Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. h ompltngenus and cosmopolitan Whereas addition, niches. the (Atkinson different In dramatically 1985). two gemmae occupy 1974, vittarioids reproduce called Farrar also 1964; propagules Stokey can via and can (years) They asexually ribbon-like. long-lived and exceptionally indeterminate be are hand, other on gametophytes, the inca- Vittarioid They reproduction. are 1971). vegetative and of Kaur (months) pable short-lived and to dis- (Nayar ephemeral a wings generally are with broad heart-shaped, and and midrib determinate the tinct are to ferns, most obvious of gametophytes of less The 1B). of are (Fig. morphology eye these naked the although in These gametophytes, differences 1995). whereas al. their major et indusia, display (Crane false also laminae groups the to, on limited occur sori and vittarioid on, borne sporangia oetfor,vtaiisgnrlygo seihts coloniz- epiphytes, as grow generally vittarioids floors, forest Fer- and 1990). simple Kramer 1982; always Tryon tile and almost Tryon are 1A; (Fig. vittarioids strap-like of those Thewhereas another. one of like leaves nothing look their sporophytes morphology, conspicuous coarse In disparate. ecologically or logically aeo ulcto eray1,2016 11, February publication Taxonomists of Plant Date of Society American 10.1600/036364416X690660 the DOI by 2016 Copyright © Botany Systematic en)i elspotdcaenwrfre oa the as to referred now clade 2007). al. well-supported et (shoestring (Schuettpelz a vittarioids adiantoids Another the in 1999). with ferns) Pryer together 1995; grouping ferns) Pteridaceae, al. (maidenhair the et within prominent Pryer emerged surprise 1994; A Stockey time. Rothwell 1994; and al. of in et ferns (Hasebe Salviniaceae water test and heterosporous Marsileaceae the the the of newly monophyly the stood these is example have of attention, Most consider- drew able suspected. subsequently which been relationships, recognized previously that associations not unexpected several had inferred 1995) 1994, al. et Adiantum (Hasebe ferns of analyses phylogenetic molecular Early ihti outpyoeei rmwr salse o h raetrltosisi h dati ld,w a o ou nunder- within on place focus took now that can transitions we genetic clade, and adiantoid ecological, the morphological, in extreme relationships the broadest with the associated lineage. for processes this established evolutionary monophyly framework the the regarding phylogenetic standing questions robust unanswered this remain With there (adiantoids), group of monophyletic phyly robust a form to of shown been have together ags lwr ntewrd u hteovdfo iyfoee netr ihnteEpobaee usd fprstclnae,such While lineages, evolution. parasitic molecular of of rates Outside related accelerated Euphorbiaceae. greatly closely exhibit the The and within loving. the epiphytes, ancestors canopy-dwelling shade involves are tiny-flowered and exception morphology, from terrestrial, One evolved seen. dissected, that rarely fully but are world, transformations the abrupt in flowers largest opooista aeln bcrdtercoeaflain.Asetclrbtncleapeis example botanical spectacular A affiliations. close their obscured long have that morphologies Adiantum 3 Keywords Abstract Adiantum eateto oay mtsna nttto,MC16 .O o 71,Wsigo .C 01-02 .S A. S. U. 20013-7012, C. D. Washington 37012, Box O. P. 166, MRC Institution, Smithsonian Botany, of Department Adiantum 21) 11:p.17 pp. 41(1): (2016), Adiantum ahenM Pryer, M. Kathleen n h itrod ol o emr morpho- more be not could vittarioids the and — — 2 n h vltoayhsoyo h itrod.Hr erve eetpyoeei vdnesgetn upr o h mono- the for support suggesting evidence phylogenetic recent review we Here vittarioids. the of history evolutionary the and evsaeuiul itnuse ytheir by distinguished uniquely are leaves costete flf,mlclrpyoeei tde fe eelsrrsn eainhp ewe aawt aial different radically with taxa between relationships surprising reveal often studies phylogenetic molecular life, of tree the Across nvriyHraimadDprmn fItgaieBooy nvriyo aiona Berkeley, California, of University Biology, Integrative of Department and Herbarium University adnarFerns, Maidenhair ppye,gmtpye,mlclrpyoey aeheterogeneity. rate phylogeny, molecular gametophytes, Epiphytes, 1 n nlz e lsi aat ofr hsrsl.W idthat find We result. this confirm to data plastid new analyze and , eateto ilg,Dk nvriy uhm ot aoia27803,U .A. S. U. 27708-0338, Carolina North Durham, University, Duke Biology, of Department r yial ra n ieydivided, finely and broad typically are – Adiantum 23 1,4 hetigFrs itrod (Pteridaceae) Vittarioids Ferns, Shoestring sal cuso shady on occurs usually an Huiet, Layne 4 uhrfrcrepnec ([email protected]) correspondence for Author Adiantum Adiantum omnctn dtr akP Simmons P. Mark Editor: Communicating Adiantum aiona97026,U .A. S. U. 94720-2465, California iethose like , Adiantum 1 a-e Li, Fay-Wei r nedMnpyei n itrto Sister and Monophyletic Indeed are , and “ hetigferns shoestring 17 “ adnarferns maidenhair eecsbtenteetogop loetn otheir to extend also groups dif- two The most forests. Although these genomes. rain tropical between of canopies ferences and trunks tree ing xlr h vltoaypoessta eutdi this in resulted to that studies, future processes in evolutionary us, the permit phy- robust explore will This framework adiantoids. within logenetic of divergences and monophyly deep data, the plastid other for new the support analyze strong Here and of find be evolution? studies may molecular recent that of that review rate ferns we as faster vittarioid their well of to morphol- history contributing the as life in and correlates genus, ecology, there ogy, are this ques- example, For of unanswered vittarioids. of still history monophyly are lutionary the there regarding clade, tions robust a compose close a identified only not have with studies How- relationship family, years, 1990). distinct recent Kramer a in 1982; ever, Tryon as and regarded (Tryon Vittariaceae been the recently quite until have in early occurred lineage. this event of duplication history evolutionary genome the one least at that are studied vittarioids all of numbers mosome htlefrdee hntetp ShetezadPyr2007; Pryer and (Schuettpelz tips 2007). the al. et than Schuettpelz deeper support far weak lie mostly that is of species there among whereas is topology robust, vittarioid consistently the across support branch consequence, relative long extraordinarily to are branches Vittarioid lengths. between dissimilarity plastid another yet of Adiantum revealed analyses further These al. have 2007). et data Pryer (Prado genus and this Schuettpelz within 2007; nested be even may vittarioids 1,2 eas fterdsiciesimp distinctive their of Because hl ti la that clear is it While Adiantum alJ Rothfels, J. Carl ” n h itrod:asrkn ifrnei branch in difference striking a vittarioids: the and vtaiis,i otat aea xrml simplified extremely an have contrast, in (vittarioids), Adiantum rt n te enlnae o htmte.A a As matter. that for lineage, fern other any to or , ” ( Adiantum Adiantum Adiantum smnpyei n itrt h vittarioids. the to sister and monophyletic is n Rafflesia ,wihaeqitseta en:beauti- ferns: quintessential are which ), 2 =29or Adiantum n rcSchuettpelz Eric and n Adiantum seilyfrtebcbn nodes backbone the for especially , u losgetdta perhaps that suggested also but , 0(öee l 97,suggesting 1977), al. et (Löve 60 = ooaaieta rdcsthe produces that holoparasite a , n 0(öee l 97,nearly 1977), al. et (Löve 30 = Adiantum iidmrhlg,vittarioids morphology, lified n h itrod together vittarioids the and pce aedpodchro- diploid have species Adiantum n h vittarioids the and Adiantum n h evo- the and 3 n for and Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. aa i niiuldt eswr opld n o aho h plastid the of each for one compiled, were missing sets as data coded individual were ren- Six regions subsequent data. plastid that to of prior regions portions excluded non-protein-coding Unsequenced were the analyses. these ambiguous; in protein-coding alignment indels the the some dered for were straightforward there and was loci, the inspected alignment manually as Although was 2004) alignment edited. (Edgar, Each MUSCLE program. integrates alignment default with which aligned 2014), Codes was (Larsson region (Gene plastid AliView 4.5 Each Sequencher Michigan). Arbor, using Ann assembled Corporation, and edited manually were cutpl ta.(07 n ohesadShetez(04;primers (2014); Schuettpelz and Rothfels and (2007) for used al. et Schuettpelz rps4 20) oha ta.(04,adRtfl n cutpl (2014). Schuettpelz and Rothfels Pryer ( and loci and plastid (2014), six Schuettpelz for al. obtained were followed et Sequences sequencing Cochran extrac- and DNA (2007), for Protocols amplification, material. herbarium tion, or silica-dried either from n odt ocpuetedeetdvrecswti h eu,and genus, the within divergences of clades deepest major known the all capture from representatives to includes date to one a aeul nomdb u non hlgntcsuyfcsdon focused study phylogenetic ongoing of 200 our bulk approximately and by the the Rothfels informed of carefully and 16 was (2007) While al. of 1. et Appendix species Schuettpelz see on (2014); based Schuettpelz selected ( were species that outgroup two and adiantoids), crispa the to group sister Adiantum 8SSEAI OAY[oue41 [Volume BOTANY SYSTEMATIC 18 xrm opooia,eooia,adgnmcmakeover genomic ferns. and in ecological, morphological, extreme euiul isce,tretil n hd oig h lsl related closely the loving; shade and “ the terrestrial, of dissected, typical beautifully Sporophytes the A. assemblage: vittarioids. the and oto hw) xetoal oglvd n aal faeulrepro- asexual of capable reproduction; propagules and (note asexual long-lived, duction apical small exceptionally of (only shown), capable ribbon-like portion indeterminate, not are and gametophytes vittarioid of short-lived, gametophytes usually shaped, The B. epiphytes. hetigferns shoestring euneAinetadDt Sets Data and Alignment Sequence N xrcin mlfcto,adSequencing and Amplification, Extraction, DNA ao Sampling Taxon Fig. .Piesfor Primers ). cytgami]and [cryptogrammoid] .Sooht n aeoht oprsnbetween comparison gametophyte and Sporophyte 1. chlN ih itrodseis ih pce fcelnhi en (the ferns cheilanthoid of species eight species, vittarioid eight , Adiantum Adiantum , rpoA “ ” adnarferns maidenhair atpA and , vtaiis r ihysmlfe,canopy-dwelling simplified, highly are (vittarioids) — aeil n Methods and Materials a pert esas oeae u sampling our coverage, sparse be to appear may pce.A osqec,orsuyi h only the is study our consequence, a As species. u ao apecnit f1 pce of species 16 of consists sample taxon Our , rps4 atpB –– gemmae ,and r itdi al 1. Table in listed are iyormaaustroamericana Pityrogramma ” rbcL –– ( Adiantum ttip). at Adiantum — eeietclt hs sdin used those to identical were N eunechromatograms sequence DNA atpA r unesnilferns quintessential are ) r eemnt,heart- determinate, are , atpB — Adiantum N a isolated was DNA , Adiantum chlN Cryptogramma , [pteridoid]) /vittarioid rbcL Adiantum . , rpoA –– , re o ahidvda lsi einwr iulyisetdfrcon- for inspected values visually bootstrap were by region supported plastid were flicts individual analyses swap- likelihood each branch Maximum ML for reconnection replicates. trees set, and and random-addition-sequence 100 bisection data selected, and tree each model ping with for best-fit PAUP* in the estimated perform conducted With to parameters maximum AICc. PAUP* model a in the likelihood the function inferred under maximum AutoModel first selection using the We model used sets 2002). and data (Swofford tree plastid 4.0a136 parsimony six PAUP* the in of (ML) each for ducted 09 oesr ovrec n rprmxn.Tefrt2%o the calcu- to of used 25% was first tree. remainder consensus the The majority-rule and 50% mixing. burn-in a proper late as and discarded Drummond was convergence and out- sample the (Rambaut ensure runs, v1.5 Tracer to MCMC in the 2009) After inspected was subsets. were genera- prior the parameters rate 1,000 among put the every variation and allow sampled unlinked, to were were set frequencies parameters trees state substitution and stationary The settings rates, the tions. default both substitution the for the cold) distribution followed three and Dirichlet Priors and flat heated (MCMC) generations. a (one million Carlo with chains 20 four Monte with for chain each running out, analyses. Markov carried BI appli- were independent in more runs conduct Two models choose best-fitting to to models. the run of used was cable some analysis was implement PartitionFinder to another 2012) possible MrBayes, not al. is et eight it 2006) Because (Ronquist from (Zwickl 3.2 out 2.0 MrBayes carried Garli boot- were in ML with and replicates) trees searches random-addition-starting (1,000 tree ML independent analyses 2). (Table (MLBS) AICc substitution strap the and analyzed to scheme according data-partitioning and optimal models the concatenated determine to were 2012) plastid sets (BI). different inference data Bayesian across and separate ML using phylogenies incongruence six together well-supported comparing the mutually when regions, of detected instances were no Because 1996). ihyoenwyotie N eune eedpstdi GenBank in in deposited deposited were sequences are 1). (Appendix http://dx.doi.org/10.5061/dryad.4m6s6. DNA trees obtained Repository: phylogenetic newly Digital Eighty-one and Dryad alignments the set Data regions. port odfrs(cnie ta.20) oeie,btntalways, not polygram- but to Sometimes, and 2004). 2006) al. 2014) Pryer et (Schneider Schuettpelz and ferns moid (Schuettpelz and ferns rate (Rothfels filmy molecular vittarioids and Marais (Des 2003) notable horsetails al. closely ferns, from et reported in Within been 2010). has evolution dramatically heterogeneity vary al. can molecular or et similar, of very (Lanfear be rate can lineages the related that revealed (<70% supported weakly is clade the all PP). <0.97 for of MLBS, support strong backbone is entire There within whereas 2). vittarioids, Fig. across relationships PP; is PP) 1.0 another 1.0 MLBS, one MLBS, to (100% relationship (100% sister their clade is vittarioid as supported, the robustly and PP) 1.0 MLBS, bootstrap ML with supported, highly are support 31) of out (24 nodes i ftecnaeae i-lsi oi( loci six-plastid rpoA concatenated the of sis (ln tree in ML identical the best were The from topology. analyses resulting Bayesian Trees and 3. likelihood Table maximum in appears statistics tree evolution,and sequence of of summary models a best-fit characteristics, study; sequence this for analyzed were concatenated) one o h octntddt e,w sdPriinidr(afa tal. et (Lanfear PartitionFinder used we set, data concatenated the For hlgntcAnalyses Phylogenetic hlgntcaaye rmars h reo iehave life of tree the across from analyses Phylogenetic ee lge aamtie sxsnl-einmtie and matrices single-region (six matrices data aligned Seven ,and “ ≥ genthreshfortopoterm .9(i.2.Temnpyyo both of monophyly The 2). (Fig. 0.99 ≥ rps4 0 n aeinpseirpoaiiy(P sup- (PP) probability posterior Bayesian and 70% ssoni i.2 eryalo t internal its of all Nearly 2. Fig. in shown is ) — ” eaaepyoeei nlsswr con- were analyses phylogenetic Separate Discussion e o10000ad1000 respectively. 100,000, and 1,000,000 to set Results L ≥ = − 0 MsnGmradKellogg and (Mason-Gamer 70% 83294 rmteanaly- the from 38,392.964) atpA , atpB Adiantum Adiantum , chlN , (82% rbcL ,the , Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. gi o paraphyletic a for again adiantoids), (36 taxa ota ld Fg C cutpl n re 07 their 2007, Pryer and Schuettpelz 3C; (Fig. clade that to raddianum isn aa()0142.7 8090152.7 48915.526 39.522 5,779 5,911 44.829 50.980 Mixed 612 612 G + I + TVM 26.471 55.993 G + I + 559 TVM 613 35.627 G + 0.175 I + GTR 1,308 1,308 G + I + GTR 45.304 38.029 G + I + GTR 543 621 30.469 20.974 G + I + GTR 1,257 1,257 37.600 0.184 lnL Best used Model 1,500 (%) 1,500 sites Variable (%) data Missing (bp) included Characters (bp) length Alignment rest the + vittarioids of clade supported weakly of a to adiantoids), sister (74 paraphyletic taxa a suggests topology 98 2): adiantoids), Fig. of (16 monophyly taxa the 67 for support weak rela- Adiantum with but places for vittarioids, first composition recovered Subset to The been adiantoids. vittarioids. within have tionships dissimilar topologies conflicting highly Three ecologically and clade phologically of sup- monophyly find supported the to strongly for struggled bring 2012). port repeatedly a also al. date in have they vittarioids et to (adiantoids), the Rothfels analyses with 2006; molecular together Pryer all relation- and Although accurate reflect (Schuettpelz that ships recov- topologies of difficulty phylogenetic associated ering the been has heterogeneity with of rate ferns, rates tree slower (i.e. have clade tree-like fern consistently evolution). MrBayes tree molecular long-lived, for times, Model deceleration the the generation of rate base longer of abrupt the evolution an at that habit the found and with (2002) (2010) al. coincided al. et certain Soltis et example, with Korall For strongly biology. correlate of 19 to aspects other appears variation rate this Garli for Model 5 sequence Primer Subset MONOPHYLETIC IS ADIANTUM AL.: ET PRYER name Primer rps4 rpoA chlN region DNA 2016] indels. 2012). al. et (Lanfear PartitionFinder using AICc V T G + I + G JC+I+G GTR + I + GTR G + JC+I+G I + G TVM + I + TVM 6 5 4 V T G + I + GTR G + I + TVM 3 r++ HKY+I+G TrN+I+G 2 T T G + I + GTR G + I + GTR 1 n ftecalne oe ymlclrevolutionary molecular by posed challenges the of One Table Table Table Adiantum .Sqec hrceitc o i lsi oi etftsqec vlto oes n eutn resaitc.Msigdt osntinclude not does data Missing statistics. tree resulting and models, evolution sequence best-fit loci, plastid six for characteristics Sequence 3. the to according determined loci; plastid six of set data concatenated the for models substitution and scheme data-partitioning Optimal 2. plastid of sequencing and amplification DNA for used Primers 1. itrt itrod,adters of rest the and vittarioids, to sister Fg A cutpl ta.20,terFg 1): Fig. their 2007, al. et Schuettpelz 3A; (Fig. Fg B cutpl ta.20,terFg ) 147 3): Fig. their 2007, al. et Schuettpelz 3B; (Fig. rbcL rS(ees)TCGGGTGACSuaCise l 1997 al. et Souza-Chies (unpubl.) study al. this et Schuettpelz (unpubl.) al. et (unpubl.) Schuettpelz al. et Schuettpelz (unpubl.) al. et Schuettpelz TACCGAGGGTTCGAATC AATTAAARGCTCTRGCRGGTRATTC TRCAYGAGTATTCYACAATAACGGG CAWATTTTTTCGATCCARGCRCGTG CGWTAYGCRAYGGCVGAATYGSAAG CTCTCGGTATCGAGGACC (reverse) trnS (forward) Adcvrps45' rpoA-R1 rpoA-F1 chlN-R2 chlN-F2 atpA/atpB/rbcL − 10,846.500 .Tetidtplgcloto is option topological third The ). Adiantum Adiantum tAap hNrc pArs l combined All rps4 rpoA rbcL chlN atpB atpA Adiantum atpA/atpB/rbcL u hstm with time this but , ihrsett h mor- the to respect with ue l 02(their 2012 al. et Lu ; − 6,783.828 ,with Adiantum Adiantum .raddianum A. .Asecond A ). Adiantum − sister sister 3,980.225 A. chlN iiyspotvle lotuieslyece support exceed universally almost values proba- posterior support comparable, different directly bility not measure thus boot- probabilities are While and posterior 0.81). things = and (PP lacking support was strap node that at support ian i.1) 0 aa(5adiantoids), (15 taxa 400 1B): Fig. e o 6tx 1 datis ohesadShetez2014, Schuettpelz and 1C: Rothfels Fig. adiantoids, data (16 their compartments) taxa genome to 26 three for date set all monophyletic to across study (from other a of six-locus only monophyly The the for 3D). demonstrate convincingly 2, support (Figs. support strong bility is Adiantum adiantoids) (24 ( loci six-plastid mor- of genera. fern degree large extraordinary within the conservatism with phological reconcile be to actually difficult may vittarioids the from derived that suggest both topologies ee outyrftstehptei htvtaiisare vittarioids that nuclear hypothesis low-copy the 25 within from nested refutes (2015) robustly al. et genes study Rothfels their by in included inferred were ferns 73 of including (but species nad5 nlsso 8tx 7 datis,L ta.(02 e their see of (2012, support monophyly bootstrap the al. parsimony for et maximum (87%) Lu strong adiantoids), found (74 2) Fig. taxa 98 of analysis , h otsgiiatpyoeei eutfo u td of study our from result phylogenetic significant most The ntercmie he-lsi akr( marker three-plastid combined their In rpoA − m].As noteworthy Also [mt]). 9,419.414 , rps4 ih8%M otta n . otro proba- posterior 1.0 and bootstrap ML 82% with , ′ nti study. this in -3 ′ ihnAdiantum within atpA/atpB/rbcL Adiantum atpA/atpB/chlN/rbcL/rpoA/rps4 − rbcL chlN chlN atpA atpA atpA 4,610.626 .raddianum A. . , , , , , eodcdnposition codon second rpoA rpoA atpB atpB atpB –– Adiantum patd + [plastid] , , Fg B ) yohssta is that hypothesis a C), 3B, (Fig. , eodcdnposition codon second hr oo position codon third rbcL rbcL lhuhol three only although rps4 Adiantum atpA/atpB/rbcL , is oo position codon first is n eodcdnposition codon second and first rps4 − n w itrod out vittarioids two and ) 4,091.730 u infcn Bayes- significant but , hr oo position codon third –– gapCp h enphylogeny fern the oprdt other to compared atpA rmrsource Primer Adiantum rm3 taxa 34 from ) .Tels two last The ). nc + [nuc] / atpB − Adiantum 38,392.964 / a a was atp1 rbcL / ) Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. upr,uls tews niae.Bac upr o l o-hcee rnhsi niae hr LSadP upr s>0.Saebrcorre- bar 100%/1.0 Scale have >50%. is branches support thickened PP all and (PP); MLBS probability where indicated posterior is (MLBS)/Bayesian branches support non-thickened bootstrap all substitutions/site. ML for 0.03 support as to Branch node sponds indicated. each otherwise at unless shown support, is support Branch 0SSEAI OAY[oue41 [Volume BOTANY SYSTEMATIC 20 eut u ipy h w ehd M n I aecon- have BI) and (MP methods thus two the (and their simply, in Put issues par- confidence (long result. any is attraction undermines situation inference), that long-branch a MP Lu internodes) unreliable to is in short prone this low very that ticularly so by given is subtended pos- especially node branches the (2012), that particular fact al. this The et 2012). for 1993; al. probability Bull et and Rothfels terior support Hillis 2003; equal; al. bootstrap are et they Alfaro likelihood when course, and of (except, parsimony from values Fig. .Tebs Lte (ln tree ML best The 2. L = − 83294 rmteaayi ftecmie i-ou lsi aaset: data plastid six-locus combined the of analysis the from 38,392.964) icuigtetonwloci new two the (including set. data sequence plastid expanded an demon- of using study study monophyly their (2012) that the the its al. convinced et strated fact not than Lu were in lower entire we Thus, the probability is study. in posterior question bootstrap parsimony Bayesian in maximum be a node reasonably with The might node MP fail. where to node expected a for support trasting ebleeta u nrae apigo lsi markers plastid of sampling increased our that believe We Adiantum atpA chlN , atpB and , hc rmtdour prompted which , chlN rpoA , rbcL oehrwith together ) , rpoA ,and only rps4 . Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. cutpl 21,terFg c:2 aa(6adiantoids), (16 taxa 26 adiantoids), 1c): (15 Fig. their taxa (2014, their 400 Schuettpelz adiantoids), (2007, 1b): al. (36 Fig. et taxa Schuettpelz their 147 B. 87%. 3): = (2012, Fig. 81 MPBS al. = support PP bootstrap et probability simony Lu posterior Bayesian adiantoids), 70%; is (74 < taxa monophyly 98 MLBS 2): Fig. support their bootstrap likelihood maximum u t hssuy 4tx 2 adiantoids), (24 taxa 34 study: this rps4 mt; + nuc adiantoids), (16 taxa 67 1): Fig. for their (2007, al. et 06 RE TA. DATMI OOHLTC21 MONOPHYLETIC IS ADIANTUM AL.: ET PRYER 2016] eainhp between relationships Fig. Adiantum brvain:A= Abbreviations: . .Cnlcigpyoeei oooisrcnl yohszdfor hypothesized recently topologies phylogenetic Conflicting 3. oohl sBysa otro rbblt P<0.95 < PP probability posterior Bayesian is monophyly Adiantum Adiantum =itrodferns. V=vittarioid ; n h itrodfrs .Schuettpelz A. ferns. vittarioid the and rbcL. atpA/atpB/rbcL .ShetezadPyr(2007, Pryer and Schuettpelz C. atpA/atpB/rbcL atpA/atpB/chlN/rbcL/rpoA/ atpA/atpB/rbcL upr for support , and .Rtfl and Rothfels D. . atpA/atpB/rbcL aiu par- maximum Adiantum support , and + aecnrbtdt hsrte pcaua transformation. may spectacular that rather this mechanisms to causal in genome contributed identify, underlying have to epiphytism, the aim studies, we of place, future in evolution robust now a framework With the phylogenetic acceleration. rate cycle, molecular and phases life duplication(s), gametophyte their and sporophyte of the trans- both morphological in involving formations ferns, vittarioid the of history adiantoids the or 2007) study). resolve al. (this et typically (Schuettpelz cheilanthoids data the of plastid only data ludens using C. using analyses here. achieved (2014) date, not was Schuettpelz To compartments, genomic for and three all support Rothfels from strong 2007; by al. however, al. recovered et 2011); Windham et al. 2008; ludens (Prado Calciphilopteris al. et et studies Eiserhardt Rothfels recent 2009; 2007; al. in et also found Schuettpelz ferns a cheilanthoid those the for mirror within relationships support Broad strong 2014). including Lu 2007; 2012), Vaginularia al. et al. (Schuettpelz studies et earlier with agreement in unpubl.). al. et (Schuettpelz clade vittarioid the for study Adiantum erycmlt hlgntcsuybsdo orplastid four on based ( for study outgroup markers phylogenetic as forward complete vittarioids moving nearly of now a sampling thus appropriate ongo- are an our we with with studies; further within-clade proceeding ing to across requisite comparable of is monophyly confidence support, the for credible and measures, both achieving Ronquist in of 1996; analysis succeed from sampling large-scale taxon al. parallel informed our as et well as 2003), (Swofford and Huelsenbeck likelihood analyses maximum as Bayesian such approaches, model-based lao .E,S olr n .Ltoi 03 ae rbosrp simu- A bootstrap? or Bayes 2003. Lutzoni. F. and Zoller, S. E., M. Alfaro, from Assistance L. of F.-W. comments P. and thoughtful M. the P. K. are M. Windham. to as K. D. DEB-1110652 acknowledged, M. to awards gratefully DEB-1407158 is DDIG DEB- and NSF Kao and T.-T. to R. as H. J. well access L. C. and as for National and P. S. UTC by M. E. funded and K. to was to UC, 1405181 DEB-1145614 research TUR, grants This study. Foundation P, Science this GOET, for DUKE, needed COLO, specimens A, of staff e aas .L,A .Sih .M rto,adK .Pyr 03 Phy- 2003. Pryer. M. K. and Britton, M. D. Smith, R. A. L., D. Marais, Des oha,A,J rd,adE cutpl.2014. Schuettpelz. E. and Prado, J. the of A., morphology Comparative Cochran, 1964. Stokey. G. A. and R. L. Atkinson, rn,C . .R arr n .F edl 95 hlgn fthe of Phylogeny 1995. Wendel. F. J. and Farrar, R. D. H., C. Crane, da,R .20.MSL:mlil euneainetwt high with alignment sequence multiple MUSCLE: 2004. C. R. Edgar, neteemkoe curddrn h evolutionary the during occurred makeover extreme An are 2) (Fig. adiantoids the within relationships other Most Acknowledgments. ot al apigadbosrpigi sesn phylogenetic assessing in Chain bootstrapping Markov confidence. and Bayesian sampling of Carlo performance Monte the comparing study lation ae nclrpatDAsqec aa( data sequence DNA horsetails, chloroplast extant on of based evolution and relationships logenetic aeoht fhmsoosferns. homosporous of gametophyte inlJunlo ln Sciences Plant of Journal tional polyphyletic a to leads simplification Vittaria Convergent Vittariaceae: from segregated genus (Pteridaceae). fern taenitidoid cuayadhg throughput. high and accuracy . wtotsrn upr)a ihrsse oterest the to sister either as support) strong (without rbcL pce Hite l nul) n comparable a and unpubl.), al. et (Huiet species mrcnFr Journal Fern American ld Rhe ta.20;Rtfl n Schuettpelz and Rothfels 2008; al. et (Ruhfel clade oeua ilg n Evolution and Biology Molecular , PhytoKeys atpA , h uhr hn h ebru uaosand curators herbarium the thank authors The samme fti ld,wihwas which clade, this of member a as chlN ieaueCited Literature 5 23 35: , 6:737 164: rpoA 5 283 85: – uli cd Research Acids Nucleic 43. oue ntebl of bulk the on focused ) Phytomorphology – – Adiantum 751. 305. Adiantum 0 255 20: rbcL Jamesonia and loe sto us allowed , – 266. Tryonia hslvlof level This . trnL-F 4 51 14: Rheopteris 2 1792 32: and Equisetum ). new a , – Eriosorus 70. Interna- – 1797. + , Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 2SSEAI OAY[oue41 [Volume BOTANY SYSTEMATIC H. and Yesilyurt, C. J. Russell, J. S. Rohwer, G. J. L., W. Eiserhardt, 22 arr .R 94 emfru engametophytes fern Gemmiferous 1974. R. D. Farrar, rd,J,C .N orge,A aaio n .L .Sltn.2007. Salatino. F. L. M. and Salatino, A. Rodrigues, N. D. C. J., Prado, aee . .Ooi .Nkzw,T ao .Kt,adK Iwatsuki. K. and Kato, M. Sano, T. Nakazawa, M. Omori, T. M., Hasebe, arr .R 95 needn engmtpye ntewild. the in gametophytes fern Independent 1985. R. D. Farrar, re,K .19.Pyoeyo aslaeu en n eainhp of relationships and ferns marsileaceous of Phylogeny 1999. M. K. Pryer, aee . .G of .M re,K ea .Io .Sn,G J. G. Sano, R. Ito, M. Ueda, K. Pryer, M. K. Wolf, G. P. M., Hasebe, rmr .U 90 itraee p 272 Pp. Vittariaceae. 1990. U. of K. deceleration Kramer, Abrupt 2010. Pryer. M. K. and Schuettpelz, E. 2012. P., Pryer. Korall, M. K. and Windham, D. M. Rothfels, J. a C. as K., bootstrapping A. of test Johnson, empirical An 1993. Bull. J. J. and M. D. Hillis, re,K . .R mt,adJ .So.19.Pyoeei relationships Phylogenetic 1995. Skog. E. J. and Smith, R. A. M., K. Pryer, aso,A 04 lVe:afs n ihwih lgmn iwrand viewer alignment lightweight clock: and the fast 2012. a Watching AliView: 2010. 2014. Guindon. A. Bromham. Larsson, S. L. and and Welch, J. Ho, J. W. R., Lanfear, Y. S. Calcott, B. R., Lanfear, oqit . .Tsek,P a e ak .L ye,A aln,S. Darling, A. Ayres, L. D. Mark, Der Van phyloge- P. Teslenko, Bayesian M. 3: F., MrBayes Ronquist, 2003. Available Huelsenbeck. 1.5. P. version J. Tracer and F. 2009. Ronquist, Drummond. J. A. and A. Rambaut, u .M,J e,S uz .P ag n .Z i 02 Phylogenetic 2012. Li. D.-Z. and Wang, Y.-P. Lutz, S. Wen, 1977. J. Sermolli. J.-M., Pichi Lu, G. E. R. and Löve, D. Á., Löve, ohes .J,A aso,L-.Ko .Krl,W-.Ciu n .M. K. and Chiou, W.-L. Korall, P. Kuo, L.-Y. Larsson, molecular A. of J., C. rate Rothfels, Accelerated 2014. Schuettpelz. E. and J. C. Rothfels, aa,B .adS ar 91 aeohtso oopru ferns. homosporous of Gametophytes 1971. Kaur. S. and phylogenetic K. for B. Testing Nayar, 1996. Kellogg. A. E. and J. R. Mason-Gamer, ohes .J,F-.L,E .Sgl .Hit .Lrsn .O ug,M. Burge, O. D. Larsson, A. Huiet, L. Sigel, M. E. Li, F.-W. J., C. Rothfels, cnie.21.Eiec o aitoso hiatodfrsi the in ferns Region. cheilanthoid Floristic of Cape radiations Greater for Evidence 2011. Schneider. ora fBotany of Journal hlgntcrltosisaogPeiaee nldn Brazilian including from Pteridaceae, inferred species, among relationships Phylogenetic m fSine USA Sciences of ferns. emy leptosporangiate of lineages 1994. nso h oa oit fEibrhScinB Section Edinburgh of Society Royal the of ings ln Sciences Plant fossil the .H afe,adW .Hu.19.Fr hlgn ae on based phylogeny Fern 1995. Hauk. D. W. and rbcL Haufler, H. C. Gastony,J.Yokoyama,J.R.Manhart,N.Murakami,E.H.Crane, oeua vlto ikdt h rgno roecnei ferns. in arborescence of origin the to Evolution linked evolution molecular (Pteridaceae). gametophytes ferns the 1118 99: on notholaenid character sporophytic of a of expression Unique analysis. phylogenetic in Biology confidence assessing for method fetn en ae neiec rmmrhlg and morphology from evidence on based ferns sequences. extant of dtrfrlredt sets. data large for editor species. between Evolution evolution & molecular Ecology of in Trends rates in variation Studying and schemes analyses. Evolution partitioning phylogenetic for of models substitution selection Combined PartitionFinder: Springer-Verlag. York: New gymnosperms Green, S. and P. and pteridophytes plants: vascular rae .:EfcetBysa hlgntcifrneadmodel and space. inference model 2012. large phylogenetic Huelsenbeck. a P. Bayesian across J. choice Efficient and Suchard, 3.2: A. M. MrBayes Liu, L. Larget, B. Hohna, models. mixed under inference netic http://tree.bio.ed.ac.uk/software/tracer/. from ora fPatResearch Plant of Journal Chinese of relationships Pteridophyta the of orsleteacetrpdrdaino uoyo Iferns. II eupolypod of radiation internodes Biology rapid short atic ancient and rates, the fast resolve roots, to deep Overcoming selection. 2012. Pryer. by driven not and strong is Biology ferns Systematic vittarioid for evolution ofitaogmlclrdt esi h rb Triticeae Tribe the in sets Review Botanical data molecular (Gramineae). among conflict .Sn .Krl,D .Seesn .W rhm .K-.Wong, K.-S. G. from Graham, inferred ferns W. genes. of nuclear history S. evolutionary low-copy Stevenson, The 25 2015. W. Wei, Pryer. X. L. M. D. Shaw, K. Chen, Korall, W. and L. S. P. DeGironimo, Jr., Sun, L. Stewart dePamphilis, X. N. C. C. Chen, Soltis, T. E. Pokorny, D. Deyholos, M. Ruhsam, uloiesequences. nucleotide rbcL 2 182 42: – 1124. 4 2786 64: 9 1695 29: yrpei pinnata Hydropteris mrcnFr Journal Fern American 1 490 61: eesqecspoieeiec o h evolutionary the for evidence provide sequences gene ytmtcBiology Systematic 6:931 160: – 192. 7 295 37: 1 146 61: au:SrusadCramer. and Strauss Vaduz: . – – 3 31 63: – 2792. 1701. 509. 1 5730 91: – rbcL 954. – – – 2:237 125: 396. 155. 54. Bioinformatics Adiantum sequences. mrcnJunlo Botany of Journal American mrcnFr Journal Fern American – 5 495 25: 5734. Taxon reconsidered. 5 524 45: – 5 205 85: 249. ytmtcBiology Systematic rceig fteNtoa Acad- National the of Proceedings – – ae nfv lsi markers. plastid five on based 0 1269 60: Bioinformatics 7 in 277 503. Taxon – mrcnJunlo Botany of Journal American 0 3276 30: 545. – 282. h aiisadgnr of genera and families The 6 355 56: – — 6 361 86: nentoa ora of Journal International 1283. d.K .Kramer U. K. eds. , Vittariaceae. oeua ilg and Biology Molecular – yoaooia atlas Cytotaxonomical 3278. 5 134 85: 9 1572 19: – 1 539 61: – 368. 0:1089 102: 369. – 181. Systematic – – American 542. 1574. Proceed- System- – 1107. rbcL U422 hssuy U423 hssuy U421 hsstudy; This KU147281, study; study; This This KU147273, KU147305, study; This KU147252, 104 NA study; Huiet This -; KU147280, data), study; This (missing KU147272, study; This KU147251, 2641 Rothfels U423 hssuy F516 cutpl ta.20;KU147282, 2007; al. et Schuettpelz EF452136, study; This KU147253, 116 Huiet cutpl,E,H cnie,L ue,M .Wnhm n .M Pryer. M. K. and Windham, D. M. from Huiet, inferred L. Schneider, H. phylogeny E., Fern Schuettpelz, 2007. Pryer. M. K. and E. Schuettpelz, ots .S,D .Sli,V aoann .R rn,adT .Barraclough. G. T. and Crane, R. P. Savolainen, V. Soltis, E. D. S., P. Soltis, ohel .W n .A tce.19.Terl of role The 1994. Stockey. A. R. and W. G. Rothwell, oz-he,T . .Bta,S ao,L atr .Bsn n .Lejeune. B. and Besin, E. Carter, L. Nadot, S. Bittar, G. T., T. Souza-Chies, ohes .J,M .Wnhm .L rs,G .Gsoy n .M. K. and Gastony, J. G. Grusz, L. A. Windham, D. M. J., C. Rothfels, cnie,H,A .Sih .Cafl,T .Hlern,C .Haufler, H. C. Hildebrand, J. T. Cranfill, R. Smith, R. A. H., of Schneider, placement Phylogenetic 2008. Davis. C. C. and Lindsay, S. B., Ruhfel, ida,M . .Hit .Shetez .L rs,C .Rothfels, J. C. Grusz, L. A. Schuettpelz, E. Huiet, L. D., M. Windham, 1982. Tryon. F. A. Phylo- and 1996. M. Hillis. R. M. Tryon, D. and Waddell, J. P. Olsen, L. J. L., D. Swofford, 2002. L. D. Swofford, cutpl,E n .M re.20.Rcniigeteebac length branch extreme Reconciling 2006. Pryer. M. K. and E. Schuettpelz, C841 ohesadShetez21;K175,Ti study; NA This study; This KU147256, KU147288, 2014; 2014; -; data), Schuettpelz Schuettpelz (missing and Rothfels and KC984519, Rothfels KC984441, 24 Nagalingum is sequence the therefore, accession, to TAGTTGGAGCACCTTTCCCAATTGGTCCAGATGGG GenBank CGGCAACTACATTAATGCGTCGAAGGAAATGCCAGT for here: short provided too the is for which obtained were data sequence of ( dash A order). of Evaluation 1997. G. P. Wolf, pcmncletradn.(ebru coy) enDAdatabase pre- DNA for for data Fern published citation acronym), viously accession, (herbarium GenBank (fernlab.biology.duke.edu), no. number and voucher locality; collector collection Taxon, specimen analysis. phylogenetic molecular our in 2006. J. D. Zwickl, datmaethiopicum Adiantum Appendix vrl eainhp n h fiiiso rvosyusmldgen- unsampled previously of affinities era. the Assessing Pteridaceae: and family relationships fern overall the of phylogeny molecular A genes. 2007. plastid three and species 1037 leptosporangiate 400 rceig fteNtoa cdm fSine USA Sciences fossils. of living Academy molecular National for the evidence of and Proceedings data fossil and molecular Integration tracheophytes: of of lineages among heterogeneity Rate 2002. e.e p o.i eosrcigtecaitc fheterosporous of cladistics the reconstructing in nov. ferns. sp. et gen. xeric-adapted in convergence evolutionary ferns. of patterns Resolving 97 hlgntcaayi fIiaeewt asmn n dis- and parsimony gene with plastid lution the Iridaceae using methods of tance analysis Phylogenetic 1997. re.20.Twr monophyletic a Toward 2008. Pryer. tion the plants. of epiphytic aspects of polygrammoid Exploring diversification of Grammitidaceae): phylogeny and the (Polypodiaceae Unraveling ferns 2004. Ranker. A. T. and from dence Rheopteris iyseiscmlxsi hiatodferns. demys- cheilanthoid and and 128 in boundaries plastid 99: complexes Using generic 2009. species redraw Pryer. to tify M. K. sequences and DNA Yatskievych, nuclear G. Beck, B. J. America tropical Associates. to Sinauer erence Sunderland: Mable. K. B. and Moritz, C. 407 Hillis, Pp. inference. genetic methods) other ifrne:Dculn ieadrt hog h evolutionary the through rate ferns. and filmy of time history Decoupling differences: ei tde ffrsadohrpteridophytes. other and ferns Botany of studies netic flrebooia eunedt esudrtemxmmlklho crite- likelihood maximum the under sets data rion sequence biological large of h .dsetto.Asi:TeUiest fTexas. of University The Austin: dissertation. D. Ph. . oeua hlgntc n Evolution and Phylogenetics Molecular 1 1041 31: – 1050. 0:109 204: mrcnJunlo Botany of Journal American Taxon U) 50 U425 hssuy U420 hsstudy; This KU147250, study; This KU147245, 2500, (UC), U) 69 U424 hssuy A(isn aa,-; data), (missing NA study; This KU147244, 4609, (UC), – 4 1429 84: 132. DK) 59 U423 hssuy A(isn aa,-; data), (missing NA study; This KU147243, 5549, (DUKE), .Vuhr n eBn ceso ubr o aaused taxa for numbers accession GenBank and Vouchers 1. n h oyhl of polyphyly the and DK) 85 C846 ohesadShetez2014; Schuettpelz and Rothfels KC984436, 3895, (DUKE), – rbcL niae o plcbe seik()idctsol 1bp 71 only indicates (*) asterisk applicable; not indicates ) 7 712 57: – datmandicola Adiantum eso .Sneln:SnurAssociates. Sinauer Sunderland: 4. Version , datmcapillus-veneris Adiantum 1063. – eei loih prahsfrtepyoeei analysis phylogenetic the for approaches algorithm Genetic – 123. 1440. eunedata. sequence AP.Pyoeei nlssuigprioy(*and parsimony using analysis Phylogenetic PAUP*. – datmdavidii Adiantum 724. ytmtcBiology Systematic atpA e ok Springer-Verlag. York: New . . utai,NwSuhWales; South New Australia, L., – ; 1 in 514 atpB atpB en n lidpat,wt pca ref- special with plants, allied and Ferns ytmtcBotany Systematic 1 479 81: ; Monogramma uloiesqecsfrphyloge- for sequences nucleotide ib. ot ia a José; San Rica, Costa Liebm., chlN chlN oeua hlgntc n Evolu- and Phylogenetics Molecular oeua systematics Molecular rps4 ; rnh,fo cultivation; from Franch., – eeof gene rbcL 4 1172 44: 5 485 55: 492. . .S . California; A., S. U. L., . Notholaena ln ytmtc n Evo- and Systematics Plant ; rpoA mrcnFr Journal Fern American Peiaeesl) Evi- s.l.): (Pteridaceae – datmhispidulum Adiantum – 502. mrcnJunlof Journal American 1185. 3 37 33: yrpei pinnata Hydropteris 9 4430 99: ;and (Pteridaceae): – ,eds.D.M. rps4 43. – Taxon 4435. i that (in .S. N. .J. C. 56: L. L. , Delivered by Ingenta to: Duke University Libraries IP: 152.3.102.242 on: Fri, 03 Jun 2016 23:19:02 Copyright (c) American Society for Plant Taxonomists. All rights reserved. U427 hssuy C850 ohesadShetez2014; Schuettpelz 2014; and Schuettpelz Rothfels and study; KC984520, This Rothfels KU147309, study; study; This KC984442, KU147289, This 2014; KU147257, Schuettpelz This KU147275, -; and -; cultivation; study; data), data), from (missing (missing Br., NA This NA R. study; -; This data), KU147274, KU147284, (missing study; NA study; study; This Co.; study; This Nantou This Taiwan, KU147307, KU147254, L., study; -; This KU147283, data), (missing 06 RE TA. DATMI OOHLTC23 MONOPHYLETIC IS ADIANTUM AL.: ET PRYER cultivation; from study; Chuquisaca; This KU147306, study; This 2016] aa,- U427 hssuy U426 hssuy A(missing NA study; This KU147286, study; (missing NA This -; -; data), KU147277, data), study; (missing -; This NA study; data), KU147312, This KU147248, study; 8340, Rothfels (DUKE), This KC984522, -; KU147293, subcordatum data), Adiantum 2014; (missing NA 2007; Schuettpelz 1997; Wolf al. and U93840, et 2007; al. Schuettpelz et Schuettpelz study; EF452133, cultivation; EF452013, This from study; KU147311, Presl, 2007; This study; al. This KU147259, KU147292, et 2007; Schuettpelz al. This et EF452070, KU147308, (missing study; 2507, NA This (UC), 2007; KU147285, al. study; et This study; Schuettpelz study; KU147276, EF452012, -; This 2007; data), KU147310, al. Schuettpelz study; et EF452132, Schuettpelz This study; KU147291, This pedatum 2007; KU147258, al. 2007; et al. et This Schuettpelz 111 *, study; Huiet 2014; This L. KU147290, -; Schuettpelz 2014; data), (missing Schuettpelz and NA and Rothfels Rothfels KC984521, KC984443, study; 2014; Schuettpelz cutpl ta.20;K179,Ti td;K171,Ti study; This EF452142, KU147316, study; study; This This cultivation; KU147298, KU147264, ludens 2007; 2007; Calciphilopteris al. al. et et study; Schuettpelz This Schuettpelz KU147297, KU147263, EF452022, 2007; 2007; al. al. Arizona; study; et et This Schuettpelz Schuettpelz KU147315, EF452138, EF452018, 2014; study; 2007; Schuettpelz This al. -; et and 2007; data), Guinea; Schuettpelz New al. (missing Rothfels Papua et NA KC984523, Blume, study; Schuettpelz This EF452017, study; KU147296, 2007; This al. KU147262, et Schuettpelz This EF452075, KU147287, -; study; data), This (missing KU147278, study; NA This study; KU147255, -; 3116A data), Rothfels J. 2007; C. al. et cultivation from Schuettpelz Willd., al. ex study; EF452134, et Bonpl. This & Schuettpelz study; KU147313, Humb. EF452014, study; This 2007; This KU147294, al. KU147260, et 2007; Schuettpelz EF452072, 2504, op,EaglA ePique; de l'As Etang loupe, 2007; al. et This KU147295, Schuettpelz study; 2007; This al. EF452015, et KU147314, Schuettpelz study; 2007; EF452135, study; al. This KU147261, et Schuettpelz EF452073, datmperuvianum Adiantum .Shetez467 Schuettpelz E. datmtenerum Adiantum . rmcultivation; from L., .Shedrs.n. Schneider H. .R .Wo 14432 Wood I. R. J. U) 56 F508 cutpl ta.20;EF452011, 2007; al. et Schuettpelz EF452068, 2506, (UC), .Hit101 Huiet L. DK) 59 U429 hssuy A(missing NA study; This KU147249, 6549, (DUKE), datmmalesianum Adiantum .G of717 Wolf G. P. Wl.e ok)Yslut&H cni. from Schneid., H. & Yesilyurt Hook.) ex (Wall. .R mt s.n. Smith R. A. omrahispida Bommeria w,Bai,MnsGerais; Minas Brazil, Sw., .Shetez1016A Schuettpelz E. DK) 14 U675 ohese l 2008; al. et Rothfels EU268725, 3174, (DUKE), w,fo cultivation; from Sw., .J .Crsehs 4076 Christenhusz M. J. M. tricholepis Adiantum .Rne 1774 Ranker T. GE) 50 U671 ohese al. et Rothfels EU268741, 3510, (GOET), ntu citrifolium Anetium ltsh rmcultivation; from Klotzsch, U) 63 U426 hssuy NA study; This KU147246, 4673, (UC), .Hit117 Huiet L. U) 63 C848 ohesand Rothfels KC984438, 4603, (UC), datmdigitatum Adiantum UC,68 F501 Schuettpelz EF452071, 638, (UTC), U) 62 C847 Rothfels KC984437, 4602, (UC), Kh)Udr. .S A., S. U. Underw., (Kuhn) .Gaa,fo cultivation from Ghatak, J. .Hit105 Huiet L. ; datmhispidulum Adiantum DK) 79 KU147247, 4759, (DUKE), CL) 08 EF452076, 3078, (COLO), datmraddianum Adiantum datmflabellulatum Adiantum datmtetraphyllum Adiantum nrpymlatifolium Antrophyum U) 49 EF452069, 2499, (UC), datmformosum Adiantum é,Mxc,Jalisco; Mexico, Fée, L)Slt. Guade- Splitg., (L.) .Hit107 Huiet L. .Shetez1406 Schuettpelz E. .Pel Bolivia, Presl, C. TR,3339, (TUR), .Hit103 Huiet L. U) 2505, (UC), Adiantum (UC), Sw., C. ; cutpl ta.20;N msigdt) ;N msigdt) -; data), (missing EF452148, NA -; -; data), data), (missing (missing NA NA 2007; elongata 2007; Haplopteris al. al. et et Schuettpelz Schuettpelz EF452027, 3871 Christenhusz cutpl ta.20;N msigdt) ;K171,Ti study; This KU147318, -; data), (missing EF452150, -; NA data), crispa 2007; (missing Cryptogramma al. NA 2007; et al. Schuettpelz et Schuettpelz EF452031, 2008; ta.20;E423,Sheteze l 07 A(isn aa,-; NA data), -; (missing data), NA (missing NA 2007; 2014; al. -; Schuettpelz et data), (missing and Schuettpelz 2014; Rothfels EF452037, Schuettpelz KC984525, 2008; -; al. and 2007; data), et al. (missing Rothfels et cultivation; NA KC984524, from Schuettpelz study; This EF452036, study; KU147303, 2007; This al. KU147266, et Schuettpelz Sofaia; EF452097, Guadeloupe, Sm., J. ta.20;K176,Ti td;E425,Sheteze l 07 NA Schuettpelz 2007; study; al. EF452035, This et KU147319, Schuettpelz 2007; EF452153, -; al. study; data), This (missing et KU147265, 2007; Schuettpelz al. et EF452096, 2546, (UC), cutpl ta.20;N msigdt) ;N msigdt) -; data), (missing EF452146, NA -; -; data), data), (missing (missing NA NA 2007; graminea 2007; Monogramma al. al. et et Schuettpelz Schuettpelz s.n. EF452025, Schneider H. ta.20;K170,Ti td;N msigdt) -; data), (missing Schuettpelz NA study; EF452157, This study; KU147304, This covillei 2007; KU147268, al. 2007; et al. et Schuettpelz 2692 Janssen A(isn aa,- F516 cutpl ta.20;N (missing NA 2007; al. 2007; et study; Guinea; al. This Schuettpelz New et KU147322, EF452166, Schuettpelz -; -; EF452050, data), data), 2008; al. (missing et NA Rothfels EU268769, 2561, td;K170,Ti td;N msigdt) -. data), This (missing KU147279, NA study; study; This study; This KU147271, KU147302, This 2007; EF452156, study; al. KU147320, et study; Schuettpelz -; EF452064, data), 227 This (missing Schuettpelz KU147267, NA KC984439, graminifolia 2007; 2014; 2014; Vittaria al. Schuettpelz et Schuettpelz and Schuettpelz study; and Rothfels This EF452176, KC984435, Rothfels KU147323, study; 3375, study; This This (COLO), KU147301, KU147270, acrocarpa 2007; 2007; Vaginularia al. al. et et Schuettpelz Schuettpelz EF452063, -; data), (missing NA -; al. data), et Schuettpelz (missing EF452165, austroamericana -; NA data), (missing NA 2007; 2007; study; al. et This Schuettpelz al. KU147321, 445 et Schuettpelz study; Schuettpelz and Rothfels EF452162, This triangularis KC984440, study; KU147300, 2012; This al. 2007; KU147269, et 2014; data), Johnson Schuettpelz (missing JQ855925, -; NA data), 2957, -; (missing data), (DUKE), NA (missing 2012; NA al. 2008; -; et al. study; et Rothfels Rothfels JF832173, EU268794, 2008; This 2008; al. et Arizona; al. KU147317, Rothfels A., et S. Rothfels study; and U. EU268782, Rothfels Davenp., -; This KC984444, data), 2008; (missing KU147299, al. NA et 2014; Rothfels Schuettpelz EU268733, 3150, (DUKE), ele atropurpurea Pellaea Mxn .Lv .Lv,U .A,Arizona; A., S. U. Löve, D. & Löve Á. (Maxon) Kuf)Ytk,Wnhm&Wlew,U .A,Arizona; A., S. U. Wollenw., & Windham Yatsk., (Kaulf.) P,34,E420,Sheteze l 07 EF452040, 2007; al. et Schuettpelz EF452102, 3548, (P), .Cot1749 Croft J. DK) 12 U678 ohese l 08 EF452049, 2008; al. et Rothfels EU268768, 3152, (DUKE), DK) 35 F518 cutpl ta.2007; al. et Schuettpelz EF452128, 2395, (DUKE), oi,fo cultivation; from Domin, hiate nitidula Cheilanthes .Shetez297 Schuettpelz E. GE) 53 F505 cutpl ta.2007; al. et Schuettpelz EF452085, 3513, (GOET), DK) 99 U670 ohese l 2008; al. et Rothfels EU268740, 2949, (DUKE), S. .H rn,fo cultivation; from Crane, H. E. (Sw.) al. cao,Zmr-hnhp Province; Zamora-Chinchipe Ecuador, Kaulf., L)R r xHo. .K,Scotland; K., U. Hook., ex Br. R. (L.) otu,PpaNwGuinea New Papua Holttum, L)Ln,fo cultivation; from Link, (L.) Pi. ckh,Fac,Ied aReunion; la de Ile France, Schkuhr, (Poir.) A,37,E422,Sheteze l 2007; al. et Schuettpelz EF452126, 3373, (A), .Shetez480 Schuettpelz E. .J .Crsehs 3976 Christenhusz M. J. M. hotrscheesmaniae Rheopteris DK) 57 U673 Rothfels EU268743, 2557, (DUKE), ale ok,fo cultivation; from Hook., ex Wall eitpei pumila Hecistopteris .Shetez301 Schuettpelz E. DK) 17 EU268749, 3187, (DUKE), eintspalmata Hemionitis ohleagrayi Notholaena .Shetez312 Schuettpelz E. .Rne 1778 Ranker T. ; .Shetez443 Schuettpelz E. Pityrogramma ltn Papua Alston, Pentagramma TR,3278, (TUR), .Hit112 Huiet L. Myriopteris .J M. J. M. (Spreng.) (DUKE), L., E. E. T.