP2 (2003), and the MultiTime Series macro version 28-32 was used to control all calcium imaging steps and photo Photoswitch Synthesis and Generation of L439C Mutant of iGluR6. Switching loops in a custom-made recipe. 0451) HEK cells were transfected with iGluR6(L439C) 0446. Synthesis of MAG and introduction of cysteine about 48 hours prior to experiments. No YFP clNA was L439C in iGluR6 were carried out as described 11. added in this case, to avoid the overlap with Fluo-4 emission Cell Culture and Transfection. and to maintain a dark background. Expressing cells were 0447 HEK293 cells were plated at approximately 3x10° determined by brief responses to 300 uM glutamate, which cells/ml on poly-L-lysine-coated glass coverslips and main allowed selection of the regions to be photoswitched. Neu tained in DMEM with 5% fetal bovine serum, 0.2 mg/ml rons expressing iGluR6(L439C) were identified by co-trans streptomycin, and 200 U/ml penicillin at 37° C. Cells were fection with Dsked at 3:1 ratio. transiently transfected with various plasmids using lipo 0452. No photobleaching was observed at the wave fectamine 2000 (Invitrogen). The amount of total transfected lengths and intensities used in the experiments, which lasted US 2007/0128662 A1 Jun. 7, 2007

less than 30 min. A significant reduction in calcium Results responses was evident ~1 hour after loading the cells with Fluo-4, probably due to bleaching and/or washout of Fluo-4, 0457. The chemical photo-switch MAG (consisting of: which is to be expected with this non-rationetric calcium Maleimide for attachment to an introduced cysteine, the dye. Although the spatial resolution of photoSwitching was photo-isomerizable Azobenzene moiety, and Glutamate as not studied in detail in these experiments, it is mostly an agonist) was covalently attached to an introduced cys dependent on the focusing of the 364 nm and 488 nm light teine at residue 439 on the outer surface of the ligand binding domain of the kainate receptor, iGluR6. As shown and should be only limited by diffraction. in Example 2, in the dark and under visible illumination 0453 Calculation of calcium traces and time series image (-500 nm), MAG is mainly in its trans form, with little or no processing was carried out with the microscope built-in activation of the receptor. Irradiation at long wave UV (-380 Software (physiology package) or with the Image.J Software nm) induces cis photo-isomerization and positions the version 1.33u (http://rsb.info.nih.gov/ij) with plugins LSM glutamate in the binding pocket, thus activating the receptor. Reader 3.2f and Z-profiler. Photoswitching of MAG leads to the opening and closing of the cation-selective pore of iGluR6(439C). Our goal here Whole-Cell Patch Clamping was to determine the properties of optical excitation of 0454 Patch clamp recordings were carried out using an neurons expressing LiGTUR. Axopatch 200A amplifier in the whole cell mode. HEK cells were voltage clamped at -60 mV and hippocampal neurons Spatial Control were current clamped at about -65 mV. Pipettes had resis 0458. One of the attractions of light-gated channels is tances of 2-5 MS2 and were filled with a solution containing, that, in principle, it should be possible to selectively activate for HEK cells (in mM): 145 CsCl, 5 EGTA, 0.5 CaCl, 1.0 only those cells that express them and fall within an illu MgCl, and 10 Hepes, pH7.2, and for neurons (in mM): 135 mination volume. Because iGluR6 can be rendered highly K-gluconate, 10 NaCl, 10 Hepes, 2 MgCl, 2 MgATP, 1 calcium permeant with a single mutation 12, the ability of EGTA, pH 7.4. The extracellular solution for HEK cells was light to activate calcium fluxes could be tested in single cells (in mM): 135 NaCl, 5.4 KC1, 0.9 MgCl, 1.8 CaCl and 10 by imaging intracellular calcium with a fluorescent indica Hepes, pH 7.6, and for hippocampal neurons: 138 NaCl, 1.5 tor. Using a laser scanning confocal microscope equipped KCl, 1.2 MgCl2, 2.5 CaCl, 10 glucose and 5 Hepes, pH 7.4. with 364 nm (UV) and 488 nm (visible) lasers, spatially In order to block iGluR6 desensitization, HEK cells were delimited photo-responses in select cells were obtained. preincubated in 0.3 mg/ml concanavalin A type VI (Sigma) Perfusion of 300 uM glutamate elicited calcium responses in 26, 27. Illumination was applied using a TILL Photonics all LiGluR expressing HEK293 cells. Single cells from Polychrome monochromator through the side port of the among these were selected and irradiated them individually IX70 inverted microscope of the physiology rig (Olympus) at 364 nm and 488 nm. Optical stimulation triggered rises in and using either a 40x or 60x objective. Fast photoswitching calcium only in the illuminated cell. Similarly, light was experiments were carried out with a custom shuttered laser used to stimulate hippocampal neurons expressing LiGluR illumination setup mounted on a large breadboard. Briefly, a with spatial selectivity. Calcium responses to photo-stimu 488 nm, 20 mW argon-ion laser (Laser Innovations) and a lation was observed in single neurons that were doubly 374 nm, 8 mW Cube laser (Coherent) were combined with transfected with Dsked and iGluR6(439C) when the illu a dichroic mirror Z405RDC (Chroma) and coupled into a mination was pointed at them. These results indicate that P600-2-UV/vis optical fiber (Ocean Optics), using a 10x. LiGluR can take full advantage of spatially delimited photo 0.25 NA, 16.5 mm WD objective (Newport). The fiber was stimulation 13), where excitation is confined to the illumi connected into the IX70 microscope (Olympus) through the nated Volume because the photo-responsive element is Laser B port using a custom-made adapter. Fast shutters covalently attached to the channel. These experiments pro (Uniblitz UHS1T2-100 driven by VMM-T1 controllers, vide a simple all-optical means of delineating neural circuits Vincent Associates) were placed at the output of each laser in culture or native tissue, using the LiGluR photo-switch as to control the illumination pulses via Software trigger. a remote actuator, standard fluorescent probes as sensors, and commercially available laser Scanning microscopes. 0455 Electrophysiological data was recorded with More sophisticated hardware platforms have also been pClamp software, which was also used to automatically developed recently 14 that should help improve temporal control the monochromator and laser shutters by means of digital signals and sequencing keys. and spatial resolution and data processing. Reproducible Bouts of Light-Evoked Firing in LiGluR Power Dependence of Photoswitching Expressing Neurons 0456 Illumination power was reduced using a variable 0459 While calcium imaging could be used to detect the number of plastic slides that acted as neutral density filters. excitation of LiGluR-expressing cells, patch clamping was Current steps produced by 380 nm and 500 nm illumination were fitted by a single exponential function and the normal used to characterize the excitation quantitatively. The ability ized amplitude (A. A respectively) and time constant of light to excite cultured postnatal hippocampal neurons, (t. T, respectively) were obtained for each illumination which were transfected with iGluR6(L439C) and FP and power. In order to calibrate irradiance (illumination power/ labeled with MAG, was examined. Current-clamp record area), the illumination power was measured with a Newport ings were performed on the FP-positive neurons (FIG. 23a). optical power meter model 840 at the exit of the microscope 0460 Switching from 500 nm illumination, which deac objective (Olympus UPlan Apo 60x/1.2W). The illuminated tivates the receptor, to 380 nm to activate the receptor area was calculated from the image of a calibrated grid evoked large depolarizations and trains of action potentials (Zeiss). for periods defined by the duration at the shorter wavelength US 2007/0128662 A1 Jun. 7, 2007 52

(FIG. 23b). The amplitude of depolarization and the fre rate of activation and deactivation of LiGluR depends lin quency of action potential firing were reproducible (FIG. early on illumination intensity (FIG. 24b), it was determined 23b). The trains of light-evoked action potentials were that millisecond Switching was possible under an illumina similar to trains evoked by current injection. Light depolar tion intensity of approximately 1 mW/mm. This intensity is ized only the transfected neurons. Neurons in the same petrie typical of focused light from a standard fluorescence lamp or dish that were not transfected did not respond (FIG. 23c), monochromator system through standard objectives, as well despite the fact that they had been exposed to MAG during as for small diode lasers. Indeed, brief (1-5 ms) pulses of the labeling period. This lack of effect can be attributed to light at ~1 mW/mm evoked currents that triggered repro the absence of a native cysteine in native GluRs at a location ducible patterns of action potentials (FIG. 25a). Light that would permit MAG to attach and be in the correct evoked patterns of firing were repeatable within a neuron geometry for its glutamate end to reach the binding pocket and in different neurons. Furthermore, the amplitude of the in either isomer of the azobenzene. responses could be easily attenuated with neutral density 0461) Photostimulation of the LiGluR-expressing neu filters, in order to mimic EPSPs (FIG. 25b, lower trace). rons could be maintained for more than an hour in calcium 0464 Rather than continuously illuminating the cells imaging and for as long as seals held in patch clamp (up to while switching back and forth between two wavelengths, 45 minutes) without any indication of toxicity due to illu we also evoked patterned action potential firing using only mination or MAG exposure. Cultured hippocampal neurons a brief pair of light pulses while otherwise keeping the cell were often patch-clamped two or more hours after MAG in the dark (FIG. 25c). This allowed a significant reduction conjugation, indicating that MAG is not toxic over a short in light exposure (although, even under continuous illumi period of time. Neuronal survival following 12 hours of nation, no photo-toxic effects were observed during any continuous exposure to several concentrations of MAG was LiGluR experiments). also examined. This is much longer than the standard 15 0465 FIGS. 24A and 24B: Speed of gating depends on minute labeling time that was employed for the recordings. intensity. (a) Speed of activation and deactivation of iGluR6 Staining for dead cells using a Live-Dead viability/cytotox current in HEK cells under voltage clamp increases with icity assay (Molecular Probes, kit L-7013) no difference was light intensity. (b) Rates of on and off photoresponses in (a), found in cell death between neurons exposed to MAG and measured from single exponential fits, are plotted against controls that were cultured in parallel (FIG. 23d). These intensity, and yield a linear relation, which can be extrapo observations indicate that MAG has no detectable toxicity at lated to 1 KHZ at ~1 KW/m. This leads to the prediction that the concentrations in which it is employed. This is consistent a 1 mm region illuminated by a 1 mW laser should evoke with our earlier observation that a model of MAG, which significant currents in ~1 ms, which is of the timescale contains the (2S, 4R)-4-substituted glutamate and a linker characteristic for synaptic activation of iGluRs. Illumination resembling half of the azobenzene tether, has an apparent was with a monochromator. affinity of 180 uM Example 2). Thus, the typical labeling 0466 FIGS. 25A-D. Designed temporal firing patterns. concentration of 10 uM MAG will activate iGluR6 only 1-5 ms pulses of illumination are sufficient to significantly minimally. Activation of other iGluRs will be minimal depolarize neurons and to trigger single action potentials because similarly Substituted glutamate analogues have been (APs). Scale bars=40 mV and 100 ms. (a) A train of 1 ms shown to be selective kainate receptor agonists. pulses of 374 nm light (laser) reliably triggers the same 0462 FIGS. 23 A-D. Photostimulation yields reproduc temporal pattern of action potential firing in a neuron. (b) ible trains of action potential firing. (a) Hippocampal neu Reproducible firing is triggered in two different neurons by rons transfected with LiGluR are easily identified for patch the same pattern of 374 nm light pulses. (c) In the same cell, ing by GFP fluorescence. (b) A neuron transfected with a train of 374 nm light pulses produces action potentials (top iGluR6(439C) and labeled with MAG is illuminated at 380 trace) or, when the illumination intensity is attenuated, nm for hundreds of milliseconds to seconds, yielding repro sub-threshold EPSP-like responses (bottom trace). (d) ducible depolarizations that trigger trains of action potentials LiGluR can be activated with a 2 ms pulse at 374 nm and which fire at a frequency that is characteristic of the par deactivated with a 2-5 ms pulse at 488 nm to fire the neuron, ticular cell. Illumination at 500 nm turns the response off and and the interval between action potentials can be in the dark permits repolarization. The firing pattern can be sculpted by to minimize irradiation. varying the duration of illumination at the two wavelengths. 0467 Because rapid stimulation of neurons is often Illumination was with a monochromator. (c) Untransfected employed in studies of synaptic plasticity, we were inter neuron has no response to light, despite exposure to MAG, ested in determining the response of neurons to light pulses but does fire repetitively in response to current injection. (d) delivered at high frequencies. We found that APs followed MAG has no deleterious effect on neurons. Untransfected our optical stimulation reliably up to 30 Hz (FIG. 26), higher neurons incubated for 12 hours in MAG (as opposed to the than the frequency reported for ChR2 Boyden et al., 2005). standard labeling time of 15 min) showed no increase in cell We attribute this performance to the fact that LiGluR evokes death compared to control. larger currents, does not desensitize, and is capable of faster deactivation under optical drive (see Supplemental Material Photoswitching in Milliseconds Generates Action Potentials and Supplemental FIG. 1). In LiGluR, the loss of 1:1 firing and Mock EPSPS at high frequencies appears to be a function of the firing 0463) EPSPs mediated by native iGluRs are triggered by properties of the neurons, not the kinetics of light-gating, very brief (millisecond long) and synchronous glutamate since sub-threshold depolarizations were reliably evoked at binding events at groups of receptors in postsynaptic mem all frequencies tested (up to 100 Hz, data not shown). branes. Ideally, an engineered system for triggering neuron 0468 FIG. 26. Neurons can follow photo-stimulation of activity would operate on the same timescale. Because the LiGluR up to 30 Hz. Trains of 5 ms laser pulses at 374 nm US 2007/0128662 A1 Jun. 7, 2007 can reliably trigger action potentials up to a rate of 30 HZ. half-life is 17.65+0.03 minutes Gorostiza et al., in prepa At 57 Hz only 12 action potentials are evoked by 20 stimuli, ration. Thus, depolarization induced by a brief pulse of 374 while at 86 Hz, only 6 action potentials are evoked by 20 nm light is followed by Sustained excitation in an ensuing stimuli. period during which there is no illumination (FIG.28b). This Sustained excitation in the dark can then be rapidly extin Light Evokes Depolarization and Action Potential Firing in guished by a brief pulse of 488 nm light (FIG. 28B). This a Wavelength Dependent Manner molecular memory of MAG makes it possible to trigger 0469 To characterize the amplitude of depolarization extended periods of excitation with minimal irradiation, evoked by steady illumination at different wavelengths during which time the cell fires at its characteristic fre iGluR6(439C) in HEK293 cells labeled with MAG was quency. This is an advantageous property of LiGluR com examined under whole-cell current clamp. Channel opening pared to ChR2. by light evoked large steady-state depolarizations. By taking 0473 FIGS. 28A and 28B. Brief pulses of illumination advantage of the fact that the photo-stationary state of MAG followed by dark evoke sustained firing at intrinsic fre (i.e. the relative proportion of azobenzene in cis and trans) quency of the cell. Due to the stability of the cis state of can be precisely varied by illumination wavelength, it was MAG, LiGluR activation by a short pulse of 374 nm light possible to produce steady-state depolarizations whose yields a long-lasting depolarization that can trigger Sustained amplitudes depended on wavelength (FIG. 27a). Similar trains of action potentials in the dark, which can be then graded depolarizations could be evoked in cultured postnatal turned off with a short pulse of light at 488 nm. (a) Sustained hippocampal neurons that were transfected with excitation of hippocampal neurons occurs under continuous iGluR6(439C) and exposed to MAG. As seen in the HEK 374 nm light (top trace) or when a brief pulse of 374 nm light cells, the amplitude of depolarization depended on wave is followed by darkness (bottom trace). (b) After a 5 ms length, with a maximum at ~380 nm. The largest depolar pulse of 374 nm light, excitation is sustained for 10 seconds izations evoked a train of action potentials (FIG. 27b). The in the dark before being turned off by 488 nm light. wavelength dependence was used to adjust the size of EPSP-like waveforms that were triggered by brief pulses of REFERENCES light, so that, for example, pulses of light at 380 nm generated Super-threshold depolarizations and evoked action 0474 1. Eder M. Zieglgansberger W. Dodt H U. (2004). potentials, while EPSP-like responses were induced in the Shining light on neurons-elucidation of neuronal func same cell by pulses of light of the same duration, but at 430 tions by photostimulation. Rev Neurosci 15, 167-83. nm (FIG. 27c). Thus, the amplitude of brief excitatory 0475 2. Svoboda K, and Yasuda R. (2006). Principles of events evoked by pulses of light can be controlled either by Two-Photon Excitation Microscopy and Its Applications modifying the intensity of illumination at 380 nm, or by adjusting wavelength. to Neuroscience. Neuron, June 15:50(6):823-39. 0476 3. Callaway E. M. (2005). A molecular and genetic 0470 FIGS. 27A-C. Wavelength-dependent depolariza arsenal for systems neuroscience. Trends Neurosci 28, tion. (a) In current-clamped HEK cells expressing LiGluR, 196-201 light induces depolarizations whose amplitude depend on illumination wavelength. In this way, the cell membrane 0477 4. Lima S Q, Miesenbock G. (2005). Remote potential can be accurately controlled across a wide range. control of behavior through genetically targeted photo (b) Illumination at a range of wavelengths depolarizes stimulation of neurons. Cell 121, 141-152. neurons. Some depolarizations are large enough to reach 0478) 5. Nagel G, Ollig D, Fuhrmann M. Kateriya S, threshold and trigger action potentials. (c) Patterned illumi Musti A M, Bamberg E. Hegemann P. (2003). Channel nation with 380 nm light evokes action potentials while 430 rhodopsin-2, a directly light-gated cation-selective mem nm light induces sub-threshold, EPSP-like responses in the same cell. Illumination was with a monochromator. brane channel. Proc Natl Acad Sci USA 100, 13940-5. 0479. 6. Boyden E. S. Zhang F, Bamberg E, Nagel G, Protracted Excitation in the Dark Deisseroth K. (2005). Millisecond-timescale, genetically 0471) We find that our azobenzene photoswitch is very targeted optical control of neural activity. Nat Neurosci 8, robust, yielding reproducible responses for many minutes in 1263-8. HEK293 cells under prolonged illumination Volgraf et al., 0480. 7. Nagel G, Brauner M, Liewald J. F. Adeishvili N, 2006). Hippocampal neurons also tolerated tens of minutes Bamberg E. Gottschalk A. (2005). Light activation of of continuous illumination, alternating between 380 nm and Channelrhodopsin-2 in excitable cells of Caenorhabditis 500 nm at intensities of 1 mW/mm or more. These record elegans triggers rapid behavioral responses. Curr Biol 15, ings typically ended only upon loss of the seal, and record 2279-84. ings were equally stable with and without illumination. However, behavioral experiments may require activity to be 0481 8. Schroll C, Riemensperger T, Bucher D, Ehmer J, manipulated over a much longer time scale, where photo Voller T, Erbguth K, Gerber B, Hendel T, Nagel G, destruction of MAG or photo-toxicity to cells could become Buchner E. Fiala A. (2006). Light-induced activation of a concern. To reduce this problem we explored the property distinct modulatory neurons triggers appetitive or aver of bi-stability of azobenzene in attempt to generate Sustained sive learning in Drosophila larvae. Current Biology 16, trains of firing in the dark. 1741-1747. 0472. Depending on how azobenzene is derivatized, its 0482 9. Li X, Gutierrez D. Hanson M, Han J, Mark M, higher energy cis conformation is stable for seconds to Chiel H., Hegemann P. Landmesser L. Herlitze S. (2005). minutes in the dark Pozhidaeva et al., 2004). For MAG, the Fast non-invasive activation and inhibition of neural and US 2007/0128662 A1 Jun. 7, 2007 54

network activity by vertebrate rhodopsin and green algae CryoSections channelrhodopsin. Proc Natl Acad Sci USA 102(49), 17816-21. 0493 Rats were sacrificed and the eyes are removed intact and placed in paraformaldehyde. After 1-2 hours the 0483) 10. Bi A, Cui J, Ma Y P. Olshevskaya E, Pu M, eyes were transferred to a saturated Sucrose solution in order Dizhoor AM, Pan Z H. (2006). Ectopic expression of a to dehydrate overnight. The next morning, eyes were imbed microbial-type rhodopsin restores visual responses in ded in a mounting agent and rapidly frozen with dry ice. mice with photoreceptor degeneration. Neuron 50, 23-33. They were then sectioned in 10-20 Lum slices using a 0484 11. Lester H A, Krouse M. E., Nass M M, Wasser standard cryostat. The sections were mounted on micro mann N H. Erlanger B. F. (1980). A covalently bound Scope slides and imaged on a confocal microscope (Such as photoisomerizable agonist: comparison with reversibly the Zeiss 510 Meta UV/Vis confocal laser scanning micro bound agonists at Electrophorus electroplaques. J Gen scope). The tissue was illuminated with 488 nm light, which Physiol 75, 207-32. excites GFP. This lets one see the distribution of our 0485 12. Chabala L D, Gurney AM, Lester H.A. (1986). GFP-tagged channels within individual cells. Dose-response of acetylcholine receptor channels opened by a flash-activated agonist in Voltage-clamped rat myo Retcam balls. J. Physiol 371, 407-33. 0494 The Retcam is a digital fiber-optic camera devel 0486 13. Banghart M. Borges K, Isacoff E. Trauner D, oped for imaging retinae in vivo. Rats were anesthetized and Kramer R H. (2004). Light-activated ion channels for laid flat on a lab bench. Their eyes were dilated and then remote control of neuronal firing. Nat Neurosci 7, 1381 covered with a viscous gel, which acts as an interface 1386. between the camera lens and the eye. The retina was imaged 0487. 14. Volgraf M, Gorostiza P. Numano R. Kramer R with white light or with 488 nm light, which allows for the H, Isacoff EY. Trauner D. (2006). Allosteric control of an viewing of GFP. This technique was used to monitor the ionotropic glutamate receptor with an optical Switch. Nat expression of our GFP-tagged channel without sacrificing Chem Biol 2, 47-52. the rat. 0488) 15. Kohler M, Burnashev N., Sakmann B, Seeburg Physiology P H. (1993). Determinants of Ca" permeability in both 0495 Rats were sacrificed and the eyes were removed TM1 and TM2 of high-affinity kainate receptor channels: intact and placed in a NaCl-based saline solution. Eyes were diversity by RNA editing. Neuron 10, 491-500. then cut open in a gelatin-bottomed petri dish, while being 0489) 16. Lippincott-Schwartz, J. Altan-Bonnet N. Patter continually perfused with oxygenated Saline. The retina was son G. H. (2003). Photobleaching and photoactivation: gently separated from the pigment epithelium and cut into following protein dynamics in living cells. Nat Cell. Biol, quadrants. These pieces were then incubated in a papain Suppl S7-14. solution for 10-20 min at 37° C., transferred to an ovomu coid solution (containing bovine serum albumin and trypsin 0490) 17. Shoham S. O’Connor DH, Sarkisov DV. Wang inhibitor) for 5 min, and a DNase solution for 10 min. The SS H. (2005). Rapid neurotransmitter uncaging in spa retina pieces were then rinsed and placed in a holding tially defined patterns. Nat Methods 2,837-843. chamber containing oxygenated Ames medium until used. 0491 18. Pedregal C, Collado I, Escribano A, Ezquerra J. 0496 Prior to recording, each piece of retina was incu Dominguez C. Mateo A I, Rubio A, Baker S R, Gold bated in 100-300 uMAAQ (acrylamide-azobenzene-quater sworthy J. Kambo R K, Ballyk BA, Hoo K. Bleakman nary ammonium ion) for 30 min, removed, rinsed, then D. (2000). 4-alkyl- and 4-cinnamylglutamic acid ana mounted flat in a recording chamber. Retinae were continu logues are potent GluR5 kainate receptor agonists. J Med ally perfused with oxygenated Saline during recordings, Chem 43, 1958-1968. except when neurotransmitter blockers are used. Example 6 0497 Recordings were done on an Olympus upright microscope. For data acquisition, signals were amplified Conferring Light Sensitivity to a Retina with an Axon Instruments amplifier and sent through an Methods analog-to-digital converter to a computer running ClampEX (Axon Instruments). Signals were filtered at 2-5 kHz and Imaging Protocols sampled at 50 kHz. Illumination at 380 nm and 500 nm is Flatmounts provided by a monochrometer (Polychrome V. Till Photon ics). 0492 Rats were sacrificed and the eyes were removed intact and placed in paraformaldehyde. After 1-2 hours the 0498 Micropipettes of borosilicate glass were pulled on eyes were cut open, and the retina was gently separated from a two-stage vertical puller to obtain a resistance of 3-6. MS2. the pigment epithelium. Small cuts were made around the These were filled with the same saline as used in the bath. perimeter of the retina so that it can be flattened onto a Loose-seal recordings are made by applying firm Suction to microscope slide. Images were taken with a large-field the membrane of an identifiable retinal ganglion cell. During microscope (such as a Zeiss Lumar Epifluorescence stereo recording, all lights except that from the monochrometer microscope). The tissue was illuminated with 488 nm light, were turned off and the filter wheel was set to a 100% mirror which excites GFP. This lets one see the distribution of our to deflect the light completely to the tissue. Recordings GFP-tagged channels throughout the entire retina. typically lasted 10-30 min. US 2007/0128662 A1 Jun. 7, 2007

ERGS be understood by those skilled in the art that various changes 0499 Rats were dark-adapted overnight, and the entire may be made and equivalents may be substituted without procedure was done under very dim red light. Rats were departing from the true spirit and scope of the invention. In anesthetized and placed in a standard electroretinogram addition, many modifications may be made to adapt a (ERG) setup. Recording electrodes were embedded in con particular situation, material, composition of matter, pro tact-like cups, which were mounted onto each eye with a cess, process step or steps, to the objective, spirit and scope conductive adherent fluid. Reference electrodes were placed of the present invention. All such modifications are intended in the mouth. A light source emitted brief flashes of white to be within the scope of the claims appended hereto.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 2 <210> SEQ ID NO 1 &2 11s LENGTH 37 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: synthetic primer <400 SEQUENCE: 1

gattgttaccaccatttgcg aagaaccgta tottctg 37

<210> SEQ ID NO 2 &2 11s LENGTH 38 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: synthetic primer <400 SEQUENCE: 2

cagaacatac ggttctt.cgc aaaatggtgg taacaatc 38 light at various intensities. The electrical response of the 1. A synthetic regulator of protein function, the regulator retina to each light flash was recorded; three trials per comprising: intensity were averaged together. Under normal conditions, the ERG will consist of a small downward deflection a) a linker domain comprising a binding moiety that (A-wave), which reflects the activity of photoreceptors, and provides for stable association with a polypeptide, a larger upward deflection (B-wave), which reflects the wherein the binding moiety is other than a bromom activity of bipolar cells. ethyl moiety; Results b) a photoisomerizable group; and 0500) The data are presented in FIGS. 29-33. FIG. 29 c) a ligand that binds to a ligand binding site of said depicts a retcam image of an eye injected with a recombinant polypeptide. adeno-associated virus (ra AV) vector comprising a nucle 2. The regulator of claim 1, wherein the ligand is an otide sequence encoding a SPARK-GFP fusion protein agonist, an antagonist, an allosteric modulator, or a blocker. under the control of a synapsin promoter (AAV-SYN 3.-5. (canceled) SPARK-GFP). FIG. 30 depicts a flatmount of an eye injected 6. The regulator of claim 1, wherein the photoisomeriz with AAV-SYN-SPARK-GFP. FIG. 31 depicts in vivo able group comprises a moiety selected from an azobenzene, SPARK expression. FIG. 32 depicts data showing that light a fulgide, a spiropyran, a triphenyl methane, a thioindigo, a inhibits spontaneous firing of SPARK-expressing retinal diarylethene, and an overcrowded alkene. ganglion cells in intact retina. Thus, the SPARK channel 7. The synthetic regulator of claim 1, wherein the linker turns neurons into virtual “off” cells. domain comprises a binding moiety that provides for cova lent linkage with an amino acid residue in the polypeptide. 0501 FIG. 33A depicts extracellular recording from a 8. The regulator of claim 7, wherein the linker domain PAL-treated retinal ganglion cell showing optical control of comprises a binding moiety chosen from a maleimide, an firing. FIG. 33B depicts ERG recordings from control acrylic ester, an acrylic amide, an O-haloacetamide, an (DMSO alone) and PAL-treated (DMSO+AAQ) rat eyes, 7 epoxide, an O-Succinimidyl ester, a disulfide, and a meth days post injection. Thus, PAL imparts light sensitivity on anethiosulfonate compound. rat retina without toxic consequences. 9. A light-regulated polypeptide, wherein the light-regu 0502. While the present invention has been described lated protein comprises a ligand-binding polypeptide and a with reference to the specific embodiments thereof, it should synthetic regulator of protein function comprising: US 2007/0128662 A1 Jun. 7, 2007 56

a) a linker domain comprising a binding moiety that 35. The method of claim 29, wherein said change in provides for stable association with the ligand-binding wavelength results in a reduced probability of binding of the polypeptide, wherein the binding moiety is other than ligand to the ligand-binding site of the light-regulated a bromomethyl moiety; polypeptide. 36.-40. (canceled) b) a photoisomerizable group; and 41. The method of claim 29, wherein the ligand-binding c) a ligand that binds to a ligand binding site of the polypeptide is selected from a transcription regulator, an ion ligand-binding polypeptide, channel, a cation channel, a ligand-gated ion channel, a Voltage-gated ion channel, a quorum sensor, a pheromone wherein the synthetic regulator is stably associated with receptor, a neurotransmitter receptor, an enzyme, enzyme, a the ligand-binding polypeptide at or near a ligand motor protein, a transporter, a membrane transport protein, binding site of the ligand-binding polypeptide. a G protein-coupled receptor, a G protein, a receptor tyrosine 10. The light-regulated polypeptide of claim 9, wherein kinase, a scaffolding protein, an adaptor protein, a cytosk the ligand has a first probability of binding to the ligand site eletal protein, an adhesion protein, a membrane-targeting at a first wavelength of light, wherein the ligand has a second protein, a protein that direct secretion, a glutamate receptor, probability of binding to the ligand binding site at a second and a localization or protein interaction domain of a protein. wavelength of light, and wherein the second probability is 42.-43. (canceled) lower than the first probability. 44. A method of modulating activity of a ligand-binding 11. The light-regulated polypeptide of claim 9, wherein polypeptide, the method comprising: the ligand has a first probability of binding to the ligand site a) contacting the ligand-binding polypeptide with a syn at a first wavelength of light, wherein the ligand has a second thetic regulator of claim 1, wherein said synthetic probability of binding to the ligand binding site at a second regulator is bound to the light-regulated polypeptide by wavelength of light, and wherein the second probability is affinity labeling, thereby generating a light-regulated higher than the first probability. polypeptide; and 12. The light-regulated polypeptide of claim 9, wherein the ligand has a first probability of binding to the ligand site b) changing the wavelength of light and/or the intensity of when exposed to light, wherein the ligand has a second light to which the light-regulated polypeptide is probability of binding to the ligand binding site in the exposed. absence of light, and wherein the second probability is lower 45. The method of claim 44, wherein said ligand-binding than the first probability. polypeptide is a wild-type polypeptide. 46. The method of claim 44, wherein said change in 13. The light-regulated polypeptide of claim 9, wherein wavelength results in an increased probability of binding of the ligand has a first probability of binding to the ligand site the ligand to the ligand-binding site of the light-regulated when exposed to light, wherein the ligand has a second polypeptide. probability of binding to the ligand binding site in the 47. The method of claim 44, wherein said change in absence of light, and wherein the second probability is wavelength results in a reduced probability of binding of the higher than the first probability. ligand to the ligand-binding site of the light-regulated 14. The light-regulated polypeptide of claim 9, wherein polypeptide. the ligand-binding polypeptide is selected from a transcrip 48. A method of identifying an agent that modulates an tion regulator, an ion channel, a cation channel, a ligand activity of a ligand-binding polypeptide, the method com gated ion channel, a Voltage-gated ion channel, a quorum prising: sensor, a pheromone receptor, a neurotransmitter receptor, a glutamate receptor, and an enzyme. a) contacting a light-regulated polypeptide with a test 15.-16. (canceled) agent, 17. The light-regulated polypeptide of claim 9, wherein wherein the light-regulated polypeptide comprises a syn the ligand is an agonist, an antagonist, an allosteric modu thetic regulator of protein function comprising: lator, or a blocker. i) a linker domain comprising a binding moiety that 18.-24. (canceled) provides for stable association with a polypeptide, 25. A cell comprising the polypeptide of claim 9. wherein the binding moiety is other than a bromom 26. (canceled) ethyl moiety; 27. A membrane comprising the polypeptide of claim 9. wherein the membrane is a biological membrane, or an ii) a photoisomerizable group; and artificial membrane. iii) a ligand that binds to a ligand binding site of said 28. (canceled) polypeptide; and 29. A method of modulating activity of the light-regulated b) determining the effect, if any, of the test agent on the polypeptide of claim 9, the method comprising changing the activity of the light-regulated polypeptide. wavelength of light and/or the intensity of light to which the 49. The method of claim 48, wherein the ligand is an light-regulated polypeptide is exposed. agonist, an antagonist, an allosteric modulator, or a blocker. 30. The method of claim 29, wherein said change in 50-55. (canceled) wavelength results in an increased probability of binding of 56. The method of claim 48, wherein said light-regulated the ligand to the ligand-binding site of the light-regulated polypeptide is present in a living cell in vitro. polypeptide. 57. The method of claim 48, wherein said light-regulated 31.-34. (canceled) polypeptide is present in a cell-free membrane in vitro. US 2007/0128662 A1 Jun. 7, 2007 57

58. The method of claim 48, wherein said light-regulated 64. The pharmaceutical composition of claim 63, wherein polypeptide is a native polypeptide. the ligand is sodium channel ligand, and wherein the com 59.-62. (canceled) position is formulated for topical administration to a site of 63. A pharmaceutical composition comprising a Surgical wound. a) synthetic regulator of protein function, the regulator 65. The pharmaceutical composition of claim 63, wherein comprising: the ligand is sodium channel ligand, and wherein the com position is formulated for injection at or near a nerve. i) a linker domain comprising a binding moiety that 66. The pharmaceutical composition of claim 63, wherein provides for stable association with a polypeptide, the ligand remains bound to the ligand binding site of the wherein the binding moiety is other than a bromom sodium channel for at least about 1 hour. ethyl moiety; 67. The pharmaceutical composition of claim 63, wherein said composition is formulated for administration in or ii) a photoisomerizable group; and around an eye. iii) a ligand that binds to a ligand binding site of said 68. The pharmaceutical composition of claim 67, wherein polypeptide; and said composition is formulated for intravitreal injection. b) a pharmaceutically acceptable carrier. k k k k k