Improved Surface Display of Human Hyal1 and Identification Of

Improved Surface Display of Human Hyal1 and Identification of Testosterone Propionate and Chicoric Acid as New Inhibitors Isabelle Lengers, Fabian Herrmann, Marc Le Borgne, Joachim Jose

To cite this version:

Isabelle Lengers, Fabian Herrmann, Marc Le Borgne, Joachim Jose. Improved Surface Display of Human Hyal1 and Identification of Testosterone Propionate and Chicoric Acid as New Inhibitors. Pharmaceuticals, MDPI, 2020, 13 (4), pp.54. 10.3390/ph13040054. hal-02539544

HAL Id: hal-02539544 https://hal.archives-ouvertes.fr/hal-02539544 Submitted on 10 Apr 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. pharmaceuticals

Article Improved Surface Display of Human Hyal1 and Identiﬁcation of Testosterone Propionate and Chicoric Acid as New Inhibitors

Isabelle Lengers 1, Fabian Herrmann 2, Marc Le Borgne 3 and Joachim Jose 1,* 1 Institute of Pharmaceutical and Medicinal Chemistry, PharmaCampus, Westfälische Wilhelms-Universtität Münster, 48149 Münster, Germany; [email protected] 2 Institute of Pharmaceutical Biology and Phytochemistry, PharmaCampus, Westfälische Wilhelms-Universtität Münster, 48149 Münster, Germany; [email protected] 3 Université de Lyon, Université Claude Bernard Lyon 1, Faculté de Pharmacie—ISPB, EA 4446 Bioactive Molecules and Medicinal Chemistry, SFR Santé Lyon-Est CNRS UMS3453—INSERM US7, 8 Avenue Rockefeller, F-69373 Lyon CEDEX 8, France; [email protected] * Correspondence: [email protected]; Tel.: +49-251-83-32200

Received: 3 February 2020; Accepted: 24 March 2020; Published: 26 March 2020

Abstract: Degradation of high molecular weight hyaluronic acid (HA) in humans is mainly catalyzed by hyaluronidase Hyal1. This enzyme is involved in many pathophysiological processes and therefore appears an interesting target for drug discovery. Until now, only a few inhibitors of human Hyal1 are known due to obstacles in obtaining active enzymes for inhibitor screening. The aim of the present work was to provide a convenient enzyme activity assay and show its feasibility by the identification of new inhibitors. By autodisplay, Escherichia coli F470 can present active Hyal1 on its surface. In this study, the inducible expression of Hyal1 on the cell surface of E. coli under the control of a rhamnose-dependent promoter (Prha) was performed and optimized. Enzyme activity per single cell was increased by a factor of 100 compared to the constitutive Hyal1 surface display, as described before. An activity of 6.8 10 4 mU per single cell was obtained under optimal reaction conditions. × − By this modified activity assay, two new inhibitors of human Hyal1 were identified. Chicoric acid, a natural compound belonging to the phenylpropanoids, showed an IC50 value of 171 µM. The steroid derivative testosterone propionate showed and IC value of 124 1.1 µM. Both values were in the 50 ± same order of magnitude as the IC50 value of glycyrrhizic acid (177 µM), one of the best known inhibitors of human Hyal1 known so far. In conclusion, we established a new enzyme activity assay for human Hyal1 and identified new inhibitors with this new assay method.

Keywords: hyaluronic acid; hyaluronidase; hyal1; autodisplay; inhibitors

1. Introduction Hyaluronic acid (HA) is the major glycosaminoglucan of the extracellular matrix (ECM) [1]. This polysaccharide can exhibit molecular weights up to 105–107 kDa. It consists of repeating disaccharide units [(1,3)-β-D-GlcNAc-(1,4)-β-D-GlcA]. The interaction of high molecular weight (HMW) HA (>20 kDa) and water molecules lead to high viscosity and elasticity [2,3]. HA’s physiological and pathophysiological functions depend on its level of fragmentation. HMW HA plays an important role in water and plasma protein homeostasis due to its physicochemical properties. It serves as a barrier in the connective tissue, skin and joints that filter molecules and is known to have space-filling effects [3]. Depending on its molecular weight, HA is also relevant in different phases of the wound healing process [4]. The metabolism of HA is catalyzed by specific hyaluronidases and HA synthases. Low molecular weight (LMW) HA fragments resulting from hyaluronidases were shown to have

Pharmaceuticals 2020, 13, 54; doi:10.3390/ph13040054 www.mdpi.com/journal/pharmaceuticals Pharmaceuticals 2020, 13, 54 2 of 18 inflammatory, angiogenic and immunosuppressive properties [5,6]. Such pathophysiological effects have not only been observed in cancer, but also in chronic inflammatory diseases. Degradation of HA is catalyzed by specific hyaluronidases (endo-β-N acetyl-D-hexosaminidases). The human genome encodes for six hyaluronidases located on two chromosomes, including Hyaluronidase 1 (Hyal1), Hyaluronidase 2 (Hyal2), Hyaluronidase 3 (Hyal3), Hyaluronidase 4 (Hyal4), Sperm adhesion molecule 1 (SPAM1/PH20) and a pseudogene HYALP1 encoding for an mRNA, which is not translated to a protein [7,8]. While enzymatic activity for Hyal3 was never confirmed, chondroitin sulfate appeared to be the main substrate for Hyal4 [9,10]. PH20, a membrane-bound hyaluronidase, predominantly expressed on sperms. It contributes to the fertilization of the oocyte by degradation of the HA rich cumulus [11]. The main HA degradation in the human body is due to Hyal1 and Hyal2 activity. Where Hyal2 degrades HA fragments beyond 20 kDa, Hyal1 catalyzes the hydrolyzing of 20 kDa HA into LMW HA fragments with pathophysiological effects, as described above. Hyal1 is usually expressed in many different types of cells. It is both a lysosomal and a secreted enzyme, located in the ECM. Its expression level was shown to be elevated in different types of cancer, e.g., prostate, bladder, or breast cancer [12–15]. The level of expression was found to correlate with tumor stage and grade in bladder cancer and could therefore be used as diagnostic and prognostic biomarker [16]. Inhibition of Hyal1 results in a decrease in angiogenic, inflammatory and immunosuppressive LMW HA fragments. This makes Hyal1 an interesting target for the treatment of cancer, in particular, bladder, prostate or breast cancer and for the treatment of inflammatory diseases like arthritis or gingivitis [17–19]. In the past, most studies on the identification of hyaluronidase inhibitors were performed with bovine testicular hyaluronidase (BTH). A number of different inhibitors have been identified. These compounds differ in structure, source and mode of inhibition. Natural compounds and whole plant extracts, as well as synthetically compounds and polymers have been described. Various flavonoids were screened for BTH inhibition; apigenin was investigated several times with differing results (67% inhibition at 250 µM or 57% inhibition at 1 mM) [20,21]. Further well-known BTH inhibitors are L-ascorbic-acid-6-hexadecanoate (Vcpal) (IC50 = 56 µM) and glycyrrhizic acid (IC50 3 - 1300 µM), which are used as reference compounds [22–24]. It cannot be ignored, at this point, that observed differences in the degree of inhibition were due to the different enzyme activity assays applied. Despite Hyal1 being an interesting target, the number of human Hyal1 inhibitors known so far is very limited. This appears to be due to restricted access to the enzyme for testing. Extraction of the enzyme using human urine or plasma is a complex process and leads to low enzyme yields [25–27]. Recombinant expression of Hyal1 in E. coli led to the formation of inclusion bodies, requiring refolding in vitro after purification, finally leading to low enzyme yield and activity (0.11 U/mg). Expression and purification using DS-2 expression system led to a Hyal1 with higher activity (8.6 U/mg), but, for this method, several chromatographic steps for purification were necessary [28]. The protein amount finally obtained was sufficient only for a few tests, including inhibition testing of reference inhibitors such as Vcpal and glycyrrhizinic acid. The IC50 values of Vcpal and glycyrrhizic acid were determined to be > 50 µM and 26 or 39.4 µM, respectively [24,28]. Since recombinant expression of Hyal1 is still a bottleneck for the identification of inhibitors, we have developed an assay based on the constitutive expression of Hyal1 on the surface of E. coli F470. Production of immobilized Hyal1 on the surface of E. coli F470 enables immediate compound screening without further steps of Hyal1 isolation and purification. In former studies, the IC50 value of glycyrrhizic acid was determined to be 177 µM[29]. In addition, we were able to identify the aqueous extracts of marshmallow roots (Althaea officinalis) (IC50 = 7.7 mg/mL) as new Hyal1 inhibitors by application of this autodisplay-based assay [30]. In this study, we were able to increase the surface display of Hyal1 on E. coli F470 and the activity per single cell by a factor of 100 in replacing the constitutive promotor with a rhamnose-inducible promotor and by optimizing the reaction conditions. Via the improved enzyme activity test, we were able to identify two new potent inhibitors with different scaffolds. Pharmaceuticals 2020, 13, 54 3 of 18 Pharmaceuticals 2019, 12, x FOR PEER REVIEW 3 of 18

2.2. Results Results

2.1.2.1. Surface Surface Expression Expression of of Hyal1 Hyal1 InIn previous previous studies studies on on the the surface surface display display of ofHyal1, Hyal1, expression expression was was under under the thecontrol control of the of constitutive PTK promoter [26,27]. Inducible protein expression could be a way to increase protein the constitutive PTK promoter [26,27]. Inducible protein expression could be a way to increase yield.protein For yield. this reason, For this Hyal1 reason, was Hyal1 expressed was expressed under the under control the of control an inducible of an inducible promotor. promotor. While isopropyl-While isopropyl-β-d-thiogalactopyranosideβ-d-thiogalactopyranoside (IPTG)-inducible (IPTG)-inducible recombinant recombinant protein protein expression expression based based on the on T7lacthe T7lac promotor promotor results results in high in high prot proteinein amounts, amounts, expression expression is prone is prone to be to leaky be leaky and and turned turned out outto be to inappropriate for the surface display of Hyal1 (data not shown). Hence, rhamnose-controlled Prha was be inappropriate for the surface display of Hyal1 (data not shown). Hence, rhamnose-controlled Prha selected as the promoter for this study. One advantage in comparison to, e.g., the PBAD promoter, is was selected as the promoter for this study. One advantage in comparison to, e.g., the PBAD promoter, theis the linear linear dependence dependence of ofprotein protein expression expression from from the the rhamnose rhamnose concentration concentration [31]. [31]. A A plasmid plasmid for for recombinant Hyal1 expression (pAIDAIrha-Hyal1) was constructed with features indicated in Figure recombinant Hyal1 expression (pAIDAIrha-Hyal1) was constructed with features indicated in Figure1 1and and a codona codon optimized optimized DNA DNA sequence sequence of human of human Hyal1 Hyal1 [32,33 [32,33].]. In addition, In addition, a myc epitopea myc epitope was inserted was insertedat the C at terminus the C terminus of Hyal1 of to Hyal1 enable to the enable detection the detection of protein of expression protein expression by an anti-myc by an anti-myc antibody antibody(Figure1). (Figure 1).

Figure 1. Schematic description of main features of pAIDAIrha-Hyal1 expression vector. DNA and Figureamino acid1. Schematic sequences description are given forof main parts features of cholera of toxinpAIDAIβ-subunitrha-Hyal1 signal expression peptide vector. (CtxB SP),DNA Hyal1 and aminoand the acid myc sequences epitope, as are well given as the for DNAparts sequenceof cholera of toxin the P βrha-subunitpromoter signal used peptide for inducible (CtxB expression.SP), Hyal1 and the myc epitope, as well as the DNA sequence of the Prha promoter used for inducible expression. E. coli host strain F470 without plasmid as well as E. coli F470 carrying the plasmid pAIDAIrha-Hyal1 (Hyal1)E. coli were host cultured strain to anF470 OD 578withoutof 0.4–0.6 plasmid and the as expression well as ofE. Hyal1 coli F470 wasinduced carrying by the adding plasmid 1 mM rhamnose. Subsequently, outer membrane proteins were isolated [31] and analyzed by 10% sodium pAIDAIrha-Hyal1 (Hyal1) were cultured to an OD578 of 0.4–0.6 and the expression of Hyal1 was induceddodecyl by sulfate-polyacrylamide adding 1 mM rhamnose. gel electrophoresisSubsequently, ou (SDS-PAGE)ter membrane [34 proteins]. The molecular were isolated weight [31] of and the analyzedHyal1 fusion by 10% protein sodium without dodecyl CtxB sulfate-polyacrylamide signal peptide was calculated gel electrophoresis to be 96 kDa. (SDS-PAGE) In the SDS-PAGE, [34]. The moleculara protein bandweight at of this the sizeHyal1 was fusion not visibleprotein inwithout the outer CtxB membrane signal peptide protein was fraction calculated (Figure to be2A). 96 kDa.Consequently, In the SDS-PAGE, a corresponding a protein Western band at Blot this analysis size was was not performed,visible in the with outer a primary membrane monoclonal protein fractionmouseanti-Hyal1 (Figure 2A). antibody Consequently, and a secondary a corresponding polyclonal Western HRP (horse Blot radishanalysis peroxidase)-labeled was performed, with rabbit a primaryanti-mouse monoclonal antiserum. mouse A clear anti-Hyal1 band at around antibody 100 and kDa appeared,a secondary indicating polyclonal the HRP expression (horse of radish Hyal1 peroxidase)-labeledfusion protein (Figure rabbit2B). Toanti-mouse prove the antiserum. surface display, A clear cells band were at treated around with 100 proteinase kDa appeared, K after indicatingHyal1 expression. the expression Proteinase of Hyal1 K as fusion a protein protein is too (Figure large to2B). pass To prov the outere the membrane.surface display, Consequently, cells were treated with proteinase K after Hyal1 expression. Proteinase K as a protein is too large to pass the

PharmaceuticalsPharmaceuticals 20192020, 12, 13, x, 54FOR PEER REVIEW 4 of4 of 18 18 outer membrane. Consequently, only proteins displayed at the cell surface were accessible for proteolysis.only proteins Outer displayed membrane at the protein cell surface A (OmpA), were accessible with a formolecular proteolysis. weight Outer of membraneabout 35 kDa, protein is a A natural(OmpA), outer with membrane a molecular protein weight of ofE. aboutcoli, with 35 kDa,a domain is a natural in the periplasm outer membrane that is linked protein to of theE. colimurein, with layer.a domain This periplasmic in the periplasm domain that is is degraded linked to by the protei mureinnase layer. K, in This case periplasmic the outer membrane domain is is degraded leaky. The by membrane-embeddedproteinase K, in case thepart outer of OmpA, membrane which is leaky.has a Themole membrane-embeddedcular weight of 25 kDa, part is ofprotected OmpA, whichfrom degradation.has a molecular Consequently, weight of 25the kDa, appearance is protected of OmpA from degradation.at a full size molecular Consequently, weight the of appearance 35 kDa and of noOmpA additional at a full band size at molecular 25 kDa is weight a clear of indication 35 kDa and of noan additionalintact outer band membrane at 25 kDa (Figure is a clear 2A, indicationLane 4). Hence,of an intactthe degradation outer membrane of Hyal1 (Figure under2 A,identical Lane 4). conditions, Hence, the as degradationseen in Figure of 2B, Hyal1 Lane under 4 indicates identical its successfulconditions, surface as seen display. in Figure 2B, Lane 4 indicates its successful surface display.

FigureFigure 2. 2.ExpressionExpression of Hyal1 of Hyal1 on E. on coliE. F470 coli andF470 protease and protease accessibility accessibility test for proving test for surface proving display. surface Analysisdisplay. Analysisof outer ofmembrane outer membrane protein proteinisolations isolations from E. from coliE. F470 coli F470 (host) (host) and and E. coliE. coli F470F470 carrying carrying pAIDAI -Hyal1 without ( ) and with (+) induction of Hyal1 fusion protein expression by addition of pAIDAIrharha-Hyal1 without (−−) and with (+) induction of Hyal1 fusion protein expression by addition of1 mM1 mM rhamnose rhamnose and proteinaseand proteinase K treatment K treatment prior to outerprior membraneto outer membrane protein isolation. protein Characteristic isolation. Characteristicouter membrane outer proteins membrane of E. coliproteinsF470 are of indicatedE. coli F470 as OmpF,are indicated OmpC andas OmpF, OmpA. OmpC Apparent andmolecular OmpA. Apparentweights ofmolecular marker proteinsweights of are marker indicated proteins on the are left indicated in kDa on (M). the 10% left SDS-PAGEin kDa (M). was10% stainedSDS-PAGE with ® A wasProBlue stained Safe with Stain ProBlue( ), aSafe primary Stain® monoclonal (A), a primary anti-myc monoclonal antibody anti-myc and secondary antibody HRP-conjugatedand secondary polyclonal antiserum were used for Western Blot analysis (B). HRP-conjugated polyclonal antiserum were used for Western Blot analysis (B). For additional proof of the surface display, flow cytometry analysis was performed (Figure3). For additional proof of the surface display, flow cytometry analysis was performed (Figure 3). Cells before and after induction of Hyal1 expression with rhamnose, as well as cells treated with Cells before and after induction of Hyal1 expression with rhamnose, as well as cells treated with proteinase K after induction were incubated with primary monoclonal mouse anti-myc antibody proteinase K after induction were incubated with primary monoclonal mouse anti-myc antibody followed by an incubation with secondary Dylight633-conjugated rabbit anti-IgG mouse antiserum. followed by an incubation with secondary Dylight633-conjugated rabbit anti-IgG mouse antiserum. A A total of 50,000 cells per sample were analyzed via flow cytometry. The mean value of fluorescence (mF) total of 50,000 cells per sample were analyzed via flow cytometry. The mean value of fluorescence of E. coli F470 pAIDAIrha-Hyal1 cells without induction of Hyal1 expression (control) was determined (mF) of E. coli F470 pAIDAIrha-Hyal1 cells without induction of Hyal1 expression (control) was to be 45 (Figure3A). The mF of cells after induction of Hyal1 expression was higher by a factor of four determined to be 45 (Figure 3A). The mF of cells after induction of Hyal1 expression was higher by a (mF = 190) (Figure3B), whereas the mF of cells with Hyal1 expression, but treated with proteinase K, factor of four (mF = 190) (Figure 3B), whereas the mF of cells with Hyal1 expression, but treated with was 46—almost identical to the control cells (Figure3C). These results clearly indicated the surface proteinase K, was 46—almost identical to the control cells (Figure 3C). These results clearly indicated display of Hyal1 under the control of the inducible rhamnose promoter. the surface display of Hyal1 under the control of the inducible rhamnose promoter.

Pharmaceuticals 2020, 13, 54 5 of 18 Pharmaceuticals 2019, 12, x FOR PEER REVIEW 5 of 18

Figure 3. Flow cytometry analyses of immune-labeled E. coli F470 cells carrying pAIDAIrha-Hyal1. Figure 3. Flow cytometry analyses of immune-labeled E. coli F470 cells carrying pAIDAIrha-Hyal1. Analysis and determination of mean fluorescence intensity (mF) of cells without induction of Hyal1 Analysis and determination of mean fluorescence intensity (mF) of cells without induction of Hyal1 expression (45) (A), induction of Hyal1 expression (190) (B) and cells with induced Hyal1 expression expression (45) (A), induction of Hyal1 expression (190) (B) and cells with induced Hyal1 expression and proteinase K treatment prior to flow cytometry analysis (46) (C). After 16 h of cultivation cells wereand proteinase harvested K and treatment incubated prior with to flow a primary cytometry monoclonal, analysis (46) anti-myc (C). After antibody 16 h of and cultivation a secondary cells were harvested and incubated with a primary monoclonal, anti-myc antibody and a secondary Dylight633-conjugated anti-IgG antiserum and analyzed after washing by flow cytometry. Dylight633-conjugated anti-IgG antiserum and analyzed after washing by flow cytometry. 2.2. Influence of Induction Time on Hyal1 Expression and Activity 2.2. Influence of Induction Time on Hyal1 Expression and Activity The E. coli F470 host strain and seven cultures of E. coli F470 carrying pAIDAIrha-Hyal1 for inducibleThe E. Hyal1 coli expressionF470 host werestrain cultured and seven and, cultures to six cultures, of E. 1coli mM F470 rhamnose carrying was pAIDAI added forrha-Hyal1 induction for inducibleof Hyal1 expression. Hyal1 expression The cultures were were cultured incubated and, forto 4–24six cultures, h and kept 1 mM at 4 ◦rhamnoseC after harvesting. was added Finally, for inductionouter membrane of Hyal1 proteins expression. were isolated The cultures and analyzed were incubated by SDS-PAGE for 4–24 and h Western and kept Blot at as 4 described °C after harvesting.above. E. coli Finally,F470 hostouter and membraneE. coli F470 proteins cells were carrying isolated pAIDAI and analyzedrha-Hyal1 by without SDS-PAGE protein and induction Western (controls)Blot as described did not showabove. any E. bandcoli F470 corresponding host and E. to Hyal1coli F470 (Figure cells4 ).carrying Hyal1 fusionpAIDAI proteinrha-Hyal1 appeared without as proteinband around induction 100 kDa, (controls) visible did in all not samples show any after band the addition corresponding of rhamnose to Hyal1 (4–24 (Figure h). For 4). this Hyal1 experiment, fusion proteinthe total appeared amount of as protein band around loaded per100 samplekDa, visible was increased in all samples in comparison after the toaddition the previous of rhamnose SDS-PAGE (4– (Figure24 h). For2). this This experiment, is indicated the by thetotal higher amount band of prot intensityein loaded of the per natural sample outer was membrane increased proteins in comparison OmpF, toOmpC the previous and OmpA. SDS-PAGE [35]. The (Figure higher 2). number This is of indicated outer membrane by the higher proteins band loaded intensity also allowedof the natural Hyal1 outerfusion membrane protein detection proteins in SDS-PAGE.OmpF, OmpC To ourand surprise, OmpA. the[35]. yield The of higher surface number displayed of outer Hyal1 membrane decreased withproteins an increasingloaded also induction allowed Hyal1 time, although fusion protein the total detection protein in amount SDS-PAGE. per lane To our of the surprise, SDS-PAGE the yield was ofidentical surface for displayed each sample. Hyal1 A decreased possible explanation with an incr couldeasing be induction the presence time, of OmpT,although an outerthe total membrane protein proteaseamount per naturally lane of occurringthe SDS-PAGE in E. coli,was belongingidentical for to each the aspartyl-protease sample. A possible family explanation [36]. The could release be the of presencesurface displayed of OmpT, proteins an outer by OmpTmembrane has been protease shown naturally in previous occurring studies [in37 –E.39 ].coli, OmpT belonging could alsoto the be aspartyl-proteaseresponsible for the family additional [36]. bandsThe release occurring of surface at lower displayed molecular proteins weights, by most OmpT prominent has been after shown 4 and in previous8 h of induction. studies [37–39]. These additional OmpT coul bandsd also could be responsible have been for generated the additional during bands outer membraneoccurring at protein lower molecularisolation as weights, observed most before prominent [40]. ExPAsy after 4 peptide and 8 h cutter of induction. online software These additional was used bands to determine could have the possiblebeen generated cleavage during sites ofouter OmpT membrane within theprotein Hyal1 isol fusionation proteinas observed [41]. before In total, [40]. 29 cleavageExPAsy peptide sites at cutterthe N terminusonline software of the Hyal1was used fusion to determine protein were the predicted. possible cleavage Proteolysis sites of of the OmpT membrane within embedded the Hyal1 fusionß-barrel protein at the C[41]. terminus In total, could 29 cleavage be excluded. sites Aat restrictionthe N terminus of accessible of the cleavageHyal1 fusion sites protein due to stablewere predicted.secondary structuresProteolysis was of the not considered.membrane embedded A further R ß-barrelV cleavage at the site C withinterminus the could linker be region excluded. between A ↓ AA513restriction and of AA514 accessible of the Hyal1cleavage fusion sites protein due to was stable described secondary previously structures by Maurer was not et al. considered. for a different A passengerfurther R↓ proteinV cleavage [37]. site Consequently, within the welinker considered region between the decreasing AA513 amount and AA514 of full of length the Hyal1 Hyal1, fusion along withprotein longer was expression described times, previously could be by due Maurer to the releaseet al. offor Hyal1 a different into the supernatantpassenger dueprotein to OmpT [37]. Consequently,cleavage. The degradation we considered bands the appearing decreasing at earlier amount time of points, full e.g.,leng afterth Hyal1, 4 and 8along h, could with be longer due to expressionOmpT cleavage times, during could outer be due membrane to the release preparation of Hyal1 or into due tothe fragments supernatant of Hyal1 due to released OmpT bycleavage. OmpT Theremaining degradation in contact bands with appearing the cell surface at earlier by uncleavedtime points, Hyal1, e.g., after a phenomenon, 4 and 8 h, could that has be beendue to observed OmpT cleavagebefore in theduring case outer of surface membrane displayed preparation adrenodoxin or due [37] (Figureto fragments4B). of Hyal1 released by OmpT remaining in contact with the cell surface by uncleaved Hyal1, a phenomenon, that has been observed before in the case of surface displayed adrenodoxin [37] (Figure 4B).

Pharmaceuticals 20202019,, 1312,, 54x FOR PEER REVIEW 66 of of 18

Figure 4. Induction time influences surface expression of Hyal1 on E. coli F470. Analysis of outer ® membraneFigure 4. Induction protein isolations time influences by 10% SDS-PAGE surface expression stained with of Hyal1 ProBlue on Safe E. coli Stain F470.(A )Analysis and Western of outer Blot (membraneB) using a protein primary isolations monoclonal, by 10% anti SDS- Hyal1PAGE antibody stained and with a secondary ProBlue Safe HRP-conjugated Stain® (A) and polyclonal Western antiserum.Blot (B) using Apparent a primary molecular monoclonal, weights anti of marker Hyal1 proteinsantibody are and indicated a secondary on the HRP-conjugated left in kDa (M). Outerpolyclonal membrane antiserum. proteins Apparent from E. molecular coli F470 (host)weights and of E.marker coli F470 proteins carrying are pAIDAIindicatedrha on-Hyal1 the left with in kDa and without the induction of Hyal1 surface display by the addition of 1 mM rhamnose and increasing (M). Outer membrane proteins from E. coli F470 (host) and E. coli F470 carrying pAIDAIrha-Hyal1 with inductionand without times. the induction Protein samples of Hyal1 were surface standardized display by the amountaddition of of natural 1 mM rhamnose outer membrane and increasing proteins occurring,induction i.e.,times. to showProtein identical samples band were sizes standardized for OmpC, OmpFby the and amount OmpA. of natural outer membrane proteins occurring, i.e., to show identical band sizes for OmpC, OmpF and OmpA. Hyal1 enzyme activity was determined using a previously described Stains-all assay [42]. InteractionHyal1 ofenzyme Stains-all activity with was HMW determined HA results using in ana previously absorbance described at 650 nm, Stains-all dependent assay on [42]. the concentrationInteraction of ofStains-all HMW HAwith (Figure HMW S1).HA Enzymeresults in activity an absorbance is commonly at 650 given nm, in dependent units (U), on which the µ correspondsconcentration to of the HMWmols HA of the(Figure substrate S1). Enzyme converted activity per minute. is commonly Because given the substratein units (U), molecules which acceptedcorresponds by Hyal1 to the can µmols be di offferent, the substrate e.g., an octamer converted can per be cleaved minute. to Because a tetramer, the followedsubstrate by molecules cleavage toaccepted a dimer, by thisHyal1 is can not be appropriate different, e.g., for Hyal1an octamer and can does be not cleaved allow to us a tetramer, to determine followed enzyme by cleavage kinetic measurementsto a dimer, this as is required not appropriate e.g., for a Lineweaver–Burkfor Hyal1 and does plot. not Hence, allow theus activityto determine of Hyal1 enzyme is defined kinetic as µ themeasurementsmol-reducing as required sugar ends e.g., produced for a Lineweaver–Bur per minute. Byk theplot. application Hence, the of activity the Stains-all of Hyal1 assay, is onlydefined the decreaseas the µmol-reducing in HMW HA sugar due to ends degradation produced by per Hyal1 minute. can By be the determined. application For of this the purpose,Stains-all theassay, enzyme only activitythe decrease needs in to HMW be defined HA asdue the to HMW degradation HA turnover by Hyal1 in mg can/mL. be Thedetermined. amount of For degraded this purpose, HMW HAthe byenzyme surface activity displayed needs Hyal1 to be wasdefined estimated as the HMW with the HA help turnover of a calibration in mg/mL. curve The amount (Figure of S1). degraded For the activityHMW HA assay, by surface cells were displayed harvested Hyal1 and was washed estimated with with sodium the help formate of a pHcalibration 3.5. Cell curve suspension (Figure wasS1). adjustedFor the activity to an ODassay,578 ofcells 10 were and HAharvested was added and washed to a final with concentration sodium formate of 0.11 pH mg 3.5./mL. Cell Aftersuspension 1 min reaction time, Stains-all was added. Surprisingly, cells with the highest Hyal1 protein expression after was adjusted to an OD578 of 10 and HA was added to a final concentration of 0.11 mg/mL. After 1 min 4reaction h of induction time, Stains-all (Figure was4) showed added. Surprisingly, the lowest HMW cells HAwith turnover, the highest i.e., Hyal1 enzyme protein activity expression (Figure after5). The4 h of HMW induction HA turnover(Figure 4) increasedshowed the over lowest time HMW with decreasingHA turnover, protein i.e. enzyme amounts activity until (Figure it reached 5). The an optimumHMW HA at turnover 16 h of induction. increased Consequently, over time with all furtherdecreasing experiments protein amounts were carried until out it afterreached 16 h an of inductionoptimum time.at 16 h of induction. Consequently, all further experiments were carried out after 16 h of induction time.

Pharmaceuticals 2020, 13, 54 7 of 18 Pharmaceuticals 2019, 12, x FOR PEER REVIEW 7 of 18

FigureFigure 5.5. EnzymeEnzyme activityactivity ofof Hyal1Hyal1 onon thethe surfacesurface ofof E.E. colicoli F470,F470, dependentdependent upon the induction time. EnzymeEnzyme activityactivity determinationdetermination was was performed performed using using the the Stains-all Stains-all assay assay [ 39[39].]. CellsCells werewere culturedcultured andand

incubatedincubated withwith 11 mMmM rhamnoserhamnose for the inductioninduction times as as indicated. indicated. Subsequently Subsequently OD OD578578 waswas set set to to10 10 after after washing washing with with sodium sodium formate formate buffer buff (100er (100 mM) mM) pH pH3.5. 3.5.hyaluronic hyaluronic acid acid(HA) (HA) was wasadded added (0.11 (0.11mg/mL mg /finalmL final concentration) concentration) and and reaction reaction was was pe performedrformed for for 1 1min min at at 37 37 ◦°C.C. SupernatantsSupernatants werewere analyzedanalyzed forfor residualresidual highhigh molecularmolecular weight weight (HMW) (HMW) HA HA using using Stains-all. Stains-all. MeanMeanvalues values ± SDSD (n(n == 3). ± 2.3.2.3. InfluenceInfluence ofof RhamnoseRhamnose ConcentrationConcentration onon Hyal1Hyal1 ExpressionExpression andand ActivityActivity

E. coli F470 host cells (control) and 10 cultures of E. coli F470 carrying pAIDAIrha-Hyal1 were E. coli F470 host cells (control) and 10 cultures of E. coli F470 carrying pAIDAIrha-Hyal1 were culturedcultured andand Hyal1Hyal1 expressionexpression waswas inducedinduced byby addingadding variantvariant concentrations ofof rhamnose (0–5 mM). ProteinProtein expressionexpression waswas analyzedanalyzed byby SDS-PAGESDS-PAGE andand WesternWestern BlotBlot analysisanalysis ofof thethe outerouter membranemembrane proteinprotein preparationspreparations (Figure(Figure6 ).6). The The band band corresponding corresponding to to Hyal1 Hyal1 fusion fusion at at 100 100 kDa kDa was was not not visible visible atat rhamnoserhamnose concentrationsconcentrations belowbelow 0.50.5 mM,mM, butbut consecutivelyconsecutively increasedincreased atat higherhigher concentrationsconcentrations ofof rhamnose.rhamnose. ItIt needsneeds toto bebe emphasizedemphasized that,that, inin thisthis experiment,experiment, thethe overalloverall proteinprotein amountamount loadedloaded perper samplesample was was lower lower than than in in the the preceding preceding experiment experiment given given in Figure in Figure4. This 4. led This to fainterled to fainter protein protein bands representingbands representing Hyal1. Hyal1. In addition, flow cytometry analysis of 50,000 cells per sample was performed as described above. Increasing rhamnose concentrations led to higher mF values, until a plateau was reached at 2 mM of rhamnose (Figure7), which means that higher concentrations of inducer did not yield higher fluorescence. This observation is confirmed by earlier studies on protein expression under the control of a rhamnose promoter [31,43]. In addition, the HMW HA turnover, dependent upon the rhamnose concentration, was determined. Increasing concentrations of rhamnose were expected to yield higher Hyal1 expression and, hence, higher activity and HMW HA turnover. (Figure7B). Cells with protein expression induced with rhamnose concentrations below 0.025 mM showed significantly less HMW HA turnover. However, a significant difference in the HA turnover at concentrations beyond higher 0.025 mM was not detectable. Finally, 1 mM rhamnose was maintained for inducing protein expression in all following experiments to be on the safe side. As already seen in the experiments described above, there was no correlation between the Hyal1 protein amount visible in the SDS-PAGE and enzymatic activity determined by Stains-all.

Figure 6. Surface expression of Hyal1 on E. coli F470, dependent upon inducer concentration. Outer

membrane proteins of E. coli F470 (host) and E. coli F470 carrying pAIDAIrha-Hyal1 with and without (0 mM rhamnose) induction of Hyal1 protein expression were analyzed by 10% SDS-PAGE stained with ProBlue Safe Stain® (A) and Western Blot analysis using a primary monoclonal anti-Hyal1 antibody and a secondary HRP-conjugated polyclonal antiserum (B). Apparent molecular weights are indicated on the left in kDa (M). Proteins samples were standardized by the amount of natural outer membrane proteins occurring, i.e., to show identical band size for OmpC, OmpF and OmpA. Rhamnose concentrations for induction of protein expression are given below the lanes of the gel and the western blot. Hyal1 and natural outer membrane proteins OmpF, C, and A are indicated.

Pharmaceuticals 2019, 12, x FOR PEER REVIEW 7 of 18

Figure 5. Enzyme activity of Hyal1 on the surface of E. coli F470, dependent upon the induction time. Enzyme activity determination was performed using the Stains-all assay [39]. Cells were cultured and

incubated with 1 mM rhamnose for the induction times as indicated. Subsequently OD578 was set to 10 after washing with sodium formate buffer (100 mM) pH 3.5. hyaluronic acid (HA) was added (0.11 mg/mL final concentration) and reaction was performed for 1 min at 37 °C. Supernatants were analyzed for residual high molecular weight (HMW) HA using Stains-all. Mean values ± SD (n = 3).

2.3. Influence of Rhamnose Concentration on Hyal1 Expression and Activity

E. coli F470 host cells (control) and 10 cultures of E. coli F470 carrying pAIDAIrha-Hyal1 were cultured and Hyal1 expression was induced by adding variant concentrations of rhamnose (0–5 mM). Protein expression was analyzed by SDS-PAGE and Western Blot analysis of the outer membrane protein preparations (Figure 6). The band corresponding to Hyal1 fusion at 100 kDa was not visible at rhamnose concentrations below 0.5 mM, but consecutively increased at higher concentrations of rhamnose. It needs to be emphasized that, in this experiment, the overall protein amount loaded per Pharmaceuticalssample was2020 lower, 13, 54 than in the preceding experiment given in Figure 4. This led to fainter protein8 of 18 bands representing Hyal1.

FigureFigure 6. 6.Surface Surface expression expression of of Hyal1 Hyal1 ononE. E. colicoli F470,F470, dependentdependent upon inducer inducer concentration. concentration. Outer Outer

membranemembrane proteins proteins of ofE. E. coli coliF470 F470 (host) (host) and andE. E. colicoli F470F470 carryingcarrying pAIDAIrharha-Hyal1-Hyal1 with with and and without without (0(0 mM mM rhamnose) rhamnose) induction induction of of Hyal1 Hyal1 proteinprotein expressionexpression were analyzed analyzed by by 10% 10% SDS-PAGE SDS-PAGE stained stained Pharmaceuticals 2019, 12, x FOR PEER REVIEW 8 of 18 withwith ProBlue ProBlue Safe Safe Stain Stain®® ((AA)) andand WesternWestern BlotBlot analysisanalysis using using a a primary primary monoclonal monoclonal anti-Hyal1 anti-Hyal1 antibody and a secondary HRP-conjugated polyclonal antiserum (B). Apparent molecular weights antibodyIn addition, and aflow secondary cytometry HRP-conjugated analysis of polyclonal 50,000 cells antiserum per sample (B). Apparent was performed molecular weightsas described areare indicated indicated on on the the left left in in kDa kDa (M). (M). ProteinsProteins samplessamples were standardized by by the the amount amount of of natural natural above. Increasing rhamnose concentrations led to higher mF values, until a plateau was reached at 2 outerouter membrane membrane proteins proteins occurring, occurring, i.e.,i.e., toto showshow identical band band size size for for OmpC, OmpC, OmpF OmpF and and OmpA. OmpA. mM of rhamnose (Figure 7), which means that higher concentrations of inducer did not yield higher RhamnoseRhamnose concentrations concentrations for for induction induction ofof proteinprotein expressionexpression are given given below below the the lanes lanes of of the the gel gel and and fluorescence. This observation is confirmed by earlier studies on protein expression under the control thethe western western blot. blot. Hyal1 Hyal1 and and natural natural outerouter membranemembrane proteins OmpF, C, C, and and A A are are indicated. indicated. of a rhamnose promoter [31,43].

FigureFigure 7. 7.Mean Mean fluorescencefluorescence (mF) (mF) values values of of immunolabeled immunolabeledE. E. coli coliF470 F470 carrying carrying pAIDAI pAIDAIrharha-Hyal1-Hyal1 ((AA)) andand HMW HMW HA HA turnover turnover (B), dependent(B), dependent upon theupon rhamnose the rhamnose concentration concentration used for proteinused for expression. protein Forexpression. flow cytometer For flow analysis, cytometer cells analysis, were harvested cells were after harvested 16 h induction after time16 h andinduction incubated time with and aincubated primary monoclonalwith a primary anti-myc monoclonal antibody andanti-myc a secondary antibody Dylight and633 a conjugatedsecondary anti-IgGDylight633 antiserum. conjugated 50,000 anti-IgG cells wereantiserum. analyzed 50,000 per sample.cells were Mean analyzed fluorescence per sample. intensity Mean is plottedfluorescence against intensity rhamnose is plotted concentration. against Forrhamnose HMW HAconcentration. turnover, cells For were HMW harvested HA turnover, and washed cells were with sodiumharvested formate and washed buffer (100 with mM) sodium pH 3.5.formate Cell suspensionbuffer (100 wasmM) adjusted pH 3.5. Cell to an suspension OD578 of 10. was HA adjusted was added to an (0.11 OD578 mg of/ mL10. HA final was concentration) added (0.11 andmg/mL the reactionfinal concentration) was run for and 1 min the at reaction 37 ◦C. Supernatantswas run for 1 weremin at analyzed 37 °C. Supernatants for residual were HMW analyzed HA by Stains-allfor residual assay. HMW Mean HA values by Stains-allSD (n assay.= 3). Mean values ± SD (n = 3). ± 2.4. Influence of pH, Temperature, Substrate Concentration and Sodium Chloride on Enzyme Activity In addition, the HMW HA turnover, dependent upon the rhamnose concentration, was determined.E. coli F470 Increasing cells displaying concentrations Hyal1 wereof rhamnose washed were with expected sodium formate to yield bu higherffer and Hyal1 suspended expression in varyingand, hence, NaCl higher concentrations activity atan varyingd HMW pH HA and turnover. the desired (Figure OD578 7B).was Cells adjusted. with Finally,protein hyaluronicexpression acidinduced diluted with in appropriaterhamnose concentrations sodium formate below buffer 0.025 was added mM showed (1:1 v/v). significantly After one minute less ofHMW reaction HA time,turnover. HMW However, HA turnover a significant was measured difference using in the Stains-all. HA turnover Hyal1 at activity concentrations was strongly beyond dependent higher 0.025 on mM was not detectable. Finally, 1 mM rhamnose was maintained for inducing protein expression in all following experiments to be on the safe side. As already seen in the experiments described above, there was no correlation between the Hyal1 protein amount visible in the SDS-PAGE and enzymatic activity determined by Stains-all.

2.4. Influence of pH, Temperature, Substrate Concentration and Sodium Chloride on Enzyme Activity E. coli F470 cells displaying Hyal1 were washed with sodium formate buffer and suspended in varying NaCl concentrations at varying pH and the desired OD578 was adjusted. Finally, hyaluronic acid diluted in appropriate sodium formate buffer was added (1:1 v/v). After one minute of reaction time, HMW HA turnover was measured using Stains-all. Hyal1 activity was strongly dependent on the NaCl concentration. The higher the NaCl concentration, the lower the turnover of high molecular weight HA (Figure 8A). Accordingly, all further experiments were performed using sodium formate buffer without any additional NaCl. HMW HA turnover was highest at pH 3.5 with a turnover of about 0.027 mg/mL HMW HA per min (Figure 8B). Hence, the pH optimum for Hyal1 was 3.5, which is in accordance with values in the literature [8]. A linear correlation was observed for HMW HA turnover and the number of bacterial cells displaying Hyal1. Increasing cell numbers led to an increased enzyme concentration and to an elevated HMW HA turnover (Figure 8C). An OD578 of five was finally chosen as appropriate for inhibitor screening. Low amounts of bacterial cells may reduce probable site effects, like interactions between a potential inhibitor and the surface of a single bacterial

Pharmaceuticals 2020, 13, 54 9 of 18 the NaCl concentration. The higher the NaCl concentration, the lower the turnover of high molecular weight HA (Figure8A). Accordingly, all further experiments were performed using sodium formate buffer without any additional NaCl. HMW HA turnover was highest at pH 3.5 with a turnover of about 0.027 mg/mL HMW HA per min (Figure8B). Hence, the pH optimum for Hyal1 was 3.5, which is in accordance with values in the literature [8]. A linear correlation was observed for HMW HA turnover and the number of bacterial cells displaying Hyal1. Increasing cell numbers led to an increased enzyme concentration and to an elevated HMW HA turnover (Figure8C). An OD 578 of five was finally chosen Pharmaceuticals 2019, 12, x FOR PEER REVIEW 9 of 18 as appropriate for inhibitor screening. Low amounts of bacterial cells may reduce probable site effects, likecell. interactionsThe HMW betweenHA turnover a potential was determined inhibitor and to be the dependent surface of upon a single varying bacterial HA cell. concentrations. The HMW HATurnover turnover increased was determined linearly up to beto 0.11 dependent mg/mL upon HA varyingand reached HA concentrations.a plateau at higher Turnover concentrations increased linearly(Figure 8D). up to Hence, 0.11 mg a /HAmL concentration HA and reached of 0.11 a plateau mg/mL at was higher chosen concentrations as substrate (Figure concentration8D). Hence, for all a HAfollowing concentration experiments. of 0.11 mg/mL was chosen as substrate concentration for all following experiments.

FigureFigure 8.8.Improving Improving the assaythe assay conditions conditions for maximum for maximum Hyal1 activity. Hyal1 Whole activity. cell activity Whole measurements cell activity ofmeasurements cells displaying of cells Hyal1 displaying were performed. Hyal1 were Cells performed. were harvested Cells afterwere 16harvested h of induction after 16 and h of OD induction578 was setand to OD 10578 or was as indicated, set to 10 or followed as indicated, by incubation followed by at incubation 37 ◦C for one at 37 minute °C for underone minute diﬀerent under conditions. different Enzymeconditions. activity Enzyme as HMW activity HA as turnover HMW HA in mgturnover/mL/min in mg/mL/min dependent on dependent NaCl concentration on NaCl concentration (A) and pH value(A) and (B ),pH optical value cell (B), density optical atcell 578 density nm (C at) and578 nm HA ( substrateC) and HA concentration substrate concentration (D). Residual (D HMW). Residual HA wasHMW detected HA was using detected the Stains-all using the assay. Stains-all Mean a valuesssay. MeanSD values are given ± SD (n are= 3). given (n = 3). ± 2.5. Reaction Time 2.5. Reaction Time Because inhibitor testing should be done under linear reaction conditions, the enzyme kinetics of Because inhibitor testing should be done under linear reaction conditions, the enzyme kinetics HA turnover were determined. For this purpose, the initial HMW HA turnover of a cell suspension of HA turnover were determined. For this purpose, the initial HMW HA turnover of a cell suspension with an OD578 = 10 was determined after induction of protein expression with 1 mM rhamnose for with an OD578 = 10 was determined after induction of protein expression with 1 mM rhamnose for 16 16 h. The reaction was followed for 180 s by determining the residual amount of HMW HA in the cell h. The reaction was followed for 180 s by determining the residual amount of HMW HA in the cell supernatant by the Stains-all assay (Figure9). It turned out that the HMW HA turnover rate increased supernatant by the Stains-all assay (Figure 9). It turned out that the HMW HA turnover rate increased in a linear way until 45 s of reaction. At later time points, the curve appeared to bend. Consequently, for inhibitor screening, the reaction time was set at 30 s, in order to be in the linear range.

Pharmaceuticals 2020, 13, 54 10 of 18 in a linear way until 45 s of reaction. At later time points, the curve appeared to bend. Consequently, forPharmaceuticals inhibitor screening, 2019, 12, x FOR the PEER reaction REVIEW time was set at 30 s, in order to be in the linear range. 10 of 18

Figure 9. HMW turnover depending on the reaction time. E. coli F470 cells expressing Hyal1 were Figure 9. HMW turnover depending on the reaction time. E. coli F470 cells expressing Hyal1 were cultivated and after 16 h of induction the OD578 was set to 10 by adding reaction buffer (sodium formate cultivated and after 16 h of induction the OD578 was set to 10 by adding reaction buffer (sodium buffer (100 mM) pH 3.5, without NaCl). After adding 0.22 mg/mL HMW HA (1:1 v/v) reaction was formate buffer (100 mM) pH 3.5, without NaCl). After adding 0.22 mg/mL HMW HA (1:1 v/v) reaction performed at 37 C for various times. The residual HMW HA was detected using the Stains-all assay. was performed◦ at 37 °C for various times. The residual HMW HA was detected using the Stains-all Mean values SD are given (n = 3). assay. Mean± values ± SD are given (n = 3). 2.6. Inhibitor Screening 2.6. Inhibitor Screening Two well-known Hyal1 inhibitors described previously are Vcpal and glycyrrhizic acid. These compoundsTwo well-known were tested Hyal1 on the inhibitors inhibition described of surface previo displayedusly are Hyal1.Vcpal and Inhibition glycyrrhizic by Vcpalacid. These at a compounds were tested on the inhibition of surface displayed Hyal1. Inhibition by Vcpal at a concentration of 200 µM was rudimentary (18.5%). Consequently, no IC50 value was determined. concentration of 200 µM was rudimentary (18.5%). Consequently, no IC50 value was determined. Glycyrrhizic acid showed more than 90% inhibition at a concentration of 200 µM. Hence, the IC50 value wasGlycyrrhizic determined acid and showed turned more out to than be 17590% inhibiti1.2 µMon (Figure at a concentration 10). This is in of agreement 200 µM. Hence, with previous the IC50 ± studiesvalue was [24]. determined and turned out to be 175 ± 1.2 µM (Figure 10). This is in agreement with previousSteroids studies are known [24]. to have an effect on HA metabolism [44–46]. Therefore, 19 different testosterone derivativesSteroids were are tested known on Hyal1 to have inhibition an effect (Tables on S1HA and metabolism S2) [44–46 ].[44–46]. In addition, Ther phenylpropanoids,efore, 19 different intestosterone particular, cinnamic derivatives acid were derivatives, tested have on beenHyal1 shown inhibition before (Table to have S1, inhibitory S2) [44–46]. effects onIn BTHaddition, [44]. Forphenylpropanoids, this reason, 15 cinnamic in particular, acid derivatives cinnamic were acid tested derivatives, on Hyal1 have inhibitions been shown as well before (Table S3)to [have47]. Outinhibitory of these effects compounds, on BTH testosterone [44]. For this propionate reason, and15 cinnamic chicoric acidacid showedderivatives the bestwere inhibition tested on values Hyal1 withinhibitions 47% and as 40% well at (Table 200 µM S3) and [47]. 100 OutµM, of respectively.these compounds, Unfortunately, testosterone the Stains-allpropionate assay and was chicoric strongly acid impairedshowed bythe high best concentrations inhibition values of chicoric with acid 47% beyond and 25040%µ M.at Consequently,200 µM and 250100µ MµM, was respectively. the highest Unfortunately, the Stains-all assay was strongly impaired by high concentrations of chicoric acid concentration that could be used in the IC50 value determination, but it resulted in a Hyal1 inhibition beyond 250 µM. Consequently, 250 µM was the highest concentration that could be used in the IC50 below 100%. This is a considerable restraint, and the IC50 value, determined to be 171 µM, has to be consideredvalue determination, with reservations. but it resulted Due to in the a Hyal1 incomplete inhibition course below of the 100%. curve, This the is standarda considerable deviation restraint, for and the IC50 value, determined to be 171 µM, has to be considered with reservations. Due to the this IC50 value could not be determined. With testosterone propionate, it was not possible to obtain moreincomplete than 50% course inhibition, of the curve, regardless the standard of the concentrations deviation for applied.this IC50 value This could could be not an be indication determined. of aWith mixed testosterone type or partial propionate, inhibition it was of Hyal1 not possible by this compound.to obtain more Because than 50% the curve inhibition, showed regardless a typical, of the concentrations applied. This could be an indication of a mixed type or partial inhibition of Hyal1 sigmoidal course, a relative IC50 value could be determined, referring to the concentration required for halfby this maximum compound. inhibition, Because which the curve turned showed out to be a typical, 124 1.1 sigmoidalµM (Figure course, 10). a relative IC50 value could be determined, referring to the concentration required± for half maximum inhibition, which turned out to be 124 ± 1.1 µM (Figure 10).

Pharmaceuticals 2020, 13, 54 11 of 18 Pharmaceuticals 2019, 12, x FOR PEER REVIEW 11 of 18

FigureFigure 10. ICIC5050 curvescurves of of glycyrrhizic glycyrrhizic acid acid (A (A),), testosterone testosterone propionate propionate (B (B) )and and chicoric chicoric acid acid ( (CC).). InhibitionInhibition of of Hyal1 Hyal1 was was tested tested using 12 different different concentrations of testosterone propionate and glycyrrhizicglycyrrhizic acid acid and 10 didifferentfferent chicoricchicoric acidacid concentrations.concentrations. The The horizo horizontalntal dotted dotted line line marks representrepresent 50% 50% inhibition. inhibition. The The vert verticalical dotted dotted line line marks marks represent represent th thee inhibitor inhibitor concentration concentration at at 50% 50% inhibition. IC value of 175 1.2 µM for glycyrrhizic acid, 124 1.1 µM for testosterone propionate inhibition. IC5050 value of 175 ±± 1.2 µM for glycyrrhizic acid, 124 ±± 1.1 µM for testosterone propionate and 171 µM for chicoric acid were determined. Mean values SD are given (n = 3). Because of the and 171 µM for chicoric acid were determined. Mean values ± SD are given (n = 3). Because of the incompleteincomplete course course of of the the curve curve obtained obtained for chicoric acid, no SD could be calculated. 3. Discussion 3. Discussion Production of recombinant human Hyal1 has been a bottleneck for inhibitor screening for a long Production of recombinant human Hyal1 has been a bottleneck for inhibitor screening for a long time. Several expression systems have been studied in the past. E. coli and Drosophila Schneider 2 time. Several expression systems have been studied in the past. E. coli and Drosophila Schneider 2 (DS-2) cells as potential systems were investigated and compared by Hofinger et al. [27]. Cytosolic (DS-2) cells as potential systems were investigated and compared by Hofinger et al. [27]. Cytosolic expression in E. coli resulted in high protein yields but very low enzyme activity. Enzyme expression expression in E. coli resulted in high protein yields but very low enzyme activity. Enzyme expression in DS-2 cells was time consuming and the final amount of Hyal1 was less than that obtained with E. in DS-2 cells was time consuming and the final amount of Hyal1 was less than that obtained with E. coli. However, specific enzyme activity was 75 times higher in eukaryotic cells [28]. For mechanistic coli. However, specific enzyme activity was 75 times higher in eukaryotic cells [28]. For mechanistic studies, enzyme kinetics or inhibitor screening the bovine enzyme BTH was used instead [22,23,48,49]. studies, enzyme kinetics or inhibitor screening the bovine enzyme BTH was used instead BTH is commercially available, and has a sequence identity of only 40% with human Hyal1 (BTH, [22,23,48,49]. BTH is commercially available, and has a sequence identity of only 40% with human UniProtKB Q7YS45, Hyal1, UniProtKB Q12794) [50,51]. The constitutive expression of Hyal1 on Hyal1 (BTH, UniProtKB Q7YS45, Hyal1, UniProtKB Q12794) [50,51]. The constitutive expression of the surface of E. coli F470 as a more reliable enzyme source was published before [29]. Activity of Hyal1 on the surface of E. coli F470 as a more reliable enzyme source was published before [29]. hyaluronidases are usually given in units (U), defined as 1 µmol reducing sugar end per minute. In Activity of hyaluronidases are usually given in units (U), defined as 1 µmol reducing6 sugar end per previous studies, we determined the activity of surface displayed Hyal1 to be 4.54 10− mU per single minute. In previous studies, we determined the activity of surface displayed Hyal1× to be 4.54 × 10-6 cell, by comparing the HMW HA turnover with that of known U from commercially available ovine mU per single cell, by comparing the HMW HA turnover with that of known U from commercially testicular hyaluronidase (OTH). In this study, the expression of Hyal1 on the surface of E. coli F470 available ovine testicular hyaluronidase (OTH). In this study, the expression of Hyal1 on the surface under control of an inducible Prha promoter led to an increase in activity by a factor of 100, resulting in of E. coli F4704 under control of an inducible Prha promoter led to an increase in activity by a factor of 6.8 10− mU per single cell, in comparison with cells displaying Hyal1 with constitutive expression -4 100,× resulting6 in 6.8 × 10 mU per single cell, in comparison with cells displaying Hyal1 withTM (4.6 10− mU) [28]. We also purified Hyal1 after expression in BTI-Tn-5B1-4 insect cells (High Five constitutive× expression (4.6 × 10-6 mU) [28]. We also purified Hyal1 after expression in BTI-Tn-5B1-4 cells). The enzyme showed a specific activity of 20.8 mU/mg and similar pH optimum and NaCl insect cells (High FiveTM cells). The enzyme showed a specific activity of 20.8 mU/mg and similar pH dependency as the surface displayed enzyme (Figure8). However, the amount of enzyme obtained optimum and NaCl dependency as the surface displayed enzyme (Figure 8). However, the amount by this approach was not sufficient for inhibitor testing. As shown for surface displayed Hyal1 here, of enzyme obtained by this approach was not sufficient for inhibitor testing. As shown for surface enzyme expression was strongly dependent on the induction time. The amount of Hyal1 decreased displayed Hyal1 here, enzyme expression was strongly dependent on the induction time. The amount with longer induction times due to the release of Hyal1 fusion protein by OmpT, an outer membrane of Hyal1 decreased with longer induction times due to the release of Hyal1 fusion protein by OmpT, protease (Figure4). This clearly points to a flaw in the current approach. Because Hyal1 expression an outer membrane protease (Figure 4). This clearly points to a flaw in the current approach. Because

Pharmaceuticals 2020, 13, 54 12 of 18 level appears to be sensitive to the induction time and other factors, this needs to be monitored carefully, because it may affect the accuracy of the IC50 value determination. The rhamnose-dependent expression of a gene of interest using Prha promotor has been described before and worked well for Hyal1 expression (Figure6)[ 31,43]. In accordance, Hyal1 activity increased with increasing inducer concentrations, attaining a plateau at 0.02 mg/mL/min HMW HA turnover (Figure7B). Parameters such as pH and salt concentration can have a strong influence on enzymatic activity. As Hyal1 is located in the lysosomes in the human body, highest enzyme activity is expected at acidic pH levels. In addition, optimal pH was determined to be 3.5 in many studies before [26,28,52]. In this study, Hyal1 was most active at pH 3.5 which was in good accordance with the values found in the literature. NaCl concentration was evaluated to have an influence on Hyal1 activity in former studies as well. Hyal1 expressed and purified from E. coli showed the highest activity without the addition of NaCl to the reaction buffer [28]. This was confirmed by the results of our study, which showed decreasing Hyal1 activity with an increase in NaCl concentration. A lot of different compounds from diverse substance classes and various origins were tested for inhibiting hyaluronidases from different sources. Heparin, as a representative for the class of sulfated glycosaminoglucans, was found to inhibit BTH almost 30 years ago (IC50 = 17 µM) [53]. Isoyama et al. published 21 additional hyaluronidase inhibitors belonging to the class of polystyrene 4 sulfonates (PSS) and O-sulfated HA derivatives [24]. IC50 values for Hyal1 were determined to be in the nanomolar and submicromolar range (PSS 990,000, IC50 = 0.0096 µM; sHA2.0, IC50 = 0.0096 µM; heparin, IC50 = 0.39 µM). These polymers showed inhibition towards different hyaluronidases. Although such polymers could be a good starting point for inhibitor screening, testing in the Stains-all assay is not possible due to polymer–dye interactions, that led to errors in the photometric readout, and, hence, heparin or other polymers could not be tested as Hyal1 inhibitors in this study. The classes of indole carboxamides and salicylates were examined as Hyal1 inhibitors before [54,55], with considerable inhibition of BTH. A large portion of hyaluronidase inhibitors identified are natural compounds belonging to diverse substance classes, such as the triterpene-containing saponines, flavonoids, isoflavonoids or even rubromycins [22,56–58]. Glycyrrhizic acid is the best investigated Hyal1 inhibitor to date. Therefore, it was used as reference inhibitor here. The IC50 value of glycyrrhizic acid was determined to be 175 1,2 µM, which was in the same order of magnitude as described before, and almost identical ± as the IC50 value determined with surface displayed Hyal1 using a constitutive expression system (177 µM) [24,28,29]. To get a closer view of the binding of glycyrrhizic acid to Hyal1 (PDB: 2PE4), docking studies were performed. These were adjusted to low pH surroundings and by predicting the lowest energy levels, the best docking scores for glycyrrhizic acid binding was not obtained at the active site. This in silico experiment pointed to an allosteric inhibition of Hyal1 by glycyrrhizic acid. This could be supported experimentally by activity measurements using the Stains-all assay. For this purpose, inhibition by glycyrrhizic acid was measured at different substrate (HMW HA) concentrations and, subsequently, inhibition in % was plotted against substrate concentration (Figure 11). To our surprise, inhibition of Hyal1 by glycyrrhizic acid at a constant concentration of 250 µM increased with increasing amounts of HMW HA. This effect fits the in silico results and could point on an uncompetitive mode of inhibition. Unfortunately, as outlined above, the Stains-all assay cannot be used to determine a Hyal1 kinetics as required, e.g., for a Lineweaver–Burk plot. Consequently, these results cannot be seen as more than a first hint that glycyrrhizic acid is not a competitive inhibitor, and need confirmation through further experiments. The mode of inhibition for glycyrrhizic acid has not been determined before for human Hyal1, but it has for bacterial hyaluronidases, where it was reported be uncompetitive [56], however these enzymes belong to a different class than human Hyal1. Pharmaceuticals 2020, 13, 54 13 of 18 Pharmaceuticals 2019, 12, x FOR PEER REVIEW 13 of 18

FigureFigure 11. Inhibition11. Inhibition of Hyal1 of Hyal1 by 250 µbyM glycyrrhizic250 µM glycyrrh acid, inizic dependency acid, in ondependency HMW HA concentration.on HMW HA

E. coliconcentration.F470 cells expressing E. coli F470 Hyal1 cells expressing were harvested Hyal1 after were 16 harves h of inductionted after 16 and h of the induction OD578 was and set the to OD 10 578 addingwas set reaction to 10 buaddingﬀer (sodium reaction formate buffer pH(sodium 3.5, 0 formate mM NaCl). pH Glycyrrhizic3.5, 0 mM NaCl). acid wasGlycyrrhizic added [250 acidµM was ﬁnal)added and [250 cells µM were final) preincubated and cells were for 10 preincubated min. After adding for 100.22mg min. After/mL HMWadding HA, 0.22mg/mL a (1:1 v/ v)HMW reaction HA, a

was(1:1 performed v/v) reaction at 37 was◦C forperformed one minute. at 37 Inhibition°C for one of minute. Hyal1 wasInhibition calculated of Hyal1 in accordance was calculated to our in previousaccordance studies. to our Mean previous values studies.SD (n Mean= 3). values ± SD (n = 3). ± TwoTwo new new Hyal1 Hyal1 inhibitors inhibitors were were identified identified in in this th study.is study. Testosterone Testosterone propionate, propionate, a steroida steroid derivative,derivative, was was determined determined to beto be moderately moderately active active against against Hyal1 Hyal1 with with an an IC50 ICvalue50 value of of 124 124 1.1± 1.1µM. µM. ± RegulationRegulation of of HA HA metabolism metabolism by by steroids steroids has has been been previously previously described described [44 [44,46,59].,46,59]. Tanyildizi Tanyildizi et et al. al. investigatedinvestigated the the influence influence of of progesterone progesterone and and testosterone testosterone on on hyaluronidase hyaluronidase activity activity in in sheep, sheep, but but camecame to theto conclusionthe conclusion that thethat compounds the compounds were not were inhibitorily not inhibitorily active. Tranilast, active. aTranilast, modified a cinnamic modified acidcinnamic was identified acid was as aidentified weak hyaluronidase as a weak inhibitorhyaluronidase in a previous inhibitor study in a [60 previous]. Several study cinnamides [60]. Several and cinnamiccinnamides acid and derivatives, cinnamic belonging acid deriva totives, the class belonging of phenylpropanoids, to the class of phenylpropanoids, were tested here (Table were tested S3). Outhere of these(Table compounds, S3). Out of only these chicoric compounds, acid turned only outchic tooric be activeacid turned against out Hyal1 to be with active an IC against50 value Hyal1 of 171withµM an (Figure IC50 value 10). of 171 µM (Figure 10).

4. Conclusions4. Conclusion AnAn improved improved whole whole cell cell assay assay with with surface surface displayed displayed Hyal1 Hyal1 for for the the screening screening assay assay was was establishedestablished and and led led to to the the identiﬁcation identification of newof new inhibitors. inhibitors. The The IC 50IC50values values of of chicoric chicoric acid acid and and testosteronetestosterone propionate propionate were were in thein the same same order order of of magnitude magnitude as as that that of of the the known known reference reference inhibitor, inhibitor, glycyrrhizicglycyrrhizic acid. acid. 5. Materials and Methods 5. Materials and Methods 5.1. Chemicals 5.1. Chemicals Chemicals for cultivation of E. coli F470 were purchased from Roth, Karlsruhe, Germany. Including Chemicals for cultivation of E. coli F470 were purchased from Roth, Karlsruhe, Germany. yeast extract, tryptone, agar, etc. VeraSeq Polymerase was purchased from Biozym (Hessisch Oldendorf, Including yeast extract, tryptone, agar, etc. Vera Seq Polymerase was purchased from Biozym Germany). Reagents for Stains-all assay and reaction buﬀer were purchased from Merck, Darmstadt, (Hessisch Oldendorf, Germany). Reagents for Stains-all assay and reaction buffer were purchased Germany. E. coli F470 was kindly provided by J. Seydel (Center for Medicine and Biosciences, from Merck, Darmstadt, Germany. E. coli F470 was kindly provided by J. Seydel (Center for Medicine Biophysics, Borstel Research Center, Sülfeld, Germany) and used for expression experiments. and Biosciences, Biophysics, Borstel Research Center, Sülfeld, Germany) and used for expression 5.2.experiments. Plasmid Construction

5.2.Artiﬁcial Plasmid Construction synthesized genes for the E. coli codon optimized reading frame of Hyal1 were purchased from GeneArt (Regensburg, Germany). The ligase free In Fusion cloning method was Artificial synthesized genes for the E. coli codon optimized reading frame of Hyal1 were applied for passenger exchange of pPQ62 to obtain the plasmid pAIDAIrha Hyal1 [32,33]. The purchased from GeneArt (Regensburg, Germany). The ligase free In Fusion cloning method was following primers 50TCATCTCAGAAGAGGATCTGGGTACCCTTAATCCTACAAAAG AAAGTGC30 applied for passenger exchange of pPQ62 to obtain the plasmid pAIDAIrha Hyal1 [32,33]. The (forward), 50CAGCGGACCACGAAAGGTGATGTTCTGCGGAGTACCGTGAGCGT30 (reverse) for following primers 5′TCATCTCAGAAGAGGATCTGGGTACCCTTAATCCTACAAAAG AAAGTGC3‘(forward),

Pharmaceuticals 2020, 13, 54 14 of 18

ampliﬁ-cation of the backbone of pPQ62 and Hyal1 50TTTCGTGGTCCGCTG30 (forward), 50CAGATCCTCTTCTGAGATGAGTTTTTGTTCCCACATGCTTTTACGTTC30 (reverse), with an additional sequence insertion of an anti-myc epitope tag at its 30 end, were ampliﬁed by PCR. E. coli stellar were used for cloning experiments. The coding region for Hyal1 fusion protein was controlled by DNA sequence analysis.

5.3. Escherichia coli F470 Culturing

E. coli F470 cells with and without the plasmid pAIDAIrha Hyal1 were cultivated for 16 h at 37 ◦C and 200 rpm in LB (lysogeny broth) medium as a pre-culture containing carbenicillin (1:100) if necessary. Subsequently, fresh LB medium was inoculated with pre-culture (1:100). The cells were grown up to an OD578 of 0.4 to 0.6 and induced with desired rhamnose concentrations (0–5 mM). Cell suspension was cultivated for 4–24 h, at 37 ◦C and 200 rpm. Cells were harvested by centrifugation at 4 C, 3500 g for 5 min and washed with reaction buffer (sodium formate buffer, 100 mM, pH 3.5) or ◦ × phosphate buffered saline (PBS) as needed for further experiments.

5.4. Preparation of Outer Membrane Proteins The outer membrane protein isolation for 80 mL of the main culture was performed by a modified method according to Park et al. [34]. Cells were harvested and washed with 3 mL 0.2 M Tris/HCl pH 8.0. Prior to outer membrane protein isolation, one culture expressing Hyal1 was treated with proteinase K with 50 m Anson units to determine cell integrity. Cell suspension was incubated for 1 h at 37 ◦C. The reaction was stopped by adding phenylmethylsulfonyl fluoride (PMSF) (1 mM) and cells were washed with 0.2 M Tris/HCl pH 8.0. After harvest, all cells were suspended in 3 mL 0.2 M Tris/HCl pH 8.0 and 6.4 mL H2O and lysed by adding lysozyme (200 µg/mL final concentration), sucrose (20 mM final concentration), 0.1 mM ethylene diamine triacetate (EDTA) (final) and were incubated for 10 min at room temperature (RT). Subsequently, PMSF (0.5 mM final) and aprotinin (10 µg/mL) were added. By the addition of 10 mL extraction buffer (50 mM Tris/HCl, 2% Triton X 100, 10 mM MgCl2) and DNAse (10 µg/mL final), the outer membranes were isolated after incubation for 30 min on ice. The suspensions were centrifuged at 4500 g for 10 min at 4 C and the supernatants were centrifuged for × ◦ 38,700 g for 10 min at 4 C and washed with water twice. The outer membrane protein isolations × ◦ were dissolved in water for SDS-PAGE and Western Blot analyses.

5.5. SDS-PAGE and Western Blot Analysis The outer membrane protein isolations were diluted (1:2) with sample buffer containing 10 mM Tris/HCl (pH 6.8, 0.2% bromphenolblue, 4% SDS, 20% Glycerol, 200 mM dithiothreitol, DTT). The samples were boiled for 20 min at 95 ◦C and analyzed by a 10% SDS-PAGE. After staining with ProBlue Safe Stain®, the molecular weight of the proteins was confirmed using pre-stained molecular weight markers. For Western Blot analysis the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane under a constant voltage of 100 V. The membrane was blocked by PBS 0.1% Tween 20 containing 5% milk powder at RT for 45 min. The primary antibody was incubated for 1 h (mouse anti-myc antibody or mouse anti-Hyal1 antibody 1:200) at RT. After washing, the secondary rabbit anti-mouse IgG HRP-labeled antiserum was added (1:10,000) and incubated for additional 2 h at RT. The membrane was incubated with HRP substrate and protein bands visualized using Chemocam HR16 camera system (Intas, Göttingen, Germany).

5.6. Flow Cytometry Analysis E. coli F470 cells were harvested (4500 g for 5 min) after cultivation and washed with ﬁlter-sterilized × PBS. 1 mL of cell suspension was set to an OD578 of 0.2 and centrifuged. The pellet was suspended in 500 µL PBS containing 3% BSA and incubated for 15 min at RT. Cells were centrifuged and suspended in 100 µL of an anti-myc antibody solution (1:1 in PBS). After incubation for 45 min at RT, the cells were washed three times and incubated with 100 µL goat anti-mouse Dylight633-labeled antiserum Pharmaceuticals 2020, 13, 54 15 of 18 solution. After additional incubation for 1 h at RT, the cells were washed three times and analyzed by FACS Aria III (BD, Heidelberg, Germany).

5.7. Stains-All Assay A slightly modified Stains-all assay was performed as described in our previous studies [28]. E. coli F470 cells were cultivated as previously described and washed using the reaction buffer. The OD578 was set to 10 and inhibitors were solved in dimethylsulfoxid (DMSO) (appropriate concentrations were added). After 10 min of preincubation, the 0.22 mg/mL HA was added to obtain a final HA concentration of 0.11 mg/mL and an OD578 of five. After the desired reaction time, the cell suspension was centrifuged, and the supernatant was analyzed at 650 nm after adding Stains-all reagent. The inhibition values were calculated as previous described [28].

5.8. In Silico Experiments To elucidate the possible binding mode of the glycyrrhizic acid further, molecular docking experiments against Hyal1 were performed, utilizing the software “Molecular operating environment (MOE)” supplied by the Chemical Computing Group (CCG, Montreal, Canada) (MOE, 2017). Initially, a structural model of Hyal-1 was acquired from the Protein Data Bank (PDB-ID 2PE4) (RCSB). Subsequently, the protein structure was corrected in MOE (correcting protonation states as well as terminal, faulty or misaligned amino acids) and energy minimized using the MMFF94x force ﬁeld [61]. Glycyrrhizic acid was subsequently analyzed concerning its possible interaction with Hyal1 by performing molecular docking experiments against all atoms of the prepared protein structure.

Supplementary Materials: The following are available online at http://www.mdpi.com/1424-8247/13/4/54/s1, Figure S1: Calibration curve—Stains-all method. Table S1: Structure and inhibition values of testosterone derivatives, Table S2: Structure and inhibition values of dihydrotestosterone derivatives, Table S3: Structure and inhibition values of cinnamic acid derivates. Author Contributions: Conceptualization was carried out by J.J. and I.L.; in vitro experiments were carried out by I.L., in silico experiments were carried out by F.H. and I.L.; steroid derivatives and cinnamic acid derivatives were synthetized by M.L.B.; writing of the manuscript was performed by J.J. and I.L.; supervision was carried out by J.J. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References

1. Cowman, M.K.; Schmidt, T.A.; Raghavan, P.; Stecco, A. Viscoelastic Properties of Hyaluronan in Physiological Conditions. F1000Research 2015, 4, 622. [CrossRef] 2. Tammi, M.I.; Day, A.J.; Turley, E.A. Hyaluronan and homeostasis: A balancing act. J. Biol. Chem. 2002, 277, 4581–4584. [CrossRef][PubMed] 3. Monslow, J.; Govindaraju, P.; Pure, E. Hyaluronan—A functional and structural sweet spot in the tissue microenvironment. Front. Immunol. 2015, 6, 231. [CrossRef][PubMed] 4. Dahiya, P.; Kamal, R. Hyaluronic Acid: A Boon in Periodontal Therapy. N. Am. J. Med. Sci. 2013, 5, 309–315. [CrossRef][PubMed] 5. El-Safory, N.S.; Fazary, A.E.; Lee, C.K. Hyaluronidases, a group of glycosidases: Current and future perspectives. Carbohydr. Polym. 2010, 81, 165–181. [CrossRef] 6. Noble, P.W. Hyaluronan and its catabolic products in tissue injury and repair. Matrix Biol. 2002, 21, 25–29. [CrossRef] 7. Csoka, A.B.; Scherer, S.W.; Stern, R. Expression analysis of six paralogous human hyaluronidase genes clustered on chromosomes 3p21 and 7q31. Genomics 1999, 60, 356–361. [CrossRef] 8. Csoka, A.B.; Frost, G.I.; Stern, R. The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol. 2001, 20, 499–508. [CrossRef] 9. Stern, R.; Jedrzejas, M.J. Hyaluronidases: Their genomics, structures, and mechanisms of action. Chem. Rev. 2006, 106, 818–839. [CrossRef] Pharmaceuticals 2020, 13, 54 16 of 18

10. Chi, A.; Shirodkar, S.P.; Escudero, D.O.; Ekwenna, O.O.; Yates, T.J.; Ayyathurai, R.; Garcia-Roig, M.; Gahan, J.C.; Manoharan, M.; Bird, V.G.; et al. Molecular characterization of kidney cancer Association of Hyaluronic Acid Family With Histological Subtypes and Metastasis. Cancer 2012, 118, 2394–2402. [CrossRef] 11. Myles, D.G.; Primakoff, P. Why did the sperm cross the cumulus? To get to the oocyte. Functions of the sperm surface proteins PH-20 and fertilin in arriving at, and fusing with, the egg. Biol. Reprod. 1997, 56, 320–327. [CrossRef][PubMed] 12. Lokeshwar, V.B.; Lokeshwar, B.L.; Pham, H.T.; Block, N.L. Association of elevated levels of hyaluronidase, a matrix-degrading enzyme, with prostate cancer progression. Cancer Res. 1996, 56, 651–657. [PubMed] 13. Lokeshwar, V.B.; Obek, C.; Pham, H.T.; Wei, D.; Young, M.J.; Duncan, R.C.; Soloway, M.S.; Block, N.L. Urinary hyaluronic acid and hyaluronidase: Markers for bladder cancer detection and evaluation of grade. J. Urol. 2000, 163, 348–356. [CrossRef] 14. Madan, A.K.; Pang, Y.; Wilkiemeyer, M.B.; Yu, D.; Beech, D.J. Increased hyaluronidase expression in more aggressive prostate adenocarcinoma. Oncol. Rep. 1999, 6, 1431–1433. [CrossRef][PubMed] 15. Tan, J.X.; Wang, X.Y.; Li, H.Y.; Su, X.L.; Wang, L.A.; Ran, L.A.; Zheng, K.; Ren, G.S. HYAL1 overexpression is correlated with the malignant behavior of human breast cancer. Int. J. Cancer 2011, 128, 1303–1315. [CrossRef] 16. Kramer, M.W.; Golshani, R.; Merseburger, A.S.; Knapp, J.; Garcia, A.; Hennenlotter, J.; Duncan, R.C.; Soloway, M.S.; Jorda, M.; Kuczyk, M.A.; et al. HYAL-1 Hyaluronidase: A Potential Prognostic Indicator for Progression to Muscle Invasion and Recurrence in Bladder Cancer. Eur. Urol. 2010, 57, 86–93. [CrossRef] 17. Neumann, A.; Schinzel, R.; Palm, D.; Riederer, P.; Munch, G. High molecular weight hyaluronic acid inhibits advanced glycation endproduct-induced NF-kappa B activation and cytokine expression. FEBS Lett. 1999, 453, 283–287. [CrossRef] 18. Jentsch, H.; Pomowski, R.; Kundt, G.; Gocke, R. Treatment of gingivitis with hyaluronan. J. Clin. Periodontol. 2003, 30, 159–164. [CrossRef] 19. Rayahin, J.E.; Buhrman, J.S.; Zhang, Y.; Koh, T.J.; Gemeinhart, R.A. High and Low Molecular Weight Hyaluronic Acid Differentially Influence Macrophage Activation. ACS Biomater. Sci. Eng. 2015, 1, 481–493. [CrossRef] 20. Salmen, S.; Hoechstetter, J.; Kasbauer, C.; Paper, D.H.; Bernhardt, G.; Buschauer, A. Sulphated oligosaccharides as inhibitors of hyaluronidases from bovine testis, bee venom and Streptococcus agalactiae. Planta Med. 2005, 71, 727–732. [CrossRef] 21. Kuppusamy, U.R.; Khoo, H.E.; Das, N.P. Structure-Activity Studies of Flavonoids as Inhibitors of Hyaluronidase. Biochem. Pharm. 1990, 40, 397–401. [CrossRef] 22. Furuya, T.; Yamagata, S.; Shimoyama, Y.; Fujihara, M.; Morishima, N.; Ohtsuki, K. Biochemical characterization of glycyrrhizin as an effective inhibitor for hyaluronidases from bovine testis. Biol. Pharm. Bull. 1997, 20, 973–977. [CrossRef] 23. Botzki, A.; Rigden, D.J.; Braun, S.; Nukui, M.; Salmen, S.; Hoechstetter, J.; Bernhardt, G.; Dove, S.; Jedrzejas, M.J.; Buschauer, A. l-Ascorbic Acid 6-Hexadecanoate, a Potent Hyaluronidase Inhibitor: X-RAY structure and molecular modeling of enzyme-inhibitor complexes. J. Biol. Chem. 2004, 279, 45990–45997. [CrossRef] 24. Isoyama, T.; Thwaites, D.; Selzer, M.G.; Carey, R.I.; Barbucci, R.; Lokeshwar, V.B. Differential selectivity of hyaluronidase inhibitors toward acidic and basic hyaluronidases. Glycobiology 2006, 16, 11–21. [CrossRef] 25. Afify, A.M.; Stern, M.; Guntenhoner, M.; Stern, R. Purification and Characterization of Human Serum Hyaluronidase. Arch. Biochem. Biophys. 1993, 305, 434–441. [CrossRef] 26. Csoka, T.B.; Frost, G.I.; Wong, T.; Stern, R. Purification and microsequencing of hyaluronidase isozymes from human urine. FEBS Lett. 1997, 417, 307–310. [CrossRef] 27. Frost, G.I.; Csoka, T.B.; Wong, T.; Stern, R. Purification, cloning, and expression of human plasma hyaluronidase. Biochem. Biophys. Res. Commun. 1997, 236, 10–15. [CrossRef] 28. Hofinger, E.S.A.; Spickenreither, M.; Oschmann, J.; Bernhardt, G.; Rudolph, R.; Buschauer, A. Recombinant human hyaluronidase Hyal-1: Insect cells versus Escherichia coli as expression system and identification of low molecular weight inhibitors. Glycobiology 2007, 17, 444–453. [CrossRef] 29. Orlando, Z.; Lengers, I.; Melzig, M.; Buschauer, A.; Hensel, A.; Jose, J. Autodisplay of Human Hyaluronidase Hyal-1 on Escherichia coli and Identification of Plant-Derived Enzyme Inhibitors. Molecules 2015, 20, 15449–15468. [CrossRef] Pharmaceuticals 2020, 13, 54 17 of 18

30. Sendker, J.; Böker, I.; Lengers, I.; Brandt, S.; Jose, J.; Stark, T.; Hofmann, T.; Fink, C.; Abdel-Aziz, H.; Hensel, A. Phytochemical Characterization of Low Molecular Weight Constituents from Marshmallow Roots (Althaea officinalis) and Inhibiting Effects of the Aqueous Extract on Human Hyaluronidase-1. J. Nat. Prod. 2017, 80, 290–297. [CrossRef] 31. Giacalone, M.J.; Gentile, A.M.; Lovitt, B.T.; Berkley, N.L.; Gunderson, C.W.; Surber, M.W. Toxic protein expression in Escherichia coli using a rhamnose-based tightly regulated and tunable promoter system. Biotechniques 2006, 40, 355–364. [CrossRef] 32. Berrow, N.S.; Alderton, D.; Sainsbury, S.; Nettleship, J.; Assenberg, R.; Rahman, N.; Stuart, D.I.; Owens, R.J. A versatile ligation-independent cloning method suitable for high-throughput expression screening applications. Nucleic Acids Res. 2007, 35, e45. [CrossRef] 33. Quehl, P.; Hollender, J.; Schuurmann, J.; Brossette, T.; Maas, R.; Jose, J. Co-expression of active human cytochrome P450 1A2 and cytochrome P450 reductase on the cell surface of Escherichia coli. Microb. Cell Factories 2016, 15, 26. [CrossRef] 34. Park, M.; Yoo, G.; Bong, J.-H.; Jose, J.; Kang, M.-J.; Pyun, J.-C. Isolation and characterization of the outer membrane of Escherichia coli with autodisplayed Z-domains. Biochim. Biophys. Acta 2015, 1848, 842–847. [CrossRef] 35. Yethon, J.A.; Vinogradov, E.; Perry, M.B.; Whitfield, C. Mutation of the lipopolysaccharide core glycosyltransferase encoded by waaG destabilizes the outer membrane of Escherichia coli by interfering with core phosphorylation. J. Bacteriol. 2000, 182, 5620–5623. [CrossRef] 36. Vandeputte-Rutten, L.; Kramer, R.A.; Kroon, J.; Dekker, N.; Egmond, M.R.; Gros, P. Crystal structure of the outer membrane protease OmpT from Escherichia coli suggests a novel catalytic site. EMBO J. 2001, 20, 5033–5039. [CrossRef] 37. Maurer, J.; Jose, J.; Meyer, T.F. Autodisplay: One-component system for efficient surface display and release of soluble recombinant proteins from Escherichia coli. J. Bacteriol. 1997, 179, 794–804. [CrossRef] 38. Baneyx, F.; Georgiou, G. Invivo Degradation of Secreted Fusion Proteins by the Escherichia-Coli Outer-Membrane Protease Ompt. J. Bacteriol. 1990, 172, 491–494. [CrossRef] 39. Sichwart, S.; Tozakidis, I.E.P.; Teese, M.; Jose, J. Maximized Autotransporter-Mediated Expression (MATE) for Surface Display and Secretion of Recombinant Proteins in Escherichia coli. Food Technol. Biotechnol. 2015, 53, 251–260. [CrossRef] 40. Jose, J.; Bernhardt, R.; Hannemann, F. Cellular surface display of dimeric Adx and whole cell P450-mediated steroid synthesis on E.coli. J. Biotechnol 2002, 95, 257–268. [CrossRef] 41. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.e.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Walker, J.M., Ed.; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. 42. Homer, K.A.; Denbow, L.; Whiley, R.A.; Beighton, D. Chondroitin sulfate depolymerase and hyaluronidase activities of viridans streptococci determined by a sensitive spectrophotometric assay. J. Clin. Microbiol. 1993, 31, 1648–1651. [CrossRef] 43. Schlegel, S.; Lofblom, J.; Lee, C.; Hjelm, A.; Klepsch, M.; Strous, M.; Drew, D.; Slotboom, D.J.; de Gier, J.W. Optimizing Membrane Protein Overexpression in the Escherichia coli strain Lemo21(DE3). J. Mol. Biol. 2012, 423, 648–659. [CrossRef] 44. Papakonstantinou, E.; Klagas, I.; Karakiulakis, G.; Hostettler, K.; S’ng, C.T.; Kotoula, V.; Savic, S.; Tamm, M.; Roth, M. Steroids and beta(2)-Agonists Regulate Hyaluronan Metabolism in Asthmatic Airway Smooth Muscle Cells. Am. J. Respir. Cell Mol. 2012, 47, 759–767. [CrossRef] 45. Papakonstantinou, E.; Klagas, I.; Karakiulakis, G.; Tamm, M.; Roth, M.; Stolz, D. Glucocorticoids and β2-agonists regulate the pathologic metabolism of hyaluronic acid in COPD. Pulm. Pharmacol. Ther. 2018, 48, 104–110. [CrossRef] 46. Raheem, K.A.; Marei, W.F.; Mifsud, K.; Khalid, M.; Wathes, D.C.; Fouladi-Nashta, A.A. Regulation of the hyaluronan system in ovine endometrium by ovarian steroids. Reproduction 2013, 145, 491–504. [CrossRef] 47. Tanyildizi, S.; Bozkurt, T. Effects of progesterone and testosterone on the hyaluronidase activities and sperm characteristics in sheep. Turk. J. Vet. Anim. Sci. 2002, 26, 1137–1143. 48. Desalegu, M.; Plonska, H.; Pigman, W. A Comparison of Serum and Testicular Hyaluronidase. Arch. Biochem. Biophys. 1967, 121, 548. [CrossRef] Pharmaceuticals 2020, 13, 54 18 of 18

49. Cramer, J.A.; Bailey, L.C.; Bailey, C.A.; Miller, R.T. Kinetic and Mechanistic Studies with Bovine Testicular Hyaluronidase. Biochim. Biophys. Acta 1994, 1200, 315–321. [CrossRef] 50. Barsukov, A.K.; Kozhevnikova, O.V.; Khokhryakova, A.V. Isolation and purification of bovine testicular hyaluronidase. Appl. Biochem. Microbiol. 2003, 39, 549–552. [CrossRef] 51. Kaya, M.O.; Arslan, O.; Guler, O.O. A new affinity method for purification of bovine testicular hyaluronidase enzyme and an investigation of the effects of some compounds on this enzyme. J. Enzym. Inhib. Med. Chem. 2015, 30, 524–527. [CrossRef] 52. Gold, E.W. Purification and Properties of Hyaluronidase from Human-Liver—Differences from and Similarities to the Testicular Enzyme. Biochem. J. 1982, 205, 69–74. [CrossRef] 53. Wolf, R.A.; Glogar, D.; Chaung, L.Y.; Garrett, P.E.; Ertl, G.; Tumas, J.; Braunwald, E.; Kloner, R.A.; Feldstein, M.L.; Muller, J.E. Heparin Inhibits Bovine Testicular Hyaluronidase Activity in Myocardium of Dogs with Coronary-Artery Occlusion. Am. J. Cardiol. 1984, 53, 941–944. [CrossRef] 54. Guerra, F. Hyaluronidase Inhibition by Sodium Salicylate in Rheumatic Fever. Science 1946, 103, 686–687. [CrossRef][PubMed] 55. Kaessler, A.; Nourrisson, M.R.; Duflos, M.; Jose, J. Indole carboxamides inhibit bovine testes hyaluronidase at pH 7.0 and indole acetamides activate the enzyme at pH 3.5 by different mechanisms. J. Enzym. Inhib. Med. Chem. 2008, 23, 719–727. [CrossRef][PubMed] 56. Hertel, W.; Peschel, G.; Ozegowski, J.H.; Willer, P.J. Inhibitory effects of triterpenes and flavonoids on the enzymatic activity of hyaluronic acid-splitting enzymes. Arch. Der Pharm. 2006, 339, 313–318. [CrossRef] 57. Harunari, E.; Imada, C.; Igarashi, Y.; Fukuda, T.; Terahara, T.; Kobayashi, T. Hyaluromycin, a New Hyaluronidase Inhibitor of Polyketide Origin from Marine Streptomyces sp. Mar. Drugs 2014, 12, 491–507. [CrossRef] 58. Kohi, S.; Sato, N.; Koga, A.; Hirata, K.; Harunari, E.; Igarashi, Y. Hyaluromycin, a Novel Hyaluronidase Inhibitor, Attenuates Pancreatic Cancer Cell Migration and Proliferation. J. Oncol. 2016, 2016, 9063087. [CrossRef] 59. Papakonstantinou, E.; Bonovolias, I.; Karakioulakis, G.; Tamm, M.; Louis, R.; Milenkovic, B.; Boersma, W.; Kostikas, K.; Blasi, F.; Aerts, J.; et al. Serum hyaluronidase-1 is increased in COPD exacerbations and is associated with COPD severity and outcomes. Eur. Respir. J. 2018, 52, PA4969. [CrossRef] 60. Kakegawa, H.; Mitsuo, N.; Matsumoto, H.; Satoh, T.; Akagi, M.; Tasaka, K. Hyaluronidase-Inhibitory and Anti-Allergic Activities of the Photo-Irradiated Products of Tranilast. Chem. Pharm. Bull. 1985, 33, 3738–3744. [CrossRef] 61. Halgren, T.A. Merck molecular force field. 1. Basis, form, scope, parameterization, and performance of MMFF94. J. Comput Chem 1996, 17, 490–519. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).