Oncogene (2000) 19, 870 ± 878 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc HYAL1LUCA-1, a candidate tumor suppressor on 3p21.3, is inactivated in head and neck squamous cell by aberrant splicing of pre-mRNA

Gregory I Frost1,3, Gayatry Mohapatra2, Tim M Wong1, Antonei Benjamin Cso ka1, Joe W Gray2 and Robert Stern*,1

1Department of Pathology, School of Medicine, University of California, San Francisco, California, CA 94143, USA; 2Cancer Genetics Program, UCSF Center, University of California, San Francisco, California, CA 94115, USA

The ®rst isolated from human plasma, in the process of carcinogenesis (Sager, 1997; Hyal-1, is expressed in many somatic tissues. The Hyal- Baylin et al., 1998). Nevertheless, functionally 1 gene, HYAL1, also known as LUCA-1, maps to inactivating point mutations are generally viewed as chromosome 3p21.3 within a candidate tumor suppressor the critical `smoking gun' when de®ning a novel gene de®ned by homozygous deletions and by TSG. functional tumor suppressor activity. Hemizygosity in We recently mapped the HYAL1 gene to human this region occurs in many malignancies, including chromosome 3p21.3 (Cso ka et al., 1998), con®rming its squamous cell carcinomas of the head and neck. We identity with LUCA-1, a candidate tumor suppressor have investigated whether cell lines derived from such gene frequently deleted in small cell lung carcinomas malignancies expressed Hyal-1 activity, using normal (SCLC) (Wei et al., 1996). The HYAL1 gene resides human keratinocytes as controls. Hyal-1 activity within a commonly deleted region of 3p21.3 where a and protein were absent or markedly reduced in six of potentially informative 30 kb homozygous deletion has seven cell lines examined. Comparative been found in one SCLC line (Latif et al., 1997). The genomic and ¯uorescence in situ hybridization identi®ed position of HYAL1 within this 30 kb homozygous chromosomal deletions of one allele of HYAL1 in six of deletion and the larger overlapping homozygous seven cell lines. Initial RT ± PCR analyses demonstrated deletions in the NCI H740 and GLC20 SCLC lines marked discrepancies between levels of HYAL1 mRNA leaves this gene a strong candidate TSG. A recent and protein. Despite repeated sequence analyses, no study identi®ed a 220 kb homozygous deletion on mutations were found. However, two species of tran- 3p21.3 in a breast carcinoma line (Sekido et al., 1998). scripts were identi®ed when primers were used that The telomeric breakpoint resides approximately 4 kb included the 5' untranslated region. The predominant centromeric to the HYAL1 open reading frame, and mRNA species did not correlate with protein translation overlaps with the centromeric region of the SCLC and contained a retained intron. A second spliced form deletions. In addition to the chromosomal aberrations, lacking this intron was found only in cell lines that the region encompassing 3p21.3 has functional tumor produced Hyal-1 protein. Inactivation of HYAL1 in suppressor activity in vivo as determined by mono- these tumor lines is a result of incomplete splicing of its chromosome mediated transfer in a nasopharyngeal pre-mRNA that appears to be epigenetic in nature. carcinoma line (Cheng et al., 1998). Despite the Oncogene (2000) 19, 870 ± 877. frequency of homozygous deletions on 3p21.3 in various carcinomas, no mutations have been reported Keywords: hyaluronidase; 3p21.3; tumor suppressor with high frequency in any of the candidate genes gene; aberrant splicing; squamous cell carcinoma; head examined to date. Hemizygosity over the candidate and neck tumors TSG locus on 3p21.3 has also been reported in head and neck squamous cell carcinomas (HNSCCs) (Buchhagen et al., 1996). As normal human keratino- Introduction cytes (NHK) produce Hyal-1 hyaluronidase, the analysis of the status of HYAL1 and the Hyal-1 Discovery of many tumor suppressor genes (TSGs) protein as well as its enzymatic activity in head and has been facilitated by the identi®cation of either neck malignancies appeared to be a rational approach homozygous chromosomal deletions or hemizygosity to characterize further this candidate TSG on 3p21.3. at a particular locus, with functionally inactivating Mammalian are a family of b,1±4 point mutations in the remaining allele. It is now endoglucosaminidases that degrade hyaluronan (HA, recognized that alternative pathways, such as ) and to a lesser extent, chondroitin hypermethylation of CpG islands and other epige- sulfate (Kreil, 1995; Frost et al., 1996; Cso ka et al., netic mechanisms can also silence tumor suppressor 1997a). Until recently, mammalian hyaluronidases were uncharacterized enzymatic activities present in many tissues, distinguished only on the basis of their pH optima. In the human, it is now established that at *Correspondence: R Stern least six hyaluronidase-like sequences occur in the 3Current address: Sidney Kimmel Cancer Center, 10835 Altman Row, San Diego, California, CA 9212, USA , three each at two chromosomal Received 28 July 1999; revised 18 October 1999; accepted 21 locations: HYAL1, HYAL2, and HYAL3 at chromo- October 1999 some 3p21 (Lepperdinger et al., 1998; Cso ka et al., Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 871 1999); and HYAL4, SPAM1,andHYALP1 at chromosome 7q31 (Cso ka et al., 1999). The gene for Hyal-2, HYAL2, a recently identi®ed lysosomal hyaluronidase (Lepperdinger et al., 1998) resides immediately centromeric to HYAL1 on 3p21.3. Hyal- 2 possesses an apparent speci®city for high molecular weight HA (420 kDa) and is expressed in all tissues except the brain. PH-20, a GPI anchored hyaluroni- dase with expression restricted normally to testes, is coded for by SPAM1 on chromosome 7q31 (Gmachl et al., 1993) ¯anked by the two other hyaluronidase-like sequences. Mgea-5 is a seventh hyaluronidase-like protein structurally unrelated to the and 7 family, coded for by MGEA5 on chromo- some 10q, that was identi®ed as a novel immunogenic antigen expressed in meningiomas (Heckel et al., 1998). Hyal-1 is a secreted somatic tissue hyaluronidase, and the predominant hyaluronidase in human plasma (Frost et al., 1997). Transcripts for Hyal-1 are found in most tissues. Paradoxically, although Hyal-1 is pre- dominantly secreted, it has an acid pH optimum in vitro. HYAL1, identical to LUCA-1, was considered a Figure 1 HA-substrate gel zymograms of HYAL1 in HNSCC lines and normal keratinocyte controls. 17E9 mAb immunopre- candidate tumor suppressor gene in SCLC based upon cipitates from (a), 1 mg cellular protein and (b), the correspond- homozygous deletion studies (Wei et al., 1996). The ing conditioned media were examined. Two enzymatic clearings at present study was designed to examine whether Hyal-1 57 kDa and 45 kDa were found in the cell layer, whereas only the activity is found in cell lines containing the chromo- 57 kDa species (similar to recombinant HYAL1) was found in the somal aberrations on 3p21.3 characteristic of HNSCC. conditioned media

Results

Hyal-1 enzyme activity and protein are absent in most cultured HNSCC cell lines Levels of Hyal-1 activity were examined in a panel of seven HNSCC lines derived from primary tumors (SCC-9, SCC-10a, SCC-15, SCC-25) and lymph node metastases (SCC-10b, HOC-313, HSC-3), and com- pared with the activity of normal human foreskin keratinocytes (NHK) in primary culture. Hyal-1 enzyme activity was measured in immunoprecipitates utilizing the 17E9 anti-Hyal-1 monoclonal antibody in two ways: by HA substrate-gel zymography; and by a microtiter-based assay using biotinylated HA. The substrate-gel zymography of the immunoprecipitates from the squamous cell carcinoma cell lines, cultured serum-free, revealed that only one laryngeal carcinoma line, SCC-10a, expressed hyaluronidase levels compar- able to the normal keratinocyte controls (Figure 1). Cultures of adult oral human keratinocytes (kindly supplied by Dr Ken Zhang, UCSF) were found to Figure 2 Microtiter-based assay of enzyme activity in 17E9 synthesize equivalent levels of HYAL1 activity com- immunoprecipitates from cell layer or serum free conditioned pared to the NHKs (not shown). All other cell lines media. 17E9 immunoprecipitates in cell layer, conditioned media either had signi®cantly reduced levels or no detectable or cell layer supernates were examined. Activity is expressed as activity by either HA-substrate gel zymography or by rTRUs. Samples were assayed in triplicate the microtiter-based enzyme assay (Figure 2). In contrast to the SCC-10a line, the SCC-10b line, which is derived from a lymph node metastasis from the same patient at a later point in disease, had no detectable processed form of Hyal-1 found in human urine activity in either assay. The microtiter-based assay is (Cso ka et al., 1997b). As no hyaluronidase activity suciently sensitive to detect 1/100th the activity found could be found in the 17E9-supernates, changes in the in the SCC-10a line without immunoprecipitation. 17E9 reactive epitope on Hyal-1 in the de®cient cell Substrate-gel zymography of the cell layer immuno- lines appeared unlikely. precipitates from NHK cells and the SCC-10a line Immunoblotting of the 17E9-immunoprecipitates possessed an additional *45 kDa lower molecular from conditioned media and cell layers with polyclonal weight isoform of Hyal-1, similar to a proteolytically antibodies against Hyal-1 were also examined (Figure

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 872 3). Hyal-1 protein levels were in agreement with the post-translational inactivation or the presence of an enzyme assays. Hyal-1 protein was only observed in the inhibitor unlikely to account for the absence of SCC-10a line and in the NHK cells. These results made enzymatic activity in the cell lines.

RT ± PCR analysis reveals discrepancies between HYAL1 mRNA and protein Reverse transcriptase ± PCR (RT ± PCR) analysis reveals discrepancies between HYAL1 mRNA and protein Reverse transcriptase-PCR (RT ± PCR) analysis of HYAL1 using primers from 482 ± 2278 bp showed that all cells, with the exception of the HOC-313 lymph node metastasis derived cell line, produced mRNA transcripts for HYAL1. The HOC-313 line showed no detectable mRNA with 40 cycles of RT ± PCR, but extended cycles did reveal a weak transcript that was of the correct size. Levels of b-actin from all cell-lines showed no appreci- able di€erences within the cDNA preparations.

Comparative genomic hybridization (CGH) and fluorescence in situ hybridization (FISH) analysis of HNSCC cell lines

Figure 3 Western blot analysis of 17E9 immunoprecipitates The apparent discrepancies between Hyal-1 protein using polyclonal antibodies against recombinant Hyal-1. (a), cell levels and HYAL1 mRNA transcripts led to an Layer, (b), conditioned media. 17E9 immunoprecipitates were examination of the HYAL1 gene on chromo- probed with rabbit polyclonal antibodies to Hyal-1 some 3p21.3 in these HNSCC lines. We assessed the

Figure 4 CGH and FISH analysis of chromosome 3 and HYAL1. CGH analysis using genomic DNA from HNSCC lines and NHK cells are shown with corresponding graphical analysis. Deletions are represented as regions scoring below the normalized line (ÐÐ). Cell lines were further examined by FISH for 3p21.3 using a 100 kb PAC probe and a chromosome 3 centromeric probe. Two hundred nuclei from each line were scored for the number of chromosome 3 centromeric (red) and 3p21.3 (green) signals. The chromosome-3/3p21.3 ratios found are shown

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 873 status of the HYAL1 gene by FISH using a 100 kb zygosity at 3p21.3 as an adequate explanation for the genomic PAC probe and compared this to the entire absence of Hyal-1 activity in these cell lines, and would chromosome 3 by CGH. Representative FISH images rule out imprinting of the HYAL1 gene on 3p21.3 from each cell line (200 nuclei scored) and CGH revealed a loss of 3p21 and one copy of HYAL1 in the The HSC-3 HNSCC line is capable of synthesizing SCC-9, SCC-10a, SCC-15, SCC-25, SCC-10b and functional HYAL1 under an inducible promoter HSC-3 relative to the chromosome 3 centromeric probe (Figure 4). The HNSCC lines were generally tetraploid Given the discrepancies between HYAL1 mRNA levels with respect to the centromeric chromosome 3 probe and protein, we wished to investigate whether the and several other centromeric chromosome markers, HNSCC lines had the capacity to produce functional but showed varying losses of 3p21.3 from ratios of 3/2 Hyal-1 under an inducible promoter. We therefore to 4/1 (chromosome-3/.3p21.3). Surprisingly, the HOC- subcloned the HYAL1 open reading frame into an 313 cell line possessed equal ratios of centromeric 3p to ecdysone-inducible vector (HYAL1 pIND, Invitrogen) HYAL1 by both FISH and CGH analysis. The HOC- and cotransfected it with the pVgRXR vector into the 313 line was diploid in DNA content. This was the HSC-3 HNSCC line. As shown in Figure 5, one of the only cell line that did not have mRNA, protein, nor HSC-3 subclones examined was fully capable of activity for Hyal-1. The SCC-10a line on the other expressing Hyal-1 activity and protein in an inducible hand, expressed HYAL1 mRNA, protein and abun- fashion in response to increasing concentrations of dant enzyme activity (*80061073 TRU/mg/cellular muristerone (Figure 5b and a, respectively). The protein), but had a clear loss of one HYAL1 allele by majority of the activity and protein was recovered in FISH and CGH. This appeared to exclude hemi- the conditioned media. As the HSC-3 line showed no chromosomal aberrations surrounding the HYAL1 gene and produced endogenous transcript for HYAL1 without Hyal-1 protein or enzyme activity, we postulated that mutations could be responsible for the loss of immunoreactive protein.

Sequencing of the full-length cDNA fails to identify mutations in the open reading frame In light of the apparent discrepancy between mRNA levels and protein, we sequenced the HYAL1 RT ± PCR products from NHKs, SCC-9, SCC-10a, SCC-15, SCC-25, SCC-10b and HSC-3 from bp 482 ± 2278. Sequencing of these RT ± PCR products failed to produce any mutations or polymorphisms that could explain our ®ndings.

Figure 6 RT ± PCR analysis of HYAL1 identi®es a spliced form Figure 5 The HSC-3 HNSCC line produces functional Hyal-1 of the 5' UTR that correlates with enzyme and protein levels. (a) b- enzyme activity and protein under an inducible promoter. (a), actin controls for RNA. (b) Analysis of the 5' UTR (15 ± 106 bp) conditioned media and cell extracts from an HSC-3 sub-clone reveals two splice forms. The lower 109 bp band corresponds to transfected with HYAL1 under an ecdysone inducible promoter the spliced 5' UTR of HYAL1. The 591 bp upper and represents were analysed with and without muristerone by 17E9 IP and the unspliced form. (c) Ampli®cation of HYAL1 from Intron-1 Western blot with rabbit anti-Hyal-1 polyclonal Abs. (b), cells and Exon-4 (482 ± 2278 bp) reveals retention of Intron-1 with cultured with increasing concentrations of inducing agent were proper splicing of Intron-2 and Intron-3 in all cell lines except the assayed for 17E9-reactive enzyme activity after 48 h HOC-313 which does not express HYAL1 mRNA (c)

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 874 RT ± PCR analysis of the 5' untranslated region of HYAL1 from Figure 6 was unlikely to be an artifact of HYAL1 reveals a novel spliced form that correlates with genomic DNA contamination, as RT ± PCR using the enzyme and protein levels primers from Intron-1 to Exon-4 produced the predicted 1796 bp product (Figure 6c) that had retained Intron-1 We noted that the 5' UTR of HYAL1 was unusually long but spliced out Intron-2 and Intron-3 as determined by (611 bp). In addition, the 5' UTR contained eight sequencing. methionine residues, placing the assumed HYAL1 open Northern blots from normal human tissues also reading frame in poor context for expression assuming identi®ed 1.9 and 2.5 kb transcripts that correlated the ATG at 611 bp as the initiation codon. An expressed with the spiced and unspliced 5' untranslated region of sequence tag (EST) for HYAL1 from neuroepithelial HYAL1 (Figure 7). We therefore concluded that both cells (AA223264) was found in the EST database of these two forms occur naturally in vivo but that only (dbEST) that skipped nucleotides 103 ± 585, suggesting the spliced form produces the functional enzyme that this portion of the 5' UTR might contain a retained protein that we detected in our assays. intron (Kozak, 1996). A retained intron can severely limit translation by preventing the ribosome from binding to Sequencing of HYAL1 genomic DNA fails to the correct initiating methionine codon (Kozak, 1991). demonstrate mutations in introns or exons The previous primers used would not have ampli®ed such a spliced form, as the forward primer was within this The HYAL1 gene was then ampli®ed from genomic potential ®rst intron. Primers ¯anking this potential DNA preparations. Sequencing of this full-length retained intron were therefore designed that ampli®ed genomic DNA from all eight cell lines failed to identify the HYAL1 5' UTR from 15 ± 606 bp. RT ± PCR based any mutations within the intron/exon splice junctions analysis identi®ed a shortened 109 bp 5' UTR in the that could explain the failure of the majority of NHK cells and in the SCC-10a line, in addition to the HNSCC lines to splice out the retained intron within expected 591 bp product (Figure 6b). Sequencing of the the 5' UTR. The HOC-313 line, which contained two PCR products from the NHK 5' UTR demonstrated neither transcript by RT ± PCR analysis, also lacked that the splicing occurred between nucleotides (103) to any detectable mutations. (585) GenBank Accession No. AF118821. This spliced form of HYAL1 correlated very well with the protein and Summary of HYAL1 in HNSCC cell lines enzyme activity levels demonstrated in Figures 1 and 3. There was a mixture of the two 5' UTRs in normal A summary of the analysis of HYAL1 in HNSCC is keratinocytes and the SCC-10a line, whereas all other cell given in Table 1. Only NHK cells and the SCC-10a line lines except the HOC-313 ampli®ed predominantly the produced comparable levels of enzyme activity, 591 bp 5' UTR. This 591 bp unspliced 5' UTR form of protein, and the spliced form of HYAL1 transcript. The SCC-9, SCC-15, SCC-25, SCC-10b, and HSC-3 lines showed very weak or absent levels of the spliced form of HYAL1, in agreement with the level of enzyme kb activity found in these cells. Levels of the unspliced 4.4 form were proportional to that found in the cells producing functional protein. The HOC-313 lines, however, produced neither transcript at levels detect- able under the number of cycles examined. 2.4

Discussion

The existence of acquired, somatic homozygous dele- 1.35 tions over 3p21.3 in human malignancies is suggestive of a tumor suppressor gene locus. The presence of a functional tumor suppressor activity encompassing this 12 3 45 67 8 region (Cheng et al., 1998) supports such a hypothesis. Homozygous deletions have been described in this region Figure 7 Northern blot analysis in human tissues reveals two species of Hyal-1 in normal tissues: lane-1, heart; lane-2, brain; both in vitro and in vivo (Todd et al., 1997), but no lane-3, placenta; lane-4, lung; lane-5, liver; lane-6, skeletal muscle; mutations of any of the genes in this deleted region have lane-7, kidney; and lane-8, pancreas been reported with high frequency in carcinomas in

Table 1 Summary of HAY1 analyses in HNSCC lines HYAL1 activity HYAL1 activity mRNA 611 bp mRNA 129 bp Cell line cell layer media Protein 5' UTR 5' UTR CGH 3p21 FISH Cen/HY1 Keratinocytes + + + + + 2 2/2 SCC-9 777+ 7 1 3/2 SCC-10a + + + + + 1 4/1 SCC-15 777+ 7 1 4/2 SCC-25 777+ 7 1 4/2 SCC-10b 777+ 7 1 4/2 HOC-313 777772 2/2 HSC 777+ 7 1 4/2

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 875 which loss of heterozygosity has occurred. Knudson's In contrast to these splicing aberrations, the HOC- `two hit hypothesis' (Knudson, 1971) explaining the 313 line lacked both transcripts for HYAL1 and yet inactivation of two alleles of a recessive oncogene has was normal by both CGH and FISH. Preliminary generally held true for classic tumor suppressor genes, studies showed a dose dependent reactivation of Hyal-1 such as pRb and p53. There has been considerable debate enzyme activity in this cell line following a 72 h recently in what constitutes a tumor suppressor gene treatment with 5-aza-2'-deoxycytidine (data not (Haber and Harlow, 1997; Sager, 1997). Although the shown). This raises the possibility that the HYAL1 HYAL1 gene product is not produced in the majority of gene is hypermethylated in the HOC-313 line. How- HNSCC lines examined, the mechanism appears to be ever, this has not been veri®ed by sequencing independent of the loss of heterozygosity. metabisul®te-treated DNA to con®rm that the CpG- Several factors have made re®ning the candidate island immediately upstream of HYAL1 is e€ected. TSG locus on 3p21.3 dicult. First, the high gene We have not examined the status of other hyalur- density of 3p21.3 makes it dicult to identify a onidase activities or their genes such as HYAL2, particular gene, even with a 30 kb homozygous immediately adjacent to HYAL1 on 3p21.3 (Cso ka et deletion. Second, many genes on chromosome 3p21 al., 1999). Our hyaluronidase activity assays have been are silenced at least in small cell lung carcinoma by unable to detect recombinant Hyal-2 enzymatic activity some unknown mechanism (Scaloni et al., 1992). using either the microtiter-based or HA substrate gel Finally, chromosome 3p is postulated to harbor other assays. The covalently bound biotinylated HA may not tumor suppressor gene loci, such as at the 3p14-p12 serve as an available substrate. Nevertheless, all Fragile Histidine Triad (FHIT) region (Druck et al., enzyme activity as measured in both assays could be 1998) and at 3p25, the von Hippel-Lindau (VHL) immunoprecipitated with the 17E9 mAB. There did not disease region (Hibi et al., 1992), making the larger appear to be a cofactor required for enzyme activity, as chromosomal deletions dicult to interpret. the HSC-3 line was capable of producing Hyal-1 The lack of a functional HYAL1 gene product in the protein and activity when the HYAL1 gene was majority of examined HNSCC lines is still intriguing, introduced without the 5' UTR region. These studies given that this gene resides within a potentially point towards the 5' UTR as the rate-limiting step in informative 30 kb homozygous deletion. Although large the production of enzyme activity. chromosomal aberrations over 3p were found in the The presence of nine start codons in the retained HNSCC lines, hemizygosity did not necessarily correlate intron 1, and a number of stop codons, three of which with the loss of enzyme activity or protein. The SCC-10a are in frame with start codons, provide a mechanism line produced enzyme activity and properly spliced the 5' for the failure of some cell lines to translate HYAL1 UTR. However, this cell line showed clear deletions of (Kozack, 1996; Zhang et al., 1998). The presence of the 3p21.3 locus by FISH and CGH analysis. This aberrant splicing may be more ubiquitous than demonstrated that one copy of the HYAL1 gene is previously assumed (Maquat, 1996). Such retained sucient to generate normal levels of enzyme activity. introns, and ¯awed pre-mRNAs are suggested to have The SCC-9, SCC-15, SCC-25, SCC-10b and HSC-3 modulating functions, and are present in apparently lines expressed predominantly mRNA transcripts normal tissues, as shown in the Northern analysis of retaining the 5' UTR intron. This unspliced 5' UTR human tissues (Figure 7). leaves the transcript in poor context for expression. A It appears that in the HNSCC lines, either aberrant mixture of the spliced and unspliced 5' UTR were splicing or possibly hypermethylation silences the found in NHK cells and in human tissues by Northern HYAL1 gene. The HYAL1 gene was inactivated or blot, demonstrating that this unspliced form is a more suppressed in six of the seven cell lines examined, but general phenomenon and not exclusive to malignancies. inactivating mutations were not shown to be the cause. Few examples of post-transcriptional regulation such Both hypermethylation and the aberrant splicing could as this exist in eukaryotic biology. The sex-lethal be explained as mere bystander e€ects. Without autoregulatory circuit in drosophila is one such model evidence for a functional role of HYAL1 in suppressing where 5' UTR splice variants regulate tumorigenicity, these ®ndings are simply associative in (Granadino et al., 1997). Aberrant or alternative nature. In conclusion, although the HYAL1 gene is splicing of other candidate tumor suppressor genes inactivated in HNSCC lines, the mechanisms respon- such as FHIT and TSG101 have been reported, and sible for such inactivation do not appear to be directly generally appear to be epigenetic rather than mutations associated with the chromosomal aberrations at 3p. at intron-exon boundaries (Gayther et al., 1997). However, further investigations of this candidate tumor The spliced 109 bp 5' UTR product was present at suppressor gene, along with the other candidate genes very low levels after 40 cycles of PCR in some of the in this region, are warranted. carcinoma lines. These results are in agreement with the 17E9 enzyme assays that detected HYAL1 at levels several log fold lower than the NHK or SCC-10a lines Materials and methods (0.5 ± 25 TRU61073 versus 500 ± 800 TRU61073/mg cellular protein, respectively). The reason for this basal Cell culture level of HYAL1 gene expression is unclear. This SCC-9, SCC-15, SCC-25 squamous cell carcinoma lines were residual activity could result from the heterogeneous from the ATCC. SCC-10a, SCC-10b, HSC-3 and HOC-313 nature of the tumor cell populations. The FISH cell lines were kindly provided by RH Kramer (Oral Cancer analysis supports the idea of 3p21.3 heterogeneity in Research Center, UCSF). The NHK cell cultures (normal copy number ratios of 3p21.3/Cen-3 per cell. Alter- human foreskin keratinocytes) were obtained from Clonetics natively, incomplete epigenetic silencing of the splicing (San Diego, CA, USA) or were generated as described machinery is equally plausible. previously (Frost et al., 1997). The NHK cells were routinely

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 876 cultured in serum-free de®ned keratinocyte basil media additional 5 s/cycle from cycles 10 ± 30 and a ®nal extension of (KBM, Life Technologies, Gaithersburg, MD, USA) with 10 min at 728C. Control b-actin primers were bAF (AACACC- antibiotics except for experiments for comparison of SCC CCAGCCATGTACGTTGC) and bAR (TCCTTCTGCATC- lines. SCC lines were cultured in DME H21/F12 50 : 50 mix CTGTCGGCAA) and run under the same conditions as with 10% FBS plus antibiotics. For the analysis of serum-free HYAL1F1 and HYAL1R1. For examination of the HYAL1 cultures, all cells were grown in DME H21/F12 50 : 50 mix 5' untranslated region from (15 to 606 bp) primers used were plus antibiotics with insulin, transferrin and selenium. HYAL1F2 (GCAGCTGGGGTGGAATCTGGC) and HYAL1R2 (CGGGACTGGTCGAGGACAACCT) with a 958C denaturing step for 3 min followed by 958C30s,638C Analysis of HYAL1 hyaluronidase activity in HNSCC cell lines 30 s, 728C for 1 min plus an additional 5 s/cycle from cycles Hyaluronidase activity was measured using the microtiter- 10 ± 30, and a ®nal extension of 10 min at 728C. For based assay as described (Frost and Stern, 1997), with ampli®cation of the genomic HYAL1 sequence from (7104 biotinylated human umbilical cord HA as substrate (ICN, to 2278 bp), primers HY1F3 (CTGGCCTGGCCTCCTA- Costa Mesa, CA, USA). The HA substrate gel zymography ATCCAAG) and HYAL1R1 were used with a 958C denaturing procedure was performed as previously described (Gunten- step for 3 min followed by 958C30s,628C30s,728C for 2 min hoener et al., 1992) using 100 mg/ml HA, ®nal concentration. plus an additional 5 s/cycle from cycles 10 ± 30 and a ®nal HNSCC lines or normal NHK cells were seeded at 26106 extension of 10 min at 728C. For sequencing PCR products, cells in the presence of serum or KBM respectively, and were bands were excised and eluted with the Gel Extraction Kit cultured overnight. Cells were washed 65 with serum-free (Boehringer-Mannheim). All sequencing reactions were per- media and were then incubated for 48 h. Cell layers were formed on double-stranded DNA with the Taq dye deoxy harvested with 3 ml/T75 with PBS+60 mM octylglucoside terminator cycle sequencing kit (Applied Biosystems) accord- (Boehringer-Mannheim, Indianapolis, IN, USA) and protease ing to the manufacturer's instructions, and run on an ABI inhibitors (Complete Boehringer-Mannheim) plus 100 U/ml PrismTM automated sequencer (Applied Biosystems, Foster DNAase (Boehringer-Mannheim) and extracted for 1 h on City, CA, USA). ice. Octylglucoside and protease inhibitors were also added to conditioned media samples. Samples were then immunopre- Generation of an ecdysone-inducible HYAL1 construct in the cipitated with 17E9 IgG2a anti-hyaluronidase antibodies HSC-3 cell line conjugated to protein-A beads (1.5 mg IgG2a/mg cellular protein) and were incubated overnight at 48C. Beads were The HYAL1 construct used previously for expression (Frost collected by centrifugation and washed once with PBS. et al., 1997) was subcloned from the PCR3.1-Uni vector into Immunoprecipitates were then measured for enzyme activity the Ecdysone-responsive pIND vector (Invitrogen, San by HA substrate gel zymography or by the microtiter-based Diego, CA, USA). The HYAL1 pIND vector was cotrans- assay. For zymography, immunoprecipitates were incubated fected into the HSC-3 line with the pVgRXR vector using with 5% SDS without reducing agents at room temperature. lipofectin (Life Technologies). Cells were selected in 500 mg/ Beads were pelleted by centrifugation and supernatants ml G418/500 mg/ml Zeocin and cloned by limiting dilution. electrophoresed on 10% SDS gels impregnated with 100 mg/ Clones overexpressing HYAL1 were screened using the ml HA (ICN). Gels were then incubated with 3% Triton X- microtiter-based assay in the absence and presence of 100 followed by incubation overnight in formate bu€er muristerone-A. A dose response of muristerone (0 ± 10 mM) pH 3.7 with 0.15 M NaCl. Enzyme degradation was then was used to examine the range of inducible HYAL1 activity. detected with Alcian blue staining followed by Coomassie HYAL1 protein levels were determined by immunoprecipita- blue R250 counterstaining. For the microtiter-based assay, tion and Western blot analysis as described above. immunoprecipitates were brought up into 0.1 M formate pH 3.7 with 0.1 NaCl and 3% Triton X-100 and incubated M Fluorescence in situ hybridization analysis of HYAL1 in in the microtiter based assay for 45 min. Enzyme activity was HNSCC cell lines described as relative turbidity-reducing units (rTRU) based upon a standard curve of calibrated commercial enzyme. A PAC probe spanning HYAL1 on 3p21.3 (Cso ka et al., 1998) was biotinylated with dATP using the BRL BioNick labeling kit (Life Technologies) and used for FISH analysis Western blot analysis of HYAL1 of normal keratinocytes and HNSCC lines as described Immunoprecipitates of HYAL1 using the 17E9 monoclonal (Mohapatra et al., 1997). Two hundred nuclei were scored for antibodies from 1 mg of total cellular protein or equivalent each cell line as a ratio of chromosome 3-centromeric probe conditioned media were electrophoresed on 12% gels and to the HYAL1 PAC signal. blotted to PVDF membranes. Membranes were blocked with 5% milk block followed by probing with rabbit polyclonal Comparative genomic hybridization of HNSCC cell lines antibodies diluted 1 : 2000 raised against immunoanity- puri®ed recombinant enzyme from HEK cells overexpressing Comparative genomic hybridization of HNSCC lines and HYAL1 and detected with ECL (Amersham, Arlington normal keratinocytes was performed as described previously Heights, IL, USA). (Mohapatra et al., 1995).

RT ± PCR analysis of HYAL1 Northern blot analysis of HYAL1 mRNA forms in human tissues Cytoplasmic RNA was isolated from normal keratinocytes and HNSCC lines by NP-40 lysis and was puri®ed with the Qiagen A human multiple tissue poly(A)+ Northern blot (Clontech) RNA isolation kit. RNA was reverse transcribed using the was probed using a 32P random primed HYAL1 cDNA that Thermoscriptase kit (Life Technologies) and 3 mg of total RNA was excised and gel-puri®ed from a PCR 31.-UNI vector. per cell line. For ampli®cation of the HYAL1 open reading Blots were exposed for 19 h. frame from (482 to 2278 bp), RT ± PCR was performed using Expand1. High Fidelity polymerase mix (Boehringer-Man- nheim) for 40 cycles using HYAL1F1 (CAGAGCAGCGGTG- GATTAATGCG) and HYAL1R1 (AAGTCCACATAAAAC- Acknowledgments GCTTAGCACGG) with a 958C denaturing step for 3 min This work was supported by NIH grant P50 DE/CA11912 followed by 958C30s,628C30s,728C for 2 min plus an to R Stern and NIH T32DE07204 to GI Frost.

Oncogene Aberrant splicing of HYAL1 pre-mRNA GI Frost et al 877 References

Baylin SB, Herman JG, Gra€ JR, Vertino PM and Issa JP. HibiK,TakahashiT,YamakawaK,UedaR,SekidoY, (1998). Adv. Cancer Res., 72, 141 ± 196. Ariyoshi Y, Suyama M, Takagi H, Nakamura Y and Buchhagen DL, Worsham MJ, Dyke DL and Carey TE. Takahashi T. (1992). Oncogene, 7, 445 ± 449. (1996). Head Neck, 18, 529 ± 537. Knudson Jr AG. (1971). Proc. Natl. Acad. Sci. USA, 68, Cheng Y, Poulos NE, Lung ML, Hampton G, Ou B, Lerman 820 ± 823. MI and Stanbridge EJ. (1998). Proc. Natl. Acad. Sci. USA, Kozak M. (1991). J. Cell. Biol., 115, 887 ± 903. 95, 3042 ± 3047. Kozak M. (1996). Mamm. Genome, 8, 563 ± 574. Cso ka TB, Frost GI, Wong T and Stern R. (1997a). FEBS Kreil G. (1995). Protein Sci., 4, 1666 ± 1669. Lett., 417, 307 ± 310. Latif F, Duh FM, Bader S, Sekido Y, Li H, Geil L, Zbar B, Cso ka TB, Frost GI, Heng HH, Scherer SW, Mohapatra G Minna JD and Lerman MI. (1997). Hum. Genet., 99, 334 ± and Stern R. (1998). Genomics, 48, 63 ± 70. 341. Cso ka AB, Scherer SW and Stern R. (1999). Genomics, 60, Lepperdinger G, Strobl B and Kreil G. (1998). J. Biol. 356 ± 361. Chem., 273, 22466 ± 22470. Cso ka TB, Frost GI, Wong T and Stern R. (1997b). FEBS Maquat LE. (1996). Am.J.Hum.Genet.,59, 279 ± 286. Lett., 417, 307 ± 310. Mohapatra G, Kim DH and Feuerstein BG. (1995). Genes Druck T, Berk L and Huebner K. (1998). Oncol. Res. 10, Cancer, 13, 86 ± 93. 341 ± 345. MohapatraG,MooreDH,KimDH,GrewalL,HyunWC, Frost GI and Stern R. (1997). Anal. Biochem., 251, 263 ± 269. Waldman FM, Pinkel D and Feuerstein BG. (1997). Genes Frost GI, Cso ka TB and Stern R. (1996). Trends Glycosci. Chromosomes Cancer, 20, 311 ± 319. Glycotech., 8, 419 ± 434. Sager R. (1997). Proc. Natl. Acad. Sci. USA, 94, 952 ± 955. Frost GI, Cso ka TB, Wong T and Stern R. (1997). Biochem. Scaloni A, Jones W, Pospischil M, Sassa S, Schneewind O, Biophys. Res. Commun., 236, 10 ± 15. Popowicz AM, Bossa F, Graziano SL and Manning JM. Gayther SA, Barski P, Batley SJ, Li L, de Foy KA, Cohen (1992). J. Lab. Clin. Med., 120, 546 ± 552. SN, Ponder BA and Caldas C. (1997). Oncogene, 15, Sekido Y, Ahmadian M, Wistuba II, Latif F, Bader S, Wei 2119 ± 2126. MH, Duh FM, Gazdar AF, Lerman MI and Minna JD. Gmachl M, Sagan S, Ketter S and Kreil G. (1993). FEBS (1998). Oncogene, 16, 3151 ± 3157. Lett., 336, 545 ± 548. Todd S, Franklin WA, Varella-Garcia M, Kennedy T, Hilliker Granadino B, Penalva LOF, Green MR, Valcarcel J and Jr CE, Hahner Anderson M, Wiest JS, Drabkin HA and Sanchez L. (1997). Proc. Natl. Acad. Sci. USA, 94, 7343 ± Gemmill RM. (1997). Cancer Res., 57, 1344 ± 1352. 7348. WeiMH,LatifF,BaderS,KashubaV,ChenJY,DuhFM, Guntenhoener MW, Pogrel MA and Stern R. (1992). Matrix, Sekido Y, Lee CC, Geil L, Kuzmin I, Zabarovsky E, Klein 12, 388 ± 396. G, Zbar B, Minna JD and Lerman MI. (1996). Cancer Haber D and Harlow E. (1997). Nat. Genet., 16, 320 ± 322. Res., 56, 1487 ± 1492. Heckel D, Comtesse N, Brass N, Blin N, Zang KD and Zhang J, Sun X, Qian Y, LaDuca JP and Maquat LE. (1998). Meese E. (1998). Hum. Mol. Genet., 7, 1859 ± 1872. Mol. Cell. Biol., 18, 5272 ± 5283.

Oncogene