DOCSLIB.ORG

The Systematics of Polyommatus Blue Butterflies (Lepidoptera, Lycaenidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Systematics of Polyommatus Blue Butterflies (Lepidoptera, Lycaenidae) SUPPLEMENTARY DOCUMENTATION Establishing criteria for higher level classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera, Lycaenidae) Gerard Talaveraa,b, Vladimir A. Lukhtanovc,d, Naomi E. Piercee and Roger Vilaa aInstitut de Biologia Evolutiva (CSIC-UPF), Passeig Marítim de la Barceloneta, 37, 08003 Barcelona, Spain bDepartament de Genètica i Microbiologia, Universitat Autònoma de Barcelona, 08193 Bellaterra (Barcelona), Spain cDepartment of Karyosystematics, Zoological Institute of Russian Academy of Science, Universitetskaya nab. 1, 199034 St Petersburg, Russia d Department of Entomology, St Petersburg State University, Universitetskaya nab. 7/9, 199034 St Petersburg, Russia e Department of Organismic and Evolutionary Biology and Museum of Comparative Zoology, Harvard University, 26 Oxford Street, Cambridge, Massachusetts 02138, USA Supplementary Table S1. Primer sequences. mt: mitochondrial, n: nuclear. T = thymine, A = adenine, G = guanine, C = cytosine, K = G+T, W = A+T, M = A+C, Y = C+T, R = A+G, S = G+C, V = G+A+C, I = Inosine, N = A+C+G+T. Primer Primer name Direction Sequence (5' to 3') location mt COI LCO14901 forward GGTCAACAAATCATAAAGATATTGG mt COI Ron2,3 forward GGATCACCTGATATAGCATTCCC mt COI Nancy3 reverse CCCGGTAAAATTAAAATATAAACTTC mt COI Tonya3 forward GAAGTTTATATTTTAATTTTACCGGG mt COI Hobbes3 reverse AAATGTTGNGGRAAAAATGTTA mt COI TN21264 forward TTGAYCCTGCAGGTGGWGGAG mt COII George3,5 forward ATACCTCGACGTTATTCAGA mt COII Phyllis3,5 reverse GTAATAGCIGGTAARATAGTTCA mt COII Strom3,5 forward TAATTTGAACTATYTTACCIGC mt COII Eva3,5 reverse GAGACCATTACTTGCTTTCAGTCATCT mt COII JL31464 forward GAGTTTCACCTTTAATAGAACA mt COII B-tLys2 reverse GTTTAAGAGACCAGTACTTG mt COII JL25324 forward ACAGTAGGAGGATTAACAGGAG n CAD CAD787F6 forward GGDGTNACNACNGCNTGYTTYGARCC n CAD CADFa7 forward GDATGGTYGATGAAAATGTTAA n CAD CADRa7 reverse CTCATRTCGTAATCYGTRCT 8,9 n EF-1α ef135 forward CAAATGYGGTGGTATYGACAAACG 8,9 n EF-1α ef684 reverse TCCTTRCGCTCCACSTGCCAYCC 8,9 n EF-1α ef531 forward TACAGYGAGCSCCGTTTYGAGGA 8,9 n EF-1α ef929 reverse GCCTCTTGGAGAGCTTCGTGGTG 8,9 n EF-1α ef51.9 forward CARGACGTATACAAAATCGG 8,9 n EF-1α efrcM4R reverse ACAGCVACKGTYTGYCTCATRTC n H3 H3F10 forward ATGGCTCGTACCAAGCAGACVGC n H3 H3R10 reverse ATATCCTTRGGCATRATRGTGAC n ITS-2 ITS-311 forward GCATCGATGAAGAACGCAGC n ITS-2 ITS-411 reverse TCCTCCGCTTATTGATATGC n wg LepWg112 forward GARTGYAARTGYCAYGGYATGTCTGG n wg LepWg2E7 reverse ACNACGAACATGGTCTGCGT n wg Wg1n13 forward CGGAGATGCGMCAGGARTGC n wg Wg2n13 reverse CTTTTTCCGTSCGACACAGYTTGC n 28S S366014 forward GAGAGTTMAASAGTACGTGAAAC n 28S A33514 reverse TCGGARGGAACCAGCTACTA 1 Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R.C. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Marine Biol. Biotech. 3, 294-299. 2 Simon, C., Frati, F., Beckebach, A., Crespi, B., Liu, H. & Flook, P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6), 651-701. 3 Monteiro, A. & Pierce, N.E. 2001. Phylogeny of Bicyclus (Lepidoptera: Nymphalidae) inferred from COI, COII, and EF-1alpha gene sequences. Molecular Phylogenetics and Evolution 18, 264-281. 4 Canfield M.R., Greene E., Moreau C.S., Chen N., & Pierce N.E. 2008. Exploring phenotypic plasticity and biogeography in emerald moths: A phylogeny of the genus Nemoria (Lepidoptera: Geometridae). Molecular Phylogenetics and Evolution 49(2), 477-87. 5 Brower, A.V.Z. 1994. Phylogeny of Heliconius butterflies inferred from mitochondrial DNA sequences (Lepidoptera: Nymphalidae). Molecular Phylogenetics and Evolution 3(2), 159-174. 6 Moulton, J.K. & Wiegmann, B.M. 2004. Evolution and phylogenetic utility of cad (rudimentary) among Mesozoic-aged eremoneuran Diptera (Insecta). Molecular Phylogenetics and Evolution 31, 363-378. 7 Vila, R., Bell, C.D., Macniven, R., Goldman-Huertas, B., Ree, R.H., Marshall, C.R., Bálint, Z., Johnson, K., Benyamini, D., & Pierce, N.E. 2011. Phylogeny and palaeoecology of Polyommatus blue butterflies show Beringia was a climate-regulated gateway to the New World. Proceedings of the Royal Society B 278(1719), 2737-2744. 8 Cho, S., Mitchell, A., Regier, J.C., Mitter, C., Poole, R.W., Friedlander, T.P., & Zhao, S. 1995. A highly conserved nuclear gene for low-level phylogenetics: elongation factor- 1alpha recovers morphology-based tree for heliothine moths. Mol. Biol. Evol. 12 (4), 650-656. 9 Kandul, N.P., Lukhtanov, V.A., Dantchenko, A.V., Coleman, J.W.S., Sekercioglu, C.H., Haig, D. & Pierce, N.E. 2004. Phylogeny of Agrodiaetus Hübner 1822 (Lepidoptera: Lycaenidae) inferred from mtDNA sequences of COI and COII, and nuclear sequences of EF1-α: karyotype diversification and species radiation. Systematic Biology 53 (2), 278-298. 10 Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S.P., Edgecombe, G.D., Macaranas, J., Cassis G., & Gray, M.R. 1998. Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46, 419- 437. 11 White, T.J., Bruns, S., Lee, S., & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics in PCR protocols: a guide to methods and applications, edited by M.A. Innis, Gelfandm D.H., J.J. Snisky, & T. J. White. Academic Press, New York, pp. 315-322. 12 Brower, A.V.Z. & DeSalle, R. 1998. Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference. Insect Molecular Biology 7(1), 73-82. 13 Designed by Ada Kalizewska (Harvard University, Cambridge, MA, USA). 14 Sequeira, A.S., Normark, B.B., & Farrell, B. 2000. Evolutionary assembly of the conifer fauna: Distinguishing ancient from recent associations in bark beetles. Proceedings of the Royal Entomological Society (London) B 267, 2359-2366. Supplementary Table S2. GenBank accession codes. Sequences obtained in this work range from JX093196 to JX093497. Specimen Code Taxon COI + COII EF-1a wg CAD ITS2 28S H3 VL02X393 Afarsia morgiana JX093487 JX093302 JX093267 JX093394 JX093228 JX093344 VL05Z994 Agriades glandon GQ128942 GQ129038 GQ128729 VL01B424 Agriades optilete GQ129011 GQ128699 GQ128910 GQ128630 GQ129110 GQ128521 GQ128803 JB05I879 Agriades optilete GQ129012 GQ128700 JX093444 GQ128631 GQ129111 GQ128522 GQ128804 AD03B064 Agriades orbitulus GQ128945 GQ128634 GQ128842 GQ128560 GQ129043 GQ128450 GQ128734 NK00P690 Agriades pheretiades JX093466 JX093284 GQ128838 GQ128556 GQ129039 GQ128446 GQ128730 AS92Z130 Agriades podarce GQ128943 GQ128632 GQ128839 GQ128557 GQ129040 GQ128447 GQ128731 AD00P259 Agriades pyrenaicus araraticus GQ128944 GQ128633 GQ128840 GQ128558 GQ129041 GQ128448 GQ128732 VL02X098 Alpherakya sarta JX093451 JX093311 JX093446 JX093268 JX093402 JX093224 JX093353 NK00P712 Aricia agestis AY496801 AY496824 GQ128843 GQ128561 GQ129044 GQ128451 GQ128735 AD02W127 Aricia artaxerxes JX093482 JX093308 JX093415 JX093255 JX093372 JX093202 JX093318 VL05Z997 Aricia chinensis JX093476 JX093364 AD00P528 Aricia crassipuncta JX093459 JX093304 JX093414 JX093376 JX093201 JX093317 AD03B041 Aricia nicias GQ128992 GQ128681 GQ128892 GQ128612 GQ129092 GQ128502 GQ128785 VL03F745 Aricia vandarvani JX093480 JX093306 JX093395 JX093347 DL99T242 Chilades lajus GQ128946 GQ128635 GQ128844 GQ128562 GQ128452 GQ128736 AS92Z312 Cupido comyntas GQ128954 GQ128643 GQ128852 GQ128571 GQ129053 GQ128461 GQ128745 AD00P540 Cupido minimus GQ128947 GQ128636 GQ128845 GQ128563 GQ129045 GQ128453 GQ128737 AD00P369 Cyaniris semiargus JX093483 JX093413 JX093260 JX093367 JX093217 JX093339 AD00P206 Cyaniris semiargus JX093491 JX093301 JX093412 JX093259 JX093371 JX093235 JX093338 JE01C283 Cyclargus ammon GQ128948 GQ128637 GQ128846 GQ128564 GQ129046 GQ128454 GQ128738 AS92Z185 Echinargus isola DQ018914 DQ018914 DQ018885 GQ128566 GQ129048 GQ128456 GQ128740 RV05M735 Eldoradina cyanea GQ128952 GQ128641 GQ128850 GQ128569 GQ129051 GQ128459 GQ128743 AD03B062 Eumedonia eumedon GQ128953 GQ128642 GQ128851 GQ128570 GQ129052 GQ128460 GQ128744 NK00P743 Eumedonia persephatta JX093492 JX093279 JX093438 JX093269 JX093398 JX093233 JX093354 RE02A007 Freyeria putli GQ128956 GQ128645 GQ128854 GQ128573 GQ129055 GQ128463 GQ128747 VL01L462 Freyeria trochylus GQ128955 GQ128644 GQ128853 GQ128572 GQ129054 GQ128462 GQ128746 VL02X159 Glabroculus cyane JX093489 JX093283 JX093434 JX093275 JX093387 JX093221 JX093356 NK00P793 Glabroculus elvira JX093456 JX093295 JX093435 JX093271 JX093399 JX093229 JX093355 MH01I001 Hemiargus hanno GQ128960 GQ128649 GQ128858 GQ128577 GQ129059 GQ128467 GQ128751 SR03K069 Hemiargus hanno bogotanus GQ128957 GQ128646 GQ128855 GQ128574 GQ129056 GQ128464 GQ128748 DL02P801 Hemiargus hanno gyas GQ128959 GQ128648 GQ128857 GQ128576 GQ129058 GQ128466 GQ128750 AS92Z255 Hemiargus hanno gyas GQ128958 GQ128647 GQ128856 GQ128575 GQ129057 GQ128465 GQ128749 RE01H234 Hemiargus huntingtoni GQ128949 GQ128638 GQ128847 GQ128565 GQ129047 GQ128455 GQ128739 RV04I212 Hemiargus martha GQ128950 GQ128639 GQ128848 GQ128567 GQ129049 GQ128457 GQ128741 MFB00N223 Hemiargus ramon GQ128961 GQ128650 GQ128859 GQ128578 GQ129060 GQ128468 GQ128752 AS92Z184 Icaricia acmon GQ128962 GQ128651 GQ128860 GQ128579 GQ129061 GQ128469 GQ128753 AS92Z065 Icaricia icarioides GQ128963 GQ128652 GQ128861 GQ128580 GQ129062 GQ128470 GQ128754 AS92Z069 Icaricia saepiolus GQ128966 GQ128655 GQ128583 GQ129065 GQ128473 AS92Z465 Icaricia shasta
Load more

Recommended publications
  • Révision Taxinomique Et Nomenclaturale Des Rhopalocera Et Des Zygaenidae De France Métropolitaine
    Direction de la Recherche, de l’Expertise et de la Valorisation Direction Déléguée au Développement Durable, à la Conservation de la Nature et à l’Expertise Service du Patrimoine Naturel Dupont P, Luquet G. Chr., Demerges D., Drouet E. Révision taxinomique et nomenclaturale des Rhopalocera et des Zygaenidae de France métropolitaine. Conséquences sur l’acquisition et la gestion des données d’inventaire. Rapport SPN 2013 - 19 (Septembre 2013) Dupont (Pascal), Demerges (David), Drouet (Eric) et Luquet (Gérard Chr.). 2013. Révision systématique, taxinomique et nomenclaturale des Rhopalocera et des Zygaenidae de France métropolitaine. Conséquences sur l’acquisition et la gestion des données d’inventaire. Rapport MMNHN-SPN 2013 - 19, 201 p. Résumé : Les études de phylogénie moléculaire sur les Lépidoptères Rhopalocères et Zygènes sont de plus en plus nombreuses ces dernières années modifiant la systématique et la taxinomie de ces deux groupes. Une mise à jour complète est réalisée dans ce travail. Un cadre décisionnel a été élaboré pour les niveaux spécifiques et infra-spécifique avec une approche intégrative de la taxinomie. Ce cadre intégre notamment un aspect biogéographique en tenant compte des zones-refuges potentielles pour les espèces au cours du dernier maximum glaciaire. Cette démarche permet d’avoir une approche homogène pour le classement des taxa aux niveaux spécifiques et infra-spécifiques. Les conséquences pour l’acquisition des données dans le cadre d’un inventaire national sont développées. Summary : Studies on molecular phylogenies of Butterflies and Burnets have been increasingly frequent in the recent years, changing the systematics and taxonomy of these two groups. A full update has been performed in this work.
    [Show full text]
  • Redalyc.IN MEMORIAM Doctor Yuri Paulovich Nekrutenko (1936-2010)
    SHILAP Revista de Lepidopterología ISSN: 0300-5267 [email protected] Sociedad Hispano-Luso-Americana de Lepidopterología España Vives Moreno, A. IN MEMORIAM Doctor Yuri Paulovich Nekrutenko (1936-2010) SHILAP Revista de Lepidopterología, vol. 39, núm. 154, junio, 2011, pp. 133-139 Sociedad Hispano-Luso-Americana de Lepidopterología Madrid, España Disponible en: http://www.redalyc.org/articulo.oa?id=45521389001 Cómo citar el artículo Número completo Sistema de Información Científica Más información del artículo Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto 133-139 IN MEMORIAM 10/6/11 11:13 Página 133 SHILAP Revta. lepid., 39 (154), junio 2011: 133-139 CODEN: SRLPEF ISSN:0300-5267 IN MEMORIAM Doctor Yuri Paulovich Nekrutenko (1936-2010) A. Vives Moreno El día 12 de junio 2010, a la edad de 74 años, murió nuestro Socio de Honor el Doctor Yuri Paulovich Nekrutenko, que lo fue de nuestra Sociedad. Nació el 30 de abril de 1936 en Kiev, perteneciente a la antigua Unión Soviética, actualmente Ucrania, dentro de una familia de artistas vinculada a las actividades cinematográficas y teatrales ucranianas. Con motivo de la Segunda Guerra Mundial, su familia fue evacuada a Uzbekistán en 1941, que es la fecha en la que comenzó su interés por los lepidópteros. Realizó sus estudios secundarios y pasó a la Universidad Shevchenko de Kiev, donde ingresaría en su Facultad de Biología, especializándose en la sistemática zoológica, la zoogeografía, la morfología y la evolución, realizando al mismo tiempo estudios en el Instituto Médico de Kiev e interesándose en el estudio de las lenguas eslavas y en el 133 133-139 IN MEMORIAM 10/6/11 11:13 Página 134 A.
    [Show full text]
  • EIG 11 Spring 2012 (PDF, 703Kb)
    NEWSLETTER Issue 11 May 2012 CONTENTS Page Chairman’s Introduction 1,2&3 Contact Details 4 EIG Trips for 2012 5 2013 Calendar Competion 5 Marsh Award 6 Thriplow Grants 6 EIG AGM 6 EIG 2012 visit to Natural History Museum 7 Mountain Blues 8,9&10 Spring Butterflies in the Lot & Dordogne 11,12&13 Encounters with the Geranium Bronze in Corfu 14 Good News for bog Butterflies in the French Pyrenees 15 Identifying Pyrgus Grizzled Skippers 16,17&18 The New Wood White 18,19&20 Intergeneric pairing of butterflies in Greece 21 Atlas of Butterflies of Slovenia 22 Reguests for Information 23 Reviews 23 Notices 24 Chairman’s Introduction In the last EIG Newsletter I gave details of a number of possible collaborative projects in Europe with European partners and colleagues. It is pleasing to report that several of these are planned for this summer season and the response to one request has already produced some very valuable information on one of Europe’s rarest butterflies. Martin Wiemers suggested an EIG survey for Pieris chaeranthi (Canary Islands Large White) (EN) in Tenerife and sent me lots of useful information which I have forwarded to people visiting Tenerife and we have three recent reports including one from a new location. Matt Rowlings took this picture of a Canary Islands Large White ( Pieris chaeranthi) ©Matt Rowlings female last week. The butterfly flies all year on an 1 island often visited by UK citizens. It is just one example of how EIG can gather useful information in Europe. We have been able to follow up several of the suggestions from partners we talked to in Laufen.
    [Show full text]
  • Area Selection for the Conservation of Butterflies in the Iberian Peninsula and Balearic Islands H
    Animal Biodiversity and Conservation 30.1 (2007) 7 Area selection for the conservation of butterflies in the Iberian Peninsula and Balearic Islands H. Romo, M. L. Munguira & E. García–Barros Romo, H., Munguira, M. L. & García–Barros, E., 2007. Area selection for the conservation of butterflies in the Iberian Peninsula and Balearic Islands. Animal Biodiversity and Conservation, 30.1: 7–27. Abstract Area selection for the conservation of butterflies in the Iberian Peninsula and Balearic Islands.— Coverage provided by the network of protected areas in the Iberian Peninsula and Balearic Islands was tested by measuring the coincidence between the squares protected by the network and the butterfly species recorded for such UTM grid squares. Five species were found to be absent in the network. The protected areas with the highest numbers of butterfly species were Ordesa National Park and Monte Perdido and the Posets– Maladeta Natural Park. Priority areas were selected using WORLDMAP software and showed that the all species of butterflies in the Iberian Peninsula and Balearic Islands can be found within 16 squares of 10 x 10 km (nine of them not within the network of protected areas). More specific area selections were also carried out: eight squares supported the total number of threatened species, five hosted all the Iberian endemisms and 13 harboured the rare butterfly species. This study detected 16 squares that are not currently protected but are important for butterfly conservation in the Iberian Peninsula and Balearic Islands. Key words: Conservation, Butterflies, Gap analysis, Protected areas, Iberian Peninsula, Balearic Islands. Resumen Selección de áreas para la conservación de las mariposas diurnas de la Península Ibérica e Islas Baleares.— Se ha analizado el nivel de cobertura que proporciona la red de espacios protegidos en la Península Ibérica e Islas Baleares comprobando la coincidencia entre éstos y el número de especies de mariposas registrado.
    [Show full text]
  • Phylogeny of European Butterflies V1.0
    bioRxiv preprint doi: https://doi.org/10.1101/844175; this version posted November 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A complete time-calibrated multi-gene phylogeny of the European butterflies Martin Wiemers1,2*, Nicolas Chazot3,4,5, Christopher W. Wheat6, Oliver Schweiger2, Niklas Wahlberg3 1Senckenberg Deutsches Entomologisches Institut, Eberswalder Straße 90, 15374 Müncheberg, Germany 2UFZ – Helmholtz Centre for Environmental Research, Department of Community Ecology, Theodor- Lieser-Str. 4, 06120 Halle, Germany 3Department of Biology, Lund University, 22362 Lund, Sweden 4Department of Biological and Environmental Sciences, University of Gothenburg, Box 461, 405 30 Gothenburg, Sweden. 5Gothenburg Global Biodiversity Centre, Box 461, 405 30 Gothenburg, Sweden. 6Department of Zoology, Stockholm University, 10691 Stockholm, Sweden *corresponding author: e-mail: [email protected] Abstract With the aim of supporting ecological analyses in butterflies, the third most species-rich superfamily of Lepidoptera, this paper presents the first time-calibrated phylogeny of all 496 extant butterfly species in Europe, including 18 very localized endemics for which no public DNA sequences had been available previously. It is based on a concatenated alignment of the mitochondrial gene COI and up to 11 nuclear gene fragments, using Bayesian inference of phylogeny. To avoid analytical biases that could result from our region-focus sampling, our European tree was grafted upon a global genus- level backbone butterfly phylogeny for analyses. In addition to a consensus tree, we provide the posterior distribution of trees and the fully-concatenated alignment for future analyses.
    [Show full text]
  • Vila Et Al 10 ESM 5
    Electronic supplementary material Phylogeny and paleoecology of Polyommatus blue butterflies show Beringia was a climate-regulated gateway to the New World Roger Vila, Charles D. Bell, Richard Macniven, Benjamin Goldman-Huertas, Richard H. Ree, Charles R. Marshall, Zsolt Bálint, Kurt Johnson, Dubi Benyamini, Naomi E. Pierce Contents Supplementary Methods. 2 Taxon sampling. 2 DNA extraction and sequencing . 2 Sequence alignments and characteristics. 3 Phylogenetic analyses. 4 Ancestral area reconstruction . 5 Ancestral hostplant reconstruction. 6 Ancestral temperature tolerance reconstruction . 6 Divergence time estimation . 7 Supplementary Results and Discussion. .8 Phylogenetic analyses. 8 Ancestral area reconstruction . 9 Ancestral hostplant reconstruction. 10 Ancestral temperature tolerance reconstruction . 10 Supplementary systematic discussion. 10 Interesting Nabokov citations. 13 List of Figures Supplementary Figure S1. Biogeographical model. 14 Supplementary Figure S2. Bayesian cladogram of the Polyommatini tribe. 15 Supplementary Figure S3. Polyommatini tribe node numbers. 16 Supplementary Figure S4. Polyommatus section node numbers . 17 Supplementary Figure S5. DIVA ancestral area reconstruction . 18 Supplementary Figure S6. Lagrange ancestral area reconstruction. 19 Supplementary Figure S7. Ancestral hostplant reconstruction . 20 Supplementary Figure S8. Ancestral and current thermal range tolerances. 21 List of Tables Supplementary Table S1. Samples used in this study . 22 Supplementary Table S2. Primer sequences . 25 Supplementary
    [Show full text]
  • The Systematics of Polyommatus Blue Butterflies (Lepi
    Cladistics Cladistics (2012) 1–27 10.1111/j.1096-0031.2012.00421.x Establishing criteria for higher-level classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera, Lycaenidae) Gerard Talaveraa,b, Vladimir A. Lukhtanovc,d, Naomi E. Piercee and Roger Vilaa,* aInstitut de Biologia Evolutiva (CSIC-UPF), Passeig Marı´tim de la Barceloneta, 37, 08003 Barcelona, Spain; bDepartament de Gene`tica i Microbiologia, Universitat Auto`noma de Barcelona, 08193 Bellaterra (Barcelona), Spain; cDepartment of Karyosystematics, Zoological Institute of Russian Academy of Science, Universitetskaya nab. 1, 199034 St Petersburg, Russia; dDepartment of Entomology, St Petersburg State University, Universitetskaya nab. 7 ⁄ 9, 199034 St Petersburg, Russia; eDepartment of Organismic and Evolutionary Biology and Museum of Comparative Zoology, Harvard University, 26 Oxford Street, Cambridge, MA 02138, USA Accepted 11 June 2012 Abstract Most taxonomists agree on the need to adapt current classifications to recognize monophyletic units. However, delineations between higher taxonomic units can be based on the relative ages of different lineages and ⁄or the level of morphological differentiation. In this paper, we address these issues in considering the species-rich Polyommatus section, a group of butterflies whose taxonomy has been highly controversial. We propose a taxonomy-friendly, flexible temporal scheme for higher-level classification. Using molecular data from nine markers (6666 bp) for 104 representatives of the Polyommatus section, representing all but two of the 81 described genera ⁄ subgenera and five outgroups, we obtained a complete and well resolved phylogeny for this clade. We use this to revise the systematics of the Polyommatus blues, and to define criteria that best accommodate the described genera within a phylogenetic framework.
    [Show full text]
  • Nota Lepidopterologica
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Nota lepidopterologica Jahr/Year: 1998 Band/Volume: 21 Autor(en)/Author(s): Nekrutenko Yuri P. Artikel/Article: A catalogue of the type specimens of Riodinidae and Lycaenidae deposited in the collection of Zoologisches Forschungsinstitut und Museum Alexander Koenig (Bonn) 119-148 ©Societas Europaea Lepidopterologica; download unter http://www.biodiversitylibrary.org/ und www.zobodat.at Nota lepid. 21 (2): 1 19-148; 10. VIL 1998 ISSN 0342-7536 A catalogue of the type specimens of Riodinidae and Lycaenidae deposited in the collection of Zoologisches Forschungsinstitut und Museum Alexander Koenig (Bonn) Yuri P. Nekrutenko Schmalhausen Institute of Zoology, UA-252601 Kiev 30, MSP, Ukraine e-mail: [email protected] Summary. A revision of the Lepidoptera collection of the Zoologisches Forschungs- institut und Museum Alexander Koenig (Bonn) showed it to contain the type material of 3 nominal species group taxa of Riodinidae and 53 of Lycaenidae. 7 label names are established to be unavailable as infrasubspecific, preoccupied (published replacement names are cited) and/ or unpublished. In 6 cases unavailable subsequent "paratype" and "lectotype" designation was found. Among others, the collection contains the type materials of W. Forster, J. P. Rambur, C. Ribbe, I. de Sagarra, R. Verity and R. Ziillich. Zusammenfassung. Die Durchsicht der Lepidoptera-Sammlung des Zoologischen For- schungsinstituts und Museums Alexander Koenig (Bonn) ergab, daß das Typenmaterial von 3 nominellen Taxa der Artgruppe bei den Riodinidae und von 53 Taxa bei den Lycaenidae enthalten war. 7 Etiketten-Namen wurden als nicht verfügbar festgestellt, weil sie infrasubspezifisch, praeoccupiert (veröffentlichte Ersatznamen werden auf- geführt) und/ oder unpubliziert sind.
    [Show full text]
  • Lepidoptera: Lycaenidae)
    SHILAP Revta. lepid., 46 (181) marzo 2018: 15 eISSN: 2340-4078 ISSN: 0300-5267 Emisión de sonido en los estados inmaduros de 18 especies de Lycaenidae ibéricos y su posible significado biológico (Lepidoptera: Lycaenidae) M. Álvarez, M. L. Munguira, E. Ruiz, J. M. Hernández & M. D. Martínez-Ibáñez Resumen Se han grabado y analizado las emisiones acústicas en 18 especies de Lycaenidae de la Península Ibérica, tanto mirmecófilas como amirmecófilas. Las especies estudiadas pertenecen a 15 géneros y corresponden a una especie de la tribu Theclini, una de Eumaeini, dos de Lycaenini y 14 Polyommatini. En cinco de ellas se han estudiado las emisiones de la larva y en las otras trece las producidas tanto por la larva como por la pupa. Las larvas de todas las especies estudiadas emitieron sonidos, así como el 77% de las pupas. Se ha estudiado la frecuencia y estructura de la señal emitida en cada especie. El mecanismo de emisión acústica es diferente en larvas y pupas: en las primeras no se ha observado la existencia de un aparato estridulador, mientras que las pupas presentan aparatos estriduladores intersegmentales abdominales. Las larvas de dos especies de Lycaena, asi como Cacyreus marshalli y Agriades pyrenaicus producen sonidos en la fase de larva, pero son amirmecófilas y no se han encontrado diferencias en la emisión de sonido entre larvas mirmnecófilas y amirmecófilas. Las pupas de las especies no mirmecófilas no emiten sonido, con la excepción de Lycaena phlaeas. Tres de las especies estudiadas (Glaucopsyche alexis, Iolana debilitata y Pseudophilotes panoptes) no emiten sonido en la fase de pupa aunque son mirmecófilas.
    [Show full text]
  • Five Blues on a Flower: Interactions Between Polyommatinae Butterflies (Lepidoptera, Lycaenidae), Ants and Parasitoids in the No
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Nachrichten des Entomologischen Vereins Apollo Jahr/Year: 2012 Band/Volume: 33 Autor(en)/Author(s): Lafranchis Tristan & Antoine Artikel/Article: Five blues on a flower: interactions between Polyommatinae butterflies (Lepidoptera, Lycaenidae), ants and parasitoids in the northern Peloponnese (Greece) 23-29 Nachr. entomol. Ver. Apollo, N. F. 33 (1): 23–29 (2012) 23 Five blues on a flower: interactions between Polyommatinae butterflies (Lepidoptera, Lycaenidae), ants and parasitoids in the northern Peloponnese (Greece) Tristan Lafranchis and Antoine Lafranchis Tristan and Antoine Lafranchis, GR­25003 Diakopto, Greece; [email protected] Abstract: A field study undertaken on the slopes of Mt. Methodology Klo kos (Peloponnese, Greece) completed by rearings in 2005–2007 has revealed the particular relationship between The study area lies on the north­facing slope of Mt. Klo­ the community of Polyommatinae caterpillars feeding on kos (northern Peloponnese) between 1100 and 1200 m. the sainfoin Onobrychis ebenoides Boiss. & Spruner, their It has been chosen for its large populations of Po ly om­ pa rasitoids and 10 species of attending ants. ma tinae and for its easy access. We could therefore hope Fünf Bläulinge an einer Pflanze: Interaktionen zwi- to find caterpillars easily and visit it regularly. The sub­ schen Polyommatinen (Lepidoptera, Lycaenidae), strate is limestone, with a stony and rocky soil. A track Ameisen und Raupenparasitoiden auf dem nördlichen runs along the edge of a dense woodland of Greek Fir Peloponnes (Griechenland) (Abies cephalonica Loudon, Pinaceae) and through dry Zusammenfassung: Feldstudien auf den Hängen des Ber­ grass lands and open scrub.
    [Show full text]
  • Biogeography of the High Mountain Lepidoptera in the Balkan Peninsula
    Research Article ISSN 2336-9744 (online) | ISSN 2337-0173 (print) The journal is available on line at www.ecol-mne.com Biogeography of the high mountain Lepidoptera in the Balkan Peninsula ZOLTÁN VARGA Department of Evolutionary Zoology, University of Debrecen, H-4010 Debrecen, Egyetem-tér 1. E-mail: [email protected] Received 24 September 2014 │ Accepted 18 October 2014 │ Published online 22 October 2014. Abstract Balkanic high mountains represent nearly all types of European vertical zonation. The elevation and vegetation character of the timberline and allied vegetation types (scrubs, tall vs short, closed vs. open rupicolous swards) but also the edaphic traits, etc. considerably influence the biogeographical composition of butterfly and moth assemblages. The habitats of the high elevations are populated by several types of mountain species. They belong to five main biogeographical groups: (i) boreo-montane (“Siberian”) species, often represented by isolated, partly differentiated populations mostly in the coniferous forests zones; (ii) arctic-alpine (in majority Eurasiatic!) species represented by isolated, most often taxonomically differentiated populations in alpine zones of highest Balkanic mountains; (iii) alpine (nearly exclusively European!) species represented by isolated, mostly taxonomically differentiated populations in subalpine-alpine zones of Balkanic mountains; (iv) Balkanic-oreal species often with isolated populations (subspecies) also in the Southern or Southwestern Alps and Massif Central, in special
    [Show full text]
  • Butterflies of the Picos De Europa Holiday Report 6-13 July 2018 Led by Patrick Barkham and Assisted by Julian Dowding
    Butterflies of the Picos de Europa Holiday Report 6-13 July 2018 Led by Patrick Barkham and assisted by Julian Dowding Picos view © J Wainscoat Gavarnie Blue © P Lister Butterflies of The Picos de Europa Holiday Report © Greenwings 2019 1 Day 1, Saturday 5 July. Prior to the arrival of the guests, the guides Patrick and Julian had spent a few days in the Picos to recce the area for butterflies with Patrick’s father John before the guests arrived. This also enabled them to be at the airport in good time for our guests’ flights. There were a few delays but nothing major, and so after introductions we were soon winging our way back to our wonderful hotel at the top end of the beautiful Liebana Valley, in the heart of the Picos de Europa. It was really lovely accommodation, set among the majestic limestone “Peaks of Europe” in lush-green northern Spain that no-one in Britain has ever heard of! The 12 guests joining us on this holiday were James and Beverly, Robin and Nicholas, Andy and Denise, Steve and Gwen, Christian, Ian, Paul and Martin. Day 2, Sunday 6 July. Our intrepid band of butterfly hunters began our first full day in Spain with a stupendous multiple-choice breakfast at the Hotel del Oso – so many pastries, so little time – before swinging into action on a stony track at the south-western end of the Liebana Valley. The weather was superb with good sunshine and warm temperatures. We had already clocked four species in the meadow by the hotel including the first of many lovely Pearly Heaths and Marbled Whites, and on the short journey to our morning destination, Chris spotted a Honey Buzzard in a nearby field.
    [Show full text]