1 Studies on 3-Hydroxypropionate Metabolism in Rhodobacter

Home , Pyruvate synthase, Rhodobacter sphaeroides

Studies on 3-Hydroxypropionate Metabolism in Rhodobacter sphaeroides

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Steven Joseph Carlson

Graduate Program in Microbiology

The Ohio State University

2018

Dissertation Committee

Dr. Birgit E. Alber, Advisor

Dr. F. Robert Tabita

Dr. Venkat Gopalan

Dr. Joseph A. Krzycki

Copyrighted by

Steven Joseph Carlson

2018

Abstract

In this work, the involvement of multiple biochemical pathways used by the metabolically versatile Rhodobacter sphaeroides to assimilate 3-hydroxypropionate was investigated. In Chapter 2, evidence of a 3-hydroxypropionate oxidative path is presented. The mutant RspdhAa2SJC was isolated which lacks pyruvate dehydrogenase activity and is unable to grow with pyruvate. Robust 3-hydropropionate growth with

RspdhAa2SJC indicated an alternative mechanism exists to maintain the acetyl-CoA pool. Further, RsdddCMA4, lacking the gene encoding a possible malonate semialdehyde dehydrogenase, was inhibited for growth with 3-hydroxypropionate providing support for a 3-hydroxypropionate oxidative pathway which involves conversion of malonate semialdehyde to acetyl-CoA. We propose that the 3- hydroxypropionate growth of RspdhAa2SJC is due to the oxidative conversion of 3- hydroxypropionate to acetyl-CoA.

In Chapter 3, the involvement of the ethylmalonyl-CoA pathway (EMCP) during growth with 3-hydroxypropionate was studied. Phenotypic analysis of mutants of the

EMCP resulted in varying degrees of 3-hydroxypropionate growth. Specifically, a mutant lacking crotonyl-CoA carboxylase/reductase grew similar to wild type with 3- hydroxypropionate. However, mutants lacking subsequent enzymes in the EMCP exhibited 3-hydroxypropionate growth defects that became progressively more severe the

ii later the enzyme participated in the EMCP. To resolve this finding, a late blockage

EMCP strain has 3-hydroxypropionate growth restored by introducing an early blockage to the EMCP. Furthermore, the introduction of thioesterase YciA to inhibited mutant strains restored 3-hydroxypropionate growth with concomitant excretion of EMCP- derived metabolites showing a CoA-thioester intermediate accumulation most likely causes a decrease in free coenzyme A levels and the growth inhibition. The work confirms the EMCP is not essential for 3-hydroxypropionate growth. However, flux through the EMCP occurs.

In Chapter 4, a novel way to alter flux through the EMCP was discovered. Late blockage EMCP mutants were inhibited for 3-hydroxypropionate growth, but spontaneously began growing after 100 hours. Whole genome sequencing of suppressor isolates identified a common mutation in the prkB gene, encoding phosphoribulokinase B of the Calvin-Benson-Bassham (CBB) cycle. The prkB mutation requirement for suppression was verified by introducing mutated alleles to the inhibited strains where 3- hydroxypropionate growth was restored. Finally, introduction of thioesterase YciA did not cause excretion of EMCP-derived metabolites during 3-hydroxypropionate growth in a suppressor strain indicating the prkB mutation decreases flux through the EMCP.

In Chapter 5, the role of propionyl-CoA carboxylase during 3-hydroxypropionate, propionate, and acetate assimilation was investigated. Propionyl-CoA carboxylase

(PccBA) catalyzes the conversion of propionyl-CoA to (2S)-methylmalonyl-CoA in the methylmalonyl-CoA pathway (MMCP) used for propionyl-CoA assimilation. The assimilation of acetyl-CoA and 3-hydroxypropionate also leads to formation of

iii propionyl-CoA whereby the MMCP would be required. A pccB mutant strain could not

- grow with propionate/HCO3 confirming the requirement of the MMCP for propionyl-

CoA assimilation. However, the same mutant could still grow with acetate and 3- hydroxypropionate. For acetate growth, metabolite analysis showed that propionate was excreted indicating a mechanism to prevent accumulation of propionyl-CoA formed during flux through the EMCP. For 3-hydroxypropionate growth, redirection of the carbon toward acetyl-CoA via the 3-hydroxypropionate oxidative pathway and entry into the EMCP was shown to allow growth when the 3-hydroxypropionate reductive pathway is blocked in R. sphaeroides.

Dedication

To those I adore most – Jamie, Henry, and Theodore.

Acknowledgments

Many thanks to all the past and present members of the Alber laboratory. To Dr.

Birgit Alber, for the training, support, and example you set in the lab. You gave me the freedom to explore through research and I am very grateful. To Dr. Marie Asao for teaching me my very first enzyme assay and your willingness (and patience) to answer all my questions. To Dr. Michael Carter for his sage wisdom, intriguing commentary on life, and continued support since his departure from the lab. To Daniel Ortiz, for your friendship. Un abrazo.

Many thanks to Dr. Tabita and the members of his laboratory. Though I wasn’t an official member, I was treated as such and am grateful for their generosity, expertise, and friendship. Much of the work would not have been possible without their equipment or help.

To my committee for the insight, suggestions, and time that was given to help throughout this process.

I am forever grateful to my family for their unconditional love and support throughout my time as a graduate student. I am indebted to them for all that they sacrificed to see me through to the end. I love and cherish you all.

Vita

2004………... ……………..……………………Logan High School

2008…………………...... …….B.S. Wildlife and Conservation Biology,

Ohio University

2012-present ………………………...………….Graduate Teaching and Research

Associate, Department of Microbiology,

The Ohio State University

Publications

Carlson SJ, Fleig A, Baron MK, Berg IA, Alber BE. 2018. Barriers to 3- hydroxypropionate-dependent growth of Rhodobacter sphaeroides by distinct disruptions of the ethylmalonyl-Coenzyme A pathway. J. Bacteriol. (Published online November 19, 2018)

Fields of Study

Major Field: Microbiology

vii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... vii Table of Contents ...... viii List of Tables...... xiv List of Figures ...... xv Chapter 1: Introduction ...... 1 1.1 Rhodobacter sphaeroides, a model organism for carbon assimilation ...... 1 1.2 Carbon assimilation in R. sphaeroides during photoheterotrophic growth...... 2 1.3 Using precursor metabolites to develop a metabolic scheme ...... 4 1.4 3-Hydroxypropionate, a tool to uncover to new physiological phenomenon ...... 5 1.5 Assimilation of 3-hydroxypropionate – A tale of two pathways, the reductive path 6 1.6 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: Propionyl- CoA assimilation using the methylmalonyl-CoA pathway...... 11 1.7 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: C4 to C3 conversion ...... 12 1.8 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: Acetyl- CoA formation ...... 13 1.9 Assimilation of 3-hydroxypropionate – A tale of two pathways, the oxidative path ...... 13 1.10 Assimilation of acetyl-CoA using the ethylmalonyl-CoA pathway ...... 15 1.11 Early steps of the ethylmalonyl-CoA pathway and PHB metabolism ...... 16 1.12 The ethylmalonyl-CoA pathway ...... 17 Chapter 2: Evidence of a 3-hydroxypropionate oxidative pathway in Rhodobacter sphaeroides ...... 19 2.1 Introduction ...... 19 viii

2.2 Materials and Methods ...... 25 2.2.1 Materials...... 25 2.2.2 Bacterial strains and growth conditions ...... 25 2.2.3 NCBI Database search for enzymes capable of converting pyruvate to acetyl- CoA (or an intermediate requiring a second enzyme to form acetyl-CoA) ...... 25 2.2.4 Isolation and complementation of RspdhAa2SJC ...... 27 2.2.5 Isolation and complementation of RsdddCMA4 ...... 29 2.2.6 Isolation of complemented R. sphaeroides strains...... 30 2.2.7 Preparation of cell extracts ...... 31 2.2.8 Pyruvate dehydrogenase complex assay measuring pyruvate- and CoA- dependent NAD+ reduction ...... 32 2.2.9 Malate dehydrogenase assay measuring oxaloacetate-dependent NADH oxidation ...... 32 2.3 Results ...... 32 2.3.1 The gene rsp_2962, encoding methylmalonate semialdehyde dehydrogenase (acylating), is required for 3-hydroxypropionate assimilation ...... 32 2.3.2 DddC required for -alanine assimilation ...... 34 2.3.3 Assimilation of -alanine requires the ethylmalonyl-CoA pathway...... 35 2.3.4 DddC is not required for acetyl-CoA assimilation...... 36 2.3.5 Bioinformatic analysis identified pyruvate dehydrogenase complex as only enzyme encoded by R. sphaeroides 2.4.1 to oxidize pyruvate to acetyl-CoA ...... 37 2.3.6 In-frame deletion strain RspdhAa2SJC cannot grow with pyruvate ...... 40 2.3.7 In-frame deletion strain RspdhAa2SJC can grow with 3-hydroxypropionate ...... 40 2.3.8 Pyruvate dehydrogenase complex activity undetectable in RspdhAa2SJC cells grown with either 3-hydroxypropionate or acetate ...... 42 2.4 Discussion ...... 43 2.4.1 Formation of acetyl-CoA occurs that is not from pyruvate oxidation, which can support growth during 3-hydroxypropionate assimilation ...... 43 2.4.2 The gene dddC most likely encodes a malonate semialdehyde dehydrogenase ...... 44 2.4.3 Oxidation of 3-hydroxypropionate is a possible alternative pathway to form acetyl-CoA...... 45 2.4.4 Possible regulation of the pyruvate dehydrogenase complex during acetate growth ...... 46 ix

2.4.5 The in-frame inactivation strains of the ethylmalonyl-CoA pathway cannot assimilate acetyl-CoA ...... 47 2.4.6 -Alanine enters central carbon metabolism at the level of acetyl-CoA in R. sphaeroides and requires the ethylmalonyl-CoA pathway for assimilation ...... 48 2.5 Future Directions ...... 49 Chapter 3: Barriers to 3-hydroxypropionate-dependent growth of Rhodobacter sphaeroides by distinct disruptions of the ethylmalonyl-CoA pathway...... 50 3.1 Introduction...... 50 3.2 Materials and Methods...... 53 3.2.1 Materials...... 53 3.2.2 Bacterial strains and growth conditions...... 53 3.2.3 Construction of the marker-less in frame deletions and complementation...... 58 3.2.4 Product analysis by High Performance Liquid Chromatography (HPLC)...... 62

3.2.5 Gas Chromatography CO2 detection...... 63 3.2.6 Determination of the dry weight...... 64 3.3 Results...... 64 3.3.1 Blocking a step in an unnecessary path matters...... 64 3.3.2 Gradual decrease in growth by blocking consecutive steps in the ethylmalonyl- CoA pathway...... 68 3.3.3 The introduction of a thioesterase rescues 3-hydroxypropionate-dependent growth of ethylmalonyl-CoA pathway mutants...... 70 3.3.4 Excretion of organic acids by strains of R. sphaeroides...... 71 3.3.5 Carbon flux through the ethylmalonyl-CoA pathway during growth with 3- hydroxypropionate...... 74 3.4 Discussion...... 76 3.4.1 The ethylmalonyl-CoA pathway is not required for the synthesis of precursor metabolites from 3-hydroxypropionate...... 76 3.4.2 Coenzyme A pool depletion as the likely cause of growth inhibition by distinct disruptions of the ethylmalonyl-CoA pathway...... 77 3.4.3 Carbon flux through the ethylmalonyl-CoA pathway during photoheterotrophic growth with 3-hydroxypropionate...... 78 3.4.4 A possible role for the ethylmalonyl-CoA pathway during 3- hydroxypropionate assimilation...... 79 3.4.5 The ability of YciA to cause excretion of mesaconic and methylsuccinic acid during 3-hydroxypropionate-dependent growth is not understood ...... 82

3.4.6 Possible explanation for why Rsmcd11KB excretes mesaconate ...... 85 3.4.7 YciA is powerful tool to qualitatively show flux through the ethylmalonyl- CoA pathway ...... 85 3.5 Suggested future directions ...... 86 Chapter 4: A phosphoribulokinase variant restores growth with 3-hydroxypropionate for Rhodobacter sphaeroides mutants by altering carbon flux through the ethylmalonyl-CoA pathway ...... 88 4.1 Introduction ...... 88 4.2 Materials and Methods ...... 93 4.2.1 Materials...... 93 4.2.2 Bacterial strains and growth conditions...... 93 4.2.3 Isolation of suppressor mutants including Rsmcd3HP+2-1, Rsmch3HP+1-1, Rsmcl13HP+3-1 ...... 94 4.2.4 Generation of site-specific R. sphaeroides mutants ...... 96 4.2.5 Plasmid transfer via conjugation ...... 100 4.2.6 Product analysis by High Performance Liquid Chromatography (HPLC). .... 100 4.2.7 Whole genome sequencing using Illumina ...... 101 4.2.8 Whole genome sequencing using Ion Torrent ...... 101 4.2.9 Molecular modeling of PrkB and PrkB_R186C ...... 102 4.3 Results ...... 102 4.3.1 R. sphaeroides deletion strains mcd11KB, mch49KB, and mcl1_4KB spontaneously overcome 3-hydroxypropionate-dependent growth inhibition ...... 102 4.3.2 Four unique mutations identified in the mch3HP+1-1 suppressor strain ...... 103 4.3.3 Ion torrent whole genome sequencing used to identify the prkB mutation as the one common mutation shared by mcd3HP+, mch3HP+, and mcl13HP+ ...... 107 4.3.4 Exchanging the wildtype prkB allele for the suppressor variant encoding PrkB_R186C restores 3-hydroxypropionate-dependent growth ...... 108 4.3.5 Exchanging the wildtype prkB allele for the suppressor variant encoding PrkB_R186C affects growth with acetate ...... 109 4.3.6 A chromosomally encoded C-terminal StrepTagII on PrkB or PrkB_R186C does not alter the phenotype ...... 109 4.3.7 Replacing the mutant prkB allele in Rsmch3HP+1-1 with a wild-type copy restores the growth inhibition ...... 111 4.3.8 Other PrkB_R186 variants can restore 3-hydroxypropionate-dependent growth ...... 111 xi

4.3.9 Carbon flux through the ethylmalonyl-CoA pathway during 3- hydroxypropionate-dependent growth is not detected in the suppressor strains ..... 112 4.3.10 Phosphoenolpyruvate identified as part of the unknown HPLC peak in spent media of the suppressor Rsmch3HP+ during 3-hydroxypropionate-dependent growth ...... 113 4.3.11 Protein sequence comparison identifies difference in cysteine residues between Prk isozymes in R. sphaeroides ...... 115 4.4 Discussion ...... 116 4.4.1 Mutation of PrkB arginine186 restores 3-hydroxypropionate dependent growth for Rsmcd1KB, Rsmch49KB, and Rsmcl1_4KB ...... 116 4.4.2 Other changes to the R. sphaeroides genome identified by Illumina sequencing ...... 117 4.4.3 PrkB_R186C affects carbon flux through the ethylmalonyl-CoA pathway ... 118 4.4.4 Possible changes to the function of PrkB_R186C ...... 119 4.4.5 How does PrkB_R186C influence carbon flux through the ethylmalonyl-CoA pathway? ...... 121 4.4.6 Possible role of the cysteines in PrkB ...... 123 4.5 Suggested future directions ...... 124 Chapter 5: Investigation into the role of propionyl-CoA carboxylase during propionate, acetate, and 3-hydroxypropionate assimilation: a crossroad of the methylmalonyl-CoA, ethylmalonyl-CoA, and 3-hydroxypropionate reductive pathways in Rhodobacter sphaeroides ...... 127 5.1 Introduction ...... 127 5.2 Materials and Methods ...... 133 5.2.1 Materials...... 133 5.2.2 Bacterial strains and growth conditions ...... 134 5.2.3 Isolation and complementation of R. sphaeroides mutant strains ...... 134 5.2.4 Plasmid transfer via conjugation ...... 139 5.2.5 Product analysis by High Performance Liquid Chromatography (HPLC). .... 139

5.2.6 Gas Chromatography CO2 detection...... 139 5.2.7 Determination of the dry weight...... 139 5.3 Results ...... 140 - 5.3.1 Inactivation of pccB abolishes growth with propionate/HCO3 for R. sphaeroides strain RspccBSJC1A...... 140

xii

5.3.2 Inactivation of pccB does not inhibit growth with acetate for R. sphaeroides strain RspccBSJC1A...... 141 5.3.3 RspccBSJC1A excretes propionate during acetate-dependent growth ...... 142 5.3.4 RspccBSJC1A can still grow with 3-hydroxypropionate ...... 144 5.3.5 RspccBSJC1A and RspccBacuI44SJC display similar growth phenotypes with 3-hydroxypropionate that differ from RsacuI10BSJC ...... 146 5.3.6 The ethylmalonyl-CoA pathway is required for 3-hydroxypropionate- dependent growth of RsacuI10BSJC, RspccBSJC1A, and RspccBacuI44SJC ...... 147 5.3.7 Flux through the ethylmalonyl-CoA pathway occurs in RsacuI10BSJC and RspccBSJC1A ...... 148 5.3.8 Propionate is excreted during 3-hydroxypropionate-dependent growth for RspccBSJC1A and RspccBacuI44SJC ...... 149 5.4 Discussion ...... 151 5.4.1 Rhodobacter sphaeroides only uses the methymalonyl-CoA pathway for assimilation of propionyl-CoA ...... 152 5.4.2 Rhodobacter sphaeroides can still use the ethylmalonyl-CoA pathway for acetate assimilation without propionyl-CoA carboxylase ...... 153 5.4.3 The transferase activity could also explain propionate excretion during 3- hydroxypropionate dependent growth...... 154 5.4.4 The ethylmalonyl-CoA pathway can be used by R. sphaeroides to assimilate 3- hydroxypropionate and implies the use of the 3-hydroxypropionate oxidative pathway ...... 155 5.5 Future directions ...... 156 References ...... 158

xiii

List of Tables

Table 1 Strains and plasmids used in Chapter 2 ...... 26 Table 2 Primers used in Chapter 2 ...... 26 Table 3 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate, acetate, -alanine, and succinate as the carbon source...... 34 Table 4 Doubling times for R. sphaeroides strains grown photoheterotrophically with succinate, 3-hydroxypropionate, acetate, or -alanine as the carbon source...... 37 Table 5 Results from BLAST search for pyruvate oxidizing enzymes in Rhodobacter sphaeroides ...... 39 Table 6 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3- hydroxypropionate, acetate, pyruvate, or -alanine as the carbon source...... 41 Table 7 Enzyme activities in cell extracts of photoheterotrophically grown R. sphaeroides strains ...... 42 Table 8 Strains used in Chapter 3 ...... 54 Table 9 Plasmids used in Chapter 3 ...... 55 Table 10 Primers used in Chapter 3 ...... 56 Table 11 Primers used in Chapter 3, continued ...... 57 Table 12 Photoheterotrophic growth of Rhodobacter sphaeroides 3-hydroxypropionate or succinate as the carbon source ...... 69 Table 13 Carbon balance after photoheterotrophic growth of different strains of ...... 74 Table 14 Strains and plasmids used in Chapter 4 ...... 95 Table 15 Primers used in Chapter 4 ...... 96 Table 16 Illumina sequencing metrics for Rsmch3HP+1-1 and Rsmch49KB ...... 106 Table 17 Overall changes compared to reference genome identified in Rsmch3HP+1-1 and Rsmch49KB using Illumina sequencing ...... 106 Table 18 The four unique changes identified in Rsmch3HP+1-1 ...... 106 Table 19 Comparison of possible suppressor mutations using whole genome sequencing data...... 108 Table 20 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3- hydroxypropionate, acetate, or succinate as the carbon source...... 110 Table 21 Encoded variant PrkB in sequenced isolated suppressor strains...... 112 Table 22 Strains and plasmids used in Chapter 5 ...... 132 Table 23 Primers used in Chapter 5 ...... 133 Table 24 Photoheterotrophic growth of Rhodobacter sphaeroides with ...... 142 Table 25 Carbon balance after photoheterotrophic growth for R. sphaeroides strains .. 145

xiv

List of Figures

Figure 1 Overview of metabolic pathways involved in R. sphaeroides assimilation of 3- hydroxypropionate...... 9 Figure 2 Detailed overview of metabolic pathways involved in R. sphaeroides assimilation of 3-hydroxypropionate...... 10 Figure 3 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism...... 20 Figure 4 R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate, -alanine, and succinate...... 33 Figure 5 Photoheterotrophic growth for R. sphaeroides ethylmalonyl-CoA pathway- deficient mutants with succinate, -alanine, and acetate...... 36 Figure 6 Photoheterotrophic growth of R. sphaeroides strains with 3-hydroxypropionate, acetate, and pyruvate...... 41 Figure 7 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism...... 65 Figure 8 Photoheterotrophic growth of wild type and mutants of Rhodobacter sphaeroides with 3-hydroxypropionate as the carbon source...... 66 Figure 9 Photoheterotrophic growth of wild-type Rhodobacter sphaeroides and mutants, affecting the ethylmalonyl-CoA pathway, with 3-hydroxypropionate as the carbon source...... 70 Figure 10 Rescue of photoheterotrophic growth of the RsΔmch49KB and RsΔmcl1_4KB mutants with 3-hydroxypropionate, by expression of the yciA gene, encoding a thioesterase...... 71 Figure 11 Analysis of organic acids in the spent medium during photoheterotrophic growth of different R. sphaeroides strains with 3-hydroxypropionate as the carbon source...... 73 Figure 12 Comparison of organic acids in the spent medium during photoheterotrophic growth of different R. sphaeroides strains with succinate or 3-hydroxypropionate as the carbon source...... 75 Figure 13 Balanced carbon distribution model for Rhodobacter sphaeroides during photoheterotrophic growth with 3-hydroxypropionate at steady state...... 81 Figure 14 Suppression of R. sphaeroides parent deletion strains during photoheterotrophic and chemoheterotrophic growth with 3-hydroxypropionate...... 104 Figure 15 Comparison of R. sphaeroides suppressor isolates during photoheterotrophic and chemoheterotrophic growth with 3-hydroxypropionate...... 105 Figure 16 PrkB_R186C restores 3-hydroxypropionate-dependent growth...... 109

Figure 17 Detection of mesaconic acid in spent media from yciA-expressing R. sphaeroides strains grown with 3-hydroxypropionate...... 114 Figure 18 Comparison of the PrkA and PrkB primary protein sequence from R. sphaeroides...... 116 Figure 19 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism...... 128 - Figure 20 Photoheterotrophic growth with succinate and propionate/HCO3 for R. sphaeroides mutant strains...... 141 Figure 21 Propionate excretion in RspccBSJC1A strains grown photoheterotrophically with acetate...... 144 Figure 22 Photoheterotrophic growth with succinate and 3-hydroxypropionate for R. sphaeroides mutant strains...... 146 Figure 23 Photoheterotrophic growth with succinate and 3-hydroxypropionate for R. sphaeroides mutant and yciA-expressing strains...... 149 Figure 24 HPLC chromatogram of spent media from R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate...... 150

xvi

Chapter 1: Introduction

1.1 Rhodobacter sphaeroides, a model organism for carbon assimilation

In this work, the metabolic pathways used to assimilate the three carbon organic carboxylate, 3-hydroxypropionate (3HP), were studied using the model organism

Rhodobacter sphaeroides 2.4.1. This Gram-negative, purple non-sulfur, - proteobacterium is an exceptional model organism for studying carbon assimilation as it is capable of utilizing a variety of organic molecules as growth substrates under different conditions. These molecules range from amino acids, sugars, alcohols, and, most importantly, fermentation products which are present in the stagnant, freshwater environments that R. sphaeroides is known to inhabit (Blankenship et al. 1995). Capable of different growth modes, chemoheterotrophic growth requires an electron acceptor such as oxygen or dimethyl sulfoxide (DMSO) and the absence of light where exogenous carbon substrates must serve a dual purpose to, both, provide energy for ATP synthesis via oxidative phosphorylation and to supply carbon for assimilation into biomass.

Photoheterotrophic growth occurs for R. sphaeroides in the presence of light and the absence of oxygen where intracytoplasmic membranes are formed and cyclic photophosphorylation is performed (Bahatyrova et al. 2004; Sener et al. 2016) to harness energy from light and convert it to ATP. This process obviates the necessity for oxidation of a carbon substrate for energy metabolism to allow all carbon supplied to the organism

1 to be available for assimilation. This attribute makes R. sphaeroides an excellent system for study as the growth of the organism is directly proportional to the ability to generate cellular constituents from the carbon source. Furthermore, a solid foundation of research to understand the mechanisms of cyclic photophosphorylation (Bahatyrova et al. 2004;

Sener et al. 2016) and the enzymes and pathways involved in CO2-fixation (Tabita 1988;

Tabita 1995) led also to the development of making R. sphaeroides genetically tractable.

1.2 Carbon assimilation in R. sphaeroides during photoheterotrophic growth

The ability of R. sphaeroides to assimilate carbon can be linked to photoheterotrophic growth in various ways. Commonly, measurements are taken as growth is occurring, using liquid cultures where optical density (OD) can be measured to show a constant rate of doubling (exponential growth). Particular carbon sources under particular conditions provide consistent growth rates for R. sphaeroides. Additionally, final growth yields can be used to determine the extent of conversion of carbon substrate to cell mass in the closed system of the sealed, anaerobic culture tubes. Decreased yields are the result of carbon lost in the form of excreted compounds, CO2 released, or that which was not assimilated. Therefore, a carbon balance can be measured whereby the carbon input must equal the sum of the carbon products.

As stated earlier, carbon is not lost as CO2 for energy generation during photoheterotrophic growth, however, the extent of assimilation for R. sphaeroides is reliant on the oxidation state of the carbon. Using the cellular elemental composition of

CH1.8N0.18O0.38 from another purple non-sulfur, -proteobacterium Rhodopseudomonas palustris (McKinlay and Harwood 2010; Carlozzi and Sachi 2001), it was determined

2 that the average oxidation state of cellular carbon is slightly reduced and this average must be achieved by the cell during growth no matter that of the incoming carbon. For growth with compounds where the carbon is more oxidized than the cell, such as succinate and 3-hydroxypropionate, this is achieved by generating and releasing CO2. For those substrates with more reduced carbon, such as propionate and butyrate, additional oxidized electron acceptors must be added to the growth media including dimethyl sulfoxide (DMSO), trimethylamine N-oxide (TMAO), or CO2 (Richardson et al. 1988).

For either circumstance, the proper cellular carbon state can be reached and the balance of electrons can be maintained.

In the case of assimilating reduced carbon substrates for R. sphaeroides, the preferred electron acceptor is CO2 which is reduced by the actions of the CO2-fixing

Calvin-Benson-Bassam (CBB) reductive pentose phosphate cycle (Tabita 1995) where ribulose-1,5-bisphosphate is carboxylated by the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) to form two molecules of 3-phosphoglycerate. The

ATP-dependent addition of a second phosphoryl group to 3-phosphoglycerate catalyzed by phosphoglycerate kinase results in 1,3-bisphosphoglycerate. Glyceraldehyde-3- phosphate dehydrogenase then catalyzes the reduction of 1,3-bisphosphoglycerate to glyceraldehyde-3-phosphate. In R. sphaeroides, the reduced electron carrier NADH is

+ used resulting in constant recycling to NAD during CO2 fixation (Tabita 1988). From glyceraldehyde-3-phosphate, multiple enzymatic steps ultimately result in the formation of ribulose-5-phosphate. The enzyme, phosphoribulokinase (Prk), then catalyzes the

ATP-dependent phosphorylation of ribulose-5-phosphate to regenerate ribulose-1,5-

3 bisphosphate for the next cycle of CO2 fixation. In this way, CO2 serves as the electron acceptor as the highly oxidized carbon is incorporated into ribulose-5-phosphate and further transformed for use by other metabolic pathways to generate cellular constituents, balancing the incorporation of the more reduced carbon substrates. However, growth with more oxidized carbon substrates may also require the CBB cycle (Laguna et al. 2011). As oxidative phosphorylation does not occur during photoheterotrophic growth for R. sphaeroides, turnover of reduced electron carriers is mediated by the actions of glyceraldehyde-3-phosphate dehydrogenase. This cofactor recycling is used to maintain operation of other biochemical pathways during growth (Laguna et al. 2011). The ability of the CBB cycle to influence carbon assimilation in R. sphaeroides is investigated in

Chapter 4.

1.3 Using precursor metabolites to develop a metabolic scheme

To study carbon assimilation, one must consider the fact that in order for a cell to duplicate, an exogenous supply of carbon molecules must be available, taken in, and transformed into all other necessary cellular carbon constituents. Albeit a highly complex process, the analysis can be simplified by focusing on key metabolites that act as major branching points for chemical transformation. These key metabolites are intermediates of the major cellular biochemical processes glycolysis/gluconeogenesis, the pentose phosphate pathway, and the tricarboxylic acid cycle collectively called central carbon metabolism. In fact, 12 major intermediate pools, termed precursor metabolites, are identified as the biosynthetic starting points for the generation of all other required carbon molecules (Neidhardt et al. 1990; Fuchs 1999). Of the original 12 intermediates,

4 we have narrowed that down to six precursor metabolite pools - acetyl-CoA, pyruvate, phosphoenolpyruvate, oxaloacetate, -ketoglutarate, and the C3-C6 phosphorylated sugars. Succinyl-CoA was combined with oxaloacetate as no net flux of succinyl-CoA for biosynthesis is predicted to occur. The phosphorylated sugars glucose-6-phosphate, fructose-6-phosphate, ribose-5-phosphate, erythrose-4-phosphate, triose phosphate, and

3-phosphoglycerate were grouped as one pool as they are all derived by the linear gluconeogenic pathway once PEP is formed. As the demand for cellular constituents remains constant during steady-state exponential growth, it becomes apparent that these pools are maintained at fixed ratios whereby fluxes can be predicted through different pathways for assimilation of particular carbon substrates. To understand the assimilatory pathway of a specific carbon substrate, the metabolic steps necessary for filling each precursor metabolite pool must be determined. A model can be made and tested, introducing mutations to block particular points in the pathway and using the resulting growth to understand the importance. This process, known as mutant analysis, is used throughout this work.

1.4 3-Hydroxypropionate, a tool to uncover to new physiological phenomenon

3-Hydroxypropionate is a simple three carbon carboxylate with a hydroxyl group on the -carbon. In nature, it exists primarily as an intermediate in variety of metabolic pathways whereby the ability to either oxidize or reduce it has been taken advantage of in many different organisms (Giovanelli and Stumpf 1958; Rendina and Coon 1957; Reisch et al. 2011; Watson et al. 2016; Wilson et al. 2017; Otzen et al. 2014; Alber and Fuchs

2002; Zhou et al. 2014). Here, we exploit the ability of Rhodobacter sphaeroides, to use

3-hydroxypropionate as a growth substrate (Schneider et al. 2012). The goal of the Alber laboratory is to understand the underlying principles that dictate how a cell assimilates carbon through the coordination of multiple biochemical processes during growth of R. sphaeroides with different carbon sources. Our work has shown 3-hydroxypropionate to be a unique carbon probe as assimilation of 3-hydroxypropionate involves flux through multiple pathways forcing the cell into a sensitive balance that is easier to perturb and, therefore, uncover new and interesting mechanisms that would otherwise not be found.

1.5 Assimilation of 3-hydroxypropionate – A tale of two pathways, the reductive path

As a growth substrate, 3-hydroxypropionate has two immediate metabolic fates to consider in regards to how it ultimately will enter central carbon metabolism for assimilation. The first fate is propionyl-CoA, as 3-hydroxypropionate can be reduced through a series of enzymatic steps that ultimately result in its formation. The initial step is the activation of 3-hydroxypropionate to 3-hydroxypropionyl-CoA followed by the dehydration of 3-hydroxypropionyl-CoA to acrylyl-CoA where acrylyl-CoA is finally reduced to propionyl-CoA. These steps have been shown to occur in various organisms where the substrates and products are consistent but the enzymes involved differ in function. For instance, in the green sulfur bacterium, Chloroflexus aurantiacus, the entire conversion of 3-hydroxypropionate to propionyl-CoA is catalyzed by the single, multi- domain, multi-catalytic enzyme propionyl-CoA synthase (Alber and Fuchs 2002). Used during the autotrophic 3-hydroxypropionate cycle, it consists of an ATP-dependent 3- hydroxpropionyl-CoA synthetase, 3-hydroxypropionyl-CoA dehydratase, and an

NADPH-dependent acrylyl-CoA reductase. This one enzyme system provides an efficient 6 strategy to generate propionyl-CoA, however, most organisms contain separate enzymes to catalyze the same reactions. In the archaea Metallosphaera sedula and Sulfolobus tokodaii, three separate enzymes perform the same reactions as part of the 3- hydroxypropionate/4-hydroxybutyrate autotrophic cycle (Alber et al. 2002; Teufel et al.

2008). Additionally, certain dimethylsulfoniopropionate (DMSP)-degrading bacteria possess functionally similar enzymes to reduce 3-hydroxypropionate, where 3- hydroxypropionate is an intermediate formed during DMSP catabolism (Reisch et al.

2013; Reisch et al. 2011). While DMSP can be degraded by either a cleavage or demethylation pathway (Reisch et al. 2011), the former leads to acrylate and/or 3- hydroxypropionate. In Ruegeria pomeroyi DSS-3, an NADPH-dependent acrylyl-CoA reductase (SPO_1914), reduces acrylyl-CoA to propionyl-CoA, is required for assimilation of either carbon substrate (Reisch et al. 2013; Asao and Alber 2013).

Inactivation of the SPO_1914 resulted in the inability to grow with 3-hydroxypropionate or acrylate while propionate growth was unaffected suggesting no other pathway exists for 3-hydroxypropionate assimilation (Reisch et al. 2013).

For R. sphaeroides, MgATP-, CoA-, and 3-hydroxypropionate-dependent oxidation of NADPH was detected in extracts of 3-hydroxypropionate grown cells while formation of the 3-hydroxypropionyl-CoA was shown to accumulate in the absence of

NADPH (Schneider et al. 2012) providing evidence that the same series of reactions as that in C. aurantiacus and the Sulfolobales species is most likely occurring. Further,

- regulation is present as no activity could be detected in succinate or propionate/HCO3 - grown cells (Schneider et al. 2012). However, the genes or enzymes responsible for the

3-hydroxypropionyl-CoA synthetase and dehydratase reactions have not been identified.

Rather, the NADPH-dependent acrylyl-CoA reductase, AcuI, highly similar to SPO_1914 in R. pomeroyi, has been characterized and shown to also convert acrylyl-CoA to propionyl-CoA (Asao and Alber 2013). Though the equilibrium of the dehydratase favors formation of 3-hydroxypropionyl-CoA, the irreversible reaction catalyzed by AcuI pulls the entire reductive path toward propionyl-CoA formation which R. sphaeroides can then metabolize using the methylmalonyl-CoA pathway (Carter and Alber 2015). Further evidence for the use of the reductive pathway via acrylyl-CoA was provided by the in vivo characterization of the acuI gene where inactivation led to a growth defect with 3- hydroxypropionate (Schneider et al. 2012; Asao and Alber 2013). However, 3- hydroxypropionate growth was not completely abolished suggesting that additional enzymes and/or pathways are involved. The reductive pathway is further investigated in

Chapter 5 where we uncover a role of the ethylmalonyl-CoA pathway for 3- hydroxypropionate assimilation in mutants where the reductive pathway is blocked.

Figure 1 Overview of metabolic pathways involved in R. sphaeroides assimilation of 3- hydroxypropionate. Precursor metabolites are presented in white boxes. The identified pathways are: 1) Oxidative path 2) Reductive path 3) Ethylmalonyl-CoA pathway 4) Methylmalonyl-CoA pathway 5) Polyhydroxybutyrate biosynthetic pathway 6) Oxidation of pyruvate to acetyl-CoA. Abbreviations: AcuI, acrylyl-CoA reductase; Ccr, crotonyl-CoA carboxylase/reductase; DddC, proposed malonate semialdehyde dehydrogenase; Ecm, ethylmalonyl-CoA mutase; Mcd, methylsuccinyl-CoA dehydrogenase; Mch, mesaconyl- CoA hydratase; Mcl1, (3S)-malyl-CoA/β-methylmalyl-CoA lyase; PccAB, propionyl- CoA carboxylase; PDHC, pyruvate dehydrogenase complex; PHA, polyhydroxyalkanoates; CBB Cycle, Calvin-Benson-Bassham cycle or reductive pentose phosphate pathway.

Figure 2 Detailed overview of metabolic pathways involved in R. sphaeroides assimilation of 3-hydroxypropionate. The identified pathways are the A) Oxidative pathway, B) Reductive pathway, C) ethylmalonyl-CoA pathway, D) methylmalonyl-CoA pathway/ethylmalonyl-CoA pathway, and E) polyhydroxybutyrate biosynthetic pathway pathway/ethylmalonyl-CoA pathway. Pyruvate oxidation catalyzed by pyruvate dehydrogenase complex is not part of the oxidative path but is shown. Abbreviations: AcuI, acrylyl-CoA reductase; Ccr, crotonyl-CoA carboxylase/reductase; DddC, proposed malonate semialdehyde dehydrogenase; Ecm, ethylmalonyl-CoA mutase; Epi, ethylmalonyl- CoA/methylmalonyl-CoA epimerase; Mcd, methylsuccinyl-CoA dehydrogenase; Mch, mesaconyl-CoA hydratase; Mcl1, (3S)-malyl-CoA/β-methylmalyl-CoA lyase; Mcl2, (3S)-malyl-CoA thioesterase; Mcm, methylmalonyl-CoA mutase; PccAB, propionyl- CoA carboxylase; PDHC, pyruvate dehydrogenase complex; PhaA, -ketothiolase; PhaB, acetoacetyl-CoA reductase; PhaC, PHA synthase; PHB, polyhydroxybutyrate.

1.6 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: Propionyl-CoA assimilation using the methylmalonyl-CoA pathway

The result of 3-hydroxypropionate reduction ultimately is the formation of propionyl-CoA. In many organisms, propionyl-CoA is further assimilated using either the methylcitrate cycle or the B12 dependent methylmalonyl-CoA pathway (Dolen et al.

2018). In R. sphaeroides, propionyl-CoA transformation proceeds using the methylmalonyl-CoA pathway (Carter and Alber 2015), where propionyl-CoA is first carboxylated by an ATP- and biotin-dependent carboxylase, PccBA, consisting of two subunits. PccA is the biotin carboxylase whereby ATP is hydrolyzed to ADP and Pi,

- concomitantly with the addition of HCO3 to the biotin cofactor. PccB, the carboxytransferase, then catalyzes the transfer and formation of the C-C bond between

- the HCO3 and the C2 of propionyl-CoA to form (2S)-methylmalonyl-CoA. This product can then undergo epimerization to (2R)-methylmalonyl-CoA followed by carbon skeleton rearrangement by the B12-dependent methylmalonyl-CoA mutase to form succinyl-CoA which serves as the entry point into the TCA cycle. From here, R. sphaeroides can further generate and maintain the precursor metabolite oxaloacetate.

Regulation of the methylmalonyl-CoA pathway in R. sphaeroides is accomplished by the transcriptional activator PccR, which is thought to bind to the consensus sequence

TTTGCAAA-X4-TTTGCAAA in the promoter region of pccB. Increased levels of propionyl-CoA activate transcription along with an additional unidentified effector molecule which leads to incremental increases in propionyl-CoA carboxylase activity as required for growth with succinate versus acetate versus propionate (Carter and Alber

2015). 11

While the reduction of acrylyl-CoA to propionyl-CoA is known to occur in R. sphaeroides for 3-hydoxypropionate assimilation (Schneider et al. 2012; Asao and Alber

2013), the requirement of the methylmalonyl-CoA pathway including propionyl-CoA carboxylase has not been shown. In Chapter 5, the role of propionyl-CoA carboxylase during photoheterotrophic growth with 3-hydroxypropionate is investigated using a

PccB-negative R. sphaeroides strain. Additionally, as propionyl-CoA is formed during assimilation of acetate (ethylmalonyl-CoA pathway) and propionate (methylmalonyl-

CoA pathway), we determined the ability of a PccB-negative R. sphaeroides strain to grow with each of these substrates and characterized the resulting phenotypes.

1.7 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: C4 to C3 conversion

The C4 molecule, succinyl-CoA, is a constituent of the tricarboxylic acid cycle.

Use of the reductive path requires the C4/C3 node (Sauer and Eiksmanns 2005) to obtain the C3 precursor metabolites pyruvate and PEP, as well as, the phosphorylated sugars of glycolysis/the pentose phosphate pathway. For R. sphaeroides, there is apparent redundancy in the decarboxylation of malate to pyruvate as two NAD(P)+-dependent malic enzymes are encoded. However, preliminary work using inactivation strains of either gene suggest separate roles which is dependent on the carbon source and growth condition (Carter 2014). PEP carboxykinase is also encoded in the genome, and this enzyme decarboxylates oxaloacetate at the cost of an ATP to obtain PEP. Interconversion of PEP and pyruvate, presumably, is possible through the concerted catalytic efforts of the pyruvate phosphate dikinase (pyruvate to PEP) and pyruvate kinase (PEP to pyruvate). 12

1.8 Assimilation of 3-hydroxypropionate carbon beyond the reductive path: Acetyl- CoA formation

Generation of the precursor metabolite acetyl-CoA using the reductive path requires pyruvate oxidation catalyzed by the pyruvate dehydrogenase complex (PDHC) in R. sphaeroides. The pyruvate dehydrogenase complex (PDHC) is a large protein complex comprised of multiple monomers of three catalytic subunits; the pyruvate decarboxylase (E1), the dihydrolipoamide acetyltransferase (E2), and the dihydrolipoamide dehydrogenase (E3). Together, this complex catalyzes the overall

+ conversion of pyruvate, CoA, and NAD to acetyl-CoA, CO2, and NADH. In bacteria, posttranslational regulation is used where product inhibition by acetyl-CoA and NADH control the amount of pyruvate oxidized . However, transcriptional regulation has also been shown to occur, wherein the GntR-type repressor PdhR was shown to respond to increased levels of pyruvate resulting in derepression of the pdh operon in E. coli (Quail and Guest 1995). Similar regulatory controls have not been studied in R. sphaeroides.

1.9 Assimilation of 3-hydroxypropionate – A tale of two pathways, the oxidative path

Alternative to the reductive path, oxidation of 3-hydroxypropionate to acetyl-CoA and CO2 has also been shown to occur in many organisms (Giovanelli and Stumpf 1958;

Rendina and Coon 1957; Wilson et al. 2017; Watson et al. 2016; Zhou et al. 2014 Todd et al. 2010), where 3-hydroxypropionate is first oxidized to malonate semialdehyde by a

3-hydroxypropionate dehydrogenase followed by oxidative decarboxylation to acetyl-

CoA and CO2 by a malonate semialdehyde dehydrogenase (Goodwin et al. 1989; Stines-

Chaumeil et al. 2006). Conversion of malonate semialdehyde to acetyl-CoA is also involved in assimilation of -alanine (Yao et al. 2011; Waters and Venables 1986;

Hayaishi et al. 1961). Early work with peanut mitochondria detected the formation of radiolabeled 3-hydroxypropionate and CO2 from radio-labeled propionate feedings where the oxidative path via malonate semialdehyde was proposed as part of a propionate beta- oxidation pathway (Giovanelli and Stumpf 1958). Further, detection of 3- hydroxypropionate, as well as, NAD+-dependent conversion of 3-hydroxypropionate to malonate semialdehyde was demonstrated in pig kidney extracts (Rendina and Coon

1957; Den et al. 1959). In the DMSP-degrading Halomonas sp. HTNK1, dddA and dddC were identified to encode a putative 3-hydroxypropionate dehydrogenase and malonate semialdehyde dehydrogenase, respectively (Todd et al. 2010). When co-expressed in E. coli, 3-hydroxypropionate-dependent growth occurred, while expression of only one gene could not support growth. Further, when only dddC was expressed no 3- hydroxypropionate was utilized while with only dddA expression 3-hydroxypropionate levels decreased with the concomitant increase in an unknown metabolite which was suspected to be malonate-semialdehyde. Similarly, Pseudomonas denitrificans

ATCC13867 has been shown to assimilate 3-hydroxypropionate using an oxidative pathway. Evidence for this includes malonate detection during 3-hydroxypropionate assimilation (Zhou et al. 2013) while deletion of a gene encoding a putative 3- hydroxypropionate dehydrogenase, sharing 59 % amino acid identity with the Halomonas

DddA, led to the inability to degrade or assimilate 3-hydroxypropionate in the strain

(Zhou et al. 2014).

In R. sphaeroides, the use of an oxidative path has not been demonstrated, though genes are present that encode homologous enzymes to the Halomonas and P. denitrificans proteins DddA and DddC. In Chapter 2, we investigate an alternative acetyl-

CoA forming pathway in a pyruvate dehydrogenase-negative strain that can still grow with 3-hydroxypropionate. As stated, the exclusive use of the reductive path in R. sphaeroides should require pyruvate oxidation for the formation of acetyl-CoA during 3- hydroxypropionate assimilation suggesting that the oxidative pathway is functioning.

1.10 Assimilation of acetyl-CoA using the ethylmalonyl-CoA pathway

Each full turn of the oxidative TCA cycle produces two molecules of CO2 negating the addition of each new acetyl-CoA molecule if no additional carbon input is provided. Many organisms including Escherichia coli and Rhodobacter capsulatus use a modified oxidative TCA cycle called the glyoxylate cycle to overcome this problem where isocitrate, rather than be oxidatively decarboxylated to -ketoglutarate, is cleaved by isocitrate lyase to form glyoxylate and succinate. Glyoxylate and acetyl-CoA are then condensed by malate synthase to form (S)-malate which is further converted to oxaloacetate. Condensation of oxaloacetate with a new molecule of acetyl-CoA forms citrate which can then undergo further transformation to isocitrate to allow for the cycle to begin afresh. The cycle effectively converts two molecules of acetyl-CoA to succinate.

Similarly, R. sphaeroides requires the anaplerotic ethylmalonyl-CoA pathway in order to assimilate carbon substrates that enter central carbon metabolism at the level of acetyl-CoA (Erb et al. 2007). Overall, 12 enzymes catalyze 14 reactions converting three acetyl-CoA molecules and two CO2 equivalents into one malate and one succinyl-CoA

15 molecule. This serves to replenish the C4-intermediates of the tricarboxylic acid cycle without loss of the carbon in the form of CO2. The initial steps in the pathway are also used by many organisms for the biosynthesis of polyhydroxybutyrate (PHB) while the latter steps are also used for propionyl-CoA metabolism. In between are the steps specific only to the ethylmalonyl-CoA pathway.

1.11 Early steps of the ethylmalonyl-CoA pathway and PHB metabolism

The first steps of the ethymalonyl-CoA pathway are common with those required for synthesis of PHB which occurs in many microorganisms including R. sphaeroides. It begins with a reversible condensation of two acetyl-CoA to acetoacetyl-CoA and CoA catalyzed by -ketothiolase, PhaA, followed by the reduction of acetoacetyl-CoA to (R)-

3-hydroxybutyryl-CoA catalyzed by the NADPH-dependent acetoacetyl-CoA reductase,

PhaB (Alber et al. 2006). For PHB biosynthesis, (R)-3-hydroxybutyryl-CoA is then polymerized by PHA synthase to form PHB. For the ethylmalonyl-CoA pathway, (R)-3- hydroxybutyryl-CoA would then by dehydrated to form crotonyl-CoA. In

Methylobacterium extorquens AM1, this step is catalyzed by CroR (Smejkalova et al.

2010), however, only the candidate gene rsp_2305, encoding a crotonase, has been identified to potentially be involved for R. sphaeroides 2.4.1.

Considered a mechanism to store excess carbon and electrons, PHB synthesis has been shown to be regulated at the protein and transcript level. Detailed work in

Azotobacter beijerinckii led to a regulatory model where feedback inhibition of - ketothiolase by CoA, as well as the high Km for acetyl-CoA, ensured carbon flux through the pathway only when there was an excess of acetyl-CoA and decreased CoA which

16 would result from increased glycolysis (Senior and Dawes 1973). In R. sphaeorides FJ1, the transcriptional repressor PhaR was shown to regulate expression of a pha operon consisting of the genes encoding a phasin, the PHA depolymerase, and the repressor

(Chou et al. 2010). An attempt to link transcriptional regulation of the Ccr-catalyzed step to PHB transcriptional regulation was accomplished by inactivating the phaR gene in R. sphaeroides 2.4.1. However, no phenotype was observed with acetate and Ccr-activity did not change in the acetate grown cells (Carter 2014). Whether or not R. sphaeroides accumulates PHB during growth with 3-hydroxypropionate is not known.

1.12 The ethylmalonyl-CoA pathway

Considered the committed step of the ethylmalonyl-CoA pathway, crotonyl-CoA carboxylase/reductase catalyzes the NADPH- and CO2-dependent reductive carboxylation of crotonyl-CoA to (2S)-ethylmalonyl-CoA (Erb et al. 2007; Erb et al.

2009a). This conversion is followed by epimerization of (2S)-ethylmalonyl-CoA to (2R)- ethylmalonyl-CoA by the ethylmalonyl-CoA/methylmalonyl-CoA epimerase, which also catalyzes the (2S)-methylmalonyl-CoA to (2R)-methylmalonyl-CoA in the later steps of the methylmalonyl-CoA pathway (Erb et al. 2008). The ethylmalonyl-CoA mutase then catalyzes the carbon backbone rearrangement of (2R)-ethylmalonyl-CoA to form methylsuccinyl-CoA followed by oxidation of methylsuccinyl-CoA to mesaconyl-C1-

CoA catalyzed by the methylsuccinyl-CoA dehydrogenase (Erb et al. 2008; Erb et al.

2009b). The mesaconyl-C1-CoA is hydrated to form -methylmalyl-CoA catalyzed by the mesaconyl-CoA hydratase (Zarzycki et al. 2008). Finally, the -methylmalyl-CoA undergoes cleavage to form glyoxyate and propionyl-CoA by the (3S)-malyl-CoA/β-

17 methylmalyl-CoA lyase. Glyoxylate condenses with another molecule of acetyl-CoA to form malyl-CoA (Erb et al. 2010). The malyl-CoA thioester is hydrolyzed by the malyl-

CoA thioesterase to form the TCA cycle intermediate (S)-malate. The propionyl-CoA can then be metabolized using the methylmalonyl-CoA pathway as described for 3- hydroxypropionate assimilation.

In this work, the role of the ethylmalonyl-CoA pathway with regard to carbon assimilation is considered. For instance, an R. sphaeroides Ccr-negative strain was shown to grow similar to wild type with 3-hydroxypropionate suggesting that the ethylmalonyl-

CoA pathway is not required for assimilation of 3-hydroxypropionate (Schneider et al.

2012). However, in strains blocked beyond Ccr, growth with 3-hydroxypropionate is inhibited. In Chapter 3, the reason for the growth inhibition in the strains with a late blockage in the ethylmalonyl-CoA pathway is investigated. In Chapter 4, mutations causing carbon flux through the ethylmalonyl-CoA pathway to decrease during 3- hydroxypropionate growth are discovered providing new insight to interactions between different biochemical processes in the organism.

Chapter 2: Evidence of a 3-hydroxypropionate oxidative pathway in Rhodobacter sphaeroides

Contributions to this work: The strain RsdddCMA4 was generated and complemented by Dr. Marie Asao including all the cloning to obtain the required plasmids. She also performed the 3-hydroxypropionate growth experiments with these strains. The ethylmalonyl-CoA pathway mutants were generated by Kelsey Baron including all the cloning to obtain the required plasmids.

2.1 Introduction

Precursor metabolites are defined as the intermediates of central carbon metabolism which serve as the biosynthetic starting points for all other necessary cellular constituents (Neidhardt et al. 1990; Fuchs 1999) (Figure 3). To study the assimilation of a particular carbon source, a metabolic scheme is constructed where pathways beginning with the carbon source must lead to each precursor metabolite by known or proposed enzymatic reactions occurring in the organism for a specific condition. This simulation of carbon flow from the source to all precursor metabolites suggests that the carbon source can be assimilated and growth will be observed. To test the scheme, inactivation of one of the proposed steps can be performed in the organism, by gene deletion for example, and the subsequent ability to grow with the particular carbon source can be used to deduce its requirement. Further predictions can then be made with the ultimate goal of understanding how the carbon enters central metabolism and maintains the precursor metabolite pools.

Figure 3 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism. Precursor metabolites are represented in boxes in panel A. A) Metabolic scheme showing possible routes by which 3-hydroxypropionate can enter central carbon metabolism at both, the level of acetyl-CoA via an oxidative pathway and at the level of succinyl-CoA via a reductive pathway. Acetyl-CoA generated via the oxidative pathway can be used directly for the synthesis of cell constituents, such as fatty acids, or could enter the ethylmalonyl-CoA pathway. The series of chemical reactions catalyzed by enzymes specific to B) the oxidative 3-hydroxypropionate pathway and C) the reductive 3- hydroxypropionate assimilatory pathway of R. sphaeroides 2.4.1. The catalyzed reactions of pyruvate to acetyl-CoA and -alanine to malonate semialdehyde dehydrogenase are included in B) but are not considered part of the oxidative pathway. Abbreviations: AcuI, acrylyl-CoA reductase; Ccr, crotonyl-CoA carboxylase/reductase; DddC, proposed malonate semialdehyde dehydrogenase; Ecm, ethylmalonyl-CoA mutase; Epi, ethylmalonyl-CoA/methylmalonyl-CoA epimerase; Mcd, methylsuccinyl-CoA dehydrogenase; Mch, mesaconyl-CoA hydratase; Mcl1, (3S)-malyl-CoA/β-methylmalyl- CoA lyase; Mcl2, (3S)-malyl-CoA thioesterase; PDHC, pyruvate dehydrogenase complex; PHA, polyhydroxyalkanoates; CBB Cycle, Calvin-Benson-Bassham cycle or reductive pentose phosphate pathway.

Acetyl-CoA, a precursor metabolite, is used by the cell for synthesis of fatty acids and as input for the tricarboxylic acid cycle. In most organisms, acetyl-CoA is formed from pyruvate. Many enzymes or pathways have been described which ultimately oxidize pyruvate to acetyl-CoA. The main enzyme studied is the pyruvate dehydrogenase complex, a large protein complex comprised of multiple monomers of three catalytic subunits; the pyruvate decarboxylase (E1) [EC 1.2.4.1], the dihydrolipoamide acetyltransferase (E2) [EC 2.3.1.12], and the dihydrolipoamide dehydrogenase (E3)

[1.8.1.4]. Together, this complex catalyzes the physiologically irreversible conversion of

+ pyruvate, CoA, and NAD to acetyl-CoA, CO2, and NADH (Schreiner et al. 2005). For many anaerobic bacteria and archaea, however, pyruvate:ferredoxin oxidoreductase [EC

1.2.7.1] is used where ferredoxin, rather than NAD+, is reduced during oxidation of pyruvate to acetyl-CoA (Vita et al. 2008). The oxygen-sensitive iron-sulfur clusters of the enzyme require the anaerobic environment. Another oxygen-sensitive enzyme is the glycyl radical-containing pyruvate:formate lyase [EC 2.3.1.54], used during fermentation from sugars for many organisms, where pyruvate and CoA are converted to acetyl-CoA and formate (Knappe and Wagner 2001). In many yeast, pyruvate decarboxylase [EC

4.1.1.1] performs the non-oxidative decarboxylation of pyruvate to acetaldehyde and

CO2, where an acetaldehyde dehydrogenase can further oxidize the acetaldehyde to acetate and then activation to acetyl-CoA can occur (Boubekeur et al. 1999). Finally, under aerobic conditions, certain organisms use pyruvate oxidase [EC 1.2.3.3] where oxygen is used as the electron acceptor to form acetyl-phosphate, CO2, and the reactive

H2O2 from pyruvate and phosphate (Tittmann 2009). The acetyl-phosphate can then be converted to acetyl-CoA by a phosphotransacetylase.

Alternative to the formation of acetyl-CoA from pyruvate, acetyl-CoA can also be formed from the oxidative decarboxylation of malonate semialdehyde which has been shown to occur during -alanine catabolism in bacteria (Yao et al. 2011; Waters and

Venables 1986; Hayaishi et al. 1961), propionyl-CoA oxidation in eukaryotes (Wilson et al. 2017; Watson et al. 2016; Otzen et al. 2014; Giovanelli and Stumpf 1958), and dimethylsulfoniopropionate (DMSP) degradation in marine microorganisms (Reisch et al. 2011; Reisch et al. 2013; Todd et al. 2010). For -alanine metabolism, a two-step assimilatory pathway requires the transamination of -alanine to malonate semialdehyde which is then converted to acetyl-CoA and CO2 by a malonate semialdehyde dehydrogenase [EC 1.2.1.18] (Hayaishi et al. 1961). For oxidation of propionyl-CoA, 3- hydroxypropionate has been demonstrated as an intermediate that is further oxidized to acetyl-CoA and CO2 via malonate semialdehyde (Wilson et al. 2017; Watson et al. 2016;

Otzen et al. 2014; Giovanelli and Stumpf 1958). In marine microorganisms, the osmolyte

DMSP can be degraded using either a cleavage or a demethylation pathway. For cleavage of DMSP leads to the formation of 3-hydroxypropionate or acrylate where either can be further oxidized to acetyl-CoA and CO2, again, via malonate semialdehyde (Reisch et al.

2011; Todd et al. 2010). Using the demethylation pathway, DMSP is first converted to methylmercaptopropionate (MMPA), which is then demethylated through a series of reactions to form acetaldehyde (Reisch et al. 2011).

3-Hydroxypropionate serves as an intermediate in the propionyl-CoA oxidative pathway and the DMSP cleavage pathway which proceed to acetyl-CoA. Used as a carbon source, 3-hydroxypropionate has been shown to support growth in organisms where an oxidative pathway via malonate semialdehyde to acetyl-CoA was implicated

(Zhou et al. 2014; Todd et al. 2010). Exclusive use of the 3-hydroxypropionate oxidative pathway in an organism would require carbon from 3-hydroxypropionate to enter central metabolism solely at the level of acetyl-CoA. For the metabolically versatile, purple non- sulfur bacterium Rhodobacter sphaeroides, assimilation of compounds that enter central carbon metabolism on the level of acetyl-CoA require the use of the ethylmalonyl-CoA pathway which is used to replenish the C4-dicarboxylic acid pools of the TCA cycle (Erb et al. 2007) and functions similarly to the well-studied glyoxylate bypass in other organisms (Dolan and Welch 2018). Strains containing inactivated genes encoding enzymes of the ethylmalonyl-CoA pathway are inhibited for growth with substrates that enter at the level of acetyl-CoA , and this can be used as a diagnostic tool. For R. sphaeroides, the use of the oxidative pathway for 3-hydroxypropionate assimilation was first investigated in this way (Schneider et al. 2012). It was shown that a Ccr-negative strain, lacking a required enzyme of the ethylmalonyl-CoA pathway, was fully capable of growth with 3-hydroxypropionate indicating the oxidative pathway was not exclusively used (Schneider et al. 2012). It was proposed that the path could still be present to generate acetyl-CoA for the synthesis of fatty acids. However, no genes or enzymes participating in the oxidative pathway were reported.

Rather, mutant analysis, cell-extract activity, and enzyme characterization was performed to show that R. sphaeroides is able to grow with 3-hydroxypropionate using the so-called reductive pathway involving the NADPH-dependent reduction of acrylyl-

CoA to propionyl-CoA catalyzed by the enzyme acrylyl-CoA reductase, AcuI (Schneider et al. 2012; Asao and Alber 2013) (Figure 3C). Further assimilation of the propionyl-

CoA formed from the reduction of acrylyl-CoA is expected to proceed via the methylmalonyl-CoA pathway whereby it is converted to the tricarboxylic acid cycle intermediate succinyl-CoA (Carter and Alber 2015) and can then be used to generate all precursor metabolites required for sustaining growth.

Considering R. sphaeroides, a major difference between using the reductive pathway versus the oxidative pathway for 3-hydroxypropionate assimilation is how acetyl-CoA would be formed. The exclusive use of the reductive pathway would proceed to acetyl-CoA via pyruvate and require an enzyme capable of pyruvate oxidation.

Conversely, the 3-hydroxypropionate oxidative pathway produces acetyl-CoA from malonate semialdehyde and its use would suggest that pyruvate oxidation is dispensable.

The aim of the current study was to investigate the presence of a 3- hydroxypropionate oxidative path in R. sphaeroides. Here, we show that a strain with an in-frame deletion of rsp_2962, predicted to encode a methylmalonate semialdehyde dehydrogenase, was severely inhibited for growth with 3-hydroxypropionate.

Furthermore, the same inactivation strain was unable to grow with -alanine, which has been shown to require the conversion of malonate semialdehyde to acetyl-CoA for assimilation in Pseudomonas sp. (Yao et al. 2011; Waters and Venables 1986; Hayaishi

24 et al. 1961). As these findings suggested the presence of an oxidative path, additional experiments were performed using a mutant strain lacking a functional pyruvate dehydrogenase complex, which we showed to be capable of robust growth with 3- hydroxypropionate while growth with pyruvate was abolished. This indicated an alternative mechanism for maintaining acetyl-CoA levels is present in R. sphaeroides during 3-hydroxypropionate assimilation which we posit to be the oxidative pathway.

2.2 Materials and Methods

2.2.1 Materials.

See Chapter 3 (pg. 53) for details on the purchase, neutralization, and concentration determination for 3-hydroxypropionate. All primers used in the study were obtained from Sigma-Aldrich (St. Louis, MO) and are listed in Table 2.

2.2.2 Bacterial strains and growth conditions

See Chapter 3 (pg. 53) for growth conditions. See Table 1 for strains used in

Chapter 2.

2.2.3 NCBI Database search for enzymes capable of converting pyruvate to acetyl- CoA (or an intermediate requiring a second enzyme to form acetyl-CoA)

To identify potential enzymes capable of converting pyruvate to acetyl-CoA,

BLAST queries were performed in the predicted Rhodobacter sphaeroides 2.4.1 proteome using amino acid sequences from characterized enzymes from other microorganisms. These included: pyruvate oxidase from Lactobacillus plantarum

(UniProt: Q6JI89), pyruvate oxidase from Escherichia coli K-12 substr. MG1655

(b0871), pyruvate:formate lyase from Escherichia coli K-12 substr. MG1655 (b0903) and 25

Chlamydomonas reinhardtii (CHLREDRAFT_146801), pyruvate:ferredoxin oxidoreductase from Helicobacter pylori (HPOK310_1005, HPOK310_1006,

HPOK310_1007, HPOK310_1008) and Desulfovibrio africanus (UniProt: P94692) , and pyruvate decarboxylase from Saccharomyces cerevisiae (UniProt: P06169).

Table 1 Strains and plasmids used in Chapter 2 Name Relevant characteristics Reference Escherichia coli DH5 Cloning host SM10 RP4-2 Tc::Mu-Km::Tn7 Simon et al. (1983) S17-1 RP4-2 Tc::Mu Tpr Smr Scr Simon et al. (1983)

Rhodobacter sphaeroides 2.4.1 wild type with cbbR mutation; encodes R247Q variant This work RspdhAa2SJC In-frame deletion inactivation of pdhAa (rsp_4047) This work RsΔccr23KB In-frame deletion of ccr Chapter 3 RsΔecm47KB In-frame deletion of ecm Chapter 3 RsΔmcd11KB In-frame deletion of mcd Chapter 3 RsΔmch49KB In-frame deletion of mch Chapter 3 RsΔmcl1_4KB In-frame deletion of mcl1 Chapter 3 RsΔdddCMA4 In-frame deletion of dddC (rsp_2962) Marie Asao

Plasmids pBBRsm2MCS5 Broad host range vector, Scr Smr Schneider et al. (2012) pMA5-1 acuI with tetA promoter Schneider et al. (2012) pMA32-1 dddC with tetA promoter Marie Asao

pBBRsm2MCS5SJC(D) “empty vector”, derived from pBBRsm2MCS5, XbaI/SpeI sites removed Chapter 3 pSC153 pdhAa-pdhAb-pdhB with endogenous promoter (rsp_4047-rsp_4049- This work rsp_4050)

pK18mobsacB Suicide vector in R. sphaeroides, Kmr SucroseS Schäfer et al. (1994) pMA10-4 In-frame deletion inactivation of dddC (rsp_2962) Marie Asao pSC125 In-frame deletion inactivation of pdhAa (rsp_4047) This work

Table 2 Primers used in Chapter 2 Primer Sequence (5’  3’) Purpose deltadddCup_for1 AAAGGCAAGCTTACGCATCGCGGGACAGG dddC upstream fragment deltadddCup_rev1 ACGCGGGTACCGTCGATCCAGTGGCTGAG dddC upstream fragment deltadddCdown_for1 GCATCAAGGAGGGTACCGCCTTCAACTTC dddC downstream fragment deltadddCdown_rev1 TGCGGAGTCATATGTCGATGCCGCCGACGTTGGTC dddC downstream fragment dddCexp_NdeIF CCGAGGGAGATTCATATGGAAGAACTCAG dddC complementation dddCexp_BamHIR GAGGTGGATCCGGACCGAAACTCAG dddC complementation delta_pdhAa_UpF GTCGGTCCAGAGTTCCTCCAGGAGCATCTCGCGGTAGTAAC pdhAa upstream fragment delta_pdhAa_UpR1 TTTCTCTAGACCGCACGCCAGAATG pdhAa upstream fragment delta_pdhAa_DnF GGATCTGCGCAAGCTTCGCCGCATAATCC pdhAa downstream fragment delta_pdhAa_DnR GAGGAACTCTGGACCGACATCTAC pdhAa downstream fragment pdhA_1xo_UpF CGACGGCCTCGAATTCCATC RspdhAa2SJC genotyping pdhA_1xo_UpR AGGGCGAGGATTCGGTCTATG RspdhAa2SJC genotyping pdhA_1xo_DnF TGCCGAAGGAGACGATGGTG RspdhAa2SJC genotyping pdhA_1xo_DnR GGATGCGCTAAAGGTAGTTTAGCC RspdhAa2SJC genotyping PDH_operon_F5 CGGGTACCTCAGGCCAGCATGGCGATCGGGTTCTC pdh operon complementation PDH_operon_R3 GCCGCCAAGCTTGCCGATATGGAGAACAGGAC pdh operon complementation Restriction endonuclease recognition sites are underlined

2.2.4 Isolation and complementation of RspdhAa2SJC

2.2.4.1 Plasmid construction for isolation of pdhAa2SJC

For inactivation of pdhAa (rsp_4047), the suicide plasmid pSC125 was constructed by amplifying a marker-less in-frame deletion via assembly PCR. The upstream fragment was amplified from R. sphaeroides genomic DNA so that 18 bp matching the downstream 3’ pdhAa coding region were encoded adjacent to 78 bp of the

5’ pdhAa coding region followed by 734 bp directly upstream using primer pair delta_pdhAa_UpF / delta_pdhAa_UpR1. The downstream fragment was amplified so that

30 bp of the 3’ pdhAa coding region (the first 18 bp matching those on the upstream fragment) plus 845 bp directly downstream were amplified using primer pairs delta_pdhAa_DnF / delta_pdhAa_DnR. These products at a 1:1 ratio then served as template in a single-assembly PCR using the primer pair delta_pdhAa_UpR1 / delta_pdhAa_DnF for amplification. The assembly PCR amplicon was cloned into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pSC125 contains an in- frame deletion of pdhAa of 882 bp. The remaining open reading frame encodes a 35- amino acid peptide.

2.2.4.2 Plasmid construction for complementation of pdhAa2SJC

For the complementation of pdhAa2SJC, pdhAa-pdhAb-pdhB (rsp_4047- rsp_4049-rsp_4050) coding region as well as 342 bp upstream of rsp_4047 to include any endogenous promoter sequence was amplified from R. sphaeroides genomic DNA using primer pair PDH_operon_F5/R3. Digestion of the 4096-bp product along with the

27 broad host range vector pBBRsm2SM5SJC(D) using HindIII/KpnI followed by ligation resulted in plasmid pSC153.

2.2.4.3 Isolation of pdhAa2SJC

Introduction of pSC125 (containing the in-frame deleted copy of pdhAa) to wild- type R. sphaeroides was conducted via conjugation with E. coli S17-1 harboring pSC125.

Twenty-five milliliters of both strains growing exponentially (OD578 nm = 0.4 - 0.6) and aerobically in LB were centrifuged at 8,000 x g for 5 min, decanted and the resulting cell pellets were washed with 1 mL of fresh LB. The suspensions were centrifuged again at

10,000 x g for 1 min, decanted, and resuspended in (0.4 – 0.6 mL) fresh LB equivalent to their final OD578 nm when harvested. A 1:1 mixture of R. sphaeroides:E. coli cells was made by combining 0.150 mL of each resuspended culture in the same microcentrifuge tube. The mixture was then centrifuged a final time at 10,000 x g for 1 min, decanted, and resuspended in 0.1 mL of fresh LB. Finally, all of this mixture was spotted onto a fresh

LB plate and incubated aerobically in the dark at 30 C for 24 h to allow for conjugation.

The entire spot was then resuspended in 0.1 mL of acetate minimal media and diluted

1:100 and 1:1000. One hundred microliters of both dilutions were plated onto acetate minimal media agar containing kanamycin and incubated anaerobically at 30 C in the light. Kanamycin-resistant single crossover recombinant strains were isolated from these plates and analyzed using PCR to determine the presence and orientation of the deleted gene compared to the wild type gene. To isolate double recombinant strains, a single crossover colony was incubated aerobically at 30 C in 0.1 mL of acetate minimal media for ~24 h. This overnight culture was then diluted 1:10 and 1:100 and 0.1 mL of each was

28 plated onto acetate minimal media agar containing 10 % sucrose and incubated at 30 C anaerobically in the light. Only those cells where homologous recombination occurred removing the plasmid DNA containing the sacB gene and, either the wild type or deletion copy of the pdhAa gene, could grow in the presence of sucrose. The resulting isolated colonies were patched onto 1) acetate minimal media with kanamycin, 2) acetate minimal media with 10 % sucrose, and 3) acetate minimal media. Cells lacking plasmid DNA were sensitive to kanamycin and resistant to sucrose. At the same time as patching, PCR amplification of pdhAa from each patched colony was performed in order to show via gel electrophoresis either a large band corresponding to a wild type revertant or a small band indicating an in-frame deletion. After isolation of potential mutant strains from the patching, genomic deletions were confirmed by PCR analysis and sequencing of the affected region.

2.2.5 Isolation and complementation of RsdddCMA4

2.2.5.1 Plasmid construction for isolation of RsdddCMA4

For the marker-less in frame deletion of dddC (rsp_2962), the suicide plasmid pMA10-4 was constructed by amplifying 27 bp of the 5’ dddC coding region plus 1523 bp directly upstream (primers: deltadddCup_for1/rev1) and 27 bp of the 3’ dddC coding region plus 1461 bp directly downstream (deltadddCdown_for1/rev1) of dddC by PCR and cloning the products in tandem into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pMA10-4 contains an in-frame deletion of dddC of 1446 bp. The remaining open reading frame encodes a 19-amino acid peptide.

2.2.5.2 Plasmid construction for complementation of RsdddCMA4

For the complementation of dddCMA4, dddC (rsp_2962) was amplified from R. sphaeroides 2.4.1 genomic DNA using primer pair dddCexp_NdeIF/dddCexp_BamHIR.

The 1536 bp product was cloned into pMA5-1, replacing the insert acuI, and putting it under the control of a constitutive tetA promoter (Schneider et al. 2012) resulting in plasmid pMA32-1.

2.2.5.3 Isolation of RsdddCMA4

Introduction of pMA10-4 (containing the in-frame deleted copy of rsp_2962

(dddC)) to wild-type R. sphaeroides was conducted via conjugation with E. coli S17-1 harboring pMA10-4. Further steps conducted to isolate RsdddCMA4 were similar to isolation of RspdhAa2SJC (pg. 28) though minimal media supplemented with succinate was used instead of acetate.

2.2.6 Isolation of complemented R. sphaeroides strains

Introduction of pBBRsm2MCS5SJC(D), pMA32-1, or pSC153 to wild-type R. sphaeroides and/or mutant derivatives was conducted via conjugation with E. coli SM10 harboring one of the complementation plasmids. Twenty-five milliliters of E. coli + plasmid and an R. sphaeroides strain growing exponentially (OD578 nm = 0.4-0.6) and aerobically were centrifuged at 8,000 x g for 5 min, decanted and the resulting cell pellets were washed with 1 mL of fresh LB. The suspensions were centrifuged again at 10,000 x g for 1 min, decanted, and resuspended in (0.4 – 0.6 mL) fresh LB equivalent to their final OD578 nm when harvested. A 1:1 mixture of R. sphaeroides:E. coli cells was made by combining 0.150 mL of each resuspended culture in the same microcentrifuge tube. The mixture was then centrifuged a final time at 10,000 x g for 1 min, decanted and

30 resuspended in 0.1 mL of fresh LB. Finally, all of this mixture was spotted onto a fresh

LB plate and incubated aerobically in the dark at 30C for ~18 hours to allow for conjugation. The entire spot was then resuspended in 0.1 mL of minimal media (with acetate for RspdhAa2SJC and succinate for RsdddCMA4) and diluted 1:1000 and

1:10,000. One hundred microliters of both dilutions were plated onto acetate or succinate minimal media agar containing spectinomycin and incubated anaerobically at 30C in the light. Transconjugates appeared within 5 days and single colonies were restreaked on acetate or succinate minimal media agar containing spectinomycin. The resulting plates were used to generate liquid glycerol stocks for storage at -80C.

2.2.7 Preparation of cell extracts

One liter cultures of R. sphaeroides wild type and mutant strains were grown photoheterotrophically while stirring at 30 C in minimal media supplemented with 10 mM of the appropriate carbon source. Upon reaching 0.4 – 0.5 OD578nm, cultures were centrifuged, supernatant was decanted leaving only a residual amount behind which was used to evenly distribute the cells into six separate microcentrifuge tubes. The microcentrifuge tubes were then centrifuged to completely remove the supernatant and then frozen at -80 C. Frozen cell pellets (300-600 mg) were suspended in 600 L of ice- cold lysis buffer containing 25 mM Tris-Cl (pH 7.9), 5 mM MgCl2,and 0.1 mg/mL

DNase and thawed on ice. Approximately 1 g of glass beads (0.1-0.25 mm diameter) was added to the cell suspension and beaten in a mixer mill (Retsch MM200) at 30 Hz for 9 min. The cell extract was then separated via centrifugation at 10,000 x g for 15 minutes to assay for activity. Protein concentrations were determined by the method of Bradford 31

(Bradford 1976) using a dilution series of bovine serum albumin to generate a standard curve.

2.2.8 Pyruvate dehydrogenase complex assay measuring pyruvate- and CoA- dependent NAD+ reduction

Activity was measured as the pyruvate-dependent, CoA-dependent, and enzyme- dependent reduction of NAD+ at 30 C by observing the change in absorbance at 365 nm

( = 3,400 M-1cm-1) in a plastic cuvette with a 1 cm path length. The 500 L reaction contained at a final concentration 150 mM Tris-Cl pH 8.5, 1 mM MgCl2, 3 mM DTT, 0.2 mM thiamine pyrophosphate, 1 mM NAD+, 0.08 mM CoA, cell extract, and initiated by the addition of 6 mM sodium pyruvate

2.2.9 Malate dehydrogenase assay measuring oxaloacetate-dependent NADH oxidation

Activity was measured as the oxaloacetate-dependent and enzyme-dependent oxidation of NADH at 30 C by observing the change in absorbance at 365 nm ( = 3,400

M-1cm-1) in a plastic cuvette with a 1 cm path length. The 500 L reaction contained at a final concentration 100 mM MOPS-KOH pH 7.5, 1 mM NADH, cell extract, and initiated by the addition of 5 mM sodium oxaloacetate.

2.3 Results

2.3.1 The gene rsp_2962, encoding methylmalonate semialdehyde dehydrogenase (acylating), is required for 3-hydroxypropionate assimilation

While screening for R. sphaeroides Tn5 transposon mutants unable to grow on various carbon sources, insertions in the gene rsp_2962, annotated to encode a methylmalonate semialdehyde dehydrogenase (acylating) [EC: 1.2.1.27], resulted in D/L- 32 lactate+, acetate+, and L-malate+ mutant R. sphaeroides strains unable to grow with 3- hydroxypropionate (Sandman et al. unpublished) (data not shown). The protein encoded by rsp_2962 shares 42 % and 46 % amino acid identity with the characterized methylmalonate semialdehyde dehydrogenases from Bacillus subtilis (Stines-Chaumeil et al. 2006) and rat liver (Goodwin et al. 1989). At least five independent transposon insertion strains, with the same phenotype, were isolated where rsp_2962 was disrupted by a transposon. To ensure that the observed phenotype with the Tn5-mutants was due to inactivation of rsp_2962 (referred to as dddC from here on), the in-frame deletion strain

RsdddCMA4 was generated. When tested for growth with 3-hydroxypropionate, a severe inhibition was observed resulting in a 8-fold increase in doubling time compared to wild type, which could be restored with constitutive expression of dddC from a plasmid (Figure 4; Table 3).

Figure 4 R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate, -alanine, and succinate. Shown are wild type (), RsdddCMA4 (), RsdddCMA4 (dddC) (), and RsdddCMA4 (empty vector) () from a single representative growth experiment.

Table 3 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate, acetate, -alanine, and succinate as the carbon source.

Doubling time (hr) 3-hydroxy- acetate -alanine succinate Strain propionate R. sphaeroides 2.4.1 (wild type) 5.50.6a 3.90.5 488b 3.30.4 wild type (empty vector) 6.60.4 4.40.1 4713b 3.50.1 RsdddCMA4 451.8b 3.40 NGbc 3.00.4 RsdddCMA4 (dddC) 6.30.3 NDd 320.5b 3.40.1 RsdddCMA4 (empty vector) 460.8b ND NGb 2.90.2b aAverage and standard deviation using three or more biological replicates unless otherwise noted bAverage and  range between two biological replicates cNG = no growth dND = not determined

We hypothesized that the growth defect observed with 3-hydroxypropionate was due to the disruption of the DddC-catalyzed conversion of malonate semialdehyde to acetyl-

CoA and CO2 as part of a 3-hydroxypropionate oxidative pathway as suggested for

Halomonas sp. HTNK1 and Pseudomonas denitrificans (Todd et al. 2010; Zhou et al.

2013; Zhou et al. 2014). In this pathway, 3-hydroxypropionate oxidation proceeds via oxidative decarboxylation of malonate semialdehyde to acetyl-CoA and CO2, catalyzed by a malonate semialdehyde dehydrogenase (Figure 3).

2.3.2 DddC required for -alanine assimilation

To support the in vivo characterization of DddC as a malonate semialdehyde dehydrogenase, the ability of RsdddCMA4 to grow with -alanine was tested. For

Pseudomonas fluorescens, the enzymatic conversion of -alanine to malonate semialdehyde by a -alanine:pyruvate aminotransferase as well as the conversion of malonate semialdehyde to acetyl-CoA and CO2 by a malonate semialdehyde dehydrogenase has been demonstrated using purified proteins (Hayaishi et al. 1961) 34

(Figure 3). Additionally, growth with -alanine has been shown to cease in a mutant

Pseudomonas aeruginosa PAO1 strain where the suspected malonate semialdehyde dehydrogenase encoding gene was inactivated (Yao et al. 2011). Similarly, we hypothesized that RsdddCMA4 would be unable to grow with -alanine lacking the malonate semialdehyde dehydrogenase that would be required for -alanine assimilation.

Wild-type R. sphaeroides exhibited slow, exponential growth with -alanine with a doubling time of 48 hours (Figure 4; Table 3). For RsdddCMA4, growth did not occur but could be restored when dddC was introduced on a plasmid. Furthermore, growth with succinate was not affected. These results substantiate the role of DddC as a malonate semialdehyde dehydrogenase due to the necessity for conversion of malonate semialdehyde to acetyl-CoA and CO2 during -alanine assimilation.

2.3.3 Assimilation of -alanine requires the ethylmalonyl-CoA pathway

For R. sphaeroides, growth with substrates that enter central carbon metabolism exclusively at the level of acetyl-CoA require the anaplerotic ethylmalonyl-CoA pathway in order to replenish C4-intermediates of the tricarboxylic acid cycle (Erb et al. 2007).

For -alanine, the requirement for the ethylmalonyl-CoA pathway would be predicted, as it is initially converted to acetyl-CoA via malonate semialdehyde (Hayaishi et al. 1961), however this has not been tested. Therefore, -alanine growth was tested with multiple in-frame deletion strains lacking one of the genes encoding an enzyme specific to the ethylmalonyl-CoA pathway. Acetate growth was tested as a comparison while succinate growth served as a control. As seen in Figure 5, all strains containing a blockage within the ethylmalonyl-CoA pathway were unable to grow with -alanine. For acetate, a 35 limited increase in OD578nm was observed that was inconsistent with exponential growth for strains Rsccr23KB, Rsecm49KB, and Rsmcd11KB to a final OD578nm 0.24, 0.24, and 0.17, respectively. All strains could then be rescued upon reintroduction of the complete gene on a plasmid, however, increased doubling times were observed for

Rsccr23KB (ccr) and Rsmcd11KB (mcd) grown with acetate compared to wild type

(Table 4). These results are indicative of -alanine assimilation requiring an initial conversion to acetyl-CoA, and subsequent to acetyl-CoA formation, entry into central carbon metabolism in order for growth to occur.

Figure 5 Photoheterotrophic growth for R. sphaeroides ethylmalonyl-CoA pathway- deficient mutants with succinate, -alanine, and acetate. Shown are wild type (), Rsccr23KB (), Rsecm47KB (), Rsmcd11KB (), Rsmch49KB (), and Rsmcl1_4KB () from a single representative growth experiment.

2.3.4 DddC is not required for acetyl-CoA assimilation

The inability of RsdddCMA4 to grow with -alanine could be due to an unexpected requirement of DddC for assimilation of acetyl-CoA, rather than the formation of acetyl-CoA. If this were the case, growth with acetate should only be possible with a functional enzyme. Therefore, RsdddCMA4 was grown with acetate. As

36 seen in Table 3, there was no difference in doubling times between it and wild type showing that DddC does not participate in acetyl-CoA assimilation and further substantiating its role in conversion of malonate semialdehyde to acetyl-CoA.

Table 4 Doubling times for R. sphaeroides strains grown photoheterotrophically with succinate, 3-hydroxypropionate, acetate, or -alanine as the carbon source.

Doubling time (hr) succinate 3-hydroxy- acetate -alanine Strain propionate R. sphaeroides 2.4.1 (wild type) 3.30.4 a 5.50.6 3.90.5 488d wild type (empty vector) 3.50.1 6.60.4 4.40.1 4713d Rsccr23KB 3.10.3 6.10.4 NE (0.2) NG Rsccr23KB (ccr) 3.20.4 6.21.1 144 101e Rsccr23KB (empty vector) 3.40.3 8.11.2 NE (0.18) NG Rsecm47KB 3.80.3 NE (0.71)b NE (0.18) NG Rsecm47KB (ecm) 3.90.8 6.40.4 6.00.2 63e Rsecm47KB (empty vector) 3.70.6 NE (0.41) NE (0.15) NG Rsmcd11KB 3.70.1 NE (0.18) NE (0.15) NG Rsmcd11KB (mcd) 3.90.8 6.20.7 172 575d Rsmcd11KB (empty vector) 3.50.2 NE (0.13) NE (0.13) NG Rsmch49KB 3.10.2 NGc NG NG Rsmch49KB (mch) 3.60.5 6.70.9 5.10.6 488d Rsmch49KB (empty vector) 3.50.2 NG NG NG Rsmcl1_4KB 3.70.1 NG NG NG Rsmcl1_4KB (mcl1) 3.90.6 6.30.6 7.42.3 61e Rsmcl1_4KB (empty vector) 3.80.4 NG NG NG aAverage and standard deviation using three or more biological replicates unless otherwise noted b NE = non-exponential increase in OD578nm (the average OD578 nm after 100 hrs of growth is given in parentheses) cNG = no growth dAverage and  range with two biological replicates eSingle experiment

2.3.5 Bioinformatic analysis identified pyruvate dehydrogenase complex as only enzyme encoded by R. sphaeroides 2.4.1 to oxidize pyruvate to acetyl-CoA

Gene annotation of dddC and the inability of RsdddCMA4 to grow with - alanine suggests that dddC encodes a malonate semialdehyde dehydrogenase. As such, 37 the severe growth defect exhibited by RsdddCMA4 with 3-hydroxypropionate implies that assimilation of 3-hydroxypropionate would require a malonate semialdehyde dehydrogenase to catalyze the conversion of malonate semialdehyde to acetyl-CoA and

CO2. We hypothesized that this requirement is for acetyl-CoA formation via a 3- hydroxypropionate oxidative pathway (Rendina and Coon 1957; Den et al. 1959) , as opposed to acetyl-CoA formation from pyruvate oxidation. Therefore, all enzymes R. sphaeroides encodes that are capable of converting pyruvate to acetyl-CoA would be dispensable during growth with 3-hydroxypropionate. To test this, we first set out to bioinformatically identify all possible enzymes R. sphaeroides encodes which could be used to obtain acetyl-CoA from pyruvate, so as to genetically inactivate them. This would then allow us to test for dependence on the putative oxidative pathway for acetyl-CoA formation during growth with 3-hydroxypropionate.

BLAST searches were conducted to determine the genetically-encoded capability of R. sphaeroides 2.4.1 to convert pyruvate to acetyl-CoA. Pyruvate dehydrogenase complex activity has previously been detected in R. sphaeroides (Maruyama and

Kitamura 1985) and the genes encoding the different subunits were identified. In R. sphaeroides, the E1 component is actually made up of two subunits designated E1 and

E1 which are encoded by the genes rsp_4074 and rsp_4049, respectively, in a possible operon along with the gene encoding the E2 subunit, rsp_4050. Two genes, rsp_0962 and rsp_2968, can be found for the E3 subunit at different loci in the genome encoding proteins that share 44 % amino acid sequence identity. The function of the E1 and E2 subunits is specific to the pyruvate dehydrogenase complex while the E3 subunit is used

38 by the two other 2-oxo acid dehydrogenase complexes present in the cell, the 2- oxoglutarate dehydrogenase complex of the TCA cycle and the branched-chain 2-oxo acid dehydrogenase complex used for catabolism of amino acids (Yeaman 1989).

Evidence in the literature that might suggest R. sphaeroides encodes any other enzymes capable of converting pyruvate to acetyl-CoA could not be found. Therefore, representative amino acid sequences from characterized enzymes of other organisms other than pyruvate dehydrogenase shown to catalyze the conversion of pyruvate to acetyl-CoA (or an intermediate leading to it) were used as queries (Table 5). As shown in

Table 5, the pyruvate dehydrogenase complex was the only enzyme identified capable of converting pyruvate to acetyl-CoA for R. sphaeroides.

Table 5 Results from BLAST search for pyruvate oxidizing enzymes in Rhodobacter sphaeroides

Gene(s) present in R. Organism/protein used for sphaeroides BLAST search Enzyme name Catalyzed reaction genome rsp_4047- Pyruvate pyruvate + HSCoA + NAD+ rsp_4049- dehydrogenase ➝ acetyl-CoA + CO2 + rsp_4050 complex NADH rsp_0962 / rsp_2968 Escherichia coli PflB Pyruvate formate- pyruvate + HSCoA ➝ acetyl- Chlamydomonas reinhardtii Not found lyase PFL CoA + formate pyruvate + phosphate + O ➝ Lactobacillus plantarum 2 Pyruvate oxidase Not found PoxB acetyl-phosphate + CO2+ H2O2 Pyruvate + ubiquinone + OH- Escherichia coli PoxB Pyruvate oxidase Not found ➝ acetate + CO2 + ubiquinol Saccharomyces cerevisiae Pyruvate pyruvate ➝ acetaldehyde + Not found PDC1 decarboxylase CO2 Helicobacter pylori PfoR Pyruvate:ferredoxin pyruvate + HSCoA + Fdox ➝ Not found Desulfovibrio africanus PfoR oxidoreductase acetyl-CoA + CO2 + Fdred

2.3.6 In-frame deletion strain RspdhAa2SJC cannot grow with pyruvate

Based on the bioinformatic search, the pyruvate dehydrogenase complex appears to be the only known pathway available to R. sphaeroides to generate acetyl-CoA from pyruvate. In order to test for the requirement for pyruvate dehydrogenase during 3- hydroxypropionate-dependent growth, a mutant was generated. Pyruvate dehydrogenase complex activity in the related bacterium Rhodobacter capsulatus has been shown to be undetectable when grown with acetate (Willison 1988). Therefore, we predicted pyruvate dehydrogenase to be dispensable for growth with acetate for R. sphaeroides. We isolated the strain RspdhAa2SJC with acetate in which 882 bp are missing from the gene pdhAa, encoding the E1 subunit. Due to the specificity for pyruvate as a substrate, loss of the

E1 subunit should render the entire pyruvate dehydrogenase complex nonfunctional.

Consistent with this prediction, RspdhAa2SJC was unable to grow with pyruvate

(Figure 6; Table 6) which could then be restored when the entire pdh coding region

(pdhAa-pdhAb-pdhB), along with the 342 bp upstream of it, was introduced on a plasmid.

The doubling time for acetate growth for RspdhAa2SJC was slightly elevated, while a much more pronounced increase in doubling time for both wild type and mutant complemented strains with acetate was observed, which was most likely due to the expression of the genes from the plasmid (Table 6).

2.3.7 In-frame deletion strain RspdhAa2SJC can grow with 3-hydroxypropionate

RspdhAa2SJC grew with 3-hydroxypropionate with a doubling time of 7.30.7 compared to 5.50.6 for wild type R. sphaeroides (Figure 6; Table 6). The increased 40 doubling time of RspdhAa2SJC was partially restored in the complemented strain while wild type (pdhAa-pdhAb-pdhB) had an increased doubling time of 7.80.1 (Table 6).

Compared to the inability of RspdhAa2SJC to grow with pyruvate, the growth observed with 3-hydroxypropionate supports the use of an alternative mechanism for acetyl-CoA formation that does not require pyruvate oxidation such as the proposed 3- hydroxypropionate oxidative pathway.

Figure 6 Photoheterotrophic growth of R. sphaeroides strains with 3-hydroxypropionate, acetate, and pyruvate. Shown are wild type (), RspdhAa2SJC (), RspdhAa2SJC (pdhAa-pdhAb-pdhB) (), and RspdhAa2SJC (empty vector) () from a representative growth experiment.

Table 6 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3- hydroxypropionate, acetate, pyruvate, or -alanine as the carbon source.

Doubling time (hr) 3-hydroxy- acetate pyruvate -alanine Strain propionate R. sphaeroides 2.4.1 (wild type) 5.50.6a 3.90.5 5.10.4 488d wild type (pdhAa-pdhAb-pdhB) 7.80.1 6.30.7d 6.30.8 ND wild type (empty vector) 6.60.4 4.40.1 NDb 4713d RspdhAa2SJC 7.30.7 4.40.3 NGc 322d RspdhAa2SJC (pdhAa-pdhAb-pdhB) 6.80.3 6.11.1d 5.20.5 ND RspdhAa2SJC (empty vector) ND 7.30.3 NG ND aAverage and standard deviation using three or more biological replicates bND = not determined cNG = no growth dAverage and  range with two biological replicates 41

2.3.8 Pyruvate dehydrogenase complex activity undetectable in RspdhAa2SJC cells grown with either 3-hydroxypropionate or acetate

As the growth with pyruvate for RspdhAa2SJC indicated that the pyruvate dehydrogenase complex was no longer functional, we wanted to corroborate this by testing for pyruvate dehydrogenase complex activity in cell extracts of wild type and the mutant grown with acetate and 3-hydroxypropionate. Pyruvate dehydrogenase activity could be readily detected in extracts from wild-type R. sphaeroides cells grown photoheterotrophically with pyruvate, acetate, and 3-hydroxypropionate (Table 7).

However, pyruvate dehydrogenase activity from acetate-grown wild type cells exhibited a four-fold decrease compared to activity detected with the pyruvate- or 3- hydroxypropionate-grown wild type cells.

Table 7 Enzyme activities in cell extracts of photoheterotrophically grown R. sphaeroides strains

Specific activity (nmol/min/mg)a Pyruvate Malate Strain Growth substrate dehydrogenase dehydrogenase R. sphaeroides 2.4.1 (wild type) pyruvate 862 48020 acetate 222 71020 3-hydroxypropionate 991 66050 wild type (pdhAa-pdhAb-pdhB) pyruvate 794 4100 pdhAa2SJC pyruvate NGb NG acetate <0.01 58050 3-hydroxypropionate <0.01 39060 pdhAa2SJC (pdhAa-pdhAb-pdhB) pyruvate 494 45030 aAverage and standard deviation from 3 technical replicates bNG = no growth

RspdhAa2SJC is unable to grow with pyruvate (Figure 4) and no pyruvate dehydrogenase activity could be detected in extracts from cells grown with acetate or 3-

42 hydroxypropionate (Table 7). Activity could be detected in RspdhAa2SJC (pdhAa- pdhAb-pdhB) though levels were lower than that measured for wild type or wild type

(pdhAa-pdhAb-pdhB). As a control, malate dehydrogenase activity was measured in all prepared cell extracts and showed similar levels regardless of the strain or carbon source

(Table 7). Therefore, in RspdhAa2SJC, an alternative enzyme and/or pathway to the pyruvate dehydrogenase complex-catalyzed reaction is used to maintain the intracellular pool of acetyl-CoA during growth with 3-hydroxypropionate.

2.4 Discussion

2.4.1 Formation of acetyl-CoA occurs that is not from pyruvate oxidation, which can support growth during 3-hydroxypropionate assimilation

The use of a reductive pathway for 3-hydroxypropionate assimilation via reduction of acrylyl-CoA to propionyl-CoA in R. sphaeroides has been established

(Schneider et al. 2012; Asao and Alber 2014). Once propionyl-CoA is formed, R. sphaeroides most likely uses the methylmalonyl-CoA pathway via propionyl-CoA carboxylation to ultimately form succinyl-CoA (Carter and Alber 2015) which can then enter central metabolism to fill all precursor metabolite pools. Acetyl-CoA may be formed via the pyruvate dehydrogenase complex and the exclusive use of the 3- hydroxypropionate reductive pathway would require acetyl-CoA formation by pyruvate oxidation (Figure 3). However, lack of evidence to discount the oxidative conversion of

3-hydroxypropionate to acetyl-CoA, which has been described in other organisms

(Giovanelli and Stumpf 1958; Rendina and Coon 1957; Callely and Lloyd 1961; Zhou et

43 al. 2014; Wilson et al. 2017; Otzen et al. 2014; Watson et al. 2016), and a possible role of dddC encoding a putative malonate semialdehyde dehydrogenase, led to this work.

To test the ability of R. sphaeroides to assimilate 3-hydroxypropionate without a functional pyruvate dehydrogenase complex, we isolated the strain RspdhAa2SJC. First, we showed that RspdhAa2SJC was unable to grow with pyruvate which suggests that a viable secondary path converting pyruvate to acetyl-CoA does not exist in R. sphaeroides during photoheterotrophic growth. Therefore, we conclude that the robust 3- hydroxypropionate-dependent growth exhibited by RspdhAa2SJC (Figure 6), with no detectable pyruvate dehydrogenase activity (Table 7), indicated that the formation of acetyl-CoA was occurring by some other path. We propose that R. sphaeroides has a pathway which can be used to generate acetyl-CoA from 3-hydroxypropionate where pyruvate oxidation is not required and attribute it to a 3-hydroxypropionate oxidative pathway.

2.4.2 The gene dddC most likely encodes a malonate semialdehyde dehydrogenase

The screening of the transposon mutant library led to the discovery of rsp_2962 and its possible role in 3-hydroxypropionate assimilation. We, therefore, set out to try to characterize the function of the gene during growth. The protein sequence similarity between R. sphaeroides DddC (RSP_2962) and the characterized methylmalonate semialdehyde dehydrogenases from Bacillus subtilis (Stines-Chaumeil et al. 2006) and rat liver (Goodwin et al. 1989), both shown to catalyze the formation of acetyl-CoA from malonate semialdehyde, provided the first line of evidence for the possible role of DddC as a malonate semialdehyde dehydrogenase. Furthermore, sequence similarity to DddC

44 from the DMSP-cleaving bacterium Halomonas sp. HTNK1 supports a similar function in the context of 3-hydroxypropionate oxidation (Todd et al. 2010). Additionally, the inability of RsdddCMA4 to grow with -alanine as a carbon source, where metabolism involves the presence of a malonate semialdehyde dehydrogenase (Yao et al. 2011;

Waters and Venables 1986; Hayaishi et al. 1961), strongly supports the in vivo function to catalyze the oxidative decarboxylation of malonate semialdehyde. Further, growth with acetate and succinate were unaffected where there is no predicted requirement. While not conclusive, the evidence provided here is consistent and establishes a basis for the in vivo functional characterization of DddC to catalyze the formation of acetyl-CoA from malonate semialdehyde.

2.4.3 Oxidation of 3-hydroxypropionate is a possible alternative pathway to form acetyl-CoA

Considering DddC to be a malonate semialdehyde dehydrogenase, then the inability of RsdddCMA4 to grow with 3-hydroxypropionate suggests that an oxidative pathway functions in R. sphaeroides additional to the reductive pathway (Schneider et al.

2012; Asao and Alber 2014). Furthermore, the proposed 3-hydroxypropionate oxidative pathway most likely is involved in the alternative acetyl-CoA forming pathway used by

RspdhAa2SJC. As shown in Table 6, RspdhAa2SJC has no growth defect with - alanine, which is consistent with 3-hydroxypropionate growth for RspdhAa2SJC, and suggests that the alternative mechanism to form acetyl-CoA involves steps that are shared between the two assimilation pathways. However, there is no evidence yet to connect the ability of RspdhAa2SJC to grow with 3-hydroxypropionate and the presence of

45 malonate semialdehyde dehydrogenase as part of the proposed 3-hydroxypropionate oxidative path.

2.4.4 Possible regulation of the pyruvate dehydrogenase complex during acetate growth

The pyruvate dehydrogenase complex activity in acetate-grown cell extracts was

4-fold lower than that detected in pyruvate or 3-hydroxypropionate grown cells (Table 7).

Higher levels of acetyl-CoA would be expected during growth with acetate which would inhibit catalysis of the pyruvate dehydrogenase complex by product inhibition, however, breakage of the cells and subsequent dilution to prepare the extract most likely would not allow such a difference to be measured. Rather, we suspect that R. sphaeroides has another layer of regulation to control the expression of the genes similar to E. coli.

Increased pyruvate levels have been shown to induce pyruvate dehydrogenase complex activity in E. coli (Dietrich and Hennin 1970) while the GntR-type transcriptional repressor, PdhR, has been shown to de-repress expression of the pdh operon in the presence of pyruvate (Quail and Guest 1995). No similar system has been studied in R. sphaeroides, however, a homolog of PdhR is encoded by rsp_3893 sharing 39 % amino acid identity with the E. coli protein. In R. sphaeroides, pyruvate levels may also be sensed leading to transcriptional repression of the pdh operon during acetate growth. If so, this would suggest that pyruvate levels are elevated during 3-hydroxypropionate growth, compared to acetate growth, considering the high pyruvate dehydrogenase activity in the 3-hydroxypropionate grown cells (Table 7). This increased level of pyruvate could be attributed to the use of the reductive pathway. As further support of this is the slight increase in doubling time for RspdhAa2SJC when grown with 3- 46 hydroxypropionate, which indicates that the pyruvate dehydrogenase complex does contribute to acetyl-CoA formation to some extent.

Most likely, both, the reductive pathway and the oxidative pathway are used simultaneously for 3-hydroxypropionate assimilation, possibly to balance the pools of electron carriers. The reductive pathway oxidizes NADPH (Asao and Alber 2013; Figure

3) while the proposed oxidative pathway would most likely reduce NAD+ (Stines-

Chameil et al. 2006) and an additional electron acceptor used by the 3-hydroxypropionate dehydrogenase (Figure 3). A requirement for both to occur could explain why blockage of either one leads to 3-hydroxypropionate growth inhibition (Figure 4; Figure 21).

2.4.5 The in-frame inactivation strains of the ethylmalonyl-CoA pathway cannot assimilate acetyl-CoA

The ethylmalonyl-CoA pathway serves as an anaplerotic pathway to replenish the

C4-intermediates of the tricarboxylic acid cycle (Erb et al. 2009). Therefore, blockage of the pathway inhibits assimilation of these carbon substrates and growth cannot occur.

While R. sphaeroides ethylmalonyl-CoA pathway insertion mutants have been characterized for acetate growth (Alber et al. 2006; Erb et al. 2008; Erb et al. 2009b; Erb et al. 2010; Schneider et al. 2012) and known to require the ethylmalonyl-CoA pathway, the inactivation strains presented here have not. Applying this method to acetate assimilation, it is clear the ethylmalonyl-CoA pathway mutants cannot grow, however, they do exhibit a more severe inhibition as the blockage in the pathway becomes later.

This same phenomenon occurs for 3-hydropropionate growth and was shown to be due to an accumulation of the pathway intermediates that most likely decreases the free coenzyme A pool (Chapter 3). The non-exponential increase in OD578nm in Rsccr23KB, 47

Rsecm49KB, and Rsmcd11KB is potentially due to the production of the carbon storage compound polyhydroxybutryate (PHB), which shares the initial steps of the ethylmalonyl-CoA pathway (Figure 3) and is known to cause OD increases that do not reflect cell doubling (Lagares et al. 2017).

2.4.6 -Alanine enters central carbon metabolism at the level of acetyl-CoA in R. sphaeroides and requires the ethylmalonyl-CoA pathway for assimilation

-Alanine assimilation has been shown to proceed via a transamination reaction where the amino group is transferred to pyruvate forming L-alanine and malonate semialdehyde followed by the oxidative decarboxylation of malonate semialdehyde to acetyl-CoA and CO2 (Figure 3) (Hayaishi et al. 1961; Yamada and Jakoby 1960; Waters and Venables 1986). Formation of acetyl-CoA from -alanine would indicate a requirement for the ethylmalonyl-CoA pathway. As such, growth was clearly abolished in the multiple strains with a blocked ethylmalonyl-CoA pathway (Figure 5).

Furthermore, entry into central metabolism at the level of acetyl-CoA, similar to acetate, would imply that the pyruvate dehydrogenase complex is not required for growth with - alanine which is shown to be the case with RspdhAa2SJC (Table 4).

Interestingly, however, discussion on unpublished results by Hayaishi et al.

(1961) indicated that constitutive generation of 3-hydroxypropionate could also be detected during -alanine assimilation, which could suggest that, for R. sphaeroides, flux through the reductive path could occur to some small degree as well. The 3- hydroxypropionate dehydrogenase has not been characterized in R. sphaeroides, however, preliminary work in the laboratory is underway investigating a possible

48 candidate gene. While -alanine growth results suggest a major role of the ethylmalonyl-

CoA pathway via acetyl-CoA entry into central carbon metabolism, further work with the substrate could provide insight to the relationship between the reductive path and the proposed oxidative pathway.

2.5 Future Directions

While mutant growth phenotypes provided a basis for the functional characterization of DddC in vivo, characterization of the enzyme in vitro would confirm the ability to catalyze the oxidative decarboxylation of malonate semialdehyde.

Additionally, detection of malonate semialdehyde dehydrogenase activity during 3- hydroxypropionate and beta-alanine growth, especially in pdhAa2SJC, will further support a participatory role in the alternative pathway. Finally, further identification and characterization of the genes/encoded enzymes of the putative oxidative path should be performed as surmounting evidence supports its existence and potential role during 3- hydroxypropionate assimilation. This would include identification of the 3- hydroxypropionate dehydrogenase, though, multiple enzymes could play a role due to substrate promiscuity amongst dehydrogenases. While it is interesting to consider the presence of the both the reductive and oxidative pathways operating in R. sphaeroides, the identity of the oxidative path enzymes and the actual reactions that are catalyzed is needed first.

Chapter 3: Barriers to 3-hydroxypropionate-dependent growth of Rhodobacter sphaeroides by distinct disruptions of the ethylmalonyl-CoA pathway

Contributions to this work: The ethylmalonyl-CoA pathway mutants were generated by Kelsey Baron including the cloning to obtain the inactivation plasmids. The strain RsΔccrΔmch24AF was generated by Angela Fleig. The cloning of plasmids pSC24 and pSC25 was performed by Dr. Birgit Alber who also complemented many of the strains.

3.1 Introduction.

A typical cell contains about fifty percent of carbon per dry weight. The incorporation of carbon derived from a carbon source into cell constituents is referred to as carbon assimilation. Heterotrophs use organic substrates for growth. The fact that organic compounds usually serve in heterotrophs not only as a source of carbon, but also as a source of energy, complicates the study of carbon metabolism and makes it difficult to discern the carbon converted to cell carbon (carbon assimilation) from the carbon that is metabolized to provide energy to the cell. The photoheterotrophic purple non-sulfur

(PNS) bacteria, like Rhodobacter sphaeroides, are notable exceptions to this rule. Being able to use light energy for ATP production and a large variety of organic carbon compounds as a single growth substrate (Imhoff 2015), R. sphaeroides may use all carbon provided for the synthesis of cell constituents. This makes this bacterium an ideal organism to study carbon assimilation. Indeed, light energy conversion occurs at spatially distinct membrane invaginations within the cell, where cyclic electron transport photophosphorylation takes place (Bahatyrova et al. 2004; Sener et al. 2016), whereas 50 carbon assimilation occurs mostly in the cytoplasm. Thus, in photoheterotrophically grown R. sphaeroides, carbon assimilation is conceptually separated from energy metabolism.

Although all carbon provided is available for cell carbon biosynthesis under photoheterotrophic conditions, how much of the carbon is actually assimilated depends on the average oxidation state of the carbon in the substrate compared to the oxidation state of the cellular carbon. If the average carbon in the carbon source is more oxidized compared to the cell carbon (e.g., in L-malate), CO2 is released as a by-product. In contrast, CO2 (or another electron acceptor) has to be provided if the average oxidation state of the carbon substrate is more reduced than that of the cell carbon (e.g., propionate, butyrate) or otherwise the cells will not grow (4). The fact that all electrons have to be accounted for in the conversion of the carbon source to cellular carbon plus possible products is referred to as redox balancing (Richardson et al. 1988; Tichi and Tabita 2001;

McKinlay and Harwood 2010).

Almost 30 years ago, Neidhardt et al. introduced the concept of precursor metabolites in cell growth (1990). Precursor metabolites are intermediates of central carbon metabolism that are the starting points for biosynthetic pathways that ultimately lead to cellular constituents. According to this concept, understanding the assimilation of carbon in a given organism means elucidation of the pathways required for the formation of all precursor metabolites from a given carbon source. These pathways may include peripheral pathways leading to an intermediate, common to other substrates, and intermediate metabolic pathways that ultimately lead into central carbon metabolism

(Fuchs 1999). The entry point into central carbon metabolism determines which further routes are necessary to synthesize all precursor metabolites, including so-called anaplerotic reaction sequences that fill the pools of tricarboxylic acid cycle intermediates.

For example, growth with substrates that enter central carbon metabolism on the level of acetyl-CoA requires a specialized reaction sequence to synthesize malate from acetyl-

CoA, unless a pyruvate synthase is present that catalyses the reversible oxidation of pyruvate. The glyoxylate cycle is used by many organisms for acetyl-CoA assimilation and it is an anaplerotic pathway that converts two molecules of acetyl-CoA to malate

(Kornberg and Krebs 1957). R. sphaeroides does not have a functional glyoxylate cycle but uses the ethylmalonyl-CoA pathway instead (Erb et al. 2007). In this case, three acetyl-CoA and two CO2 molecules are converted to two molecules of malate (Fig. 1B).

R. sphaeroides is able to use 3-hydroxypropionate as the sole carbon source

(Schneider et al. 2012) and we have previously shown that a so-called reductive path via propionyl-CoA is required to convert 3-hydroxypropionate to the central carbon intermediate succinyl-CoA (Fig. 1C). A so-called oxidative path may also operate to provide acetyl-CoA as was suggested for other bacteria (Reisch et al. 2011; Curson et al.

2011); however, that has not been shown in the case of R. sphaeroides and acetyl-CoA may also be formed by the oxidation of pyruvate. As succinyl-CoA does not need to be synthesized from acetyl-CoA, the anaplerotic ethylmalonyl-CoA pathway, refilling the pool of C4-dicarboxylic acids of the tricarboxylic acid cycle, should not be required during growth with 3-hydroxypropionate. Here we show that the ethylmalonyl-CoA pathway is indeed not essential for the assimilation of 3-hydroxypropionate by R.

52 sphaeroides. Nevertheless, there is flux through the pathway and a blockage late in the ethylmalonyl-CoA pathway leads to the build-up of CoA-intermediates that can arrest growth. Our data show that even the blockage of the pathway that is not obligatory under certain conditions may result in growth inhibition. A possible participation of the ethylmalonyl-CoA pathway for redox balancing during 3-hydroxypropionate assimilation by R. sphaeroides is proposed.

3.2 Materials and Methods.

3.2.1 Materials.

3-Hydroxypropionate was purchased from Tokyo Chemical Industries America

(Portland, OR). An aliquot of 25 ml of the 2.8 M 3-hydroxypropionic acid solution was neutralized on ice to a pH between 6.5 – 7.0 using 3 M NaOH (about 23 ml) and diluted to a final concentration of 1 M using ddH2O. Concentrations of the 3-hydroxypropionate stock before and after neutralization/dilution were determined by an enzymatic assay using propionyl-CoA synthase (Schneider et al. 2012). The solution was then filter- sterilized using a low-binding polyethersulfonate 0.22 μM membrane (Millipore) and injected into N2-sparged stoppered screw-capped (Hungate) tubes at volumes between 2 and 5 ml for storage at -20°C. All primers used in the study were obtained from Sigma-

Aldrich (St. Louis, MO) and are listed in Table 10 and Table 11.

3.2.2 Bacterial strains and growth conditions.

Rhodobacter sphaeroides 2.4.1 (DSMZ 158) and its derivative strains were grown anaerobically in the light (3,000 lux) at pH 6.8 and 30°C in minimal media (Alber et al.

2006) (with the exception that 0.5 mg l-1 of cobalt chloride hexahydrate instead of 0.05 mg l-1 was used). The medium was supplemented with 10 mM of the carbon source; for carboxylic acids the sodium salts were used. Media plates included 2.5 % (w/v) agar.

Oxygen in liquid media was removed and replaced with N2 by repeated vacuuming and sparging.

Table 8 Strains used in Chapter 3 Name Relevant characteristics Reference

Escherichia coli DH5α Cloning strain Escherichia coli S17-1 Donor strain for conjugation (kanamycin resistant) Simon et al. (1983) Escherichia coli SM10 Donor strain for conjugation (streptomycin resistant) Simon et al. (1983) Rhodobacter sphaeroides 2.4.1 Wild type DSMZ 158 WT (pBBR) Wild type plus plasmid pBBRsm2(SJC)D This work WT (ccr) Wild type plus plasmid pSC65 Birgit Alber WT (mch) Wild type plus plasmid pSC24 Birgit Alber WT (mch + ccr) Wild type plus plasmid pSC25 Birgit Alber WT (ecm) Wild type plus plasmid pSC94 This work WT (mcd) Wild type plus plasmid pSC97 This work WT (mcl1) Wild type plus plasmid pSC100 This work WT (yciA) Wild type plus plasmid pSC113 This work RsΔccr23KB In-frame deletion of ccr Kelsey Baron RsΔccr23KB (pBBR) In-frame deletion of ccr plus plasmid pBBRsm2(SJC)D Birgit Alber RsΔccr23KB (ccr) In-frame deletion of ccr plus plasmid pSC65 Birgit Alber RsΔmch49KB In-frame deletion of mch Kelsey Baron RsΔmch49KB (pBBR) In-frame deletion of mch plus plasmid pBBRsm2(SJC)D Birgit Alber RsΔmch49KB (mch) In-frame deletion of mch plus plasmid pSC24 Birgit Alber RsΔmch49KB (yciA) In-frame deletion of mch plus plasmid pSC113 This work RsΔccrΔmch24AF In-frame deletion of ccr and mch Angela Fleig RsΔccrΔmch24AF (pBBR) In-frame deletion of ccr and mch plus plasmid pBBRsm2(SJC)D Birgit Alber RsΔccrΔmch24AF (ccr + mch) In-frame deletion of ccr and mch plus plasmid pSC25 Birgit Alber RsΔecm47KB In-frame deletion of ecm Kelsey Baron RsΔecm47KB (pBBR) In-frame deletion of ecm plus plasmid pBBRsm2(SJC)D This work RsΔecm47KB (ecm) In-frame deletion of ecm plus plasmid pSC94 This work RsΔmcd11KB In-frame deletion of mcd Kelsey Baron RsΔmcd11KB (pBBR) In-frame deletion of mcd plus plasmid pBBRsm2(SJC)D This work RsΔmcd11KB (mcd) In-frame deletion of mcd plus plasmid pSC97 This work RsΔmcl1_4KB In-frame deletion of mcl1 Kelsey Baron RsΔmcl1_4KB (pBBR) In-frame deletion of mcl1 plus plasmid pBBRsm2(SJC)D This work RsΔmcl1_4KB (mcl1) In-frame deletion of mcl1 plus plasmid pSC100 This work RsΔmcl1_4KB (yciA) In-frame deletion of mcl1 plus plasmid pSC113 This work

Table 9 Plasmids used in Chapter 3 Name Relevant characteristics Reference pK18mobsacB Conjugation plasmid containing sacB for selection with sucrose Schäfer et al. (1994) pKB4 Inactivation construct for mcd (rsp_1679) Kelsey Baron pKB11 Inactivation construct for mcl1 (rsp_1771) Kelsey Baron pKB15 Inactivation construct for ccr (rsp_0960) Kelsey Baron pKB22 Inactivation construct for ecm (rsp_0961) Kelsey Baron pKB23 Inactivation construct for mch (rsp_0973) Kelsey Baron pUC19 General cloning vector New England Biolabs pSC16 rrnB terminator This work pSC19 rrnC terminator This work pBBRsm2MCS5 Low copy, contains streptomycin/spectinomycin resistance cassette Schneider et al. (2012) pBBRsm2(SJC)D “empty vector”, derived from pBBRsm2MCS5, XbaI/SpeI sites removed This work pSC24 Complementation construct for mch (nptII promoter, rrnB terminator) Birgit Alber pSC25 Complementation construct for mch and ccr (nptII promoter – mch – rrnB terminator Birgit Alber – tetA promoter – ccr – rrnC terminator) pSC45 tetA promoter This work pSC54 nptII promoter This work pSC65 Complementation construct for ccr (tetA promoter, rrnC terminator) This work pSC75 rrnB promoter This work pSC94 Complementation construct for ecm (nptII promoter, no terminator) This work pSC97 Complementation construct for mcd (nptII promoter, no terminator) This work pSC100 Complementation construct for mcl1 (nptII promoter, no terminator) This work pSC113 Expression plasmid for yciA (rrnB promoter) This work pCM160_RBS-YciA- Source of yciA Sonntag et al. Ec-Mex (2014)

Table 10 Primers used in Chapter 3 Primer DNA sequence (5′ → 3′)1 Use deltamchup_for1 GAAGAGGATCCTCTAGACCGCCGATTACGGCCATC mch inactivation deltamchup_rev1 GATGGTGGATCCCAGCCGGTAATCCTCGAAG mch inactivation deltamchdown_for1 AGTATGGATCCGGCGTCCTCCTGGATCTC mch inactivation deltamchdown_rev1 GTCTTCAAGCTTCCACGCCACCACGCCGGTG mch inactivation RTmcl2_for1 TATTCCCGGCTCGAAGG genotype RsΔmch49KB, RsΔccrΔmch24AF deltamchgenot_rev1 GCGCCCTTTCAGATGATGATGACGG genotype RsΔmch49KB, RsΔccrΔmch24AF deltamchgenot_for1 ACTCTACCGCTACCTGACCGAAGAC genotype RsΔmch49KB, RsΔccrΔmch24AF mchdown_rev2 CGTGAGCTTGGCGTTGAAGA genotype RsΔmch49KB, RsΔccrΔmch24AF mchcomp_for1 CCCGAGACCAAGCTGGGAGACCACCATATGAAGAC Δmch complementation mchcomp_rev1 ATGCGGGCCTGTGATCACAAGCTTGCGCACTAGTGCAGGG Δmch complementation UP_ccr_5' CCGGATGGCCCAGGCATACATCTC ccr inactivation UP_ccr_3' CGACGAGCCGCGCCTTCATGTAG ccr inactivation delta_KpnI_5' TAGGTACCCCGGATGGCCCAG ccr inactivation delta_ccr_XbaI_3' GTTCTAGACGACGAGCCGCGC ccr inactivation ccrdown_for2 CTCGCCGGGCTTCTCGATCTTG ccr inactivation ccrdown_rev2 CCCTGCATGTCCGAGGTCTTCC ccr inactivation deltaccrdown_for1 GCTAGGTACCTTCGCCGACGTGCTC ccr inactivation deltaccrdown_rev1 AGAGAATTCACCTGAGCGCCCTTGATG ccr inactivation genotccrup_2 ATCGCGACATAGGCGAGGCGTTTCC genotype RsΔccr23KB deltaecmup_rev1 GCCAGGCGGTACCCTTCTGGGTCATGGCAAG genotype RsΔccr23KB genotccrdown_2 CGATCGAGGCCGGCATCACATTC genotype RsΔccr23KB ccrgeno_for3 CGCTCAGCACGTCGAGGATCCAGTC genotype RsΔccr23KB RSccrcomp_SpeI_F2 AGCTCGGTACCACGGCGACTAGTACTTGCGGATCGCTC Δccr complementation RSccrcomp_NdeI_R2 ACAGGAGGCACATATGGCCCTCGACGTGCAGAGC Δccr complementation deltaecmup_for1 TCAACTGGTTGGTACCCGACGCCTGCTTGAG ecm inactivation deltaecmup_rev1 GCCAGGCGGTACCCTTCTGGGTCATGGCAAG ecm inactivation deltaecmdown_for1 TTCGAGCTGAACGGTACCATGATGGATATCGTGGGTC ecm inactivation deltaecmdown_rev1 GGCTGGAAGCTTTGGCGCTCGGCCATTTG ecm inactivation ecmmtantup_for1 GGGCTTGTGCTGGTTTCTGTACATCTTC genotype RsΔecm47KB ecmmtantup_rev1 GCCGGGACGCGAGGGATCCTATTC genotype RsΔecm47KB ecmmtantdown_for1 CGCATAAATGCGACATGCAGCAATATCC genotype RsΔecm47KB ecmmutantdown_rev1 GGACCAAGATGACCGCCGAACTCAC genotype RsΔecm47KB ecm_compSJC_F GAGTGGAGTCCCCTTCATATGACCCAGAAGGATAG Δecm complementation ecm_compSJC_R GATCGGCCAAGGTACCCGGGACTAGTGGGATCCTATTC Δecm complementation delta_EcoRIXbaI_5' ATGAATTCTAGAAGCCGAACCCGAGATCTATGCCAC mcd inactivation deltamcd_KpnI_3' ATAGGTACCGGTCATGGTCGATCCGTCCTTC mcd inactivation deltamcd_KpnI-5' ATAGGTACCGCGCTGGAATATCAGATCAGCC mcd inactivation deltamcd_XbaI_3' TACTCTAGAACTGCCCTACCAGCTCACCGTC mcd inactivation

Restriction endonuclease recognition sites are italicized

Table 11 Primers used in Chapter 3, continued Primer DNA sequence (5′ → 3′)1 Use deltamcdPCRdown_rev1 GCTGCTACGCCAAGACGATCAATCTC genotype RsΔmcd11KB deltamcdgenot_for1 ATCTCCGCTGGGAGATGCGTCTCTTG genotype RsΔmcd11KB mcddown_for2 CCCTGGTTCTATCCCGAGGAC genotype RsΔmcd11KB deltamcdgenot_rev1 ATGACCGCCACATCGAATTGAGAGC genotype RsΔmcd11KB mcd_compSJC_F ACGCCATGCCGAAGGACGGATCGCATATGACC Δmcd complementation mcd_compSJC_R TGGTACCTACTAGTCGGCCCGTCAGTCCAG Δmcd complementation deltamcl1up_for1 CCGTCATCTAGAGCACCCGCGATTCGGTG mcl1 inactivation deltamcl1up_rev1 AGGCGGCGCATGCTGAAGGCGGAAGCTCATG mcl1 inactivation deltamcl1down_for1 GCGGCGATGCATGCGGCCAAGGCGAGGGGCGAG mcl1 inactivation deltamcl1down_rev1 CGCCCGAGCAAGCTTCGCCGATCACCACCGCCACC mcl1 inactivation deltamcdPCRdown_rev1 GCTGCTACGCCAAGACGATCAATCTC genotype RsΔmcd11KB mcl1up_for2 CGGCAGCAGGGTCTGGAGATCG genotype RsΔmcl1_4KB mcl1PCRup_rev1 GCATGATCGGCGTCTATTGGGACAACC genotype RsΔmcl1_4KB mcl1PCRdown_for1 GCGGCTTCCGCAATTATCTTCGCAG genotype RsΔmcl1_4KB mcl1PCRdown_rev1 TCTTCTCGGCATCCTTCCACAGGATCG genotype RsΔmcl1_4KB mcl1_compSJC_F TTGCCGAGAGACCATATGAGCTTCCGCCTTC Δmcl1 complementation mcl1_compSJC_R TGCCTCCCAAGGTACCGCAGCACTAGTATGACTCAG Δmcl1 complementation PnptII_F1:5’ GTGGGCTTACATGGCGAAAGCTTGACTGGGCGGTTTTCTAGACAGC pSC54 (nptII promoter) PnptII_R1: 5’ AATCCATCTTGTTCACATATGCGAAACGATCCTCATCC pSC54 (nptII promoter) cp_PtetAacuI_ F TCGGGCTTTGTTAGCAGCCGGTACCACTAGTCATACCGCGCTCTC pSC45 (tetA promoter) cp_PtetAacuI_ R ACTCACTATAGGGCGAATTTGAGCTCCACCGCGAAGCTTGCCGCTC pSC45 (tetA promoter) rrnB_promoter_Up AGGCTCGGGCGGCCGTCTAGATGGGGTCTCTG pSC75 (rrnB promoter) rrnB_promoter_Dn AGCCATATGGTCCTCCTGTACTTCAATTGTCGCGGCCGACGTTTC pSC75 (rrnB promoter) rrnB_terminator_F1 GAAGGCCGCAGGTTCAAAGCTTGCCCCCGCTCTAGAATTAACGC pSC16 (rrnB terminator) rrnB_terminator_R1 ACGCCTCACAACGCGGTACCTTCCACGGATCGACTAGTAGCTTTC pSC16 (rrnB terminator) rrnC_terminator_F1 TGAAGGCCGCAAGCTTAAATCCTGCCCCCGCATCTAGAATCCTGTC pSC19 (rrnC terminator) rrnC_terminator_R1 CCGTAGCGCGGTACCAGGAGGCTACTAGTGGGCTGATCAAG pSC19 (rrnC terminator) yciA_F ACCCCATATGTCGACCACCCACAAC pSC113 (yciA expression) yciA_R GCCAGTGAATTCGCTGAACTAGTATGGTCACTC pSC113 (yciA expression) Restriction endonuclease recognition sites are italicized

Growth in liquid cultures was estimated based on the optical density (OD) at 578 nm.

For growth studies, cell were pre-grown anaerobically in 5 ml minimal medium containing 10 mM sodium succinate (OD578nm ~ 1.5), and 0.1 ml of cells, that were in stationary phase for about 5 to 10 hours, were transferred into Hungate tubes with 4 ml minimal medium and the appropriate carbon source (initial OD578nm 0.03 – 0.05). R. sphaeroides strains carrying plasmids were grown in the presence of 25 μg ml-1 spectinomycin. Media used for the isolation of single crossover mutant strains contained 57 of kanamycin (20 μg ml-1). Escherichia coli strains DH5α, S17-1, and SM10 were grown in lysogeny broth (LB) at 37 °C with ampicillin (100 μg ml-1), spectinomycin (50 μg ml-

1) or kanamycin (50 μg ml-1) as needed.

3.2.3 Construction of the marker-less in frame deletions and complementation.

The suicide plasmid pKB23 employed for the marker-less in frame deletion of mch (rsp_0973) was constructed by amplifying 42 bp of the 5’ mch coding region plus

1,445 bp directly upstream (primers: deltamchup_for1/rev1) and 45 bp of the 3’ coding region plus 1,546 bp directly downstream (primers: deltamchdown_for1/rev1) of mch by polymerase chain reaction (PCR) and cloning the products in tandem into pK18mobsacB

(Schafer et al. 1994). The resulting plasmid pKB23 contains an in-frame deletion of mch of 942 bp. The remaining open reading frame encodes a 30-amino acid peptide.

The suicide plasmid pKB15 employed for the marker-less in frame deletion of ccr

(rsp_0960) was constructed by amplifying 123 bp of the 5’ ccr coding region plus 1,497 bp directly upstream (nested PCR using primers: UP_ccr_5'/3' and delta_KpnI_5'/ delta_ccr_XbaI_3') and 36 bp of the 3’ ccr coding region plus 1,483 bp directly downstream (nested PCR using primers: ccrdown_for2/rev2 and deltaccrdown_for1/rev1) of ccr by PCR and cloning the products in tandem into pK18mobsacB. The resulting plasmid pKB15 contains an in-frame deletion of ccr of 1,131 bp. The remaining open reading frame encodes a 54-amino acid peptide.

The suicide plasmid pKB22 employed for the marker-less in frame deletion of ecm (rsp_0961) was constructed by amplifying 12 bp of the 5’ ecm coding region plus

1,434 bp directly upstream (primers: deltaecmup_for1/rev1) and 51 bp of the 3’ coding

58 region plus 1,773 bp directly downstream (deltecmdown_for1/rev1) of ecm by PCR and cloning the products in tandem into pK18mobsacB. The resulting plasmid pKB22 contains an in-frame deletion of ecm of 1,896 bp. The remaining open reading frame encodes a 22-amino acid peptide.

The suicide plasmid pKB4 employed for the marker-less in frame deletion of mcd

(rsp_1679) was constructed by amplifying 6 bp of the 5’ mcd coding region plus 1,487 bp directly upstream (primers: Δmcd_EcoRI/XbaI_5’, Δmcd_KpnI_3’) and 111 bp of the 3’ coding region plus 1,439 bp directly downstream (deltamcd_KpnI-5', deltamcd_XbaI_3') of mcd by PCR and cloning the products in tandem into pK18mobsacB. The resulting plasmid pKB4 contains an in-frame deletion of mcd of 1,530 bp. The remaining open reading frame encodes a 40-amino acid peptide.

The suicide plasmid pKB11 employed for the marker-less in frame deletion of mcl1 (rsp_1771) was constructed by amplifying 18 bp of the 5’ mcl1 coding region plus

1,460 bp directly upstream (primers: deltamcl1up_for1/rev1) and 111 bp of the 3’ coding region plus 1,367 bp directly downstream (deltamcl1down_for1/rev1) of mcl1 by PCR and cloning the products in tandem into pK18mobsacB. The resulting plasmid pKB11 contains an in-frame deletion of mcl1 of 823 bp. The remaining open reading frame encodes a 44-amino acid peptide.

The mutant strains RsΔmch49KB, RsΔccr23KB, RsΔecm47KB, RsΔmcd11KB,

RsΔmcl1_4KB were generated by mating R. sphaeroides 2.4.1 with E. coli S17-1 transformed with the respective suicide plasmid and single and double crossovers were isolated as described previously (Carter and Alber 2015). The double mutant

RsΔccrΔmch24AF was isolated by mating RsΔccr23KB with E. coli S17-1 transformed with pKB23. The resulting mutant strains were genotyped by sequencing PCR products derived from chromosomal DNA and primers (listed in Table S1) that amplified the entire flanking regions where crossovers may have occurred.

For complementation studies, pBBR1MCS-derived plasmids (Kovach 1994) and the BioBrick method (Shetty et al. 2008) were used. The restriction sites XbaI and SpeI were removed from pBBRsm2MCS5 (Schneider et al. 2012) by cutting the plasmid with

XbaI/SpeI and self-ligating the product to obtain pBBRsm2(SJC)D.

For complementation of the RsΔmch49KB mutant, a 1,116 bp fragment was amplified from R. sphaeroides 2.4.1 genomic DNA with primers mchcomp_for1/rev1 and inserted into pSC54. pBBRsm2(SJC)D-derived pSC54 is the source for the nptII promoter, which was obtained using primers PnptII_F1:5’/R1:5’ and plasmid pK18mobsacB as the template. The rrnB terminator was added by inserting the

KpnI/XbaI fragment of pSC16 to obtain pSC24. pSC16 was constructed by ligating the

294 bp downstream region of one of the two 23S rRNA genes present in R. sphaeroides

(Dryden and Kaplan 1993) (primers rrnB_terminator_F1/R1, template: R. sphaeroides

2.4.1 genomic DNA) into pUC19.

For complementation of the RsΔccr23KB mutant, a 1,347 bp fragment was amplified with primers RSccrcomp_SpeI_F2/NdeI_R2 and inserted into pUC19 using

KpnI/NdeI restriction sites. To the resulting plasmid, the rrnC terminator was added by inserting a KpnI/XbaI fragment of pSC19. pSC19 was constructed by ligating the 294 bp downstream region of the second 23S rRNA gene (primers rrnC_terminator_F1/R1,

60 template: R. sphaeroides 2.4.1 genomic DNA) into pUC19. Finally, the KpnI/NdeI fragment of the resulting plasmid was added to plasmid pSC45 resulting in pSC65. pBBRsm2(SJC)D-derived pSC45 is the source for the tetA promoter and was constructed using primers cp_PtetAacuI_ F/R and plasmid pMA5-1 (Asao and Alber 2013) as the template.

For complementation of the RsΔecm47KB mutant, a 2,009 bp fragment was amplified with primers ecm_compSJC_F/_R and inserted into KpnI/NdeI-cut pSC54 to obtain pSC94.

For complementation of the RsΔmcd11KB mutant, a 1,694 bp fragment was amplified with primers mcd_compSJC_F/_R and inserted into KpnI/NdeI-cut pSC54 to obtain pSC97.

For complementation of the RsΔmcl1_4KB mutant, a 1,004bp fragment was amplified with primers mcl1_compSJC_F/_R and inserted into KpnI/NdeI-cut pSC54 to obtain pSC100.

For complementation of the RsΔccrΔmch24AF mutant, the KpnI/XbaI fragment of pSC65 into SpeI/KpnI-cut pSC24 to obtain pSC25. The expression of the ccr gene is driven by the tetA promoter and that of the mch gene by the nptII promoter.

For expression of the thioesterase YciA from E. coli, the yciA gene was amplified using primers yciA_F/_R and pCM160_RBS-YciA-Ec-Mex as a template (a kind gift by

M. Buchhaupt). The 433 bp product was cloned into pSC75 to obtain plasmid pSC113. pSC75 is the source of the rrnB promoter (Dryden and Kaplan 1993) and was constructed

61 using primers rrnB_promoter_Up/Dn and chromosomal R. sphaeroides 2.4.1 DNA as the template.

The pBBRsm2(SJC)D plasmid (empty vector control), pSC24, pSC25, pSC65, pSC94, pSC97, pSC100, and pSC113 were independently transferred to wild type,

RsΔmch49KB, RsΔccr23KB, RsΔccrΔmch24AF, RsΔecm47KB, RsΔmcd11KB, and

RsΔmcl1_4KB by mating the R. sphaeroides strains with E. coli SM10 transformed with the respective plasmid. All plasmids and strains used in this study are listed in Table 8 and Table 9.

3.2.4 Product analysis by High Performance Liquid Chromatography (HPLC).

For the detection and quantification of organic acids present in the spent media as a result of photoheterotrophic growth of R. sphaeroides, samples (0.6 ml) were taken at different time points during growth, centrifuged at 16,000 × g for 3 min to remove the cells, and 0.5 ml of the supernatant was frozen at –20 ⁰C until further analysis. Samples were thawed and centrifuged at 16,000 × g for 3 min. The supernatant (100 – 150 μl) were acidified by adding 3 M sulfuric acid to a final concentration of 0.03 M, and centrifuged at 16,000 × g for 3 min and the supernatant (30 – 100 μl) was used for analysis. Organic acids were analyzed on a Shimadzu Prominence HPLC system with dual wavelength detection (210 and 230 nm) using two different columns.

Ion exclusion HPLC was performed using a RezexTM ROA-Organic Acid H+ (8 %) 250

× 4.6 mm (Phenomenex) column that was preceded by a Carbo-H+ cartridge. Organic acids were separated isocratically in 2.5 mM sulfuric acid at 60 ⁰C with a flow rate of 0.5 ml min-1. Peak retention times (min) for known standards of the following organic acids

62 were determined: phosphoenolpyruvic (4.0), 3-phosphoglyceric (4.1), oxalic (4.1), pyruvic (4.2), citric (4.6), glyoxylic (5.3), (3S)-malic (5.3), succinic (5.9), ethylmalonic

(6.0), methylsuccinic (6.3), (S)-lactic (6.4), 3-hydroxypropionic (6.5), (R)-3- hydroxybutyric (6.5), acetoacetic (6.6), acetic (7.0), mesaconic (7.3), propionic (7.9), butyric (9.1), and crotonic (10.3). Limits of detection for mesaconic, methylsuccinic, and

3-hydroxypropionic acid were 0.5 μM, 50 μM, and 50 μM, respectively.

Because there was an overlap of the 3-hydroxypropionic acid and methylsuccinic acid peaks for the ion exclusion column, reversed-phase HPLC was performed using an

Alltima 5 μm C18 250 x 4.6 mm column (Hichrom) preceded by an Alltima 5 μm C18 guard cartridge to determine methylsuccinic acid concentrations. Organic acids were separated via a gradient between buffer B (80 % ACN/20 % 0.1 % phosphoric acid, pH

2.5) and buffer A (0.1 % phosphoric acid, pH 2.5) at 30 C with a flow rate of 0.8 ml min-1. The gradient was as follows: 0.06 % B for 6 min, 0.06 % B to 40 % B for 35 min,

40 % B to 75 % B for 5 min, 75 % B to 0.06 % B for 7 min, and 0.06 % B for 12 min to re-equilibrate the column. Retention times (min) of acid standards that were analyzed are as follows: 3-hydroxypropionic (7.5), mesaconic (22.3), and methylsuccinic acid (23.8).

3.2.5 Gas Chromatography CO2 detection.

Quantification of CO2 present in the headspace and liquid growth cultures was performed by Gas Chromatography (GC) using a splitless Shimadzu GC-14A with a thermal conductivity detector. All syringes and centrifuge tubes were stored in an N2- filled chamber prior to use to ensure no CO2 was introduced during sampling. The headspace was directly sampled from the growth culture bottles. To determine dissolved

CO2 in the growth media, 1.5 ml of the culture was withdrawn, the cells were removed by centrifugation at 16,000 × g for 3 min, 1 ml of the supernatant was injected into a N2- sparged stoppered screw-capped Hungate tube containing 0.2 ml 37 % hydrochloric acid, and intermittently shaken for 1 hour. One milliliter of the headspace was applied to a

60/80 Carboxen-1000 column (Supelco) using helium carrier gas at 190 ⁰C column temperature. A CO2 standard curve was generated by acidifying known amounts of solid sodium bicarbonate (0.3 – 1.5 mg) with 1 ml 37 % hydrochloric acid in N2-sparged

Hungate tubes and sampling of the headspace. Retention time for CO2 was 7.8 min. The limit of detection for CO2 was 4 μM.

3.2.6 Determination of the dry weight.

To determine cell dry mass, the cells from 50 ml of the growth culture were collected by centrifugation at 13,000 × g for 5 min and washed three times with deionized water. The resulting cell pellets were lyophilized overnight and the masses determined using an analytical balance. The analysis was performed in triplicates.

3.3 Results.

3.3.1 Blocking a step in an unnecessary path matters.

Crotonyl-CoA carboxylase/reductase (Ccr) catalyzes the committed step of the ethylmalonyl-CoA pathway (Fig. 7B). Robust growth of an in-frame ccr deletion mutant with 3-hydroxypropionate as the carbon source seems to support the idea that, under these conditions, the ethylmalonyl-CoA pathway is not essential (Fig. 8A; Table 12).

Surprisingly, however, 3-hydroxypropionate-dependent growth is abolished by a

64 blockage of a later step in the pathway: when most of the coding region of mch, the gene for mesaconyl-CoA hydratase, was deleted no growth was observed (Fig. 8B).

Figure 7 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism. Precursor metabolites are represented in boxes. A) Metabolic scheme showing possible routes by which 3-hydroxypropionate can enter central carbon metabolism at both, the level of acetyl-CoA via an oxidative path and at the level of succinyl-CoA via a reductive path. Acetyl-CoA generated via the oxidative path can be used directly for the synthesis of cell constituents, such as fatty acids, or could enter the ethylmalonyl-CoA pathway. The series of chemical reactions catalyzed by enzymes specific to B) the ethylmalonyl- CoA pathway and C) the reductive 3-hydroxypropionate assimilatory pathway of R. sphaeroides 2.4.1. Abbreviations: AcuI, acrylyl-CoA reductase; Ccr, crotonyl-CoA carboxylase/reductase; Ecm, ethylmalonyl-CoA mutase; Epi, ethylmalonyl- CoA/methylmalonyl-CoA epimerase; Mcd, methylsuccinyl-CoA dehydrogenase; Mch, mesaconyl-CoA hydratase; Mcl1, (3S)-malyl-CoA/β-methylmalyl-CoA lyase; Mcl2, (3S)-malyl-CoA thioesterase; PHA, polyhydroxyalkanoates; CBB Cycle, Calvin-Benson- Bassham cycle or reductive pentose phosphate pathway.

Figure 8 Photoheterotrophic growth of wild type and mutants of Rhodobacter sphaeroides with 3-hydroxypropionate as the carbon source. A) Growth of wild type (filled squares) and RsΔccr23KB (filled triangles▲). B) Growth of RsΔmch49KB (filled triangles▼), RsΔmch49KB (mch) (open triangles) and wild type (mch) (open squares). C) Growth of RsΔccrΔmch24AF (filled circles), RsΔccrΔmch24AF (ccr) (left half-filled circles), RsΔccrΔmch24AF (mch) (right half- filled circles), RsΔccrΔmch24AF (ccr + mch) (open circles). 66

Introducing mch on a plasmid restored growth with 3-hydroxypropionate as the carbon source (Fig. 8B; Table 12). There are at least two possibilities for the apparent conundrum. One possibility is that the ethylmalonyl-CoA pathway is required but another enzyme or other enzymes may bypass the Ccr-catalyzed step in the RsΔccr23KB mutant during 3-hydroxypropionate-dependent growth, although Ccr is essential for growth with acetate (Schneider et al. 2012). Another possibility is that the Mch reaction participates in an additional unknown pathway. Mch (Rsp_0973) has two (R)-specific enoyl-CoA hydratase-like domains and one of the domains may function outside the ethylmalonyl-

CoA pathway during 3-hydroxypropionate-dependent growth. Both possibilities could be ruled out by the following experiment: an in-frame deletion of ccr was introduced into the RsΔmch49KB background and the double mutant regained the ability to grow with 3- hydroxypropinate as the carbon source (Fig. 8C; Table 12). The fact that genes encoding two enzymes of the ethylmalonyl-CoA pathway can be deleted simultaneously and growth with 3-hydroxypropionate as the carbon source is still possible shows that for 3- hydroxypropionate assimilation by R. sphaeroides the ethylmalonyl-CoA pathway is not essential. Reintroducing ccr on a plasmid into the RsΔccrΔmch24AF double mutant again resulted in a no-growth phenotype (Fig. 8C), just like that seen for the

RsΔmch49KB single mutant (Fig. 8B). Therefore, an active Ccr enzyme is required for the mch deletion to exert its no-growth phenotype, suggesting that for the wild type, Ccr is active during growth with 3-hydroxypropoinate, although Ccr activity in cell extracts was below detection limit (< 5 nmol/min/mg) (Schneider et al. 2012).

3.3.2 Gradual decrease in growth by blocking consecutive steps in the ethylmalonyl- CoA pathway.

In order to investigate why a blockage late in the non-essential ethylmalonyl-CoA pathway results in the inability of R. sphaeroides to use 3-hydroxypropionate, genes encoding enzymes catalyzing consecutive steps of the ethylmalonyl-CoA pathway were deleted. Ethylmalonyl-CoA epimerase (Epi) was not investigated because the enzyme also catalyzes the epimerization of (2S)/(2R)-methylmalonyl-CoA, a step required for the reductive route for 3-hydroxypropionate assimilation (Fig. 7) (Schneider et al. 2012).

Ethylmalonyl-CoA mutase (Ecm) (Erb et al. 2008) catalyzes the carbon skeleton rearrangement to form (2S)-methylsuccinyl-CoA which then is oxidized by methylsuccinyl-CoA dehydrogenase (Mcd) (Erb et al. 2009) to mesaconyl-CoA, the substrate of Mch (Zarzycki et al. 2008) (Fig. 7B). The in-frame deletion mutants of both ecm and mcd, resulted in non-exponential 3-hydroxypropionate-dependent growth (Fig.

9). The growth defect was more pronounced for the RsΔmcd11KB mutant compared to the RsΔecm47KB mutant as exemplified with a decrease in apparent growth yield for the mcd disruption mutant (Table 12). An in-frame deletion of mcl1 encoding (3S)-malyl-

CoA/β-methylmalyl-CoA lyase, an enzyme that acts downstream of Mch showed a no- growth phenotype with 3-hydroxypropionate, just like the RsΔmch49KB mutant (Fig. 9).

All mutants grew normally with succinate as the carbon source and 3-hydroxypropionate-dependent growth for all mutants was restored by introducing the respective genes in trans (Table 12). The observation that the interruption of consecutive steps in the ethylmalonyl-CoA pathway leads to more pronounced deficiencies in 3- hydroxypropionate-dependent growth the further down in the pathway the blockage 68

Table 12 Photoheterotrophic growth of Rhodobacter sphaeroides 3-hydroxypropionate or succinate as the carbon source Doubling times (hours) Strain 3-hydroxy- succinate propionate Rhodobacter sphaeroides 2.4.1 5.50.6a (1.6)b 3.30.4 WT (pBBR) 6.60.4 3.50.1 WT (ccr) 6.20.5 3.80.3 WT (ecm) 6.30.3 4.00.8 WT (mcd) 6.70.7 3.60.5 WT (mch) 6.70.9 3.70.4 WT (mcl1) 6.30.3 3.60.4 WT (ccr + mch) 6.60.6 3.80.1 WT (yciA) 9.50.4 (1.4) 4.50.3 Rsccr23KB 6.10.4 3.10.3 Rsccr23KB (pBBR) 8.11.2 3.40.3 Rsccr23KB (ccr) 6.21.1 3.20.4 Rsccr23KB (ccr + mch) 7.20.6 3.60 Rsecm47KB N.E. (0.71) 3.80.3 Rsecm47KB (pBBR) N.E. (0.41) 3.70.6 Rsecm47KB (ecm) 6.40.4 3.90.8 Rsmcd11KB N.E. (0.18) 3.70.1 Rsmcd11KB (pBBR) N.E. (0.13) 3.50.2 Rsmcd11KB (mcd) 6.20.7 3.90.8 Rsmch49KB N.G.c 3.10.2 Rsmch49KB (pBBR) N.G. 3.50.2 Rsmch49KB (mch) 6.70.9 3.60.5 Rsmch49KB (ccr + mch) 7.40.9 3.80.1 Rsmch49KB (yciA) 313 (0.29) 4.70.8 Rsmcl1_4KB N.G. 3.70.1 Rsmcl1_4KB (pBBR) N.G. 3.80.4 Rsmcl1_4KB (mcl1) 6.30.6 3.90.6 Rsccrmch24AF 7.50.6 3.30.5 Rsccrmch24AF (pBBR) 8.20.3 3.40.4 Rsccrmch24AF (ccr) N.G. 4.10.4 Rsccrmch24AF (mch) 7.80.9 3.80.2 Rsccrmch24AF (ccr + mch) 6.80.3 3.70.4 aStandard deviation calculated using three or more biological replicates

b N.E. = non-exponential growth (the average OD578 nm after 100 hrs of growth is given in parentheses) cN.G. = no growth

Figure 9 Photoheterotrophic growth of wild-type Rhodobacter sphaeroides and mutants, affecting the ethylmalonyl-CoA pathway, with 3-hydroxypropionate as the carbon source. Growth of wild type (squares), RsΔccr23KB (▲), RsΔecm47KB (stars), RsΔmcd11KB (hexagon), RsΔmch49KB (▼), and RsΔmcl1_4KB (diamonds). The growth of all mutants was restored by the introduction of the corresponding gene that had been deleted from the chromosome, on a plasmid (Table 1).

occurs is consistent with the idea that there is a buildup of intermediates that ultimately leads to complete growth inhibition.

3.3.3 The introduction of a thioesterase rescues 3-hydroxypropionate-dependent growth of ethylmalonyl-CoA pathway mutants.

All intermediates of the ethylmalonyl-CoA pathway are CoA-esters (Fig. 7B).

One possibility to prevent the buildup of intermediates of the pathway upon blockage at a late step, and possibly avoid the depletion of the free coenzyme A pool, is to delete ccr and, therefore, prevent any flux through the pathway in the first place (Fig. 7; Fig. 8C). In principle, another possibility would be the hydrolysis of the CoA-ester intermediates inside the cell to relieve growth inhibition. In order to test this possibility the thioesterase

YciA was introduced into the two R. sphaeroides mutants that showed no growth with 3- hydroxypropionate, RsΔmch49KB and RsΔmcl1_4KB. The thioesterase YciA has been shown to hydrolyze several CoA-intermediates of the ethylmalonyl-CoA pathway to form the corresponding acids and free CoA (Sonntag et al. 2014). The expression of the yciA gene indeed rescued the growth of both mutants (Fig. 10), consistent with the idea that

CoA depletion was the cause of the observed growth inhibition.

Figure 10 Rescue of photoheterotrophic growth of the RsΔmch49KB and RsΔmcl1_4KB mutants with 3-hydroxypropionate, by expression of the yciA gene, encoding a thioesterase. RsΔmch49KB (yciA) (open triangle), RsΔmcl1_4KB (yciA) (open diamonds), and wild type (yciA) (open squares).

3.3.4 Excretion of organic acids by strains of R. sphaeroides.

Although 3-hydroxypropionate-dependent growth of the RsΔmch49KB (yciA) and

RsΔmcl1_4KB (yciA) strains was restored, compared to the mutants not carrying the thioesterase-encoding gene, the growth rate but also the growth yield of the

RsΔmch49KB (yciA) strain was significantly lower compared to the wild-type (yciA) strain (Fig. 10; Table 12). In the defined medium used, growth of the wild-type strain

71 ceased when 3-hydroxypropionate was exhausted (Fig. 11). A decrease in growth yield for the RsΔmch49KB (yciA) strain compared to the wild type suggested that either less of the 3-hydroxypropionate was consumed or not all of the carbon used was made available for cell synthesis. Therefore, the spent growth medium of the RsΔmch49KB (yciA) mutant was analyzed for 3-hydroxypropionate that remained and also for the presence of possible products formed (Fig. 11). Less than one half of the carbon source supplied was consumed by the RsΔmch49KB (yciA) mutant before growth ceased and roughly one fifth of the supplied carbon was assimilated (Table 13). This is in contrast to the wild- type strain for which most of the supplied carbon is assimilated; some CO2 is formed for redox balance, as expected, because the carbon in 3-hydroxypropionate is more oxidized compared to the average cell carbon. Based on the ash-free biomass elemental composition of Rhodopseudomonas palustris, it was estimated that eleven percent of the carbon would be released as CO2 for the wild type (Schneider et al. 2012); here, the determined value of 8.3 percent of CO2 released is in good agreement with the theoretical value (Table 13). For the RsΔmch49KB (yciA) strain, the remaining carbon, that was not assimilated, was recovered in methylsuccinate, mesaconate, and CO2. About one fourth of the supplied carbon was recovered in mesaconate (Table 13), meaning that almost one half of the 3-hydroxypropionate consumed was converted to mesaconate by the

RsΔmch49KB (yciA) mutant strain. Only less than one percent of the supplied carbon was recovered in CO2, consistent with the fact that the average carbon in mesaconate is more oxidized than cell carbon and, therefore, less CO2, as an additional oxidized product, is released to maintain redox balance.

Figure 11 Analysis of organic acids in the spent medium during photoheterotrophic growth of different R. sphaeroides strains with 3-hydroxypropionate as the carbon source. Panel A: Growth of wild-type R. sphaeroides (WT, left) and WT (yciA) (right) was monitored by optical density (squares) and the concentration of 3-hydroxypropionate (gray circles) as well as the production of organic acids were monitored (gray triangles: mesaconate; methylsuccinate was below the detection limit for WT). Panel B: RsΔmch49KB (yciA) growth (open triangles), 3-hydroxypropionate (gray circles), and mesaconate (gray triangles) and methylsuccinate (gray diamonds) production.

Table 13 Carbon balance after photoheterotrophic growth of different strains of Rhodobacter sphaeroides with 3-hydroxypropionate as the carbon source. Organic acids detected in Total supernatantc Carbon a b d Biomass CO2 MS MC 3HP balance Strain (mol carbon / mol starting carbon x 100 %) WT 951e 8.30.2 NDf ND ND 1033 WT (yciA) 922 8.50.1 ND 0.060.02 ND 1012 RsΔmch49KB (yciA) 192 0.90.1 2.00.9 243 562 1022 a Based on 22.4 g cell dry weight /mol C b Headspace CO2 + dissolved supernatant CO2 c After final OD578nm was reached d MS = methylsuccinic acid, MC = mesaconic acid, 3HP = 3-hydroxypropionic acid e Data represents three biological replicates with standard deviation f ND = below the detection limit

Mesaconate and methylsuccinate accumulated during growth, in parallel to 3- hydroxypropionate consumption, for the RsΔmch49KB (yciA) mutant, and apparently both organic acids were not re-consumed (Fig. 11).

3.3.5 Carbon flux through the ethylmalonyl-CoA pathway during growth with 3- hydroxypropionate.

Interestingly, the wild type (yciA) strain also formed mesaconate as a product during 3-hydroxypropionate assimilation (Fig. 11; Table 13). It was, therefore, possible to directly show that carbon flux through the ethylmalonyl-CoA pathway does occur during photoheterotrophic growth of R. sphaeroides with 3-hydroxypropionate as the carbon source.

Figure 12 Comparison of organic acids in the spent medium during photoheterotrophic growth of different R. sphaeroides strains with succinate or 3-hydroxypropionate as the carbon source. Growth of R. sphaeroides strains wild type (), wild type (yciA) (), RsΔmcd11KB (yciA) (), RsΔmch49KB (yciA) (), and RsΔmcl1_4KB (yciA) () with minimal media containing either succinate or 3-hydroxypropionate was measured by optical density and the spent media was analyzed using an ion-exclusion column via HPLC for detection of organic acids at the final time point. Final concentrations of mesaconic (black bars) and methylsuccinic (white bars) acid are shown. The concentrations of the organic acids were determined from a single growth experiment. The limit of detection for mesaconic and methylsuccinic acid was 0.5 M and 50 M, respectively.

3.3.6 Comparison of organic acid excretion when R. sphaeroides strains are grown with succinate versus 3-hydroxypropionate.

Excretion of the organic acids methylsuccinic acid and mesaconic acid by WT

(yciA) and RsΔmch49KB (yciA) was detected when grown with 3-hydroxypropionate with a concomitant decrease in growth yield due to the loss of available carbon for assimilation (Fig. 11). Growth with succinate as the only carbon source, however, did not cause a significant drop in the final OD578nm for any of the mutant strains or wild type expressing yciA (Fig. 12). Therefore, we predicted that no organic acids were being excreted during growth with succinate. As shown in Figure 12, neither methylsuccinic acid nor mesaconic acid could be detected in the mutant or wild type strains expressing yciA when grown with succinate. This contrasted with the results from growth with 3- 75 hydroxypropionate where similar final concentrations of methylsuccinic acid were detected in the spent media amongst the three mutant strains while both RsΔmch49KB

(yciA) and RsΔmcl1_4KB (yciA) excreted 5-fold more mesaconic acid than RsΔmcd4KB

(yciA).

3.4 Discussion.

3.4.1 The ethylmalonyl-CoA pathway is not required for the synthesis of precursor metabolites from 3-hydroxypropionate.

Not only an in-frame ccr deletion mutant but also a mutant which had an additional in-frame deletion of mch, showed robust photoheterotrophic growth with 3- hydroxypropionate (Fig. 8). The conclusion then that the ethylmalonyl-CoA pathway is dispensable for 3-hydroxypropionate assimilation re-emphasizes the requirement for a reductive path via propionyl-CoA for the synthesis of succinate and consequently the precursor metabolite oxaloacetate (Fig. 7) (Schneider et al. 2012). The synthesis of all other precursor metabolites, including acetyl-CoA, may start from tricarboxylic acid cycle C4-intermediates. It is not clear, yet, which specific enzymes are required for the conversion of C4 (either malate or oxaloacetate) to pyruvate or phosphoenolpyruvate

(PEP); the genome of R. sphaeroides encodes two possible malic enzymes and a PEP carboxykinase. Once PEP is formed, all the required C3- to C6-sugar-phosphates are synthesized via gluconeogenesis. Acetyl-CoA may be formed by oxidative decarboxylation of pyruvate by pyruvate dehydrogenase. Another possibility is the formation of acetyl-CoA directly from 3-hydroxypropionate via an oxidative path, possibly involving malonate semialdehyde as an intermediate (Fig. 7). Regardless, if

76 acetyl-CoA is formed via propionyl-CoA, succinyl-CoA, and pyruvate or directly from 3- hydroxypropionate, the overall carbon- and redox-balance is the same:

3-hydroxypropionate + HSCoA  acetyl-CoA + CO2 + 4[H]

The ATP- requirements and most likely also the electron-carrying cofactors, however, would differ between the two routes. An oxidative path leading directly from 3- hydroxypropionate to acetyl-CoA has not been established for R. sphaeroides and the specifics of possible electron-carrying cofactors are not known. In summary, the current metabolic scheme for 3-hydroxypropionate assimilation by R. sphaeroides does not require flux through the ethylmalonyl-CoA pathway in order to synthesize all precursor metabolites.

3.4.2 Coenzyme A pool depletion as the likely cause of growth inhibition by distinct disruptions of the ethylmalonyl-CoA pathway.

The non-growth phenotype with 3-hydroxypropionate of the in-frame mch-only deletion came as a surprise (Fig. 8). Interestingly, the introduction of the YciA thioesterase that acts on several CoA-intermediates of the ethylmalonyl-CoA pathway caused growth recovery for the mch and also the mcl1 mutant (Fig. 9). Furthermore, the growth yield for the mcd mutant improved when yciA was introduced (data not shown).

The free acids of the key intermediates mesaconyl-CoA and methylsuccinyl-CoA were recovered in the spent medium for all three mutants in the presence of YciA (Table 13;

Fig. 11; data not shown). We propose that the growth inhibition is due to the titration of free CoA and depletion of the CoA pool in the cell rather than detrimental effects due to a specific metabolite accumulating and targeting another aspect of metabolism, based on the following observations. There is a gradual decrease in growth by blocking 77 consecutive steps in the ethylmalonyl-CoA pathway (Fig. 9) rather than a point in the pathway at which wild-type growth switches to a non-growth phenotype. Therefore, the growth defect is not due to the deletion of a gene encoding a specific enzyme of the ethylmalonyl-CoA pathway resulting in the accumulation of a specific growth-inhibiting metabolite. Also, replotting the growth data for the in-frame ecm mutant on an arithmetic, instead of a semi-logarithmic scale, reveals a straight line up to 70 hours after inoculation. Linear growth is consistent with the dilution of an essential and stable cofactor for each doubling (Hartl et al. 2017). We conclude that the essential cofactor is coenzyme A that becomes depleted leading to growth inhibition. A similar conclusion was made by Schneider et al. concerning a Methylobacterium extorquens mutant strain

(Schneider et al. 2012). A propionyl-CoA carboxylase deletion strain was initially unable to grow with oxalate after a switch from succinate-containing medium and several CoA- esters accumulated inside the cell, including propionyl-CoA and mesaconyl-CoA and a simultaneous decrease in the free coenzyme A pool was observed; however, growth ensued after the free coenzyme A pool returned to wild type levels even though the accumulation of CoA-esters remained unchanged (Schneider et al. 2012).

3.4.3 Carbon flux through the ethylmalonyl-CoA pathway during photoheterotrophic growth with 3-hydroxypropionate.

The introduction of the YciA thioesterase allows for a very sensitive method to monitor actual carbon flux through the ethylmalonyl-CoA pathway due to the appearance of mesaconate in the spent medium and the high extinction coefficient of mesaconate at

-1 -1 230 nm (ε230nm = 5,500 M cm ) (Teipel et al. 1968). Clearly, this tool can only be used for growth condition where the ethylmalonyl-CoA pathway is not essential, as is the case 78 for 3-hydroxypropionate-dependent growth. However, the extent of the flux through the ethylmalonyl-CoA pathway cannot be quantified by this method because the secretion of free acids depends on the specific activity of the thioesterase in the cell, the pool sizes of the corresponding CoA-intermediates and it also depends on the extent by which the free acids are secreted by the cell or are able to accumulate within the cell. Carbon flux through the ethylmalonyl-CoA pathway during photoheterotrophic growth with 3- hydroxypropionate was demonstrated (Fig. 11B); however, no flux was detected during photoheterotrophic growth with succinate (data not shown).

3.4.4 A possible role for the ethylmalonyl-CoA pathway during 3- hydroxypropionate assimilation.

The fact that carbon flux occurs through the ethylmalonyl-CoA pathway during photoheterotrophic growth with 3-hydroxypropionate may simply mean that it is accidental: under the given conditions the pathway is not completely turned off and, therefore, some acetyl-CoA is diverted through this route. Another possibility is that some flux through the ethylmalonyl-CoA is beneficial during 3-hydroxypropionate- dependent growth which also may explain the slight growth defect observed in the ccr mutant compared to the wild type (Fig. 8A). In order to understand carbon assimilation from a given carbon source, it is not only important to know the nature of the pathways that allow for the synthesis of all precursor metabolites but also the relative quantitative requirements for each precursor metabolite has to be considered. Furthermore, CO2 is an obligate intermediate (CO2 is transiently produced and consumed) in the conversion of 3- hydroxypropionate to all precursor metabolites (Fig. 1); overall though, a defined net amount of CO2 is released from the cell, because the average carbon in 3- 79 hydroxypropionate is more oxidized than the cell carbon. Based on the cellular elemental composition of Rhodopseudomonas palustris (Carlozzi and Sacchi 2001), the net release of CO2 would be eleven percent (0.5 per 4.5 carbons):

1.5 C3H6O3 + 0.72 NH3 → 4 CH1.8N0.18O0.38 + 0.5 CO2 + 1.98 H2O

An actual percentage of 8.3 percent was determined in this study, suggesting that the average cell carbon for R. sphaeroides is slightly more oxidized compared to R. palustris but it is still more reduced than the average carbon in 3-hydroxypropionate. A balanced carbon distribution model at steady state for the central carbon metabolism of R. sphaeroides during photoheterotrophic growth with 3-hydroxypropionate was constructed (Fig. 13). For the relative precursor requirements, values were used that were determined for E. coli grown aerobically with glucose (Neidhardt et al. 1990; Fuchs

1999). If a net release of ten percent CO2 from 3-hydroxypropionate is assumed, the model predicts that less than ten percent of the starting carbon in 3-hydroxypropionate has to pass through the ethylmalonyl-CoA pathway. Specifically for Ccr, only five percent would pass through the Ccr-catalyzed step as predicted by the model (Fig. 13).

Based on the molar growth yield of 60 g dry weight per mole 3-hydroxypropionate consumed (Schneider et al. 2012), a doubling time of 5.5 hours (Table 12), and a five percent carbon flux through the Ccr step, the minimal required Ccr activity would be 3.5 nmol/min/mg. Therefore, the low flux predicted by the model is consistent with a Ccr activity that is less than the detection limit of 5 nmol/min/mg in cell extracts (Schneider et al. 2012); the model, however, is also consistent with the fact that Ccr is active during photoheterotrophic growth with 3-hydroxypropionate as shown here.

The following considerations may shed light on the possible function of the ethylmalonyl-CoA pathway during 3-hydroxypropionate assimilation. At first sight, the ethylmalonyl-CoA pathway seems to be redundant to a reductive path that ultimately also leads to tricarboxylic acid C4-intermediates. The formation of malate from 3- hydroxypropionate by the reductive path via propionyl-CoA can be written as:

3-hydroxypropionate + CO2  malate

In the case of a combination of an oxidative path and the ethylmalonyl-CoA pathway, 3- hydroxypropionate is first oxidized to acetyl-CoA and CO2 is released.

Figure 13 Balanced carbon distribution model for Rhodobacter sphaeroides during photoheterotrophic growth with 3-hydroxypropionate at steady state. The requirement for the relative amounts of precursor metabolites (boxed numbers) are calculated based on E. coli grown aerobically with glucose (Neidhardt et al. 1990, Fuchs 1999). Also considered is the fact that ten percent of the carbon from 3- hydroxypropionate will be released as CO2 (30/300 carbons) based on the cellular elemental composition of Rhodopseudomonas palustris (Carlozzi & Sacchi 2001, Schneider et al. 2012). An actual number of 8.3 percent CO2 released was determined as part of this work. The model predicts that 15/300 carbons (5 percent) pass through the Ccr-catalyzed step. 81

The ethylmalonyl-CoA pathway then converts acetyl-CoA to malate but only reuses a fraction of the CO2, that was initially released by the oxidation of 3-hydroxypropionate to form acetyl-CoA, according to the following equations:

3 × 3-hydroxypropionate + 3 HSCoA  3 acetyl-CoA + 3 CO2 + 12[H]

3 acetyl-CoA + 2 CO2 + 3 H2O  2 malate + 3 HSCoA

3-hydroxypropionate + H2O  ⅔ malate + ⅓ CO2 + 4[H]

The net CO2 (and reductant) released from the conversion of 3-hydroxypropionate via acetyl-CoA can be used by the reductive pathway. We, therefore, propose that during growth with 3-hydroxypropionate, two routes that lead from 3-hydroxypropionate to malate operate simultaneously (i) the reductive path and (ii) an oxidative path via acetyl-

CoA in combination with the ethylmalonyl-CoA pathway. Carbon flux through both routes (one consuming CO2, the other releasing CO2) allows a balance that ensures the precise net amount of CO2 is released from the cell. In the absence of a functional ethylmalonyl-CoA pathway (ccr mutant and ccr-mch double mutant) more acetyl-CoA, than is required for cell carbon biosynthesis, is still likely to be formed in order to supply

CO2 for the reductive path to proceed; however, the surplus of acetyl-CoA and some reductant is now used to form polyhydroxybutyrate. This hypothesis remains to be tested.

3.4.5 The ability of YciA to cause excretion of mesaconic and methylsuccinic acid during 3-hydroxypropionate-dependent growth is not understood

How expression of Escherichia coli yciA, encoding an unspecific thioesterase, in

R. sphaeroides leads to detection of only mesaconate and methylsuccinate in growth media is not understood. YciA was initially characterized in vitro as having broad 82 substrate specificity toward fatty acyl-CoAs of different chain lengths (C2-C10) as well as CoA-thioesters with aromatic and hydroxyl containing side chains (Zhuang et al.

2008). Furthermore, the ability of YciA to catalyze the hydrolysis of ethylmalonyl-CoA pathway-derived thioesters was investigated and the kinetic parameters were compared to five other selected thioesterases from various sources (Sonntag et al. 2014). YciA from E. coli had the highest specific activity of the six enzymes toward ethylmalonyl-CoA (6.2

U/mg), methylmalonyl-CoA (10.6 U/mg), methylsuccinyl-CoA (7.2 U/mg), mesaconyl-

CoA (12.3 U/mg), and methylmalyl-CoA (3.5 U/mg) as substrate though the Km values for three of the five thioesterases were comparable (8 M – 200 M) with two enzymes having Km values that exceeded 1 mM for some of the CoA thioesters (Sonntag et al.

2014). The in vitro characterization showed that YciA catalyzed the hydrolysis of ethylmalonyl-CoA, methylmalonyl-CoA, methylsuccinyl-CoA, mesaconyl-CoA, and

4 4 - methylmalyl-CoA with similar efficiencies (calculated kcat/Km = 1.0 x 10 – 6.4 x 10 M

1s-1). Interestingly, the catalytic efficiency determined for hydrolysis of succinyl-CoA

5 -1 -1 (calculated kcat/Km = 4.4 x 10 M s ) was between 7-fold and 44-fold higher than those determined for the different ethylmalonyl-CoA pathway thioesters listed above. In the same study, the ethylmalonyl-CoA pathway-containing Methylobacterium extorquens was shown to excrete methylsuccinate (58 mg/L or 0.44 mM) and mesaconate (70 mg/L or 0.54 mM) when expressing yciA and grown with methanol while no additional free acids could be detected in the supernatant. Finally, yields of methylsuccinate and mesaconate from methanol by M. extorquens were increased to a combined titer of almost 0.7 g/L by either blocking the synthesis of PHB via deletion of the PHB synthase-

83 encoding gene or decreasing the cobalt ion concentration available in the growth media to decrease the ethylmalonyl-CoA and methylmalonyl-CoA mutase activity (Sonntag et al.

2015). It was proposed that increased flux and/or pool sizes of the ethylmalonyl-CoA pathway intermediates led to the increased excretion of mesaconic acid (3.4 mM) and methylsuccinic acid (1.7 mM) (Sonntag et al. 2015).

Also, an M. extorquens mutant strain lacking a functional Ccr (and therefore a functional ethylmalonyl-CoA pathway) was bioengineered to use the glyoxylate bypass as an alternative way to assimilate acetate for growth. Expression of yciA in the Meccr glyoxylate bypass strain lead to excretion of crotonic acid when grown with acetate minimal media if treated with 3-nitropropionate to inhibit isocitrate lyase and then supplemented with additional acetate (Schada von Borzyskowski et al. 2018).

The in vivo findings for M. extorquens correlate with those for R. sphaeroides presented here as we were only able to detect mesaconic acid and methylsuccinic acid in the spent media. However, a larger ratio of mesaconic acid to methylsuccinic acid was excreted by R. sphaeroides (5:1) as compared to M. extorquens (2:1) (Fig. 11; Fig. 12) which is indicative of the difference in pool sizes of the ethylmalonyl-CoA pathway, the reactivity of YciA inside the two cells, as well as the ability of the organisms to excrete specific acids (or, in the case of M. extorquens, to re-assimilate some acids). The concentrations of the intermediates of the ethylmalonyl-CoA pathway, in either organism, is influenced by how the pathway is integrated within the organism’s metabolism as further discussed below.

3.4.6 Possible explanation for why Rsmcd11KB excretes mesaconate

The Rsmcd11KB mutant lacks the enzyme methylsuccinyl-CoA dehydrogenase which catalyzes the formation of mesaconyl-CoA from methylsuccinyl-CoA. Therefore, we were intrigued by the excretion of mesaconate with the the Rsmcd11KB (yciA) where the formation of mesaconyl-CoA should not be occurring (Fig. 12). However, methylsuccinate has been shown to be a substrate for succinate dehydrogenase catalyzing the formation of mesaconate as the product (Gawron et al. 1962). Therefore, we propose the methylsuccinate formed from methysuccinyl-CoA catalyzed by YciA is then used by succinate dehydrogenase to form mesaconate which is then excreted.

3.4.7 YciA is powerful tool to qualitatively show flux through the ethylmalonyl-CoA pathway

While in vitro kinetic parameters have been determined for YciA using the ethylmalonyl-CoA pathway thioester intermediates as substrates and the amount of free acid excreted by cells expressing yciA can be quantitated, we argue that actual flux through the ethylmalonyl-CoA pathway cannot be determined quantitatively based on product excretion. First, the in vivo activity of YciA will be influenced by actual production levels of the enzyme in the cell. Furthermore, the in vivo activity of YciA will depend on the intracellular conditions including pH, salt concentration, presence of multiple substrates, concentration of the substrates, etc. such that using in vitro kinetic parameters will not accurately represent the activity occurring in the cell. Second, pool sizes of the ethylmalonyl-CoA pathway intermediates are influenced by the thermodynamics of the pathway itself. The relative amounts of intermediates present in the cell will depend on the concentration of necessary co-factors/co-substrates that are 85 influenced by other metabolic processes used in the cell i.e. CO2 and NADPH (for crotonyl-CoA carboxylase/reductase), Co2+ (for ethylmalonyl-CoA mutase), and quinone

(as the possible electron acceptor for methylsuccinyl-CoA dehydrogenase). Also, there is the possibility that the ethylmalonyl-CoA pathway CoA-thioester intermediates are used by other enzymes in the cell operating outside of the pathway which would further influence the pool sizes. Additionally, the removal of the CoA-thioesters via hydrolysis to the free acid has a direct effect on the pool sizes of those CoA-thioesters as compared to the absence of YciA and, therefore, will alter the rate of individual ethylmalonyl-CoA pathway enzymes. Finally, the amount of free acid detected in the media is relative to the ability of the cell to transport it and does not necessarily directly relate to the actual hydrolysis of the CoA-thioester in the cell. Many similar arguments were made by

Sonntag et al., and it was actually demonstrated that changes in the Co2+ concentrations and blocking of PHB synthesis influenced product excretion for M. extorquens (2015). In summary, the excretion of methylsuccinate and mesaconate caused by the presence of

YciA is a powerful tool to qualitatively show that flux through the ethylmalonyl-CoA pathway is occurring but it is impossible to derive an absolute value for flux or relate pool sizes of intermediates by quantifying products formed.

3.5 Suggested future directions

As concluded in this chapter, the evidence indicates that the accumulation of

CoA-thioester intermediates decreases the availability of free coenzyme A. To further support this, the ratio of intracellular free coenzyme A to CoA-thioesters should be

86 quantified at different time points during the growth of Rsecm49KB and Rsmcd11KB with 3-hydroxypropionate as compared to wild type. It would be expected for this ratio to decrease over time in the mutant strains as more and more coenzyme A becomes trapped as CoA-thioester intermediates of the ethylmalonyl-CoA pathway. A directed approach can be used where specific CoA-thioesters are quantified such as 3-hydroxybutyryl-CoA, crotonyl-CoA, ethylmalonyl-CoA, and methylsuccinyl-CoA and compared to free coenzyme A or an indirect approach where free coenzyme A is measured before and after alkaline hydrolysis.

As stated in the discussion, a consequence of blocking the ethylmalonyl-CoA pathway could be the formation of polyhydroxybutyrate. This should be quantified over time during growth with 3-hydroxypropionate and compared between the ccr-negative strain and wild type. The small amount of flux that is predicted to occur through the ethylmalonyl-CoA pathway in wild type would suggest that the increased amount of polyhydroxybutyrate formed would be small as well, therefore, sensitive methods such as quantification by GC should be used.

Chapter 4: A phosphoribulokinase variant restores growth with 3-hydroxypropionate for Rhodobacter sphaeroides mutants by altering carbon flux through the ethylmalonyl-CoA pathway

Contributions to this work: Sequencing was performed by facilities on The Ohio State University-Columbus campus as cited in the Methods.

4.1 Introduction

Metabolic perturbations to the bacterial cell require adjustments. Rhodobacter sphaeroides, a purple non-sulfur bacterium highly regarded for its metabolic versatility, contains an extensive repertoire of enzymes providing the ability to adapt to changes in its environment. Capable of utilizing a diverse set of organic carbon substrates (Imhoff

2015) for, both, photoheterotrophic and chemoheterotrophic growth, it also has two operons encoding separate sets of enzymes of the Calvin-Benson-Bassam (CBB) reductive pentose phosphate cycle allowing for CO2 fixation. These operons, termed cbbI and cbbII, are differentially expressed depending on the conditions (Dangel and Tabita

2015; Dubbs and Tabita 2004) and encode functionally distinct isozymes (Novak and

Tabita 1999; Badger and Bek 2008). During chemoheterotrophic growth, carbon must be used for, both, the production of biomass and energy conservation. For energy, the carbon substrate can be oxidized to CO2 involving the tricarboxylic acid (TCA) cycle in order to obtain reduced electron carriers, such as NADH, which is then re-oxidized to

NAD+ by the enzymes of the electron transport chain. This provides the necessary electrons and protons to generate a proton motive force for ATP formation via oxidative 88 phosphorylation. However, for photoheterotrophic growth, ATP is generated via cyclic photophosphorylation, whereby electrons are recycled and no carbon is oxidized. R. sphaeroides can use the carbon entirely for biomass, but the cell must find a way to re- oxidize NADH to provide NAD+ for enzymatic steps used in pathways during cellular growth (Laguna et al. 2011). In this way, the CBB cycle is necessary for photoheterotrophic growth in R. sphaeroides. Glyceraldehyde-3-phosphate dehydrogenase oxidizes NADH to NAD+ to form glyceraldehyde-3-phosphate from 1,3- bisphosphoglycerate. From there, multiple enzymes are used to regenerate ribulose-1,5- bisphosphate whereby CO2 is catalytically added by ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) to form two molecules of 3-phosphoglycerate (Tabita

1988). Therefore, the concerted effort of the entire CBB cycle maintains the proper ratio

+ of NAD /NADH as CO2 ultimately serves as the electron acceptor. Indeed, loss of the

CBB cycle in purple non-sulfur bacteria such as Rhodobacter capsulatus and R. sphaeroides leads to strains unable to grow photoheterotrophically unless mutations are acquired which turn on NADH-consuming systems, such as nitrogen fixation (McKinlay and Harwood 2010; Biegel et al. 2011), so that the proper balance of NAD+/NADH is restored (Tichi and Tabita 2001).

As part of the CBB cycle, phosphoribulokinase, Prk, provides the substrate for

RubisCO by catalyzing the ATP-dependent phosphorylation of ribulose-5-phosphate. In

R. sphaeroides, ribulose-1,5-bisphosphate also serves as an activator for CbbR, a regulatory protein which controls expression of the cbb operons (Dangel and Tabita

2015).

Three major forms of Prk are known and shown to involve different regulatory mechanisms. The first is found in higher plants and green algae where cysteine residues present on the N-terminus form inhibitory disulfide bonds which can be reduced by thioredoxin (Howard et al. 2008; Thieulin-Pardo et al. 2015). Additionally, these Prk can form large inhibitory protein complexes mediated by the small disordered CP12 protein

(Howard et al. 2008). The second form of Prk is found in cyanobacteria and other types of algae where only inhibitory complexes mediated by CP12 act to modulate the activity

(Thieulin-Pardo et al. 2015). The proteobacterial Prk, however, has not been shown to interact with other proteins nor have regulatory cysteine residues been identified

(Miziorko 2006). Rather, the proteobacterial Prk is inhibited by AMP and allosterically activated by NADH (Novak and Tabita 1999; Kung et al. 1999; Rindt and Ohmann 1969;

Kung et al. 1999). In R. sphaeroides, the allosteric activation of Prk by NADH has been suggested to serve as a redox-sensing mechanism where changes in the NAD+/NADH ratio could modulate the activity and lead to changes in RubisCO levels (Farmer and

Tabita 2015).

R. sphaeroides encodes two prokaryotic Prk isozymes, PrkA (or CbbPI) and PrkB

(or CbbPII), where the structural genes are located on the cbbI and cbbII operons, respectively. While the isozymes share 88 % amino acid sequence identity and have similar maximal rates, the allosteric regulation imposed by NADH differs. In the absence of NADH, PrkB activity decreases by 50 % whereas PrkA decreases by 95% (Novak and

Tabita 1999). The structural difference that leads to the differential regulation is not understood and work done on PrkB is limited. However, in vitro studies on the isozyme

PrkA has led to the identification of many residues involved in substrate binding

(Harrison et al. 1998; Runquist et al. 1999; Runquist et al. 1996), catalysis (Charlier et al.

1994; Runquist et al. 1999), cooperativity (Runquist et al. 1998), and allosteric regulation by NADH (Kung et al. 1999; Runquist et al. 1998; Charlier et al. 1994). For instance, multiple residues have been identified in the mobile lid domain of PrkA where changes lead to the decreased requirement for NADH activation while maintaining high activity

(Runquist et al. 1998; Kung et al. 1999; Charlier et al. 1994).

As part of studying how R. sphaeroides grows with a particular carbon substrate, it is necessary to discern the biochemical steps required for the substrate to enter central metabolism and then be used to make all other carbon molecules in the cell. This, as stated, is too complex, therefore, the concept of precursor metabolites (Neidhardt et al.

1990; Fuchs 1999) is employed whereby 12 intermediates of central carbon metabolism are used to simplify the metabolic scheme. Of the original 12, these six – acetyl-CoA, phosphoenolpyruvate, pyruvate, oxaloacetate, -ketoglutarate, and C3-C6-phosphate sugars – are identified by us as the biosynthetic starting points for all other cellular constituents, therefore, the ability to maintain these pools should result in growth of the cell. Succinyl-CoA was combined with oxaloacetate as no net flux of succinyl-CoA for biosynthesis is predicted to occur. The phosphorylated sugars glucose-6-phosphate, fructose-6-phosphate, ribose-5-phosphate, erythrose-4-phosphate, triose phosphate, and

3-phosphoglycerate were grouped as one pool as they are all derived by the linear gluconeogenic pathway once PEP is formed. This provides a model that can be tested and revised as new interactions between separate pathways and systems are discovered.

Using this method, advances have been made in understanding how R. sphaeroides assimilates 3-hydroxypropionate where a major point of contention has been the role of the ethylmalonyl-CoA pathway. Assimilation of carbon substrates that enter central metabolism exclusively at the level of acetyl-CoA in R. sphaeroides require the use of it in order to replenish the C4-dicarboxylic acid pools of the TCA cycle (Erb et al.

2007). Overall, three molecules of acetyl-CoA and two molecules of CO2 are converted to two molecules of malate thus maintaining the C4 pool and allowing for all other precursor metabolites to be synthesized. During photoheterotrophic growth with 3- hydroxypropionate, it was thought to be dispensable due to the ability to block the committed step of the pathway, catalyzed by crotonyl-CoA carboxylase/reductase (Ccr), without any apparent phenotype resulting (Schneider et al. 2012). Furthermore, discovery of a so-called reductive path which ultimately converts 3-hydroxypropionate to succinyl-

CoA showed that an entry point into central carbon metabolism existed which would not require the ethylmalonyl-CoA pathway (Schneider et al. 2012; Asao and Alber 2014).

However, additional growth experiments showed that blockages of the ethylmalonyl-CoA pathway at steps after Ccr lead to severe growth inhibitions with 3-hydroxypropionate

(Figure 9). Using strains producing the thioesterase YciA, it was shown that the growth inhibitions were due to the accumulation of CoA thioester intermediates specific to the ethylmalonyl-CoA pathway most likely leading to a decrease in the free coenzyme A pool (Figure 11). Further mutant analysis showed that the pathway is not essential as long as the early blockage was present to prevent the accumulation of the intermediates

(Figure 8C). One interesting observation made during this study was that the late

92 blockage strains that were initially inhibited for 3-hydroxypropionate-dependent growth, when incubated for over 100 h, spontaneously began growing.

Here, we investigated the spontaneous 3-hydroxypropionate-dependent growth in the R. sphaeroides mutant strains containing late blockages in the ethylmalonyl-CoA pathway. Suppressor strains were isolated and characterized. Results from whole genome sequencing identified a common mutation resulting in a change to arginine186 in PrkB.

Furthermore, introduction of the suppressor mutation to the parental deletion strains restored 3-hydroxypropionate-dependent growth. Finally, evidence is presented indicating the mutation caused carbon flux through the ethylmalonyl-CoA pathway to decrease, thus, preventing the accumulation of CoA-thioester intermediates observed in the parent deletion strains prior to suppression. Possible mechanisms for how

PrkB_R186C is able to influence carbon flux through the ethylmalonyl-CoA pathway are discussed.

4.2 Materials and Methods

4.2.1 Materials.

See Chapter 3 (pg. 53) for details on the purchase, neutralization, and concentration determination for 3-hydroxypropionate All primers used in the study were obtained from Sigma-Aldrich (St. Louis, MO) and are listed in Table 15.

4.2.2 Bacterial strains and growth conditions.

Refer to Chapter 3 (pg. 53). See Table 14 for strains used in Chapter 4.

4.2.3 Isolation of suppressor mutants including Rsmcd3HP+2-1, Rsmch3HP+1-1, Rsmcl13HP+3-1

Parent strains Rsmcd11KB, Rsmch49KB, and Rsmcl1_4KB consistently exhibited minimal changes in OD578 nm under photoheterotrophic growth condition with

3-hydroxypropionate as the carbon source in defined minimal media. After 100-150 h, however, exponential growth would begin and cultures reached a final OD578 nm close to that of wild type (~1 vs 1.4). During this spontaneous growth, 100 L of the exponentially growing cultures would be used to inoculate 4 mL of fresh, liquid 3- hydroxypropionate minimal media serving as an enrichment for the suppressor mutants.

Growth would begin immediately for these re-inoculations. After reaching early stationary phase in the re-inoculations, samples were 3-phase streaked onto succinate minimal media agar plates to obtain isolated colonies. Succinate served as a non-selective carbon source for isolating the suppressor strains because the parent strains were capable of growth with it similar to wild type. All growth for isolation was performed photoheterotrophically. From the succinate minimal media agar plates, one to four colonies were picked to either re-streak onto fresh succinate minimal media agar plates or inoculate liquid succinate minimal media to grow cultures up for stocks. The isolated suppressor strains were named according to 1) the parent deletion strain, 2) a single suppressing culture from a particular experiment, and 3) particular isolate taken from that culture. For example, Rsmch3HP+1-1 was derived from Rsmch49KB, was isolated from the 1st culture tube that was used, and was the first isolate obtained from that culture.

Table 14 Strains and plasmids used in Chapter 4 Name Relevant characteristics Reference Escherichia coli DH5 Cloning host SM10 RP4-2 Tc::Mu-Km::Tn7 Simon et al. 1983 S17-1 RP4-2 Tc::Mu Tpr Smr Scr Simon et al. 1983

Rhodobacter sphaeroides 2.4.1 (WT) wild type with cbbR mutation; encodes CbbR R247Q variant DSMZ 158 Rsmcd11KB In-frame deletion inactivation of mcd (rsp_1679) Chapter 3 Rsmch49KB In-frame deletion inactivation of mch (rsp_0973) Chapter 3 Rsmcl1_4KB In-frame deletion inactivation of mcl1 (rsp_1771) Chapter 3 Rsmcd3HP+2-1 Spontaneous mutant derived from Rsmcd11KB; prkB mutation encodes This work R186C variant Rsmch3HP+1-1 Spontaneous mutant derived from Rsmch49KB; prkB mutation encodes This work R186C variant Rsmcl13HP+3-1 Spontaneous mutant derived from Rsmcl1_4KB; prkB mutation This work encodes R186C variant RsprkB*7SJC Allelic exchange for prkB* encoding R186C variant This work RsprkBCstrep9SJC Allelic exchange for prkBCstrep encoding wildtype PrkB with C- This work terminal StrepTagII RsprkB*Cstrep14SJC Allelic exchange for prkB*Cstrep encoding PrkB R186C and C-terminal This work StrepTagII RsmchprkB*8SJC Allelic exchange for prkB* encoding R186C variant This work RsmchprkBCstrep30SJC Allelic exchange for prkBCstrep encoding C-terminal StrepTagII variant This work RsmchprkB*Cstrep22SJC Allelic exchange for prkB*Cstrep encoding R186C and C-terminal This work StrepTagII variant RsmcdprkB*3SJC Allelic exchange for prkB* encoding R186C variant This work RsmcdprkBCstrep16SJC Allelic exchange for prkBCstrep encoding C-terminal StrepTagII variant This work RsmcdprkB*Cstrep15SJC Allelic exchange for prkB*Cstrep encoding R186C and C-terminal This work StrepTagII variant Rsmcl1prkB*8SJC Allelic exchange for prkB* encoding R186C variant This work Rsmcl1prkBCstrep14SJC Allelic exchange for prkBCstrep encoding C-terminal StrepTagII variant This work Rsmcl1prkB*Cstrep7SJC Allelic exchange for prkB*Cstrep encoding R186C and C-terminal This work StrepTagII variant

Plasmids pBBRsm2SJC(D) “empty vector”, derived from pBBRsm2MCS5, XbaI/SpeI sites removed Chapter 3 pSC113 Escherichia coli yciA with rrnB promoter from R. sphaeroides 2.4.1 Chapter 3

pK18mobsacB Suicide vector in R. sphaeroides, Kmr SucroseS Schaefer et al. 1994 pSC138 Exchange of prkB (rsp_3267) for prkBCstrep encoding wildtype PrkB This work with C-terminal StrepTagII pSC139 Exchange of prkB (rsp_3267) for prkB*Cstrep encoding PrkB R186C This work and C-terminal StrepTagII pSC140 Exchange of prkB (rsp_3267) for prkB* encoding PrkB R186C This work

As a comparison, Rsmch3HP+2-1 would have been isolated from a completely different culture tube and different experiment.

Table 15 Primers used in Chapter 4 Primer Sequence (5’  3’) Purpose delta_prkB_HindIII_UpF GGAAGCTTGTGGGCATCGGTTCAATC prkB genetic region prkBstreptag_UpR_OutNest TCCTTCATGGCTCTCATCC prkB upstream fragment delta_prkB_xbaI_DnR2 AAGCTCTAGATGGCAACCCTGATTGTC prkB genetic region delta_prkB_dnFstrep_Outnest GGGCGAATTCCATCGTG prkB downstream fragment delta_pkrB_UpRstrep_InNest TCACTTCTCGAACTGCGGGTGCGACCAGGCCGAGGC prkBstreptagII upstream CCGCGCGCGGCGCGCCTC fragment delta_pkrBstrep_DnF_InNest TCGGCCTGGTCGCACCCGCAGTTCGAGAAGTGAGGC prkBstreptagII downstream GCGACAGACAGACG fragment prkBreg_seqF2 AGCCCGATGGAATCGTG genotype prkB exchange prkBreg_seqR3 GGCGAATTCCATCGTGGTG genotype prkB exchange prkBreg_seqR2 GTCGATCGGGACGATCTTCTC genotype prkB exchange prkBreg_seqR1 GGACCTTCCCGACCTGTTTC genotype prkB exchange prkBreg_seqF3 CCGGAGCCATTCGGAGTTTG genotype prkB exchange prkB_speI_HindIII_R CGAAGCTTGATCCGCGGCCCACTAGTCGTCTGTCTG genotype prkB exchange prkB_ndeI_F GGGCCTGTTCCGGAGTTAACATATGTCGAAGAAATA genotype prkB exchange TC geno_prkB_UpF CAGTTCGCCGCATAGACCTG genotype prkB exchange geno_prkB_DnR CCCACATCGATCCAGTCGTCTC genotype prkB exchange yciA_F ACCCCATATGTCGACCACCCACAAC pSC113 (yciA expression) yciA_R GCCAGTGAATTCGCTGAACTAGTATGGTCACTC pSC113 (yciA expression) Restriction endonuclease recognition sites are underlined

4.2.4 Generation of site-specific R. sphaeroides mutants

4.2.4.1 Plasmid construction for isolation of strains with a prkB* allele

The suicide plasmid pSC140 employed for exchange of the wild type gene prkB

(rsp_3267) with one containing a single missense mutation was constructed by amplifying 5055 bp of the prkB genetic region from Rsmch3HP+1-1 gDNA (primers: delta_prkB_HindIII_UpF/delta_prkB_xbaI_DnR2) by PCR and cloning the product into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pSC140 contains prkB with the point mutation c556t encoding PrkB_R186C.

4.2.4.2 Plasmid construction for isolation of strains with prkB*Cstrep allele

The suicide plasmid pSC139 employed for exchange of the wild type gene prkB

(rsp_3267) with one containing a single missense mutation as well as the StrepTagII coding sequence on the 3’ end was constructed using assembly PCR. The upstream fragment was amplified from Rsmch3HP+1-1 gDNA so that the entire 876 bp-prkB gene

96 except the stop codon was preceded by 2076 bp of the upstream region (nested primers: delta_prkB_HindIII_UpF/prkBstreptag_UpR_OutNest and delta_prkB_HindIII_UpF/ delta_pkrB_UpRstrep_InNest). The StrepTagII coding sequence was included in the forward primer so that it was added to the 3’ end of the gene. The downstream fragment was amplified so that the 2088 bp directly downstream of the prkB stop codon was encoded (nested primers: delta_prkB_xbaI_DnR2/ deltal_prkB_dnFstrep_Outnest and delta_pkrBstrep_DnF_InNest/delta_prkB_xbaI_DnR2). The StrepTagII coding sequence was included in the reverse primer so that it was directly adjacent to where the 3’ end of the gene would be. These products at a 1:1 ratio then served as template in a single assembly PCR reaction using the primer pair delta_prkB_HindIII_UpF/delta_prkB_xbaI_DnR2 for amplification. The assembly PCR product was cloned into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pSC139 contains prkB*Cstrep with the point mutation c556t encoding

PrkB_R186C_Cstrep.

4.2.4.3 Plasmid construction for isolation of strains with prkBCstrep allele

The suicide plasmid pSC138 employed for exchange of the wild type gene prkB

(rsp_3267) with one containing the StrepTagII coding sequence on the 3’ end was constructed using assembly PCR. The upstream fragment was amplified from wild-type

R. sphaeoroides gDNA so that the entire 876 bp-prkB gene except the stop codon was preceded by 2076 bp of the upstream region (nested primers: delta_prkB_HindIII_UpF/prkBstreptag_UpR_OutNest and delta_prkB_HindIII_UpF/ delta_pkrB_UpRstrep_InNest). The StrepTagII coding sequence was included in the

97 forward primer so that it was added to the 3’ end of the gene. The downstream fragment was amplified so that the 2088 bp directly downstream of the prkB stop codon was encoded (nested primers: delta_prkB_xbaI_DnR2/ deltal_prkB_dnFstrep_Outnest and delta_pkrBstrep_DnF_InNest/delta_prkB_xbaI_DnR2). The StrepTagII coding sequence was included in the reverse primer so that it was directly adjacent to where the 3’ end of the gene would be. These products at a 1:1 ratio then served as template in a single assembly PCR reaction using the primer pair delta_prkB_HindIII_UpF/delta_prkB_xbaI_DnR2 for amplification. The assembly PCR product was cloned into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pSC138 contains prkBCstrep encoding PrkB_Cstrep.

4.2.4.4 Plasmid construction for yciA expression

Refer to Chapter 3 (pg. 61).

4.2.4.5 Isolation of mcd11KB

Refer to Chapter 3 (pg. 59).

4.2.4.6 Isolation of mch49KB

Refer to Chapter 3 (pg. 58).

4.2.4.7 Isolation of mcl1_4KB

Refer to Chapter 3 (pg. 59).

4.2.4.8 Isolation of strains with prkB*

Mutant strains RsprkB*7SJC, RsΔmcdprkB*3SJC, RsΔmchprkB*8SJC, and

RsΔmcl1prkB*8SJC were isolated by mating R. sphaeroides 2.4.1 with E. coli S17-1 transformed with the suicide plasmid pSC140 and single and double crossovers were

98 isolated as described previously (Carter and Alber 2015). The resulting mutant strains were genotyped by sequencing PCR products derived from chromosomal DNA and primers (listed in Table 15) that amplified the entire flanking regions where crossovers may have occurred.

4.2.4.9 Isolation of strains with prkBCstrep

Mutant strains RsprkBCstrep9SJC, RsΔmcdprkBCstrep16SJC,

RsΔmchprkBCstrep30SJC, and RsΔmcl1prkBstrepSJC were isolated by mating R. sphaeroides 2.4.1 with E. coli S17-1 transformed with the suicide plasmid pSC138 and single and double crossovers were isolated as described previously (Carter and Alber

2015). The resulting mutant strains were genotyped by sequencing PCR products derived from chromosomal DNA and primers (listed in Table 15) that amplified the entire flanking regions where crossovers may have occurred.

4.2.4.10 Isolation of strains with prkB*CStrepII

Mutant strains RsprkB*Cstrep14SJC, RsΔmcdprkB*Cstrep15SJC,

RsΔmchprkB*Cstrep22SJC, and RsΔmcl1prkB*Cstrep7SJC were isolated by mating R. sphaeroides 2.4.1 with E. coli S17-1 transformed with the suicide plasmid pSC139 and single and double crossovers were isolated as described previously (Carter and Alber

2015). The resulting mutant strains were genotyped by sequencing PCR products derived from chromosomal DNA and primers (listed in Table 4.2) that amplified the entire flanking regions where crossovers may have occurred.

4.2.5 Plasmid transfer via conjugation

The pBBRsm2(SJC)D plasmid (empty vector control), pSC94, pSC97, pSC100, pSC113 and pSC142 were independently conjugated into wild type, RsΔmcd11KB,

RsΔmch49KB, RsΔmcl1_4KB, and Rsmch3HP+1-1 by mating the R. sphaeroides strains with E. coli SM10 transformed with the respective plasmid.

4.2.6 Product analysis by High Performance Liquid Chromatography (HPLC).

For the detection and quantification of organic acids present in the spent media as a result of photoheterotrophic growth of R. sphaeroides, samples (0.6 ml) were taken at different time points during growth, centrifuged at 16,000 × g for 3 min to remove the cells, and 0.5 ml of the supernatant was frozen at –20 ⁰C until further analysis. Samples were thawed and centrifuged at 16,000 × g for 3 min. The supernatant (100 – 150 μl) was acidified by adding 3 M sulfuric acid to a final concentration of 0.03 M, and centrifuged at 16,000 × g for 3 min and a portion of the resulting supernatant (30 – 100 μl) was used for analysis. Organic acids were analyzed on a Shimadzu Prominence HPLC system with dual wavelength detection (210 and 230 nm) using a RezexTM ROA-Organic Acid H+ (8

%) 250 × 4.6 mm (Phenomenex) column that was preceded by a Carbo-H+ cartridge for ion exclusion chromatography. Organic acids were separated isocratically in 2.5 mM sulfuric acid at 60 ⁰C with a flow rate of 0.5 ml min-1. Peak retention times (min) for known standards of the following organic acids were determined: phosphoenolpyruvic

(4.0), 3-phosphoglyceric (4.1), oxalic (4.1), pyruvic (4.2), citric (4.6), glyoxylic (5.3),

(3S)-malic (5.3), succinic (5.9), ethylmalonic (6.0), methylsuccinic (6.3), (S)-lactic (6.4),

3-hydroxypropionic (6.5), (R)-3-hydroxybutyric (6.5), acetoacetic (6.6), acetic (7.0),

100 mesaconic (7.3), propionic (7.9), butyric (9.1), and crotonic (10.3). Limits of detection for mesaconic, methylsuccinic, and 3-hydroxypropionic acid were 0.5 μM, 50 μM, and

50 μM, respectively.

4.2.7 Whole genome sequencing using Illumina

R. sphaeroides genomic DNA was isolated from 1 mL of photoheterotrophically grown cells in succinate minimal media taken at early stationary phase using a GeneJET

Genomic DNA Purification Kit (ThermoFisher Scientific). Final DNA concentrations were determined using a Nanodrop 2000 (ThermoFisher Scientific). Paired-end sequencing was performed on an Illumina HiSeq 2500 at the Genomics Shared Resource at the Ohio State University. Raw reads were trimmed and filtered using sickle pe with default parameters (Joshi and Fass 2011) and then mapped to the annotated genome of R. sphaeroides 2.4.1 (Accession Numbers: Chr1, NC_007493.2; Chr2, NC_007494.2;

PlasmidA, NC_009007.1; PlasmidB, NC_007488.2; Plasmid C, NC_007489.1;

PlasmidD, NC007490.2; PlasmidE, NC_009008.1; National Center for Biotechnology

Information, https://www.ncbi.nlm.nih.gov/genome/, accessed 2018) with bowtie2

(Langmead and Salzberg 2012). Potential SNPs/INDELs were identified using FreeBayes

1.0.2.29-3 on the Galaxy server, manually analyzed using Microsoft Excel, and visualized using the Integrated Genomics Viewer (Robinson et al. 2011)

4.2.8 Whole genome sequencing using Ion Torrent

R. sphaeroides genomic DNA was isolated from 1 mL of photoheterotrophically grown cells in succinate minimal media taken at late exponential phase using a GeneJET

Genomic DNA Purification Kit (ThermoFisher Scientific). Final DNA concentrations

101 were determined using a Nanodrop 2000 (ThermoFisher Scientific). Shotgun sequencing was performed on an Ion Torrent Sequencer at the OSU Pharmacogenomics Core

Laboratory at the OSU College of Medicine Center for Pharmacogenomics. Raw reads were mapped to the annotated genome of R. sphaeroides 2.4.1 (National Center for

Biotechnology Information, https://www.ncbi.nlm.nih.gov/genome/, accessed 2018) with bowtie2 (Langmead and Salzberg 2012). Potential SNPs/INDELs were identified and visualized using the Integrated Genomics Viewer (Robinson et al. 2011)

4.2.9 Molecular modeling of PrkB and PrkB_R186C

The molecular models for PrkB and PrkB_R186C were generated using the protein modeling web portal Phyre2 (Kelley et al. 2015) and visualized using UCSF

Chimera software (Petterson et al. 2004).

4.3 Results

4.3.1 R. sphaeroides deletion strains mcd11KB, mch49KB, and mcl1_4KB spontaneously overcome 3-hydroxypropionate-dependent growth inhibition

Three R. sphaeroides mutant strains that were blocked in the ethylmalonyl-CoA pathway at the steps catalyzed by methylsuccinyl-CoA dehydrogenase (Mcd), mesaconyl-CoA hydratase (Mch), or methylmalyl-CoA lyase (Mcl1) exhibited severe 3- hydroxypropionate-dependent growth defects (Figure 14). The growth defects were attributed to ethylmalonyl-CoA pathway-specific CoA-thioesters accumulating that probably led to a depletion of the CoA pool as a result of the metabolic blocks. As shown in Figure 14, these in-frame deletion strains, Rsmcd11KB, Rsmch49KB, and

Rsmcl1_4KB exhibited minimal growth for up to 100 hours of incubation with 3-

102 hydroxypropionate. However, after 100 h the same strains started to grow reaching a final

OD578 nm similar to wild-type R. sphaeroides (Figure 14). This phenomenon consistently happened when these strains were incubated with 3-hydroxypropionate. Re-inoculation of the spontaneously growing cultures into fresh, liquid 3-hydroxypropionate minimal media resulted in immediate exponential growth reaching a final OD578 nm similar to wild type (data not shown). This finding implicated a suppression, rather than a growth lag for the initial culture. Seven suppressor strains were isolated and characterized for photoheterotrophic and chemoheterotrophic growth with 3-hydroxypropionate (data not shown). Amongst the seven isolates tested, slight variability in growth occurred, however, three strains, Rsmcd3HP+2-1, Rsmch3HP+1-1, and Rsmcl13HP+3-1, exhibited the highest degree of similarity (Figure 15). For these three strains, it was proposed that a common suppressor mutation may cause the 3-hydroxypropionate-positive growth phenotype. To identify the mutation, we sequenced the entire genome of each suppressor strain, as well as each parental deletion strain, so as to “triangulate” the one mutation that may be unique to the suppressors.

4.3.2 Four unique mutations identified in the mch3HP+1-1 suppressor strain

Whole genome sequencing was performed on strains Rsmch49KB and

Rsmch3HP+1-1 using Illumina paired-end sequencing with genomic DNA isolated from cells grown photoheterotrophically in succinate minimal media. For both strains, 98 % of the genome was mapped to the Rhodobacter sphaeroides 2.4.1 reference genome with an average depth of 161 bases and 184 bases for Rsmch49KB and Rsmch3HP+1-1, respectively (Table 16). The accuracy of the data was supported by the lack

103 of reads aligned to the deleted mch sequence. In total, 213 changes from the reference genome for R. sphaeroides 2.4.1 were initially identified in Rsmch49KB and 239 changes in Rsmch3HP+1-1 using the variant detecting program FreeBayes which separately compared reads of each individual strain to the reference genome (Table 17).

Figure 14 Suppression of R. sphaeroides parent deletion strains during photoheterotrophic and chemoheterotrophic growth with 3-hydroxypropionate. Wild type is shown with (). The parent deletion strains Rsmcd11KB (), Rsmch49KB (), and Rsmcl1_4KB () spontaneously grew after ~100 hours. Samples were taken during exponential phase from anaerobic cultures for sub-culturing and isolation of suppressor strains as described in the Materials and Methods. Growth of the parent deletion strains was routinely done to observe suppression and obtain new isolates. Shown are representative growth curves from a single experiment.

104

Figure 15 Comparison of R. sphaeroides suppressor isolates during photoheterotrophic and chemoheterotrophic growth with 3-hydroxypropionate. Wild type is shown with (). The isolates Rsmcd3HP+2-1 () Rsmch3HP+1-1 () and Rsmcl13HP+3-1 () were chosen due to the similar growth phenotypes in both anaerobic and aerobic conditions. Performed in biological triplicate. Shown are representative growth curves from a single experiment.

However, after cross-referencing all the FreeBayes-identified mutations between the two strains using Microsoft Excel and the visualization software Integrated Genomics

Viewer, only four of the 26 possible mutations in Rsmch3HP+1-1 were considered unique to the strain compared to Rsmch49KB. The other mutations identified by FreeBayes could be attributed to areas of low sequencing coverage and/or phage-related genes that already contained multiple changes from the reference genome. These four unique mutations are presented in Table 18.

105

Table 16 Illumina sequencing metrics for Rsmch3HP+1-1 and Rsmch49KB

Rsmch3HP+1-1 Rsmch49KB Mapped Coverage Mapped Coverage bases with (%) bases with (%) depth >10 depth >10 Chromosome 1 (3188524)a 3179734 99.724 3179594 99.720 Chromosome 2 (943018) 942990 99.997 942987 99.997 Plasmid A (114045) 112550 98.689 112503 98.648 Plasmid B (114179) 114099 99.930 114086 99.919 Plasmid C (105284) 105240 99.958 105212 99.932 Plasmid D (100827) 22152 21.970 22178 21.996 Plasmid E (37100) 37026 99.801 37021 99.787 Genome (4602977) 4513791 98.062 4513581 98.058 Total reads mapped to genome 5874366 5136676 Average mapped read length (bases) 150 150 Average depth for genome (bases) 184 161 aTotal number of bases

Table 17 Overall changes compared to reference genome identified in Rsmch3HP+1-1 and Rsmch49KB using Illumina sequencing

Changes Strain Chr 1 Chr 2 Plasmid A-E Totalb Unique Rsmch49KB 134a 38 41 213 0 Rsmch3HP+1-1 150 41 48 239 4 aChange was seen in >95% of mapped reads bMost identified changes from the reference can be attributed to low coverage, phage-related genes, and variability of the actual change defined by the program that were manually evaluated

Table 18 The four unique changes identified in Rsmch3HP+1-1

Genome molecule Gene (locus tag) Annotation Mutationa Variant Chr1 tetR (RSP_2801) regulatory protein 2 bp deletion; frameshift at position 66 g189, c190 Chr1 (RSP_0169) sodium/solute 1 bp insertion; frameshift at position symporter c501 170 Chr1 mcpA (RSP_2440) methyl-accepting silent - chemotaxis protein Chr2 prkB (RSP_3267) phosphoribulokinase missense; c556t R186C aIndicates the nucleotide change within the open reading frame starting from the 5’ end.

106

4.3.3 Ion torrent whole genome sequencing used to identify the prkB mutation as the one common mutation shared by mcd3HP+, mch3HP+, and mcl13HP+

Along with the Illumina sequencing, whole genome sequencing of the three suppressor strains, Rsmcd3HP+2-1, Rsmch3HP+1-1, and Rsmcl13HP+3-1, the three parental deletion strains, Rsmcd11KB, Rsmch49KB, and Rsmcl1_4KB, and the wild-type R. sphaeroides strain was performed using Ion Torrent technology. Results for

Rsmcd11KB could not be used at all as the data files were too large to process.

Furthermore, compared to the Illumina results, coverage for the other six strains was exemplified by 100-500 bp gaps throughout the genome where no sequences aligned impairing the analysis. Performing similar metrics as was done for the Illumina data was not possible, however, the presence or absence of the four unique mutations could be determined as those regions sequenced well. As shown in Table 19, the same nucleotide change in prkB was present in all three suppressor strains while not present in

Rsmch49KB, Rsmcl1_4KB, and wild type. Furthermore, the other three mutations identified using the Illumina data were not present in the any of the three suppressor strains. Therefore, as the likely suppressor mutation, we decided to investigate the prkB mutation further.

107

Table 19 Comparison of possible suppressor mutations using whole genome sequencing data

Mutation identified in sequencing results Sequencing tetR (RSP_0169) mcpA prkB platform Strain (RSP_2801) (RSP_2440) (RSP_3267) Illumina Rsmch3HP+1-1 + + + + Rsmch49KB - - - - Ion Torrent Rsmch3HP+1-1 + + + + Rsmch49KB - - - - Rsmcl13HP+3-1 - - - + Rsmcl1_4KB - - - - Rsmcd3HP+2-1 - - - + Wild type - - - - + = mutation was identified in genome

4.3.4 Exchanging the wildtype prkB allele for the suppressor variant encoding PrkB_R186C restores 3-hydroxypropionate-dependent growth

The sequencing data identified a single nucleotide change common amongst the three suppressor strains in the prkB gene (rsp_3267), encoding a phosphoribulokinase B variant, PrkB_R186C. To verify that this change was the bona fide suppressor mutation, the prkB gene was replaced on the chromosome with a mutated allele encoding

PrkB_R186C in strains Rsmcd11KB, Rsmch49KB, and Rsmcl1_4KB, and wild-type

R. sphaeroides. The resulting strains RsWTprkB*7SJC, Rsmcd_prkB*3SJC,

Rsmch_prkB*8SJC, and Rsmcl1_prkB*8SJC were tested for photoheterotrophic growth with 3-hydroxypropionate. For Rsmcd_prkB*3SJC, Rsmch_prkB*8SJC, and

Rsmcl1_prkB*8SJC, 3-hydroxypropionate-dependent growth matched that of the corresponding spontaneous suppressor strains with doubling times slightly greater than wild type (Figure 16; Table 20). Succinate growth matched that of the wild type for all strains while acetate growth was inhibited, as expected, for the ethylmalonyl-CoA pathway deletion mutants. These results indicated that a single nucleotide change 108 encoding PrkB_R186C in the parent deletion strains was sufficient to restore 3- hydroxypropionate-dependent growth.

4.3.5 Exchanging the wildtype prkB allele for the suppressor variant encoding PrkB_R186C affects growth with acetate

Interestingly, the wild type strain encoding PrkB_R186C exhibited a doubling time twice as long as wild type when grown with acetate while the doubling time when grown with 3-hydroxypropionate was similar to the other strains encoding PrkB_R186C

(Figure 16).

Figure 16 PrkB_R186C restores 3-hydroxypropionate-dependent growth. Photoheterotrophic growth of strains wild type () WTprkB*7 () RsmcdprkB*3 () RsmchprkB*8 () Rsmcl1prkB*8 () RsmchprkBCStrep8 () with 3- hydroxypropionate, acetate, and succinate. Performed in biological triplicate. Shown are representative growth curves from a single experiment.

4.3.6 A chromosomally encoded C-terminal StrepTagII on PrkB or PrkB_R186C does not alter the phenotype

Additionally, strains were generated where the prkB gene was replaced on the chromosome with either an allele encoding the wild-type PrkB with a C-terminal

StrepTagII or a mutated allele encoding the PrkB_R186C variant with a C-terminal

109

StrepTagII. Each parental deletion strain, as well as wild-type R. sphaeroides, was subjected to this procedure resulting in eight isolated strains (Table 20).

Table 20 Doubling times for R. sphaeroides strains grown photoheterotrophically with 3- hydroxypropionate, acetate, or succinate as the carbon source.

Doubling time (hr) Strain 3-hydroxy- acetate succinate propionate Rhodobacter sphaeroides 2.4.1 (WT) 5.50.6a 4.00.5 (0.96) 3.00.2 WTprkB*7SJC 7.00.6 6.90.1 (0.96) 3.70.8 WTprkBCstrep9SJC 6.20.3 4.30.2 (0.96) 3.20.1 WTprkB*Cstrep14SJC 6.80.6 6.80.2 (0.96) 3.40.1 Rsmcd11KB NEb (0.18)d NGc 3.70.1 Rsmcd3HP+2-1 7.01 ND 3.50.5 RsmcdprkB*3SJC 6.40.3 NG (0.22) 3.50.4 RsmcdprkB*Cstrep15SJC 6.60.2 NG (0.25) 3.70.4 RsmcdprkBCstrep16SJC NE NG (0.15) 3.50.6 Rsmch49KB NG NG (0.09) 3.10.2 Rsmch3HP+1-1 6.80.7 NG (0.11) 3.70.3 Rsmch3HP+prkBCstrep8SJC NG NG (0.08) 3.30.5 RsmchprkB*8SJC 7.20.5 NG (0.13) 3.50.3 RsmchprkB*Cstrep22SJC 7.00.8 NG (0.13) 3.30.1 RsmchprkBCstrep30SJC NG NG (0.09) 3.30.2 Rsmcl1_4KB NG NG 3.70.1 Rsmcl13HP+3-1 7.10.9 ND 3.60.4 Rsmcl1prkB*8SJC 6.40.2 NG (0.12) 3.30.5 Rsmcl1prkB*Cstrep7SJC 6.40.2 NG (0.14) 3.80.5 Rsmcl1prkBCstrep14SJC NG NG (0.09) 3.50.4 aStandard deviation calculated using three or more biological replicates bNE = non-exponential growth cNG = no growth d () = the average OD578 nm after 100 hrs of growth is given in parentheses

Looking at Table 20, the addition of the StrepTagII does not cause any significant differences to growth or doubling times in photoheterotrophic growth conditions containing either succinate, acetate, or 3-hydroxypropionate when compared to a similar

110 strain where the C-terminal StrepTagII is not encoded. Also, strains encoding the prkB mutation were capable of 3-hydroxypropionate-dependent growth while no other change to growth behavior was present with the addition of the C-terminal StrepTagII.

4.3.7 Replacing the mutant prkB allele in Rsmch3HP+1-1 with a wild-type copy restores the growth inhibition

The prkB mutant allele in Rsmch3HP+1-1 was replaced with one encoding the wild-type PrkB with a C-terminal StrepTagII. The resulting isolated strain

Rsmch3HP+PrkBCstrep8SJC reverted back to the 3-hydroxypropionate-inhibited growth phenotype of the parental deletion strain Rsmch49KB (Figure 16, Table 20) further supporting the prkB mutation as the required genetic change for suppression to occur.

4.3.8 Other PrkB_R186 variants can restore 3-hydroxypropionate-dependent growth

All three of the originally sequenced spontaneous suppressor mutants encode the same PrkB_R186C variant. To determine if the same mutation was present in other isolates, the prkB genetic region of three other spontaneous suppressor isolates was PCR amplified and sequenced. As shown in Table 21, while a mutation was always found to change the same R186 residue, the change was not limited to a cysteine. Of the three tested, two encoded PrkB_R186S and one encoded PrkB_R186H.

111

Table 21 Encoded variant PrkB in sequenced isolated suppressor strains

PrkB variant Codon change Strain encoded from CGCa Rsmcd3HP+1-2 PrkB_R186S AGC Rsmcd3HP+1-4 PrkB_R186S AGC Rsmcd3HP+2-1 PrkB_R186C TGC Rsmch3HP+1-1 PrkB_R186C TGC Rsmcl13HP+1-1 PrkB_R186H CAC Rsmcl13HP+3-1 PrkB_R186C TGC aSix codons encode arginine including CGT, CGC, CGG, CGA, AGA, AGG

4.3.9 Carbon flux through the ethylmalonyl-CoA pathway during 3- hydroxypropionate-dependent growth is not detected in the suppressor strains

3-hydroxypropionate-dependent growth inhibition is caused by the late blockage of the ethylmalonyl-CoA pathway which leads to an accumulation of CoA-thioesters R. sphaeroides is unable to overcome (without suppression). Therefore, a possible effect of the prkB mutation would be to halt carbon flux through the ethylmalonyl-CoA pathway preventing the accumulation. To test this, the plasmid pSC113, encoding Escherichia coli

YciA, a thioesterase that catalyzes the CoA cleavage from mesaconyl-CoA, was introduced to wild type, Rsmch49KB, and Rsmch3HP+1-1 (Figure 17). Cleavage of the

CoA-thioesters leads to excretion of the resulting free acid into the growth media which can be detected via HPLC (Sonntag et al. 2014; Table 13). Mesaconic acid was below the detection limit in the spent media when the spontaneous and constructed suppressor strains Rsmch3HP+1-1 (yciA) was grown photoheterotrophically with 3- hydroxypropionate. This contrasts with, both, Rsmch49KB (yciA) and wild type (yciA) where 1.5 mM±0.1 and 0.004±0.001 mM final concentrations of mesaconic acid were detected. The lack of organic acid excretion in strains encoding PrkB_R186C compared 112 to detectable levels in the parent mutant strains, as well as the wild type, shows that flux through the ethylmalonyl-CoA pathway no longer occurs, or has decreased below the level of detection, thus preventing the accumulation of CoA-thioesters. How

PrkB_R186C could be affecting carbon flux through the ethylmalonyl-CoA pathway is discussed below.

4.3.10 Phosphoenolpyruvate identified as part of the unknown HPLC peak in spent media of the suppressor Rsmch3HP+ during 3-hydroxypropionate-dependent growth

As seen in Figure 17, an unknown peak was observed in spent media from

Rsmch3HP+1-1 (yciA) grown with 3-hydroxypropionate. This same peak was not present in spent media from wild type grown with succinate, acetate, or 3-hydroxypropionate nor

Rsmch49KB grown with succinate. It also did not appear in non-suppressor strains carrying the yciA gene grown with succinate or 3-hydroxypropionate. The unknown peak only appeared during mid exponential phase and gradually increased into early stationary phase when analyzing the spent media from Rsmch3HP+1-1 grown with 3- hydroxypropionate as the carbon source, with or without yciA present. Many standards were tested (listed in Methods and Materials) where the peak for phosphoenolpyruvic acid was the closest match to the unknown.

113

Figure 17 Detection of mesaconic acid in spent media from yciA-expressing R. sphaeroides strains grown with 3-hydroxypropionate. A) Photoheterotrophic growth of strains wild type (), wild type (yciA) (), Rsmch49KB (yciA) (), and Rsmch3HP+1-1 (yciA) () with 3-hydroxypropionate. B) HPLC ion exclusion chromatography of organic acids in samples taken from the spent media during the growth in A) where decreasing amounts of the carbon substrate 3- hydroxypropionate (3-hydroxypropionate) is observed over time. Spent media from wild type (yciA) and Rsmch49KB (yciA) had increasing amounts of mesaconic acid (MA) while none could be detected for wild type or Rsmch3HP+1-1 (yciA). The detection limit for MA is 0.5 M. However, a new, unknown peak was observed for Rsmch3HP+1-1 (yciA). This new peak was not specific to expressing yciA as it appeared when spent media from Rsmch3HP+1-1 grown with 3-hydroxypropionate was analyzed (data not shown). This analysis was performed in triplicate with a representative shown here. 114

4.3.11 Protein sequence comparison identifies difference in cysteine residues between Prk isozymes in R. sphaeroides

In addition to PrkB, R. sphaeroides encodes a second isozyme of phosphoribulokinase, PrkA, which shares 88 % amino acid identity with PrkB. To investigate why PrkB was being mutated, as opposed to PrkA, their amino acid sequences were compared. All residues identified during in vitro studies of PrkA and assigned a functional role involved in substrate binding (H45, R49, R173), NADH binding (R31,

R234, R257), catalysis (H100, K165, D169), and cooperativity (R186, R187), were invariant between the two proteins (Runquist et al. 1996; Runquist et al. 1998; Runquist et al. 1999; Harrison et al. 1998; Charlier et al. 1994; Kung et al. 1999). The majority of the residue differences occur between residues 116 and 148 including residue 136 which is a cysteine in PrkB and an alanine in PrkA (Figure 18). Further, PrkA contains only one cysteine at residue 194 which is also present in PrkB. This notable difference implied a possible interaction between the two cysteines in PrkB. However molecular modeling and comparison of the two isozymes showed a distance of 13 Å which would not be conducive for disulfide bond formation (data not shown). No interaction between the two residues is apparent.

115

Figure 18 Comparison of the PrkA and PrkB primary protein sequence from R. sphaeroides. Residues shaded blue indicate a difference in amino acid identity between PrkA and PrkB. The cysteines (R136 and R194) encoded in PrkB are shaded black. Arginine 186 is shaded green. Numbering is consistent between the two sequences.

4.4 Discussion

4.4.1 Mutation of PrkB arginine186 restores 3-hydroxypropionate dependent growth for Rsmcd1KB, Rsmch49KB, and Rsmcl1_4KB

Growth experiments conducted with the constructed suppressor strains provide clear evidence that introduction of a single point mutation to prkB in the parent deletion

116 strains restores 3-hydroxypropionate-dependent growth (Figure 16). This is further substantiated by the inability of Rsmch3HP+prkBCstrep8 to grow with 3- hydroxypropionate after the wild-type prkB allele is re-introduced (Figure 16). In total, six suppressor isolates with restored 3-hydroxypropionate-dependent growth have been sequenced where all six contain a mutation affecting PrkB_R186 (Table 21). Nonsense mutations could occur randomly in the gene, therefore, the specificity toward R186 implies that this change does not cause a loss of function. Furthermore, in R. sphaeroides, inactivation of prkB was shown to cause a severe growth defect under photoheterotrophic conditions with succinate (Hallenbeck et al. 1990) which we do not observe. Therefore, this indicates that the change to PrkB_R186 most likely bestows an altered function to the protein which leads to 3-hydroxypropionate-positive growth for the parent deletion strains.

4.4.2 Other changes to the R. sphaeroides genome identified by Illumina sequencing

Of the changes identified by sequencing the whole genome of the R. sphaeroides strains, it is worth noting that a mutation was identified in the cbbR gene, encoding the transcriptional regulator, CbbR, which activates expression of both cbb operons (Dangel and Tabita 2015). This mutation was found in all strains including wild type. The mutation encodes the variant CbbR_R274Q, which is constitutively active when expressed in an R. sphaeroides strain during photoheterotrophic and chemoheterotrophic growth with malate (Dangel et al. 2005). This strain encoding the CbbR_R274Q variant caused the form I and form II RubisCO protein levels to increase as well as Rubisco activity to increase in both chemoheterotrophic and photoheterotrophic conditions when

117 compared to a strain expressing wild-type CbbR. Whether or not this occurs in any of our strains during growth with 3-hydroxypropionate has not been determined. Furthermore, we have not tested the effects of the PrkB mutation in a strain without the CbbR mutation, therefore, we are unable to conclude whether or not the CbbR mutation is a prerequisite to the PrkB mutation that confers the 3-hydroxypropionate-positive phenotype to the parent deletion strains.

4.4.3 PrkB_R186C affects carbon flux through the ethylmalonyl-CoA pathway

For the spontaneous suppressor strain Rsmch3HP+1-1 (yciA), no mesaconic acid was detected in spent media during 3-hydroxypropionate-dependent growth, which contrasts the results for wild type (yciA) and Rsmch49KB (yciA) (Figure 17). This finding clearly indicates that carbon flux through the ethylmalonyl-CoA pathway is decreased due to the presence of PrkB_R186C. We have shown that blockage of the ethylmalonyl-CoA pathway during 3-hydroxypropionate assimilation to be a manageable metabolic change for R. sphaeroides as our previous findings show that the pathway is not essential for growth with 3-hydroxypropionate (Figure 8, pg 66). Furthermore, this effect would explain the ability of the suppressors to grow as the decreased flux would prevent the accumulation of CoA-thioester intermediates of the ethylmalonyl-CoA pathway which most likely decreases the free coenzyme A pool.

Consistent with the 3-hydroxypropionate results, growth with acetate was affected in all suppressor strains encoding PrkB_R186C which can be attributed to decreased flux through the ethylmalonyl-CoA pathway. For each deletion strain encoding PrkB_R186C, an increased OD578nm after 100 h of incubation was observed with acetate, as compared to

118 the respective deletion-only parent strain (Table 20). Flux through the ethylmalonyl-CoA pathway for the deletion strains is inhibitory (Chapter 3), therefore, the increased final

OD578nm would imply less flux is occurring. It also supports the idea that blocking the ethylmalonyl-CoA pathway is beneficial to the parent deletion strains. While the OD578nm change is minor, the consistent increase measured for the suppressor strains indicates that the effect is real. Additionally, WTprkB*7 exhibited a two-fold increase in doubling time during growth with acetate (Table 20). Taken together, they indicate that PrkB_R186C directly or indirectly decreases flux through the ethylmalonyl-CoA pathway. However, the ability for WTprkB*7 to grow with acetate suggests that each enzyme is still present and functional, though, no work has been done to discern if a particular step has become rate-limiting to explain the slower growth. Also, these measurable changes during acetate growth indicate the effect caused by PrkB_R186C is not specific to 3-hydroxypropionate assimilation.

4.4.4 Possible changes to the function of PrkB_R186C

Initially, we proposed that only PrkB_R186C variant conferred the ability to grow, however, further genotyping of isolate suppressor strains identified mutations encoding, both, PrkB_R186S and PrkB_R186H. The chemical properties of serine, histidine, and cysteine are not shared, therefore, it seems likely that changing R186 is the predominant requirement. In the crystal structure for PrkA and the molecular model for

PrkB, R186 interacts with E178 to form a salt bridge (Harrison et al. 1998), therefore, disruption of this structural element could be important and is supported by the residue changes found thus far. However, no functionality has been assigned to the salt bridge

119 per se (Harrison et al. 1998). Rather, in vitro characterization of PrkA_R186Q of R. sphaeroides showed that alteration of the residue forced the protein to be stuck in an allosteric R state, exhibiting a loss of cooperativity with ATP along with a three-fold increase in affinity for it (Km for ATP = 0.017 mM vs 0.055 mM for wild-type PrkA), a

2-fold increase in affinity for ribulose-5-phosphate (Ru5P) (Km for Ru5P = 0.048 mM vs

0.096 mM for wild-type PrkA), and a decreased requirement for NADH-mediated activation (6-fold decrease in activity without NADH vs a 30-fold decrease for wild-type

PrkA), while maintaining high specific activity (273 nmol/min/mg vs 338 nmol/min/mg for wild type PrkA) (Runquist et al. 1998; Kung et al. 1999). The results were similar for

PrkA_E178 when changed to an alanine (Charlier et al. 1994). Owing to the high sequence similarity between PrkA and PrkB, an analogous affect could occur for

PrkB_R186C whereby it becomes constitutively active requiring a lower level of NADH for activation. Furthermore, only two studies have been done on PrkB and it was shown in both to have a lower requirement for NADH activation than PrkA, where only a 25-

50% decrease in activity occurs in the absence of NADH as compared to a 90-95% decrease for PrkA (Gibson and Tabita 1987; Novak and Tabita 1999). This observation could imply that altering residue R186 in PrkB could lead to even less of a requirement for NADH for full activation and explain why PrkB, rather than PrkA, is mutated.

Alternatively, expression of the cbbII operon, which includes prkB, is increased under photoheterotrophic conditions compared to the cbbI operon (Dubbs and Tabita 2004), therefore it could be the abundance of PrkB which makes it a better target. The overall effect could be a constitutively activated protein with a decreased requirement for

120

NADH, or rather, a decreased sensitivity to signals from the cell that reflect the redox state.

4.4.5 How does PrkB_R186C influence carbon flux through the ethylmalonyl-CoA pathway?

In this study, we have evidence to support, both, decreased carbon flux through the ethylmalonyl-CoA pathway and that parent deletion strains Rsmcd11KB,

Rsmch49KB, and Rsmcl1_4KB encoding PrkB_R186C are once again able to grow with 3-hydroxypropionate. Any discussion on how PrkB_R186C causes this effect is purely speculative. However, development of a testable model can help guide future experiments. For instance, if the result of altering R186 is a constitutively active PrkB requiring less NADH activation, it could lead to a more oxidized NAD+/NADH ratio. As a role of the CBB cycle during photoheterotrophic growth is to maintain a proper level of oxidized pyridine nucleotides (Laguna et al. 2011), sensitivity to NADH by Prk could be used as a regulatory mechanism so as to become activated when the NADH levels begin to elevate. As the enzyme that catalyzes the production of RuBP, a proposed effector molecule for cbbII operon expression (Dangel and Tabita 2015), as well as, the substrate for RubisCO, Prk would be an effective way to sense the NAD+/NADH ratio, therefore the redox state of the cell, and modulate the CBB cycle as needed. Additionally, this might or might not be enhanced by the constitutive CbbR_R274Q variant encoded in our

R. sphaeroides strains. This type of mechanism was previously proposed by Farmer and

Tabita (2015), where nitrogenase catalysis, resulting in increased NADH oxidation, caused the decreased expression of RubisCO. As such, the proposed decreased requirement for NADH activation by PrkB_R186C would stimulate RuBP generation at a 121 higher NAD+/NADH ratio and therefore the CBB cycle could work to maintain this higher NAD+/NADH ratio. This higher ratio is indicative of chemoheterotrophic growth conditions where the TCA cycle would be used to oxidize carbon to obtain reducing equivalents to power the respiratory enzymes. As part of this, the type-II citrate synthase which catalyzes the condensation of acetyl-CoA and oxaloacetate to form citrate, and encoded by many Gram-negative bacteria including E. coli and Rhodobacter capsulatus

(Eidels and Preiss 1970; El-Mansi et al. 2006), is inhibited by higher levels of NADH and proposed to decrease flux through the TCA cycle as the NAD+/NADH ratio decreases (Eidels and Preiss 1970). In R. sphaeroides, rsp_1994 is annotated to encode a type-II citrate synthase and shares 86 % amino acid identity with the type-II citrate synthase from R. capsulatus. The higher NAD+/NADH ratio would increase condensation of oxaloacetate with acetyl-CoA and, therefore, increase flux through the TCA cycle. No bicarbonate is supplied to the media when 3-hydroxypropionate is the carbon substrate, therefore, all CO2 must be generated from it during photoheterotrophic growth, so this could provide the necessary CO2 for the CBB cycle, as well as, the reductive 3- hydroxypropionate-assimilatory pathway (Chapter 3 Discussion). Furthermore, increased

CO2 fixation via the CBB cycle, resulting in more 3-phosphoglycerate, could alter the C3 pool sizes including PEP and pyruvate. In support of this idea, PEP was identified as part of the unknown peak detected in spent media during 3-hydroxypropionate-growth for the suppressor mutants. Ultimately, this would result in a smaller acetyl-CoA pool. Acetyl-

CoA is the input for both the TCA cycle and the ethylmalonyl-CoA pathway, therefore, channeling more for the former would limit the amount available for the latter. While no

122 regulatory system controlling the ethylmalonyl-CoA pathway has been discovered in R. sphaeroides, acetyl-CoA levels have been implicated in controlling flux through the PHB biosynthetic/ethylmalonyl-CoA pathway in Methylobacterium extorquens AM1

(Korotkova et al. 2002). Furthermore, the 3-hydroxypropionate-dependent growth inhibition of Rsmcd11KB observed under chemoheterotrophic growth is less pronounced (Figure 14) supporting a beneficial effect of oxidizing more acetyl-CoA as needed for oxidative respiration. Obviously, more work is required to truly understand how the PrkB_R186 variants influence the ethylmalonyl-CoA pathway, but this provides a framework to guide future experiments.

4.4.6 Possible role of the cysteines in PrkB

The difference in cysteine residues between PrkA and PrkB was an interesting observation made while looking at possible effects caused by the change to residue R186.

Disulfide bonds in eukaryotic and cyanobacterial Prks are used to regulate activity though no such mechanism has been shown to exist for prokaryotic Prks (Graciet et al. 2004;

Kung et al. 1999). Looking at a molecular model for PrkB (data not shown), a distance of

13 Å is predicted between C136 and C194 which would not be conducive to forming a disulfide bond. However, considering conformational changes caused by substrate binding and product release (Kung et al. 1999), as well as, C136 being a part of an unstructured loop, there is plausibility for the distance to change and formation of a disulfide bond to occur. As the accessibility of a proposed disulfide bond cannot be discerned from the model, possibly, it could impose a structural change that puts it in a conformation more similar to the allosteric R state as described for the PrkA_R186Q

123 variant which could explain the decreased NADH activation requirement for PrkB. This could also potentially explain why PrkB was far more unstable during the purification process resulting in 85 % less activity than PrkA (Novak and Tabita 1999). Alternatively, if the bond were accessible, it could suggest a regulatory mechanism similar to that imposed by plant PRK where activation of the protein requires thioredoxin-mediated reduction or interaction with other proteins of the CBB cycle similar to plant and cyanobacterial Prks (Gontero and Maberly 2012; Graciet et al. 2004). Finally, considering the cysteine difference between PrkA and PrkB, Ralstonia eutropha, a non- phototrophic, metabolically versatile beta-proteobacterium, encodes two Prk isozymes in separate CBB operons, similar to R. sphaeroides, that share 96 % amino acid identity between each other where one encodes two cysteines and the other encodes three cysteines. In vitro studies have not been done on these isozymes, however, it would provide further support for the importance of the cysteines to know if NADH activation requirements differ between these two isozymes as well.

4.5 Suggested future directions

Many questions are left unanswered. The release of PEP by the suppressor mutant

mch3HP+1-1 during photoheterotrophic growth with 3-hydroxypropionate, suggests that intracellular metabolite pool sizes are changing which we suggest to be a result of flux at higher NAD+/NADH and allowing for the increased flux of the TCA cycle. Along with

PEP, other intracellular metabolite levels should be measured including acetyl-CoA, oxaloacetate, PEP, and citrate. These possible changes in pool sizes could provide

124 evidence for increased fluxes of the CBB cycle and TCA cycle as well as suggest possible intermediates sensed by the ethylmalonyl-CoA pathway.

To correlate with the pool sizes, enzyme levels of RubisCO should be determined in suppressor strains compared to wild type grown with 3-hydroxypropionate to determine if increased activity is present in the suppressors. Allosteric regulation of citrate synthase would make it difficult to measure a difference as any change would be lost during breakage and dilution of the cells, however, -ketoglutarate dehydrogenase complex activity upregulation could imply more flux through the TCA cycle. Due to both isozymes being present and the predicted change expected to not drastically alter Vmax,

Prk activity may not provide any conclusive evidence, therefore, in vitro characterization of PrkB_R186 variants should be performed first to determine the effects of altering the residue. While we focused on the R186C variant, other residues should be investigated to compare the functional differences each one might confer.

Determination of how flux through the ethylmalonyl-CoA pathway is being limited should be investigated in the suppressors during 3-hydroxypropionate growth starting with measurements of both transcript levels and activity for Ccr as it is the committed step and shown to be upregulated during acetate growth (Carter 2014). While, acetyl-CoA levels are implicated to be limiting the flux through the pathway, there is still the possibility that a specific step is being targeted. As the Ccr activity levels measured using NADPH oxidation were not detectable in cell extracts grown with 3- hydroxypropionate (Schneider et al. 2012), a radiometric assay using labeled bicarbonate can be used instead in order to observe any difference. Comparison between wild type

125 and WTprkB*7 grown with acetate could also be used and provide more robust activities that could be compared. Additionally, quantification of polyhydroxybutyrate (PHB) should be done with the suppressor strains vs wild type grown with 3-hydroxypropionate to determine if there is any change. Decreased PHB quantities in the suppressors could suggest that less flux is occurring in that part of the ethylmalonyl-CoA pathway while increased PHB in the suppressors would suggest that the blockage is at either crotonyl-

CoA or ethylmalonyl-CoA formation.

One of the interesting observations made while comparing the amino acid sequence and molecular models of PrkA to PrkB is the presence of two cysteine residues in PrkB as compared to one cysteine in PrkA. For PrkB, molecular modeling of the protein shows the two cysteines to be in range of interacting suggesting the possibility of a disulfide bond to form. The isolation of strains encoding PrkB or PrkB_R186C with the additional C-terminal StrepTagII will allow for characterization of the in vivo state of the proteins to determine if modifications to the identified cysteines are present or interaction with other proteins can be co-eluted.

126

Chapter 5: Investigation into the role of propionyl-CoA carboxylase during propionate, acetate, and 3-hydroxypropionate assimilation: a crossroad of the methylmalonyl-CoA, ethylmalonyl-CoA, and 3-hydroxypropionate reductive pathways in Rhodobacter sphaeroides

Contributions to this work: The initial detection and characterization of the propionate excretion from RsΔpccBSJC1A during acetate growth was performed by Dr. Michael Carter (Carter 2014).

5.1 Introduction

The Gram-negative, purple non-sulfur bacterium Rhodobacter sphaeroides is a metabolically versatile microorganism capable of assimilating a variety of organic carbon sources under photoheterotrophic growth conditions. Obtaining energy from light via cyclic photophosphorylation, R. sphaeroides does not oxidize the supplied carbon for

ATP production but rather is able to convert it all to biomass. This attribute makes R. sphaeroides an ideal model organism to understand how carbon is assimilated by the cell.

Recently, work in our lab has focused on three different carbon assimilatory pathways

(Figure 18) that are used by R. sphaeroides; the methylmalonyl-CoA pathway (Carter and

Alber 2015), the ethylmalonyl-CoA pathway (Erb et al. 2007; Erb et al. 2008; Erb et al.

2009a; Erb et al. 2009b; Erb et al. 2010), and the 3-hydroxypropionate reductive pathway

(Schneider et al. 2012; Asao and Alber 2013).

127

Figure 19 Biochemical pathways of R. sphaeroides linking 3-hydroxypropionate assimilation to central carbon metabolism. Precursor metabolites are represented in boxes in panel A. A) Metabolic scheme showing possible routes by which 3-hydroxypropionate can enter central carbon metabolism at both, the level of acetyl-CoA via an oxidative pathway and at the level of succinyl-CoA via a reductive pathway. Acetyl-CoA generated via the oxidative pathway can be used directly for the synthesis of cell constituents, such as fatty acids, or could enter the ethylmalonyl-CoA pathway. The series of chemical reactions catalyzed by enzymes specific to B) the reductive 3-hydroxypropionate assimilatory pathway, C) the oxidative 3-hydroxypropionate pathway, D) the methylmalonyl-CoA pathway, and E) the ethylmalonyl-CoA pathway of R. sphaeroides 2.4.1. Abbreviations: AcuI, acrylyl-CoA reductase; Ccr, crotonyl-CoA carboxylase/reductase; DddC, proposed malonate semialdehyde dehydrogenase; Ecm, ethylmalonyl-CoA mutase; Epi, ethylmalonyl- CoA/methylmalonyl-CoA epimerase; Mcd, methylsuccinyl-CoA dehydrogenase; Mch, mesaconyl-CoA hydratase; Mcl1, (3S)-malyl-CoA/β-methylmalyl-CoA lyase; Mcl2, (3S)-malyl-CoA thioesterase; Mcm, methylmalonyl-CoA mutase; PccBA, propionyl-CoA carboxylase; PHA, polyhydroxyalkanoates; CBB Cycle, Calvin-Benson-Bassham cycle or reductive pentose phosphate pathway.

128

- For R. sphaeroides, growth with propionate/HCO3 requires the methylmalonyl-

CoA pathway (Figure 19D) which is used by the cell for the assimilation of propionyl-

CoA (Carter and Alber 2015). In the methylmalonyl-CoA pathway, the first step is catalyzed by propionyl-CoA carboxylase, PccBA. This enzyme catalyzes the ATP- and biotin-dependent carboxylation of propionyl-CoA to (2S)-methylmalonyl-CoA and consists of two subunits. PccA is the biotin carboxylase where ATP is hydrolyzed to

- ADP and Pi concomitantly with the addition of HCO3 to the biotin cofactor. PccB, the carboxytransferase, then catalyzes the transfer and formation of the C-C bond between

- the HCO3 and the C2 of propionyl-CoA to form (2S)-methylmalonyl-CoA. The (2S)- methylmalonyl-CoA is then further converted by the other enzymes of the pathway to form the tricarboxylic acid cycle intermediate succinyl-CoA (Figure 18).

For acetyl-CoA assimilation in R. sphaeroides, the ethylmalonyl-CoA pathway

(Figure 19E) is required. This requirement has been shown using multiple deletion strains blocked at different steps in the pathway where growth with acetate has ceased (Figure

5). To assimilate acetyl-CoA using the ethylmalonyl-CoA pathway, initially two molecules of acetyl-CoA condense to form the C4 compound acetoacetyl-CoA (Alber et al. 2006). Further conversion to crotonyl-CoA occurs where the enzyme crotonyl-CoA carboxylase/reductase, Ccr, then catalyzes the reductive carboxylation of crotonyl-CoA to the C5 compound (2S)-ethylmalonyl-CoA (Erb et al. 2007; Erb et al. 2009a). This is considered the committed step of the pathway. From (2S)-ethylmalonyl-CoA, several novel enzymes specific for the pathway (Erb et al. 2008; Erb et al. 2009b; Zarzycki et al.

2008) are used to produce -methylmalyl-CoA which is then cleaved to form glyoxylate

129 and propionyl-CoA (Erb et al. 2010). The glyoxylate is then condensed with acetyl-CoA to form malyl-CoA and subsequently the CoA moiety is hydrolyzed to produce the intermediate of the tricarboxylic acid cycle S-malate. The propionyl-CoA formed from the cleavage of -methylmalyl-CoA then proceeds by the methylmalonyl-CoA pathway to succinyl-CoA. In this way the ethylmalonyl-CoA pathway is considered to be dependent on the methylmalonyl-CoA pathway. To this, it was shown that deletion of pccR, encoding the transcriptional activator for pccB led to a basal level of propionyl-

CoA carboxylase activity, which apparently was enough to support growth with acetate,

- but not with propionate/HCO3 (Carter and Alber 2015). However, the ability of R. sphaeroides to grow with acetate, or rather, assimilate acetyl-CoA, in the complete absence of propionyl-CoA carboxylase activity, has not been tested.

Finally, the 3-hydroxypropionate reductive pathway (Figure 19B) was recently discovered in R. sphaeroides where it was shown to involve the ATP- and CoA- dependent conversion of 3-hydroxypropionate to acrylyl-CoA (Schneider et al. 2012) which is then reduced to propionyl-CoA by the enzyme acrylyl-CoA reductase, AcuI

(Asao and Alber 2013). It was proposed that the propionyl-CoA formed from acrylyl-

CoA would then be assimilated using the methylmalonyl-CoA pathway, however, the requirement of the methymalonyl-CoA pathway for 3-hydroxypropionate assimilation has not been tested. Additionally, it was shown that the inactivation of the gene encoding

AcuI causes a growth defect with 3-hydroxypropionate where a reduced growth rate and yield is observed in the mutated strain (Schneider et al. 2012; Asao and Alber 2013;

Figure 22). Why growth is not completely abolished in this AcuI-negative strain is not

130 known. One possibility would be that carbon flux is diverted to the oxidative conversion of 3-hydroxypropionate to acetyl-CoA via malonate semialdehyde (Figure 19C). In R. sphaeroides, the ability of a Ccr-negative mutant to grow with 3-hydroxypropionate indicated that an oxidative pathway is not exclusively used for assimilation of 3- hydroxypropionate, as the ethylmalonyl-CoA pathway would be required to assimilate the acetyl-CoA formed (Schneider et al. 2012). However, the ability of the AcuI-negative strain to grow could imply that 3-hydroxypropionate carbon can be redirected to acetyl-

CoA via the oxidative pathway thus making the ethylmalonyl-CoA pathway essential for assimilation when the reductive pathway is blocked.

As described, propionyl-CoA formation and subsequent carboxylation represents a metabolic convergence juncture in R. sphaeroides during the assimilation of acetyl-

CoA, propionyl-CoA, and 3-hydroxypropionate. The aim of this study was to gain a better understanding of the importance of these pathways when used by R. sphaeroides in

- order to grow with acetate, propionate/HCO3 , and 3-hydroxypropionate. Here we show that a propionyl-CoA carboxylase-negative strain, RspccBSJC1A, is unable to grow

- with propionate/HCO3 , providing further evidence that the methylmalonyl-CoA pathway is required for propionyl-CoA assimilation. The same strain is then shown to grow with acetate where we uncover a propionate excretion mechanism used by the organism most likely to prevent accumulation of propionyl-CoA. Finally, evidence for the redirection of carbon through the ethylmalonyl-CoA pathway for assimilation of 3-hydroxypropionate in strains blocked in the reductive pathway is presented. Specifically, double mutants blocked in both the ethylmalonyl-CoA pathway and the reductive pathway cannot grow

131 with 3-hydroxypropionate while single mutants of either can. Further, flux through the ethylmalonyl-CoA pathway is shown in reductive pathway single mutants using the propionate excretion mechanism as well as inducing excretion of organic acids derived from the CoA-thioester intermediates of the ethylmalonyl-CoA pathway using the thioesterase, YciA. The presence of a 3-hydroxypropionate oxidative pathway is implied by the ability of R. sphaeroides to re-direct carbon from the reductive pathway to the ethylmalonyl-CoA pathway.

Table 22 Strains and plasmids used in Chapter 5 Name Relevant characteristics Reference Escherichia coli DH5 Cloning host SM10 RP4-2 Tc::Mu-Km::Tn7 Simon et al. (1983) S17-1 RP4-2 Tc::Mu Tpr Smr Scr Simon et al. (1983)

Rhodobacter sphaeroides 2.4.1 wild type with cbbR mutation; encodes R247Q variant DSMZ 158 Rsccr23KB In-frame deletion inactivation of ccr (rsp_0960) Chapter 3 RsacuI10BSJC In-frame deletion inactivation of acuI (rsp_1434) This work RspccBSJC1A In-frame deletion inactivation of pccB (rsp_2189) This work RspccBacuI44SJC In-frame deletion inactivation of acuI (rsp_1434); derived from This work RspccBSJC1A RsccracuI7ASJC In-frame deletion inactivation of acuI (rsp_1434); derived from This work Rsccr23KB RsccrpccB3BSJC In-frame deletion inactivation of pccB (rsp_2189); derived from This work Rsccr23KB RsccrpccBacuI6BSJC In-frame deletion inactivation of acuI (rsp_1434); derived from This work Rsccr23pccB3BSJC

Plasmids pBBRsm2MCS5SJC(D) Broad host range vector, Scr Smr, “empty vector” Chapter 3 pSC22 tetA promoter – acuI (rsp_1434) – rrnA terminator This work pSC56 pccB (rsp_2189) with constitutive tetA promoter from pRL27 This work pSC66 nptII promoter – ccr (rsp_0960) – rrnC terminator; tetA promoter – acuI This work (rsp_1434) – rrnA terminator pSC68 tetA promoter – pccB (rsp_2189) – rrnB – terminator; nptII promoter – This work ccr (rsp_0960) – rrnC terminator; tetA promoter – acuI (rsp_1434) – rrnA terminator pSC111 tetA promoter – acuI (rsp_1434) – rrnA terminator; nptII promoter – This work pccB (rsp_2189) – rrnB terminator pSC113 Escherichia coli yciA with rrnB promoter from R. sphaeroides 2.4.1 Chapter 3

pK18mobsacB Suicide vector in R. sphaeroides, Kmr SucroseS Schaefer et al. (1994) pKB15 In-frame deletion inactivation of ccr (rsp_0960) Chapter 3 pKB109 In-frame deletion inactivation of acuI (rsp_1434) This work pSC8 In-frame deletion inactivation of pccB (rsp_2189) This work

132

Table 23 Primers used in Chapter 5 Primer Sequence (5’  3’) Purpose Deltapcc-mcmup_rev1 AGCGGTGGGTACCGAACATGTCGAATTCCTCGAAC pccB upstream fragment deltapccBup_F1 CCGACATATGGCGCGATCTAGAGTTGCAGCAGCTGGTAGG pccB upstream fragment G deltapccBdown_for1 AGGCCATCGGTACCCTGCGGAACAAGAAAC pccB downstream fragment deltapccBdown_R2 CCGGCTGTTCAAGCTTCACGGCTTCTTCTTTC pccB downstream fragment UP_ccr_5' CCGGATGGCCCAGGCATACATCTC ccr upstream fragment UP_ccr_3' CGACGAGCCGCGCCTTCATGTAG ccr upstream fragment delta_ccr_KpnI_5' TAGGTACCCCGGATGGCCCAG ccr upstream fragment delta_ccr_XbaI_3' GTTCTAGACGACGAGCCGCGC ccr upstream fragment ccrdown_for2 CTCGCCGGGCTTCTCGATCTTG ccr downstream fragment ccrdown_rev2 CCCTGCATGTCCGAGGTCTTCC ccr downstream fragment deltaccrdown_for1 GCTAGGTACCTTCGCCGACGTGCTC ccr downstream fragment deltaccrdown_rev1 AGAGAATTCACCTGAGCGCCCTTGATG ccr downstream fragment DeltaRSP_1434up_for1 TTGCTGCAGTGGTTTGCAAGAAACTTTGTG acuI upstream fragment DeltaRSP_1434up_rev1 CTAGGTACCACCGTCCGAGGACGCATCGTCATTC acuI upstream fragment DeltaRSP_1434down_for1 CTCGGCAAGCTCGGTACCCGAAACGGACTGCGTATC acuI downstream fragment DeltaRSP_1434down_rev1 CTCCGGGCCGAATTCCAGGTTGAGGTCGGTAAG acuI downstream fragment RSccrcomp_SpeI_F2 AGCTCGGTACCACGGCGACTAGTACTTGCGGATCGCTC ccr for complementation RSccrcomp_NdeI_R2 ACAGGAGGCACATATGGCCCTCGACGTGCAGAGC ccr for complementation rrnA_terminator_F1 AAGGCCGCAGGTTCAAAGCTTGCCCCCGCATCTAGAAAAT rrnA terminator region G rrnA_terminator_R1 CGGCGCGCTGAGGCGGTACCACTAGTCCGCGACAGCAGAT rrnA terminator region G rrnB_terminator_F1 GAAGGCCGCAGGTTCAAAGCTTGCCCCCGCTCTAGAATTA rrnB terminator region ACGC rrnB_terminator_R1 ACGCCTCACAACGCGGTACCTTCCACGGATCGACTAGTAG rrnB terminator region CTTTC rrnC_terminator_F1 TGAAGGCCGCAAGCTTAAATCCTGCCCCCGCATCTAGAAT rrnC terminator region CCTGTC rrnC_terminator_R1 CCGTAGCGCGGTACCAGGAGGCTACTAGTGGGCTGATCAA rrnC terminator region G cp_PtetAacuI_ F TCGGGCTTTGTTAGCAGCCGGTACCACTAGTCATACCGCGC tetA promoter + acuI TCTC cp_PtetAacuI_ R ACTCACTATAGGGCGAATTTGAGCTCCACCGCGAAGCTTG tetA promoter + acuI CCGCTC pccBcomp_F GGGGCAAGCATATGAAAGACATTCTCCAGGAACTCGAGAA pccB for complementation C pccBcomp_R1 CCTCAGGTACCAGCCTCATACTAGTCCTCCTCCCGATCAG pccB for complementation PnptII_F1 GTGGGCTTACATGGCGAAAGCTTGACTGGGCGGTTTTCTAG nptII promoter ACAGC PnptII_R1 AATCCATCTTGTTCACATATGCGAAACGATCCTCATCC nptII promoter Restriction endonuclease recognition sites are underlined

5.2 Materials and Methods

5.2.1 Materials.

133

5.2.2 Bacterial strains and growth conditions

Refer to Chapter 3 (pg. 53) for bacterial growth conditions. All strains used in

Chapter 5 are listed in Table 22.

5.2.3 Isolation and complementation of R. sphaeroides mutant strains

5.2.3.1 Plasmid construction for isolation of strains with a ccr in-frame deletion

Refer to Chapter 3 (pg. 58).

5.2.3.2 Plasmid construction for isolation of strains with an acuI in-frame deletion

The suicide plasmid pKB109 employed for the marker-less in frame deletion of acuI (rsp_1434) was constructed by amplifying 48 bp of the 5’ acuI coding region plus

1,285 bp directly upstream (primers: DeltaRSP_1434up_for1/rev1) and 39 bp of the 3’ acuI coding region plus 1,053 bp directly downstream of acuI (primers:

DeltaRSP_1434down_for1/rev1) by PCR and cloning the products in tandem into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pKB109 contains an in- frame deletion of acuI of 894 bp. The remaining open reading frame encodes a 30 amino acid peptide.

5.2.3.3 Plasmid construction for isolation of strains with a pccB in-frame deletion

The suicide plasmid pSC8 employed for the marker-less in frame deletion of pccB

(rsp_2189) was constructed by amplifying 162 bp of the 5’ pccB coding region plus 681 bp directly upstream (primers: deltapccBup_F1/Deltapcc-mcmup_rev1) and 57 bp of the

3’ pccB coding region plus 792 bp directly downstream of pccB (primers: deltapccBdown_for1/deltapccBdown_R2) by PCR and cloning the products in tandem into pK18mobsacB (Schaefer et al. 1994). The resulting plasmid pSC8 contains an in-

134 frame deletion of pccB of 1,314 bp. The remaining open reading frame encodes a 74 amino acid peptide.

5.2.3.4 Plasmid construction for complementation of ccr23KB

Refer to Chapter 3 (pg. 60).

5.2.3.5 Plasmid construction for complementation of acuI10BSJC

For complementation of the RsΔacuI10BSJC mutant, pSC22 was obtained by amplifying a 227 bp fragment from the rrnA terminator region from R. sphaeroides genomic DNA with primers rrnA_terminator_F/R and inserting it into pSC45. For pSC45, a 1,381 bp fragment was amplified from plasmid pMA5-1 (Asao & Alber 2013) with primers cp_PtetAacuI_F/R and inserted into pBBRsm2(SJC)D.

5.2.3.6 Plasmid construction for complementation of pccBSJC1A

For complementation of the RsΔpccBSJC1A mutant, 1,580 bp fragment was amplified from R. sphaeroides 2.4.1 genomic DNA with primers pccBcomp_F/R1 and inserted into pUC19 resulting in pSC17. A 330 bp fragment from the rrnB terminator region was amplified from R. sphaeroides genomic DNA with primers rrnB_terminator_F1/R1 and inserted into pUC19 resulting in pSC16. The XbaI/KpnI fragment from pSC16 was then ligated into pSC17 resulting in pSC49. The NdeI/SpeI fragment from pSC49 was then ligated into the pBBRsm2(SJC)D-derived pSC45 resulting in pSC56. pBBRsm2(SJC)D-derived pSC45 is the source for the tetA promoter and was constructed using primers cp_PtetAacuI_ F/R and plasmid pMA5-1 (Asao &

Alber 2013) as the template.

135

5.2.3.7 Plasmid construction for complementation of RspccBacuI44SJC

For complementation of the RspccBacuI44SJC mutant, the 1477 bp XbaI/KpnI insert fragment from pSC22 was ligated into the 6823 bp SpeI/KpnI vector fragment from pSC54 resulting in pSC111. pSC22 was obtained by amplifying a 227 bp fragment from the rrnA terminator region from R. sphaeroides genomic DNA with primers rrnA_terminator_F/R and inserting it into pSC45.

5.2.3.8 Plasmid construction for complementation of RsccracuI7ASJC

For complementation of the RsccracuI7ASJC mutant, the 1477 bp XbaI/KpnI insert fragment from pSC22 was ligated into the 6602 bp SpeI/KpnI vector fragment from pSC62 resulting in pSC66. pSC22 was obtained by amplifying a 227 bp fragment from the rrnA terminator region from R. sphaeroides genomic DNA with primers rrnA_terminator_F/R and inserting it into pSC45. pSC62 was obtained by inserting the

1605 bp NdeI/KpnI fragment from pSC59 into the 5013 bp NdeI/KpnI fragment from pSC52. pSC52 was obtained by replacing the tetA promoter of pSC45 with the nptII promoter from pSC54. pSC59 was obtained by amplifying the ccr gene using primers

RSccrcomp_SpeI_F2/NdeI_R2 and inserting it into pSC19. pSC19 was obtained by amplifying the rrnC terminator region from R. sphaeroides genomic DNA with primers rrnC_terminator_F/R and inserting it into pUC19.

5.2.3.9 Plasmid construction for complementation of RsccrpccB3BSJC

For complementation of the RsccrpccB3BSJC mutant, the bp HindIII/SpeI insert fragment from pSC62 was ligated into the bp HindIII/XbaI vector fragment from pSC56 resulting in pSC67. 136

5.2.3.10 Plasmid construction for complementation of RsccrpccBacuI6BSJC

For complementation of the RsccrpccBacuI6BSJC mutant, the bp

HindIII/SpeI insert fragment from pSC56 was ligated into the bp HindIII/XbaI vector fragment from pSC66 resulting in pSC68.

5.2.3.11 Plasmid construction for yciA expression

Refer to Chapter 3 (pg. 61).

5.2.3.12 Isolation of ccr23KB

Refer to Chapter 3 (pg. 58).

5.2.3.13 Isolation of acuI10BSJC

Mutant strain RsΔacuI10BSJC was isolated by mating R. sphaeroides 2.4.1 with

E. coli S17-1 transformed with the suicide plasmid pKB109 and single and double crossovers were isolated as described previously (Carter & Alber 2015, Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred.

5.2.3.14 Isolation of pccBSJC1A

Mutant strain RsΔpccBSJC1A was isolated by mating R. sphaeroides 2.4.1 with

E. coli S17-1 transformed with the suicide plasmid pSC8 and single and double crossovers were isolated as described previously (Carter & Alber 2015, Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred. 137

5.2.3.15 Isolation of RspccBacuI1030SJC

Mutant strain RsΔpccBΔacuI1030SJC was isolated by mating strain

RsΔpccBSJC1A with E. coli S17-1 transformed with the suicide plasmid pKB109 and single and double crossovers were isolated as described previously (Carter & Alber 2015,

Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred.

5.2.3.16 Isolation of RsccracuI7ASJC

Mutant strain RsΔccrΔacuI7ASJC was isolated by mating strain RsΔccr23KB with E. coli S17-1 transformed with the suicide plasmid pKB109 and single and double crossovers were isolated as described previously (Carter & Alber 2015, Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred.

5.2.3.17 Isolation of RsccrpccB3BSJC

Mutant strain RsccrpccB3BSJC was isolated by mating strain RsΔccr23KB with E. coli S17-1 transformed with the suicide plasmid pSC8 and single and double crossovers were isolated as described previously (Carter & Alber 2015, Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred.

138

5.2.3.18 Isolation of RsccrpccBacuI6BSJC

Mutant strain RsccrpccB3BSJC was isolated by mating strain

RsccrpccB3BSJC with E. coli S17-1 transformed with the suicide plasmid pKB109 and single and double crossovers were isolated as described previously (Carter & Alber

2015, Chapter 2). The resulting mutant strains were genotyped by sequencing PCR amplicons derived from chromosomal DNA and primers that amplified the entire flanking regions where crossovers may have occurred.

5.2.4 Plasmid transfer via conjugation

The pBBRsm2(SJC)D plasmid (empty vector control), pSC22, pSC56, pSC66, pSC67, pSC68, pSC111, and pSC113 were independently conjugated into wild type,

RsΔccr23KB, RsΔacuI10BSJC, RsΔpccBSJC1A, RsΔpccBΔacuI1030SJC,

RsΔccrΔpccB3BSJC, RsΔccrΔacuI7ASJC, and RsΔccrΔpccBΔacuI6BSJC by mating the

R. sphaeroides strains with E. coli SM10 transformed with the respective plasmid as previously described in detail in Chapter 2.

5.2.5 Product analysis by High Performance Liquid Chromatography (HPLC).

Refer to Chapter 4 (pg. 100).

5.2.6 Gas Chromatography CO2 detection.

Refer to Chapter 3 (pg. 63).

5.2.7 Determination of the dry weight.

Refer to Chapter 3 (pg. 64).

139

5.3 Results

- 5.3.1 Inactivation of pccB abolishes growth with propionate/HCO3 for R. sphaeroides strain RspccBSJC1A.

For R. sphaeroides, the ATP- and biotin-dependent carboxylation of propionyl-

CoA to (2S)-methylmalonyl-CoA catalyzed by propionyl-CoA carboxylase, PccBA, is the immediate step following the reduction of acrylyl-CoA to propionyl-CoA in the 3- hydroxypropionate assimilatory reductive path (Schneider et al. 2012; Asao and Alber

2014). The enzyme also catalyzes an intermediate step in the ethylmalonyl-CoA pathway

(Erb et al. 2007) and methylmalonyl-CoA pathway (Carter and Alber 2015) used for assimilation of acetyl-CoA and propionyl-CoA, respectively. The overlapping requirement of PccBA proposed in these three different metabolic pathways made it an obvious target for study, thus, the gene pccB encoding the carboxyltransferase subunit

PccB of the PccBA complex was inactivated in R. sphaeroides grown photoheterotrophically with minimal media succinate. The resulting in-frame deletion

- strain RspccBSJC1A was first tested for growth with propionate/HCO3 . For R. sphaeroides, the addition of bicarbonate to the media is required when grown with carbon sources more reduced than the average oxidation state of the cell (Richardson et al.

1988). As Figure 20 shows, growth was completely abolished for RspccBSJC1A, as compared to growth with succinate, and was restored with complementation. This result provides further evidence that the methylmalonyl-CoA pathway is the only pathway present in R. sphaeroides for propionyl-CoA assimilation (Carter and Alber 2015).

140

- Figure 20 Photoheterotrophic growth with succinate and propionate/HCO3 for R. sphaeroides mutant strains. Shown are wild type (), RspccBSJC1A (), RspccB (pccB) (), and RspccB (empty vector) (). Shown are representative growth curves from a single experiment. Performed in biological triplicate.

5.3.2 Inactivation of pccB does not inhibit growth with acetate for R. sphaeroides strain RspccBSJC1A.

In the ethylmalonyl-CoA pathway, propionyl-CoA is formed as an intermediate where it is then further assimilated using the methylmalonyl-CoA pathway to ultimately enter the tricarboxylic acid cycle as succinyl-CoA (Figure 19). Compared to growth with

- propionate/HCO3 , growth with acetate for RspccBSJC1A was minimally affected with only a two-fold increase in doubling time along with a 20 % decrease in growth yield based on the final OD578 nm (Figure 21). Complementation with pccB restored growth.

141

Table 24 Photoheterotrophic growth of Rhodobacter sphaeroides with - propionate/HCO3 , acetate, 3-hydroxypropionate or succinate as the carbon source. Doubling time (hr) Strain propionate/ acetate 3-hydroxy- succinate - HCO3 propionate Rhodobacter sphaeroides 2.4.1 (WT) 4.50.9a 3.80.3 5.50.6 3.30.4 RsacuI10BSJC NDe ND 133 3.40.6 RsacuI10BSJC (acuI) ND ND 5.90.5c 3.50.4c RspccBSJC1A NGb 8.51 539 3.50.1 RspccBSJC1A (pBBR) NG ND 48d 4.60.6 RspccBSJC1A (pccB) 8.41.7 4.60.2 6.90.2 3.80 RspccBacuI44SJC ND ND 4910c 4.40.3 RspccBacuI44SJC (pccB + acuI) ND ND 6.30.3c 4.00.5c RsccrpccB3BSJC ND ND NG c 3.60.3c RsccrpccB3BSJC (ccr + pccB) ND ND 6.4d 3.6d RsccracuI7ASJC ND ND NG 3.51 RsccracuI7ASJC (ccr + acuI) ND ND 6.3d 3.8d RsccrpccBacuI6BSJC ND ND NG c 3.80.3c RsccrpccBacuI6BSJC ND ND 6.2d 3.5d (ccr + pccB + acuI) aAverage and standard deviation using three or more biological replicates unless otherwise noted bNG = no growth cAverage and  range with two biological replicates dSingle experiment eND = not determined

5.3.3 RspccBSJC1A excretes propionate during acetate-dependent growth

The moderate detriment to acetate-dependent growth caused by pccB inactivation was not expected as the ethylmalonyl-CoA pathway is required for assimilation of carbon sources entering central metabolism at the level of acetyl-CoA (Erb et al. 2007). The ethylmalonyl-CoA pathway blockage introduced by the pccB deletion occurs immediately after the cleavage of -methylmalyl-CoA which forms a molecule each of glyoxylate and propionyl-CoA. The glyoxylate is then condensed with a molecule of acetyl-CoA to form malyl-CoA followed by hydrolysis of the CoA moiety resulting in

142 the tricarboxylic acid cycle intermediate S-malate (Figure 19E). Potentially, the condensation of glyoxylate and acetyl-CoA leading to the formation of S-malate could still occur, maintaining precursor metabolite pools for growth. However, accumulation of propionyl-CoA should have deleterious effects by decreasing the coenzyme A pool similar to blockages at early steps in the ethylmalonyl-CoA pathway as shown in Chapter

3 (Figure 9, pg. 70). This did not seem to be the case, therefore, a mechanism limiting the propionyl-CoA pool size was proposed. Considering the decreased growth yield of the mutant when grown with acetate, it was proposed that a metabolic by-product such as propionate could be excreted resulting in loss of carbon for assimilation.

Photoheterotrophic growth with acetate was compared amongst wild type,

RspccBSJC1A, and RspccBSJC1A (pccB). Spent media was collected at different time points and analyzed using high performance liquid chromatography for detection of organic acids excreted as well as utilization of the growth substrate. The final amount of

CO2 present in the media and headspace was analyzed using gas chromatography with a thermal conductivity detector. Finally, dry cell weight was measured. This allowed for a total carbon balance to be made with the growing cultures. As shown in Table 25, 90 % of the carbon that was originally supplied to RspccBSJC1A culture as acetate was used by the cell where one third of it was converted to propionate. Wild type and

RspccBSJC1A (pccB) converted all the acetate to biomass and CO2 while no propionate was detected in the spent media.

143

Figure 21 Propionate excretion in RspccBSJC1A strains grown photoheterotrophically with acetate. Growth was monitored by optical density for A) wild type (), B) RspccBSJC1A (pccB) (), and C) RspccBSJC1A () while use of the growth substrate acetate () and production of propionate () was monitored in the growth cultures. The results shown are from a single representative experiment. Performed in biological quadruplicate.

5.3.4 RspccBSJC1A can still grow with 3-hydroxypropionate

In the reductive path for 3-hydroxypropionate assimilation, propionyl-CoA is formed from the reduction of acrylyl-CoA (Figure 19). Again, this propionyl-CoA is proposed to then use the methylmalonyl-CoA pathway for further assimilation.

144

Table 25 Carbon balance after photoheterotrophic growth for R. sphaeroides strains Organic acids detected in Total supernatantc Carbon a b Carbon Biomass CO2 Ace Prop balance source Strain (mol carbon / mol starting carbon x 100%) Acetate Wild type 96±3e 11±2 NDd ND 105±1 RsΔpccBSJC1A 49±3 14±4 9±1 29±2 99±9 RsΔpccBSJC1A (pccB) 91±5 12±5 ND ND 101±5 a Based on 22.4 g cell dry weight / mol C b Headspace CO2 + dissolved supernatant CO2 c Amount at final OD578nm d ND = not detected eData represents four biological replicates with standard deviation

The inhibited growth of RspccBSJC1A with 3-hydroxypropionate supported the role of propionyl-CoA carboxylation for 3-hydroxypropionate assimilation, however, we expected growth to be completely abolished. If 3-hydroxypropionate can only be assimilated via the reductive pathway which proceeds to propionyl-CoA, and the methylmalonyl-CoA pathway is the only way to assimilate propionyl-CoA (Figure 19), then we would expect there to be no growth with 3-hydroxypropionate for

RspccBSJC1A. Therefore, a different pathway or mechanism for the carbon to bypass the blockage at the propionyl-CoA carboxylase step must be present. Considering our results from Chapter 2, where an oxidative pathway was proposed which converts 3- hydroxypropionate to acetyl-CoA via malonate semialdehyde, we decided to investigate the requirement of the ethylmalonyl-CoA pathway in RspccBSJC1A. If 3- hydroxypropionate was being converted to acetyl-CoA, to then be assimilated, it would require the use of the ethylmalonyl-CoA pathway (Erb et al. 2007). Furthermore, while propionyl-CoA carboxylase is a part of the ethylmalonyl-CoA pathway, we showed that assimilation of acetyl-CoA is still possible with RspccBSJC1A (Figure 21).

145

5.3.5 RspccBSJC1A and RspccBacuI44SJC display similar growth phenotypes with 3-hydroxypropionate that differ from RsacuI10BSJC

As part of testing the use of the ethylmalonyl-CoA pathway for 3- hydroxypropionate assimilation in RspccBSJC1A, we wanted to understand why there was a difference in growth for RspccBSJC1A and RsacuI10BSJC (Figure 22). In the strain RsacuI10BSJC, inactivation of the acrylyl-CoA reductase, AcuI, which catalyzes the reduction of acrylyl-CoA to propionyl-CoA in the reductive path, results in a growth defect with 3-hydroxypropionate that is not as severe as that observed for

RspccBSJC1A (Figure 22).

Figure 22 Photoheterotrophic growth with succinate and 3-hydroxypropionate for R. sphaeroides mutant strains. Shown are wild type (), Rsccr23KB () RsacuI10BSJC () RspccBSJC1A () RspccBacuI44SJC () RsccrpccB3BSJC () RsccracuI7ASJC () and RsccrpccBacuI6BSJC (). Shown are representative growth curves.

146

As the reductive pathway is considered linear, we hypothesized that the difference was due to the role of propionyl-CoA carboxylase in the ethylmalonyl-CoA pathway which could be used to assimilate acetyl-CoA derived from 3-hydroxypropionate oxidation.

RsacuI10BSJC would still have a complete ethylmalonyl-CoA pathway which could allow for the increased growth rate and yield with 3-hydroxypropionate. To test this idea, we generated the double mutant strain RspccBacuI44SJC and grew it with 3- hydroxypropionate to determine if the PccB-negative phenotype was dominate. As shown in Figure 22, RspccBacuI44SJC exhibited a growth defect similar to RspccBSJC1A with 3-hydroxypropionate compared to RsacuI10BSJC suggesting the presence or absence of AcuI did not matter for RspccBSJC1A to assimilate 3-hydroxypropionate.

Alternatively, propionyl-CoA carboxylation was required for the improved 3- hydroxypropionate growth observed with RsacuI10BSJC . This supported the role of the ethylmalonyl-CoA pathway.

5.3.6 The ethylmalonyl-CoA pathway is required for 3-hydroxypropionate- dependent growth of RsacuI10BSJC, RspccBSJC1A, and RspccBacuI44SJC

Based on the observation that the ability to carboxylate propionyl-CoA allowed for faster growth and a higher growth yield with 3-hydroxypropionate for

RsacuI10BSJC, we wanted to further test the importance of the ethylmalonyl-CoA pathway in these deletion strains. To this end, we first inactivated the ccr gene in

RspccBSJC1A, RsacuI10BSJC, and RspccBacuI44SJC resulting in the in-frame deletion strains RsccracuI7ASJC, RsccrpccB3BSJC, and

RsccrpccBacuI6BSJC. The inactivation of ccr in a wild-type background does not 147 cause growth inhibition with 3-hydroxypropionate since the reductive pathway is complete (Figure 22), therefore, any change observed when inactivated in the mutant strains would indicate that the ethylmalonyl-CoA pathway is now required for growth.

Therefore, growth with 3-hydroxypropionate was compared. Looking at Figure 22, it can be seen that for all three strains, for which the reductive pathway was interrupted, deletion of ccr resulted in the inability to use 3-hydroxypropionate as a carbon source.

This observation indicated that the ability for RspccBSJC1A, RsacuI10BSJC, and

RspccBacuI44SJC to grow with 3-hydroxypropionate required the ethylmalonyl-CoA pathway.

5.3.7 Flux through the ethylmalonyl-CoA pathway occurs in RsacuI10BSJC and RspccBSJC1A

To directly test if flux occurs through the ethylmalonyl-CoA pathway in

RspccBSJC1A and RsacuI10BSJC during growth with 3-hydroxypropionate, we tested for carbon flux through the pathway using RsacuI10BSJC and RspccBSJC1A expressing the Escherichia coli yciA gene which encodes a thioesterase. This thioesterase cleaves the CoA from mesaconyl-CoA, an intermediate of the ethymalonyl-CoA pathway, and causes excretion of mesaconate in the growth media (Chapter 3). At the final time point in the growth experiment (Figure 23), spent media was collected and analyzed using HPLC to detect the presence of organic acids. Mesaconate was detected in the spent media of RsacuI10BSJC (yciA) and RspccBSJC1A (yciA) at concentrations of 122 M and 303 M (n=2), respectively, compared to that determined for wild type

(yciA), 41 M (n=3) (Figure 11, pg. 73; Table 13, pg. 74). Also, as a consequence of

148 excreting mesaconate, the growth yield was lower for both strains, indicating a loss of carbon that could have been used for assimilation (Figure 23). This finding supports the notion that carbon flux through the ethylmalonyl-CoA pathway is occurring during 3- hydroxypropionate-dependent growth of RsacuI10BSJC and RspccBSJC1A.

Figure 23 Photoheterotrophic growth with succinate and 3-hydroxypropionate for R. sphaeroides mutant and yciA-expressing strains. Shown are wild type () RsacuI10BSJC () RspccB1ASJC () RspccB1ASJC (yciA) () RsacuI10BSJC (yciA) (). Shown are growth curves from a single experiment. The yciA expressing strains were performed in biological duplicate and error bars are shown.

5.3.8 Propionate is excreted during 3-hydroxypropionate-dependent growth for RspccBSJC1A and RspccBacuI44SJC

To independently assess if flux through the ethylmalonyl-CoA pathway was occurring in RspccBSJC1A or RspccBacuI44SJC during growth with 3- hydroxypropionate, we tested to see if propionate would be excreted similar to growth with acetate for RspccBSJC1A. Spent media was collected at the final time point for growth with 3-hydroxypropionate and analyzed using HPLC (Figure 24). Propionate 149 could be detected during growth for both RspccBSJC1A and RspccBacuI44SJC, however, the background in the HPLC chromatograms was elevated and the amount excreted could not be measured using our current separation method. Furthermore, a significant amount of the 3-hydroxypropionate remained in the media at the end of growth for RspccBSJC1A and RspccBacuI44 considering the peak size of the chromatogram, however, the amount was not quantified. Therefore, growth ceased prior to using all the substrate provided.

Figure 24 HPLC chromatogram of spent media from R. sphaeroides strains grown photoheterotrophically with 3-hydroxypropionate. Samples were taken from growth cultures of (—) wild type, (—) RspccBSJC1A, (—) RsacuI10BSJC, and (—) RspccBacuI44SJC after reaching their respective final OD578nm. Samples were acidified and analyzed at 210 nm using ion-exclusion high performance liquid chromatography that retains weak organic acids. The propionate peak is indicated. The smaller peak in the propionate standard is from an unidentified contaminant that was present in all standards/runs. An unknown peak was identified in the spent media of RsacuI10BSJC and RspccBacuI44SJC and is indicated by an arrow. The large peaks observed between 10 and 15 min for RspccBSJC1A and RspccBacuI44SJC shown here were not reproducible therefore they were considered contamination. 150

Propionate excretion was not expected for RsacuI10BSJC grown with 3- hydroxypropionate as propionyl-CoA carboxylase is still present. As such, spent media was analyzed from RsacuI10BSJC growth with 3-hydroxypropionate after reaching final OD578nm and no propionate could be detected (Figure 24). However, an unknown peak was identified. We could not identify the identity of the metabolite using standards in our laboratory including acrylic acid which was initially suspected. The same peak was also present in the spent media of RspccBacuI44SJC grown with 3- hydroxypropionate, but not in the spent media of RspccBSJC1A (Figure 24). Therefore, the unknown peak was specific to the deletion of acuI. Also, similar to RspccBSJC1A and RspccBacuI44, growth with 3-hydroxypropionate ceased for RsacuI10BSJC prior to using all the substrate, as detected using HPLC, though the final amount remaining was not quantified.

5.4 Discussion

In R. sphaeroides, a reductive path for 3-hydroxypropionate assimilation is used where the enzyme acrylyl-CoA reductase, AcuI, catalyzes the NADPH-dependent reduction of acrylyl-CoA to propionyl-CoA (Asao and Alber 2013; Schneider et al.

2012). Deletion of the encoding gene acuI resulted in an increased doubling time and decreased growth yield with 3-hydroxypropionate as compared to wild type which supported the use of the reductive path during 3-hydroxypropionate assimilation (Asao and Alber 2013; Figure 22). The initial goal of the work presented here was to further characterize the reductive path used for 3-hydroxypropionate assimilation. To this end,

151 we tested the requirement of propionyl-CoA carboxylase, PccBA, which catalyzes the next step in the reductive pathway, by generating the in-frame deletion strain

RspccBSJC1A. Furthermore, as an enzyme predicted to be required for propionyl-CoA and acetyl-CoA assimilation in R. sphaeroides, further work was performed to characterize the phenotype of RspccBSJC1A when grown photoheterotrophically with

- propionate/HCO3 or acetate.

5.4.1 Rhodobacter sphaeroides only uses the methymalonyl-CoA pathway for assimilation of propionyl-CoA

Prior to determining how the inactivation of PccBA would affect growth with 3- hydroxypropionate, we sought to investigate if assimilation of propionyl-CoA was dependent on PccBA. To do this, we tested RspccBSJC1A for the ability to grow with

- - propionate/HCO3 (Figure 20). Growth with propionate/HCO3 in R. sphaeroides has been shown to require propionyl-CoA carboxylase activity as part of the methylmalonyl-CoA pathway in R. sphaeroides. However, it was the deletion of the transcriptional activator for pccB in an R. sphaeroides mutant strain where a basal level of propionyl-CoA carboxylase activity could still be detected and this was used to explain the inability to

- grow with propionate/HCO3 (Carter and Alber 2015). We wanted to show that actually

- deleting pccB resulted in the inability to grow with propionate/HCO3 . As such,

RspccBSJC1A, which encodes a truncated pccB gene, can no longer grow with

- propionate/HCO3 . These results indicate that the methylmalonyl-CoA pathway is the only pathway present in R. sphaeroides to assimilate propionyl-CoA.

152

5.4.2 Rhodobacter sphaeroides can still use the ethylmalonyl-CoA pathway for acetate assimilation without propionyl-CoA carboxylase

Loss of propionyl-CoA carboxylase, catalyzing an intermediate step of the ethylmalonyl-CoA pathway for acetyl-CoA assimilation, resulted in slower growth and a decreased doubling time with acetate compared to wild type (Figure 21), though, the expectation was that a more severe growth defect would be observed as the PccBA catalyzed reaction in the ethylmalonyl-CoA pathway was considered necessary to prevent the build-up of propionyl-CoA. We showed that propionyl-CoA does not build-up but rather the CoA moiety must be removed and propionate is excreted. As shown in Table

25, the excretion of propionate was primarily balanced by a loss of biomass. Released

CO2 levels were similar amongst the three strains though slightly higher for

RspccBSJC1A. This was most likely due to the loss of the more reduced carbon in propionate which would require release of the more oxidized CO2 to maintain proper redox balance in the cell. We assumed that the average oxidation state of the cellular carbon in R. sphaeroides to be -0.5 based on the cellular elemental composition

CH1.8N0.18O0.38 determined for Rhodopseudomonas palustris (Carlozzi and Sacchi 2001).

The mechanism for the CoA removal from propionyl-CoA is not known though similar results were observed in an Aspergillus nidulans methylcitrate cycle mutant where propionyl-CoA accumulation during growth with propionate could be prevented by the addition of acetate to the media (Fleck and Brock 2008). An acyl-CoA:carboxylate

CoA transferase (CoaT) was purified from A. nidulans and shown to transfer the CoA from propionyl-CoA to acetate forming propionate and acetyl-CoA. The enzyme was

153 proposed to serve as a detoxification mechanism to prevent accumulation of propionyl-

CoA as a result of the metabolic disruption (Fleck and Brock 2008). In R. sphaeroides, the gene rsp_0029 encodes a protein annotated as an acetyl-CoA hydrolase/transferase which shares 44 % amino acid sequence identity with CoaT and has been shown to be upregulated in cells grown with acetate compared to cells grown with glucose (Alber et al. 2006). During acetate growth with RspccBSJC1A, propionyl-CoA accumulation could be prevented by the transfer of the CoA moiety to acetate, similar to A. nidulans, thus activating it to acetyl-CoA for continued flux through the ethylmalonyl-CoA pathway. This would be a favorable CoA transfer loop where the carbon source is activated and the inhibitory molecule is eliminated. Also, this would explain the hyperbolic growth curve (Figure 21) and the inability to fully assimilate all the acetate

(Table 25). The initially high concentration of acetate favors the formation of acetyl-

CoA, however, decreasing amounts of acetate due to growth reach a level where the CoA transfer becomes rate-limiting and eventually to a level below the binding affinity of the transferase for acetate. This was seen during growth where the decrease in acetate in the media is inversely proportional to, both, the increase in OD578nm and the increase in propionate (Figure 21).

5.4.3 The transferase activity could also explain propionate excretion during 3- hydroxypropionate dependent growth.

Extending this hypothesis to 3-hydroxypropionate growth with RspccBSJC1A, where propionate was also detected in the spent media (Figure 24), would first require the assumption that the gene product of rsp_0029 is capable of using 3-hydroxypropionate as

154 an acceptor molecule. The enzyme, CoaT, was shown to also use propionate and succinate albeit with lower activity and a higher Km (Fleck and Brock 2008). Second, transfer of the CoA to 3-hydroxypropionate would generate 3-hydroxypropionyl-CoA which is most likely the first intermediate in the reductive path (Schneider et al. 2012).

This could create a futile cycle where any 3-hydroxypropionate activated by the transferase to form propionate for excretion would then be converted to a new propionyl-

CoA molecule. Decreased activity with 3-hydroxypropionate could explain the higher doubling time while lower apparent binding affinity for 3-hydroxypropionate could explain the lower growth yield.

5.4.4 The ethylmalonyl-CoA pathway can be used by R. sphaeroides to assimilate 3- hydroxypropionate and implies the use of the 3-hydroxypropionate oxidative pathway

- The complete inhibition of growth for RspccBSJC1A with propionate/HCO3 indicated that propionyl-CoA has no other biochemical means to be assimilated in R. sphaeroides. Therefore, the growth of RspccBSJC1A with 3-hydroxypropionate (Figure

22) suggests that 3-hydroxypropionate must be converted to a different molecule which can be assimilated for entry into central carbon metabolism and does not require propionyl-CoA carboxylase. As shown in Chapter 2, evidence is presented that implicates the oxidation of 3-hydroxypropionate to acetyl-CoA via malonate semialdehyde to be occurring during growth with 3-hydroxypropionate. The formation of acetyl-CoA would then require the ethylmalonyl-CoA pathway for assimilation. In support of this idea, inactivation of ccr, in either an acuI-negative or pccB-negative strain, leads to complete loss of growth with 3-hydroxypropionate while growth to some degree was observed with 155 only a single deletion (Figure 22). Furthermore, increased carbon flux through the ethylmalonyl-CoA pathway is observed in RsacuI10BSJC (yciA) and RspccBSJC1A

(yciA) during growth with 3-hydroxypropionate as increased excretion of mesaconate in the mutants compared to wild type can be detected while growth yield decreases (Figure

23). Finally, the detection of propionate excretion in RspccBSJC1A and

RspccBacuI44SJC during growth with 3-hydroxypropionate supports flux through the pathway as well. Taken together, the work presented shows that the ethylmalonyl-CoA pathway can and must be used when a blockage in the reductive path is present in R. sphaeroides. This implies that the acetyl-CoA required for entry into the ethylmalonyl-

CoA pathway is generated by 3-hydroxypropionate oxidation though further work is needed to show that this is occurring.

5.5 Future directions

Further work should be done on rsp_0029 encoding the putative acetyl-CoA hydrolase to understand the propionate excretion mechanism. Purification and characterization of the protein can be done to determine if it has transferase activity similar to CoaT, as well as, see if it can use 3-hydroxypropionate as a substrate.

Furthermore, inactivation of rsp_0029 in the strain RspccBSJC1A compared to inactivation of it in wild type could provide in vivo evidence as being responsible for the propionate excretion. Finally, RspccBSJC1A growth with other carbon substrates that enter central carbon metabolism at the level of acetyl-CoA, thereby requiring the ethylmalonyl-CoA pathway, but not forming acetate or 3-hydroxypropionate along the 156 way, can be tested to see if the proposed transferase mechanism is specific to the presence of acetate or 3-hydroxypropionate.

Carbon balances should be performed on RsacuI10BSJC and RspccBSJC1A grown with 3-hydroxypropionate to better understand how the 3-hydroxypropionate is being converted to carbon products in these strains. Also, the identification of the unknown peak in the spent media of RsacuI10BSJC should be determined as it might suggest a different excretion mechanism to prevent build-up of metabolites.

Work throughout the different chapters has indicated that an oxidative path could be operating in R. sphaeroides during growth with 3-hydroxypropionate. Therefore, identification and characterization of the genes and enzymes responsible should be done as indicated in Chapter 2. Clearly, a relationship between the reductive path and the ethylmalonyl-CoA pathway exists where blockage of one can lead to use of the other which can be explained by the oxidative conversion of 3-hydroxypropionate to acetyl-

CoA.

157

References

1. Abdelal ATH, Schlegel HG. 1974. Purification and regulatory properties of phosphoribulokinase from Hydrogenomonas eutropha H16. Biochem. J. 139:481- 489.

2. Alber BE, Kung JW, Fuchs G. 2008. 3-hydroxypropionyl-coenzyme A synthetase from Metallosphaera sedula, an enzyme involved in autotrophic CO2 fixation. J. Bacteriol. 190:1383-9.

3. Alber BE, Spanheimer R, Ebenau-Jehle C, Fuchs G. 2006. Study of an alternate glyoxylate cycle for acetate assimilation by Rhodobacter sphaeroides. Mol Microbiol 61:297–309.

4. Asao M, Alber BE. 2013. Acrylyl-coenzyme A reductase, an enzyme involved in the assimilation of 3-hydroxypropionate by Rhodobacter sphaeroides. J Bacteriol 195:4716-4725.

5. Badger MR, Bek EJ. 2008. Multiple rubisco forms in proteobacteria: their functional significance in relation to CO2 acquisition by the CBB cycle. Journal of Experimental Botany. 59:1525-1541.

6. Bahatyrova S, Frese RN, Siebert CA, Olsen JD, van der Werf KO, van Grondelle R, Niedermann RA, Bullough PA, Otto C, Hunter CN. 2004. The native architecture of a photosynthetic membrane. Nature 430:1058-1062.

7. Bannerjee D, Sanders LE, Sokatch JR. 1970. Properties of purified methylmalonate semialdehyde dehydrogenase of Pseudomonas aeruginosa. J. Biol. Chem. 245:1828-1835.

8. Becker A, Fritz-Wolf K, Kabsch W, Knappe J, Schultz S, Volker Wagner AF. 1999. Structure and mechanism of the glycyl radical enzyme pyruvate formate-lyase. Nat. Struct. Biol. 10:969-75.

9. Biegel E, Schmidt S, González JM, Müller V. 2011. Biochemistry, evolution and physiological function of the Rnf complex, a novel ion-motive electron transport complex in prokaryotes. Cell. Mol. Life Sci. 68:613-634.

10. Blankenship RE, Madigan MT, Bauer CE. 1995. Anoxygenic Photosynthetic Bacteria. Kluwer Academic Publishers

158

11. Blombach B, Cramer A, Eikmanns BJ, and Schreiner M. 2009. RamB is an activator of the pyruvate dehydrogenase complex subunit E1p gene in Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 16:236-239.

12. Boubekeur S, Bunoust O, Camougand N, Catroviejo M, Rigoulet M, Guerin B. 1999. A mitochondrial pyruvate dehydrogenase bypass in the yeast Saccharomyces cerevisiae. J. Biol. Chem. 274:21044-21048.

13. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.

14. Brock M, Buckel W. 2004. On the mechanism of action of the antifungal agent propionate. Eur. J. Biochem. 271:3227-3241.

15. Buchanan BB, Balmer Y. 2005. Redox regulation: A broadening horizon. Annu. Rev. Plant Biol. 56:187-220.

16. Bullock HA, Reisch CR, Burns AS, Moran MA, Whitman WB. 2014. Regulatory and functional diversity of methylmercaptopropionate coenzyme A ligases form the dimethylsulfoniopropionate demethylation pathway in Ruegeria pomeroyi DSS-3 and other proteobacteria. J. Bacteriol. 196:1275-85.

17. Callely AG, Lloyd D. 1964. The metabolism of propionate in the colourless alga, Prototheca zopfi. Biochem J. 92: 338-345.

18. Carlozzi P, Sacchi A. 2001. Biomass and studies on Rhodopseudomonas palustris grown in an outdoor, temperature controlled, underwater tubular photobioreactor. J. Biotechnol. 88:239-249.

19. Carter MS and Alber BE. 2015. Transcriptional regulation by the short-chain fatty acyl coenzyme A regulator (ScfR) PccR controls propionyl coenzyme A assimilation by Rhodobacter sphaeroides. J Bacteriol. 197:3048-3056.

20. Carter MS. 2014. PhD thesis. The Ohio State University, Columbus, Ohio.

21. Charlier HA, Runquist JA, Miziorko HM. 1994. Evidence supporting catalytic roles for aspartate residues in phosphoribulokinase. Biochemistry. 33: 9343-9350.

22. Chou ME, Chang WT, Chang YC, Yang MK. 2009. Expression of four pha genes involved in poly-beta-hydroxybutyrate production and accumulation in Rhodobacter sphaeroides FJ1. Mol. Genet. Genomics. 282:97-106.

159

23. Chou ME, Yang MK. 2010. Analyses of binding sequences of the PhaR protein of Rhodobacter sphaeroides FJ1. FEMS Microbiol. Lett. 302:138-143.

24. Chowdhury EK, Nagata S, Misono H. 1996 3-Hydroxyisobutyrate dehydrogenase from Pseudomonas putida E23: purification and characterization. Biosci. Biotechnol. Biochem. 60:2043–2047.

25. Conrad R, Schlegel HG. 1977. Influence of aerobic and phototrophic growth conditions on the distribution of glucose and fructose carbon into the Entner- Doudoroff and Embden-Meyerhof pathways in Rhodopseudomonas sphaeroides. J. Gen. Microbiol. 101:277-290.

26. Curson ARJ, Todd JD, Sullivan MJ, Johnston AWB 2011. Catabolism of dimethylsulphoniopropionate: microorganisms, enzymes and genes. Nat. Rev. 9: 849-859.

27. Dangel AW, Tabita FR. 2015. CbbR, the master regulator for microbial carbon dioxide fixation. J. Bacteriol. 197:3488-3498.

28. Dangel AW, Gibson JL, Janssen AP, Tabita FR. 2005. Residues that influence in vivo and in vitro CbbR function in Rhodobacter sphaeroides and identification of a specific region critical for co-inducer recognition. Mol. Microbiol. 57:1397- 1414.

29. Den H, Robinson WG, Coon MJ. 1959. Enzymatic conversion of beta- hydroxypropionate to malonic semialdehyde. J. Biol. Chem. 234:1666-1671.

30. Dietrich J, Hennin U. 1970. Regulation of pyruvate dehydrogenase complex synthesis in Escherichia coli K12: Identification of the inducing metabolite. Eur. J. Biochem. 14:258-269.

31. Dijkhuizen L, Harder W. 1984. Current views on the regulation of autotrophic carbon dioxide fixation via the Calvin cycle in bacteria. Antonie van Leeuwenhoek. 50:473-487.

32. Dolan SK, Welch M. 2018. The glyoxylate shunt, 60 years on. Annu. Rev. Microbiol. 72:309-30.

33. Dolan SK, Wijaya A, Geddis SM, Spring DR, Silva-Rocha R, Welch M. 2018. Loving the poison: the methylcitrate cycle and bacterial pathogenesis. Microbiology. 164:251-259.

160

34. Dryden SC, Kaplan S 1993. Identification of cis-acting regulatory regions upstream of the rRNA operons of Rhodobacter sphaeroides. J Bacteriol 175:6392-6402.

35. Dubbs JM, Tabita FR. 2004. Regulators of nonsulfur purple phototrophic bacteria and the interactive control of CO2 assimilation, nitrogen fixation, hydrogen metabolism and energy generation. FEMS Microbiology Reviews. 28:353-376.

36. Dubbs JM, Tabita FR. 2003. Interactions of the cbbII promoter- operator region with CbbR and RegA (PrrA) regulators indicate distinct mechanisms to control expression of the two cbb operons of Rhodobacter sphaeroides. J. Biol. Chem 278:16443-16450.

37. Eidels L, Preiss J. 1970. Citrate synthase: a regulatory enzyme from Rhodopseudomonas capsulate. J. Biol. Chem. 245:2937-2945.

38. El-Mansi M, Cozzone AJ, Shiloach J, Eikmanns BJ. 2006. Control of carbon flux through enzymes of central and intermediary metabolism during growth of Escherichia coli on acetate. Curr. Opin. Microbiol. 9:173-179.

39. Erb TJ, Berg IA, Brecht V, Müller M, Fuchs G, Alber BE 2007. Synthesis of C5-dicarboxylic acids from C2-units involving crotonyl-CoA carboxylase/reductase: the ethylmalonyl-CoA pathway. Proc Natl Acad Sci USA 104:10631-10636.

40. Erb TJ, Brecht V, Fuchs G, Muller M, Alber BE. 2009a. Carboxylation mechanism and stereochemistry of crotonyl-CoA carboxylase/reductase, a carboxylating enoyl-thioester reductase. PNAS 106:8871-8876.

41. Erb TJ, Frerichs-Revermann L, Fuchs G, Alber BE. 2010. The apparent malate synthase activity of Rhodobacter sphaeroides is due to two paralogous enzymes, (3S)-malyl-CoA/beta-methylmalyl-CoA lyase and (3S)-malyl-CoA thioesterase. J. Bacteriol. 192:1249-1258.

42. Erb TJ, Fuchs G, Alber BE. 2009b. (2S)-Methylsuccinyl-CoA dehydrogenase closes the ethylmalonyl-CoA pathway for acetyl-CoA assimilation. Mol. Microbiol. 73:992-1008.

43. Erb TJ, Retey J, Fuchs G, Alber BE. 2008. Ethylmalonyl-CoA mutase from Rhodobacter sphaeroides defines a new subclade of coenzyme B12- dependent acyl-CoA mutases. J. Biol. Chem 283:32283-32293.

161

44. Ewering C, Heuser F, Benolken JK, Bramer CO, Steinbuchel A. 2006. Metabolic engineering of strains of Ralstonia eutropha and Pseudomonas putida for biotechnological production of 2-methylcitric acid. Metab. Eng. 8:587-602.

45. Farmer R, Tabita FR. 2015. Phosphoribulokinase mediates nitrogenase-induced carbon dioxide fixation gene repression in Rhodobacter sphaeroides. Microbiology. 161: 2184-2191.

46. Ferry JG. 2015. Acetate metabolism in anaerobes from the domain Archaea. Life (BaseI). 5:1454-1471.

47. Fleck CB, Brock M. 2008. Characterization of an acyl-CoA: carboxylate CoA- transferase from Aspergillus nidulans involved in propionyl-CoA detoxification. Molecular Microbiology. 68:642-656.

48. Fuchs G 1999. In: Biology of the Prokaryotes. Chapter 7: p. 115. Leneler JW, Drews G, Schlegel HG ed. Georg Thieme Verlag, Stuttgart, Germany.

49. Garrison E, Marth G. 2012. Haplotype-based variant detection from short-read sequencing. arXiv preprint arXiv:1207.3907 [q-bio.GN]

50. Gawron O, Glaid AJ, Fondy TP, Bechtold MM. 1962. New substrates, new inhibitors, and the stereochemistry of the succinic dehydrogenase system. J. Am. Chem. Soc. 84:3877-3882.

51. Gibson JL, Tabita FR. 1987. Organization of phosphoribulokinase and ribulose bisphosphate carboxylase/oxygenase genes in Rhodopseudomonas (Rhodobacter) sphaeroides. J. Bacteriol. 169:3685-3690.

52. Giovanelli J, Stumpf PK. 1958. Fat metabolism in higher plants. X. Modified beta oxidation of propionate by peanut mitochondria. J. Biol Chem. 231:411-426.

53. Gontero B, Maberly SC. 2012. An intrinsically disordered protein, CP12: jack of all trades and master of the Calvin cycle. Biochemical Society Transaction. 40:995-999

54. Goodwin GW, Rougraff PM, Davis EJ, Harris RA. 1989. Purification of methylmalonate-semialdehyde dehydrogenase from rat liver. Identity to malonate semialdehyde dehyhydrogenase. J. Biol. Chem. 264:14965-14971

162

55. Graciet E, Lebreton S, Gontero B. 2004. Emergence of new regulatory mechanisms in the Benson-Calvin pathway via protein-protein interactions: a glyceraldehyde-3-phosphate dehydrogenase/CP12/phosphoribulokinase complex. Journal of Experimental Botany. 55:1245-1254.

56. Guo Y, Oliver DJ. 2012. E. coli propionyl-CoA synthetase is regulated in vitro by an intramolecular disulfide bond. Appl. Biochem. Microbiol. 48:257-261.

57. Hallenbeck PL, Kaplan S. 1987. Cloning of the gene for phosphoribulokinase activity form Rhodobacter sphaeroides and its expression in Escherichia coli. J. Bacteriol. 169:3669-3678.

58. Hallenbeck PL, Lerchen R, Hessler P, Kaplan S. 1990. Phosphoribulokinase activity and regulation of CO2 fixation critical for photosynthetic growth of Rhodobacter sphaeroides. J. Bacteriol. 172: 1749-1761.

59. Harrison DHT, Runquist JA, Holub A, Miziorko HM. 1998. The crystal structure of phosphoribulokinase from Rhodobacter sphaeroides reveals a fold similar to that of adenylate kinase. Biochemistry. 37: 5074-5085.

60. Hartl J, Kiefer P, Meyer F, Vorholt JA 2017. Longevity of major coenzymes allow minimal de novo synthesis in microorganisms. Nature Microbiology 2:17073.

61. Hayaishi O, Nishizuka Y, Tatibana M, Takeshita M, Kuno S. 1961. Enzymatic studies on the metabolism of beta-alanine. J Biol Chem. 236:781-790.

62. Howard TP, Metodiev M, Lloyd JC, Raines CA. 2008. Thioredoxin-mediated reversible dissociation of a stromal multiprotein complex in response to changes in light availability. PNAS. 105:4056-4061.

63. Hu B, Lidstrom M. 2012. CcrR, a TetR family transcriptional regulator, activates the transcription of a gene of the ethylmalonyl coenzyme A pathway in Methylobacterium extorquens AM1. J. Bacteriol. 194:2802-2808.

64. Imhoff JF 2015. Genus Rhodobacter In Bergey’s Manual of Systematics of Archaea and Bacteria online, John Wiley & Sons, Inc.

65. J van Zyl L, Schubert WD, Tuffin M, Cowan D. 2014. Structure and functional characterization of pyruvate decarboxylase from Gluconacetobacter diazotrophicus. BMC Struct. Biol. 14:21

163

66. Joshi NA, Fass JN. 2011. Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files (Version 1.33) [Software]. Available at https://github.com/najoshi/sickle.

67. Jouanneau Y, Tabita FR. 1986. Independent regulation of synthesis of form I and form II ribulose bisphosphate carboxylase-oxygenase in Rhodopseudomonas sphaeroides. J Bacteriol 165:620-4.

68. Kelley, LA, Mezulis S, Yates CM, Wass MN, Sternberg MJE. 2015. The Phyre2 web portal for protein modeling, prediction, and analysis. Nature Protocols. 10:845-858.

69. Knappe J, Volker Wagner AF. 2001. Stable glycyl radical from pyruvate formate-lyase and ribonucleotide reductase (III). Advances in Protein Chemistry. 59:277-309.

70. Kobayashi D, Tamoi M, Iwaki T, Shigeoka S, Wadano A. 2003. Molecular characterization and redox regulation of phosphoribulokinase from the cyanobacterium Synechococcus sp. PCC7942. Plant and Cell Physiology. 44: 269- 276.

71. Kornberg HL, Krebs HA 1957. Synthesis of cell constituents from C2-units by a modified tricarboxylic acid cycle. Nature 17:988-991.

72. Kornberg HL, Madsen NB. 1958. The metabolism of C2 compounds in microorganisms: Synthesis of malate from acetate via the glyoxylate cycle. Biochem. J. 68:549-557.

73. Korotkova N, Chistoserdova L, Lidstrom M. 2002. Poly- β-hydroxybutyrate biosynthesis in the facultative methylotroph Methylobacterium extorquens AM1: Identification and mutation of gap11, gap20, and phaR. J. Bacteriol. 184: 6174- 6181.

74. Kovach ME 1994. pBBR1MCS: a broad-range cloning vector. Biotechniques 16:801-802.

75. Kung G, Runquist JA, Miziorko HM, Harrison DHT. 1999. Identification of the allosteric regulatory site in bacterial phosphoribulokinase. Biochemistry. 38:15157-15165.

76. Lagares A, Borella GC, Linne U, Becker A, Valverde C. 2017. Regulation of polyhydroxybutyrate metabolism in Sinorhizobium meliloti by the trans-encoded small RNA MmgR. J. Bacteriol. 199: e00776-16.

164

77. Laguna R, Tabita FR, Alber BE. 2011. Acetate-dependent photoheterotrophic growth and the differential requirement for the Calvin-Benson- Bassham reductive pentose phosphate cycle in Rhodobacter sphaeroides and Rhodopseudomonas palustris. Arch. Microbiol. 193:151-154.

78. Langmead B, Salzberg S. 2012. Fast gapped-read alignments with Bowtie 2. Nat. Meth. 9:357-359.

79. Leadbeater L, Bowien B. 1984. Control of autotrophic carbon assimilation in Alcaligenes eutrophus by inactivation and reactivation of phosphoribulokinase. J. Bacteriol. 157:95-99.

80. Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. 2011. Pyruvate formate lyase acts as a formate supplier for metabolic processes during anaerobiosis in Staphylococcus aureus. J. Bacteriol. 4:952-962.

81. Maruyama K, Kitamura H. 1975. Some effects of propionate on the growth of Rhodopseudomonas spheroides S. Agric. Biol. Chem. 39:1521-1526.

82. Maruyama K, Kitamura H. 1985. Mechanisms of growth inhibition by propionate and restoration of the growth by sodium bicarbonate or acetate in Rhodopseudomonas sphaeroides S. Journal of Biochemistry. 98:819-824.

83. Maruyama K. 1979. The metabolic pathway of propionate in Rhodopseudomonas spheroides S. Agric. Biol. Chem. 43:2385-2386.

84. Massey LK, Sokatch JR, Conrad RS. 1976. Branched-chain amino acid catabolism in bacteria. Bacteriological Reviews. 40:42-54.

85. McKinlay JB, Harwood CS 2010. Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria. Proc Natl Acad Sci USA 107:11669- 11675.

86. Meister M, Saum S, Alber BE, Fuchs G. 2005. L-Malyl-Coenzyme A/ß- methylmalyl-Coenzyme A lyase is involved in acetate assimilation of the asocitrate lyase-negative bacterium Rhodobacter capsulatus. J. Bacteriol. 187:1415-1425.

87. Miziorko HM. 2006. Phosphoribulokinase: Current perspectives on the structure/function basis for regulation and catalysis. Adv. Enzymol. Relat. Areas Mol. Biol. 74:95-127

165

88. Narancic T, Scollica E, Kenny ST, Gibbons H, Carr E, Brennan L, Cagney G, Wynne K, Murphy C, Raberg M, Heinrich D, Steinbüchel A, O’Connor KE. 2016. Understanding the physiological roles of polyhydroxybutyrate (PHB) in Rhodospirillum rubrum S1 under aerobic chemoheterotrophic conditions. Appl Microbiol Biotechnol. 100:8901-8912.

89. Neidhardt FC, Ingraham JL, Schaechter M. 1990. In: Physiology of the Bacterial Cell. Chapter 5: Biosynthesis and Fueling, p. 133-172. Sinauer Associates, Inc. Publisher, Sunderland, Massachusetts.

90. Novak JS, Tabita FR. 1999. Molecular approaches to probe differential NADH activation of phosphoribulokinase isozymes from Rhodobacter sphaeroides. Arch. Biochem. Biophys. 363:273-282.

91. Novak RT, Gritzer RF, Leadbetter ER, Godchaux W. 2004. Phototrophic utilization of taurine by the purple nonsulfur bacteria Rhodopseudomonas palustris and Rhodobacter sphaeroides. Microbiology. 150:1881-91.

92. Ochsner AM, Christen M, Hemmerle L, Peyraud R, Christen B, Vorholt JA. 2017. Transposon sequencing uncovers an essential regulatory function of phosphoribulokinase for methylotrophy. Curr. Biol. 27:2579-2588.

93. Otzen C, Bardl B, Jacobsen ID, Nett M, Brock M. 2014. Candida albicans utilizes a modified -oxidation pathway for the degradation of toxic propionyl- CoA. J. Biol. Chem. 289:8151-8169.

94. Parsons JB, Rock CO. 2013. Bacterial lipids: metabolism and membrane homeostasis. Prog. Lipid Res. 52:249-276.

95. Patel MS, Nemeria NS, Furey W. Jordan F. 2014. The pyruvate dehydrogenase complexes: Structure-based function and regulation. J. Biol. Chem. 289:16615- 16623.

96. Payne J, Morris JG. 1969. Pyruvate carboxylase in Rhodopseudomonas spheroides. Microbiology. 59:97-101.

97. Peoples OP, Sinskey AJ. 1989. Poly-beta-hydroxybutyrate biosynthesis in Alcaligenes eutrophus H16. Characterization of the genes encoding beta- ketothiolase and acetoacetyl-CoA reductase. J. Biol. Chem. 264:15293-15297.

98. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. 2004. UCSF Chimera – a visualization system for exploratory research and analysis. J. Comput. Chem. 13:1605-12.

166

99. Popov KM, Kedishvili NY, Harris RA. 1992. Coenzyme A- and NADH- dependent esterase activity of methylmalonate semialdehyde dehydrogenase. Biochim. Biophys. Acta. 1119:69-73.

100. Qian Y, Tabita FR. 1998. Expression of glnB and a glnB-like gene (glnK) in a ribulose bisphophosphate carboxylase/oxygenase-deficient mutant of Rhodobacter sphaeroides. J Bacteriol. 180:4644-9.

101. Quail MA, Guest JR. 1995. Purification, characterization and mode of action of PdhR, the transcriptional repressor of the pdhR-aceEF-lpd operon of Escherichia coli. Mol. Microbiol. 15:519-29.

102. Reisch CR, Crabb WM, Gifford SM, Teng Q, Stoudemayer MJ, Moran MA, Whitman WB. 2013. Metabolism of dimethylsulfoniopropionate by Ruegeria pomeroyi DSS-3. Mol. Microbiol. 89:774-91.

103. Reisch CR, Moran MA, Whitman WB 2011. Bacterial metabolism of dimethylsulfoniopropionate (DMSP). Front Microbiol 2:172.

104. Rendina G, Coon MJ. 1957. Enzymatic hydrolysis of the coenzyme A thiol esters of beta-hydroxypropionic and beta-hydroxyisobutyric acids. J. Biol. Chem. 225:523-534.

105. Richardson DJ, King GF, Kelly DJ, McEwan AG, Ferguson SJ, Jackson JB 1988. The role of auxiliary oxidants in maintaining redox balance during phototrophic growth of Rhodobacter capsulatus on propionate or butyrate. Arch Microbiol 150:131-137.

106. Rindt KP, Ohmann E. 1969. NADH and AMP as allosteric effectors of ribulose-5-phosphate kinase in Rhodopseudomonas spheroides. Biochem. Biophys. Res. Commun. 36:357-364.

107. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative Genomics Viewer. Nat. Biotechnol. 29:24-26.

108. Runquist JA, Harrison DHT, Miziorko HM. 1998. Functional evaluation of invariant arginines situated in the mobile lid domain of phosphoribulokinase. Biochemistry. 37:1221-1226.

167

109. Runquist JA, Harrison DHT, Miziorko HM. 1999. Rhodobacter spaheroides Phosphoribulokinase: Identification of Lysine-165 as a catalytic residue and evaluation of the contributions of invariant basic amino acids to ribulose 5-phosphate binding. Biochemistry. 38:13999-14005.

110. Runquist JA, Narasimhan C, Wolff CE, Koteiche HA, Miziorko HM. 1996. Rhodobacter sphaeroides phosphoribulokinase: binary and ternary complexes with nucleotide substrate analogs and effectors. Biochemistry. 35:15049-15056.

111. Sauer U, Eikmanns BJ. 2005. The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol. Rev. 29:765-794.

112. Schäfer A, Tauch A, Jäger W, Kalinowski J, Theirbach G, Pühler A 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73.

113. Schada von Borzyskowski L, Sonntag F, Poschel L, Vorholt JA, Schrader J, Erb TJ, Buchhaupt M. 2018. Replacing the ethylmalonyl-CoA pathway with the glyoxylate shunt provides metabolic flexibility in the central carbon metabolism of Methylobacterium extorquens AM1. ACS Synth. Biol. 7:86-97.

114. Schedel M, Klemme JH, Schlegel HG. 1975. Regulation of C3- enzymes in facultative phototrophic bacteria: the cold-labile pyruvate kinase of Rhodopseudomonas sphaeroides. Arch. Microbiol. 103:237-245.

115. Schneider K, Skovran E, Vorholt JA 2012. Oxalyl-Coenzyme A reduction to glyoxylate is the preferred route of oxalate assimilation in Methylobacterium extorquens AM1. J. Bacteriol. 194:3144-3155.

116. Schneider, K, Asao M, Carter MS, Alber BE. 2012. Rhodobacter sphaeroides uses a reductive route via propionyl coenzyme A to assimilate 3- aydroxypropionate. J. Bacteriol. 194:225-232.

117. Schreiner M, Fiur D, Holátko J, Pátek M, Eikmanns BJ. 2005. E1 enzyme of the pyruvate dehydrogenase complex in Corynebacterium glutamicum: molecular analysis of the gene and phylogenetic aspects. J. Bacteriol. 187:6005- 6018.

168

118. Sener M, Strumpfer J, Singharoy A, Hunter CN, Schulten K 2016. Overall energy efficiency of a photosynthetic vesicle. eLIFE 5:e09541.

119. Senior PJ, Dawes EA. 1973. The regulation of poly--hydroxybutyrate metabolism in Azotobacter beijerinckii. Biochemical Journal. 134:225-238.

120. Shetty RP, Endy D, Knight TF 2008. Engineering BioBrick vectors from BioBrick parts. JBE 2:5.

121. Siebert K, Schobert P, Bowien B. 1981. Purification, some catalytic and molecular properties of phosphoribulokinase from Alcaligenes eutrophus. Biochim. Biophys. Acta. 658:35-44.

122. Smejkalova H, Erb TJ, Fuchs G. 2010. Methanol assimilation in Methylobacterium extorquens AM1: Demonstration of all enzymes and their regulation. PLoS One. 5:e13001.

123. Smith SA, Tabita FR. 2002. Up-regulated expression of the cbbI and cbbII operons during photoheterotrophic growth of a ribulose 1,5-bisphosphate carboxylase-oxygenase deletion mutant of Rhodobacter sphaeroides. J Bacteriol. 184:6721–6724.

124. Sonntag F, Buchhaupt M, Schrader J 2014. Thioesterases for ethylmalonyl-CoA pathway derived dicarboxylic acid production in Methylobacterium extorquens AM1. Appl Microbiol Biotechnol 98:4533-4544.

125. Sonntag F, Muller JE, Kiefer P, Vorholt JA, Schrader J, Buchhaupt M. 2015. High-level production of ethylmalonyl-CoA pathway-derived dicarboxylic acids by Methylobacterium extorquens under cobalt-deficient conditions and by polyhydroxybutyrate negative strains. Appl. Microbiol. Biotechnol. 99:3407-3419.

126. Spero MA, Brickner JR, Mollet JT, Pisithkul T, Amador-Noguez D, Donohue TJ. 2016. Different functions of phylogenetically distinct bacterial complex I isozymes. J Bacteriol. 198:1268 –1280.

127. Stines-Chaumeil C, Talfournier F, Branlant G. 2006. Mechanistic characterization of the MSDH (methylmalonate semialdehyde dehydrogenase) from Bacillus subtilis. Biochem. J. 395:107-15.

128. Tabita FR. 1988. Molecular and cellular regulation of autotrophic carbon dioxide fixation in microorganisms. Microbiological Reviews. 52:155-189.

169

129. Tabita FR. 1995. The biochemistry and metabolic regulation of carbon metabolism and CO2 fixation in purple bacteria. In: Anoxygenic photosynthetic bacteria. Blankenship RE, Madigan MT,Bauer CE, editors. The Netherlands: Kluwer Academic Publishers. 885-908.

130. Talfournier F, Stines-Chaumeil C, Branlant G. 2011 Methylmalonate semialdehyde dehydrogenase from Bacillus subtilis: substrate specificity and coenzyme A binding. J. Biol. Chem. 286:21971–21981.

131. Tao Y, Liu D, Yan X, Zhou Z, Lee JK, Yang C. 2011. Network identification and flux quantification of glucose metabolism in Rhodobacter sphaeroides under photoheterotrophic H2-producing conditions. J. Bacteriol. 194:274-283.

132. Teipel JW, Hass M, Hill RL 1968. The substrate specificity of fumarase. J Biol Chem 243:5684-5694.

133. Teufel R, Kung JW, Kockelkorn D, Alber BE, Fuchs G. 2009. 3- hydroxypropionyl-coenzyme A dehydratase and acrylyl-coenzyme A reductase, enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in the Sulfolobales. J. Bacteriol. 191:4573-4581.

134. Thieulin-Pardo G, Remy T, Lignon S, Lebrun R, Gontero B. 2015. Phosphoribulokinase from Chlamydomonas reinhardtii: a Benson-Calvin cycle enzyme enslaved to its cysteine residues. Mol Biosyst. 11:1134-1145.

135. Thorvaldsdóttir H, Robinson JT, Mesirov JP. 2013. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in Bioinformatics. 14:178-192.

136. Tichi MA, Tabita FR 2001. Interactive control of Rhodobacter capsulatus redox-balancing systems during phototrophic metabolism. J Bacteriol 183:6344-6354.

137. Tittmann K. 2009. Reaction mechanisms of thiamine diphosphate enzymes: redox reactions. FEBS Journal. 276: 2454-2468.

138. Todd JD, Curson AR, Nikolaidou-Katsaraidou N, Brearley CA, Watmough NJ, Chan Y, Page PC, Sun L, Johnston AW. 2010. Molecular dissection of bacterial acrylate catabolism-unexpected links with dimethylsulfoniopropionate catabolism and dimethyl sulfide production. Environ. Microbiol. 12:327-43.

170

139. Vita N, Hatchikian EC, Nouailler M, Dolla A, Pieulle L. 2008. Disulfide bond-dependent mechanism of protection against oxidative stress in pyruvate-ferredoxin oxidoreductase of anaerobic Desulfovibrio bacteria. Biochemistry. 47:957-964.

140. Wang X, Falcone DL, Tabita FR. 1993. Reductive pentose phosphate- independent CO2 fixation in Rhodobacter sphaeroides and evidence that ribulose bisphosphate carboxylase/oxygenase activity serves to maintain the redox balance of the cell. J. Bacteriol. 175:3372-3379.

141. Waters P, Venables WA. 1986. A complete pathway for beta-alanine and beta-amino-iso-butyrate catabolism in Pseudomonas aeruginosa. FEMS Microbiology Letters. 34:279-282.

142. Watson E, Olin-Sandoval V, Hoy MJ, Louisse T, Yao V, Mori A, Holdorf A, Troyanskaya OG, Ralser M, Walhout AJM. 2016. Metabolic network rewiring of propionate flux compensates vitamin B12 deficiency in C. elegans. eLife. 5:e17670.

143. Willison JC. 1988. Pyruvate and acetate metabolism in the photosynthetic bacterium Rhodobacter capsulatus. Journal of General Microbiology. 134:2429- 2493.

144. Wilson KA, Han Y, Zhang M, Hess JP, Chapman KA, Cline GW, Tochtrop GP, Brunengraber H, Zhang GF. 2017. Inter-relationships between 3-hydroxypropionate and propionate metabolism in rat liver: relevance to disorders of propionyl-CoA. Am. J. Physiol. Endocrinol. Metab. 313:E413-E428.

145. Wongkittichote P, Mew NA, Chapman KA. 2017. Propionyl-CoA carboxylase – A review. Molecular Genetics and Metabolism. 122:145-152.

146. Yao T, Xu L, Ying H, Huang H, Yan M. 2010 The catalytic property of 3-hydroxyisobutyrate dehydrogenase from Bacillus cereus on 3- hydroxypropionate. Appl. Biochem. Biotechnol. 160:694 –703.

147. Yao X, He W, Lu CD. 2011. Functional characterization of seven - glutamylpolyamine synthetase genes and the bauRABCD locus for polyamine and -alanine utilization in Pseudomonas aeruginosa PAO1. J. Bacteriol. 193:3923- 3930.

148. Yeaman S. 1989. The 2-oxo acid dehydrogenase complexes: recent advances. Biochem. J. 257:625-632.

171

149. Zarzycki J, Fuchs G. 2011. Coassimilation of organic substrates via the autotrophic 3-hydroxypropionate bi-cycle in Chlorofluxus aurantiacus. Appl. Environ. Microbiol. 77:6181-6188.

150. Zarzycki J, Schlichting A, Strychalsky N, Muller M, Alber BE, Fuchs G. 2008. Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. J. Bacteriol. 190:1366-1374.

151. Zhou S, Ashok S, Ko Y, Kim DM, Park S. 2014. Development of a deletion mutant of Pseudomonas denitrificans that does not degrade 3- hydroxypropionic acid. Appl. Microbiol. Biotechnol. 98:4389-98.

152. Zhou S, Catherine C, Rathnasingh C, Somasundar A, Park S. 2013. Production of 3-hydroxypropionic acid from glycerol by recombinant Pseudomonas dentrificans. Biotechnol. Bioeng. 110:3177-87.

153. Zhuang Z, Song F, Zhao H, Li, L, Cao J, Eisenstein E, Herzberg O, Dunaway-Mariano D. 2008. Divergence of function in the hot dog fold enzyme superfamily: the bacterial thioesterase YciA. Biochemistry. 47:2789-2796.

172